Nanopores, pharmaceutical compositions, and methods of use thereof

Abstract

A nanopore is provided, comprising a plurality of nucleic acid strands that self-assemble into a three-dimensional polyhedral stem structure defining an internal cavity. The nanopore can optionally include one or more internal oligonucleotide strands positioned at least partially within the internal cavity and hybridized to one or more of the plurality of nucleic acid strands of the nanopore. The nanopores can be internalized into a cell membrane and form a transmembrane channel therethrough, through which the nanopores can allow selective passage into the cell. Methods of use of the nanopore are also provided.

Description

70808-02NANOPORES, PHARMACEUTICAL COMPOSITIONS, AND METHODS OF USE THEREOFPRIORITY

[0001] This application is related to and claims the priority benefit of U.S. Provisional Patent Application No. 63 / 691,631, which was filed September 6, 2024. The contents of the aforementioned application are hereby expressly incorporated herein by reference into this disclosure.GOVERNMENT SUPPORT

[0002] This subject matter was developed with government support under Grant No. 23057066 awarded by the U.S. National Science Foundation. The government may have certain rights in this subject matter.TECHNICAL FIELD

[0003] The present invention relates to cell biology, nanostructures, and related fields. The present invention provides nanostructures and methods of construction and use thereof.BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0004] The sequences described herein are set forth in the Figures and also provided in computer- readable form submitted herewith and incorporated herein by reference (File name: “‘70808-02 PCT Sequence Listing f08SEP2025”; file size: 29.9 MB; date created: September 8, 2025). The information recorded in computer readable form is identical to the written Sequence Listing provided herein, pursuant to 37 C.F.R. § 1.821(f).BACKGROUND

[0005] Cell-cell interactions are fundamental to the organization and activity of multicellular systems. Stable interactions contribute to the structural integrity of tissues and support intercellular communication, while transient interactions, often mediated by multivalent ligandreceptor binding at the cell surface, are critical for dynamic processes such as signaling, trafficking, and material exchange. For example, cells can recognize and respond to molecules displayed on the surface of other cells, initiate signaling cascades that regulate cellular activity, or facilitate the internalization of bound particles and biomolecules through receptor-mediated uptake.70808-02

[0006] Advances in nanotechnology have led to the development of synthetic nanoscale structures designed to replicate, interface with, and augment natural cellular processes. Among these, deoxyribonucleic acid (DNA) nanotechnology' has emerged as a particularly versatile platform, enabling the programmable construction of nanoscale assemblies with precise spatial and functional control.

[0007] A prominent application of such technology is the engineering of nanopores. Nanopores are nanoscale openings or channels within a membrane (e.g., a cell membrane) that permit the controlled passage of ions, nucleic acids, proteins, or other biomolecules. Current state of the art encompasses both biological nanopores, such as protein pores reconstituted into lipid bilayers (commonly employed for single molecule sensing and sequencing), and synthetic nanopores, including solid-state pores fabricated from inorganic materials and nanopores assembled from DNA nanostructures. These systems have demonstrated utility in high-resolution biosensing, molecular analysis, and controlled transport across membranes.

[0008] However, existing nanopore technologies exhibit significant limitations. Biological nanopores, while highly selective, often lack long-term stability and can be difficult to integrate into scalable or device-compatible platforms. Solid-state nanopores offer mechanical robustness but are limited by fabrication constraints at sub-nanometer precision and by insufficient molecular specificity. DNA-based nanopores, while highly programmable and adaptable, remain challenged by issues of biostability, nuclease susceptibility, and reliable incorporation into lipid bilayers or cellular membranes. Langecker et al., Synthetic Lipid Membrane Channels Formed by Designed DNA Nanostructures, Science 338(6109): 932-936 (2012); Seeman & Sleiman, DNA nanotechnology, Nature Reviews & Materials 3: 17068 (2017); Xing et al., Highly shape- and size-tunable membrane nanopores made with DNA, Nature Nanotechnology 17: 708-712 (2022); Zhan et al., Recent Advances in DNA Origami -engineered nanomaterials and applications. Chemical Reviews 123: 496-4050 (2023); Kosara et al., Structural DNA nanotechnology' at the nexus of next-generation bio-applications: challenges and perspectives, Nanoscale Advances 4(6): 386 (2024). Moreover, achieving consistent transport selectivity, tunable gating, and functional lifetimes comparable to natural ion channels continues to present unresolved difficulties in the field.

[0009] Accordingly, there remains a need for improved nanopores that combine the structural precision and programmability’ of nucleic acid nanotechnology with enhanced stability, biocompatibility, and functional control suitable for practical use in biosensing, molecular delivery, and related applications.70808-02SUMMARY

[0010] The present disclosure provides deoxyribonucleic acid (DNA)-based nanostructures comprising tunable configurations capable of interacting with prokary otic and eukaryotic cell membranes. These nanostructures - or nanopores - can function as synthetic channels, facilitating the transfer of biomolecules of varying dimensions across cellular membranes, which allows for the circumvention of natural cellular processes and thus enables a range of diagnostic and therapeutic applications.

[0011] In certain embodiments, a nanopore is provided that comprises a plurality of nucleic acid strands that self-assemble into a three-dimensional polyhedral structure defining an internal cavity. The nucleic acid strands can be single stranded. The three-dimensional polyhedral structure can be selected from the group consisting of a tetrahedron, cube, octahedron, dodecahedron, and icosahedron, for example. The nanopore can comprise one or more internal oligonucleotide strand positioned at least partially within the internal cavity. The one or more internal oligonucleotide strand can be fully or partially hybridized to one or more of the plurality of nucleic acid strands of the nanopore.

[0012] The internal cavity7can have a diameter of between about 0.5 nm and about 200 nm. In certain embodiments, the nucleic acid strands comprise between about 20 nucleotides (nts) (such as 20 nucleotides) to about 100 nts (such as 100 nts).

[0013] In certain embodiments, the one or more of the nucleic acid strands is linked to a cholesterol moiety.

[0014] The plurality of nucleic acid strands can comprise, for example, a first oligonucleotide, a second oligonucleotide, a third oligonucleotide, and a fourth oligonucleotide. Each of the first oligonucleotide and third oligonucleotide can be partially hybridized to the second and fourth oligonucleotide such that the oligonucleotides form a four-sided structure defining the internal cavity7. In certain embodiments, at least one of the plurality of nucleotide strands further comprises a cholesterol motif.

[0015] One or more of the plurality7of nucleic acid strands can have at least 68% sequence identity7to SEQ ID NO: 1, at least 68% sequence identity to SEQ ID NO: 2, at least 68% sequence identity to SEQ ID NO: 4, and / or at least 68% sequence identity to SEQ ID NO: 5. In certain embodiments, the one or more internal oligonucleotide strand has at least 68% sequence identity to SEQ ID NO: 6. The one or more internal oligonucleotide strand can promote formation of a secondary structure which is, optionally, one or more loops or hairpin motifs. In certain embodiments, the one or more internal oligonucleotide strand comprises five hairpin motifs, with the three most-central hairpin motifs available for functionalization.70808-02

[0016] In certain embodiments, the first oligonucleotide further comprises a nucleic acid sequence that has at least 68% sequence identity to SEQ ID NO: 7, the second oligonucleotide further comprises a nucleic acid sequence that has at least 68% sequence identity to SEQ ID NO: 8, the third oligonucleotide further comprises a nucleic acid sequence that has at least 68% sequence identity to SEQ ID NO: 9, and / or the fourth oligonucleotide further comprises a nucleic acid sequence that has at least 68% sequence identity7to SEQ ID NO: 10.

[0017] At least one of the plurality of nucleotide strands can be, in certain embodiments, functionalized with one or more ligands. In certain embodiments, the nanopore comprises one or more internal oligonucleotide strand that is functionalized with one or more ligands. The one or more ligands can each independently be selected from the group consisting of a targeting ligand, a fluorescent marker, and a therapeutic agent.

[0018] The nanopores hereof can be configured for spontaneous interaction with a prokary otic or eukaryotic cell membrane.

[0019] Pharmaceutical compositions are also provided. In certain embodiments, the pharmaceutical composition comprises any nanostructure hereof and a pharmaceutically acceptable carrier.

[0020] Methods for creating a transmembrane channel through a target membrane are provided. In certain embodiments, such a method comprises contacting the target membrane with any nanopore hereof or any pharmaceutical composition hereof. The target membrane can be a cell membrane and / or a lipid membrane. The cell membrane can be a prokary otic cell membrane or a eukaryotic cell membrane.

[0021] In certain embodiments of the methods, the nanopore facilitates uptake of a nucleic acid, a protein, peptide, and / or a small-molecule therapeutic across the target membrane. In certain embodiments, the nanopore forms a synthetic pore in the target membrane selective for one or more classes of molecules. The one or more classes of molecules can be selected from the group consisting of ions, proteins, nucleases, molecules, chemical compounds, oligonucleotides, enzymes and signal molecules.

[0022] In certain embodiments, the one or more surfaces of the transmembrane channel and / or the one or more internal oligonucleotide strand of the nanopore is / are functionalized.

[0023] Methods of constructing any of the nanopore structures or the pharmaceutical compositions described herein are also provided. In certain embodiments, the method comprises combining, under suitable conditions, an equal proportion of a first oligonucleotide, a second oligonucleotide, a third oligonucleotide, and a fourth oligonucleotide, wherein the first oligonucleotide, second oligonucleotide, third oligonucleotide, and fourth oligonucleotide selfassemble to define an internal cavity therebetween in communication with tw o open ends.70808-02

[0024] Combining under suitable conditions can further comprise combining an equal portion of one or more internal oligonucleotides, wherein the one or more internal oligonucleotides selfassemble, are positioned, at least partially, within the internal cavity' of the nanopore, and at least partially hybridize to one or more of the first, second, third, or fourth oligonucleotides. In certain embodiments, the oligonucleotide partially hybridizes to the second and fourth oligonucleotides, and the third oligonucleotide partially hybridizes to the second and fourth oligonucleotides such that the four oligonucleotides form a four-sided, open nanopore structure.

[0025] The methods hereof can further comprise functionalizing one or more of the first, second, third, fourth oligonucleotides, or the one or more internal oligonucleotide strands to facilitate selective transfer of nucleic acid, a protein, peptide, and / or small molecule through the two open ends and internal cavity of the nanopore.

[0026] Methods for transporting molecules into a cell are also provided, such methods comprising: contacting a target cell with any of the nanopores or the pharmaceutical compositions hereof, wherein the nanopore inserts into a cell membrane and creates a transmembrane channel between an extracellular environment and an intracellular environment; and administering one or more molecules to the extracellular environment; wherein the one or more molecules are transported into the intercellular environment by selective passage through the cell membrane mediated by the nanopore. The nanopore can comprise one or more internal oligonucleotide strands functionalized to modulate transport through the internal cavity formed by the nanopore.

[0027] Methods for modulating stem cell function are also provided. In certain embodiments, a method for modulating stem cell function comprises contacting a population of stem cells with any nanopore or the pharmaceutical composition hereof, wherein the DNA nanopore stimulates proliferation and / or differentiation of the stem cells. Contacting the nanopore can, for example, modify the sensitivity of the stem cells to one or more external stimuli. In certain embodiments, the stem cells comprise embry onic stem cells, induced pluripotent stem cells, or adult stem cells. In certain embodiments, the nanopore can further comprise one or more functional groups, ligands, or biomolecules that facilitate interaction with a stem cell receptor or signaling pathway.BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate various embodiments and. together with the description, serve to explain the principles of the disclosed subject matter. Drawings are provided for purposes of illustration and are not intended to limit the scope of the claims in any manner.

[0029] FIG. 1 illustrates a schematic representation of a synthetic nucleic acid nanopore embedded within a lipid bilayer cellular membrane. The nanopore is depicted as being integrated70808-02 into the membrane, potentially allowing for selective permeability and molecular transport and / or regulated translocation of molecules from an extracellular (ec) space to an intracellular (ic) space.

[0030] FIGS. 2A and 2B provide a detailed schematic diagram of the structural design of the nanopore structures. These figures include components such as a Cy3 label, cholesterol moieties, and, in FIG. 2B. an inner strand. In FIG. 2A, the components are arranged and depicted with specific orientations: LI is positioned at the right front face, L2 at the right back face, L3 at the left back face, and L4 at the left front face, thus forming a cube-stem shape (e.g., a nanocube). The pore is illustrated as extending vertically through the nanocube, with the locations of components L2-Choll (L2Choll), L2-Chol2 (L2Chol2), L4-Choll (L4Choll), and L4-Chol2 (L4Chol2) clearly indicated. FIG. 2B presents the nanocube structure with component L5 identified as an inner DNA strand, which is situated at least partially within the confines of the nanocube structure.

[0031] FIGS. 2C-2F illustrate sequence mapping for various configurations of the faces of the nanocubes described herein, detailing strand orientation and comer elements, if present. In particular, FIG. 2C depicts an arrangement of nucleic acids configured to form nanocube component LI (SEQ ID NO: 1). FIG. 2D illustrates an arrangement of nucleic acids configured to form nanocube component L2 (SEQ ID NO: 2). FIG. 2E presents an arrangement of nucleic acids configured to form nanocube component L3 (SEQ ID NO: 4). FIG. 2F displays an arrangement of nucleic acids configured to form nanocube component L4 (SEQ ID NO: 5).

[0032] FIGS. 2G-2K illustrate the sequence mapping of nucleic acid arrangements that form various components of the nanotubes described herein. FIG. 2G depicts an arrangement of nucleic acids configured to form the L5 strand orientation of a nanotube component (SEQ ID NO: 6). FIG. 2H illustrates an arrangement of nucleic acids configured to form the L2-Chol l strand orientation of a nanotube component (SEQ ID NO: 7). FIG. 21 shows an arrangement of nucleic acids configured to form the L2-Chol2 strand orientation of a nanotube component (SEQ ID NO: 8). FIG. 2J presents an arrangement of nucleic acids configured to form the L4-Choll strand orientation of a nanotube component (SEQ ID NO: 9). FIG. 2K depicts an arrangement of nucleic acids configured to form the L4-Chol2 strand orientation of a nanotube component (SEQ ID NO: 10).

[0033] FIGS. 3A-3F illustrate atomic force microscope images of five distinct nanopores. FIG. 3A provides an overview image of the five nanopores. FIG. 3B shows a close-up image of nanocube 1 from FIG. 3A, accompanied by a graph depicting the height versus length analysis of the image. FIG. 3C presents a close-up image of nanocube 2 from FIG. 3A, along with a graph of the height versus length analysis of the image. FIG. 3D displays a close-up image of nanocube 3 from FIG. 3A, with an accompanying graph of the height versus length analysis of the image.70808-02FIG. 3E illustrates a close-up image of nanocube 4 from FIG. 3A, together with a graph of the height versus length analysis of the image. FIG. 3F shows a close-up image of nanocube 5 from FIG. 3A, accompanied by a graph of the height versus length analysis of the image.

[0034] FIGS. 4A-4E illustrate data obtained from dynamic light scattering analysis studies of DNA nanopores with an inner strand, incorporating various cholesterol motifs. Specifically, FIG. 4A presents the analysis of a monomeric DNA nanocube constructed from components LI, L2, L3, L4, and L5. FIG. 4B depicts the analysis of a monomeric DNA nanocube formed from components LI, L2, L3, L4, and L5, with the addition of L2Choll. FIG. 4C illustrates the analysis of a monomeric DNA nanocube formed from components LI, L2, L3, L4, and L5, with the inclusion of both L2Choll and L2Chol2. FIG. 4D shows the analysis of a monomeric DNA nanocube formed from components LI, L2, L3, and L4, with the addition of LICholl, LlChol2, and L4Choll. FIG. 4E demonstrates the analysis of an aggregation formed by nanocube components L 1 , L2, L3 , and L4, with the inclusion of L 1 Choi 1 , L 1 Chol2, L4Chol 1 , and L4Chol2.

[0035] FIGS. 5A-5C depict images of DNA nanopores labeled with Cy3 and cholesterol, demonstrating interactions with various cell types. FIG. 5A is a photograph illustrating the interaction of the DNA nanopores with prokary otic cells, specifically human commensal Lactobacillus crispatus, gram-positive. FIG. 5B is a photograph showing the interaction with eukaryotic cells, specifically the U87MG brain cancer cell line. FIG. 5C is a photograph and magnified insert, showing the spontaneous interaction of the DNA nanopore hereof with eukaryotic 293TN producer cell lines. Each figure provides visual evidence of the binding and interaction characteristics of the DNA nanopores with the respective cell types.

[0036] FIGS. 6A-6N illustrate data derived from a flow cytometry analysis concerning the transport of biomolecules into U87 brain cancer cells, utilizing vanous DNA nanostructures. Specifically, FIGS. 6A, 6E, and 61 depict the transport without the use of any DNA nanostructure. FIGS. 6B, 6F, and 6J demonstrate the transport facilitated by a DNA nanopore with a pore size of 0.8 nm. FIGS. 6C, 6G, and 6K illustrate the transport using a DNA nanopore with a pore size of 7 nm. FIGS. 6D, 6H, and 6L show the transport involving a DNA nanopore incorporating a central strand.

[0037] FIGS. 6A-6D present Cy5 transport, accompanied by representative confocal images of a DNA nanopore structure. FIGS. 6E-6H display GFP transport, with corresponding representative confocal images of the DNA nanopore structure. FIGS. 6I-6L illustrate FAP-FITC transport, also with representative confocal images of the DNA nanopore structure. Finally, FIGS. 6M and 6N provide plots of the transport yield for the three distinct DNA nanostructures, categorized according to molecular size.70808-02

[0038] FIGS. 7 A and 7B illustrate an embodiment of the inner strand of a nanopore, comprising five hairpin motifs. The three centrally located hairpin motifs are configured to accommodate aptamer sequences, which can enhance selectivity.

[0039] FIGS. 8A-8E depict fluorescent images on the left and corresponding graphical data on the right, illustrating the membrane localization of Cy3-labeled DNA nanostructures on U87MG brain cancer cells. The scale bar in each image represents a length of 10 micrometers. FIG. 8A presents data obtained in the absence of any DNA nanopore, serving as a control. FIG. 8B illustrates data from a DNA nanocube that incorporates cholesterol-Cy3, yet lacks an inner strand, highlighting the effect of cholesterol-Cy3 on membrane localization. FIG. 8C displays data from a DNA nanocube containing both cholesterol-Cy3 and an inner strand, demonstrating the combined influence of these components on membrane interaction. FIG. 8D shows data from a DNA nanocube that includes L5 but excludes both cholesterol-Cy3 and an inner strand, providing insight into the role of L5 in membrane localization. FIG. 8E presents data from a DNA nanocube comprising L5, cholesterol-Cy3, and an inner strand, illustrating the cumulative effect of these elements on the membrane localization of the nanostructure.

[0040] FIGS. 9A and 9B illustrate quantitative analysis data regarding the interfacing ability of DNA nanostructure membranes in U87MG brain cancer cells, with a focus on cholesterol tagging. The analysis includes a comparison of interfacing ability in the absence and presence of cholesterol. Statistical analysis was conducted utilizing a two-tailed t-test to evaluate the differences between the two conditions, with a significance level indicated by (*p < 0.05).

[0041] FIG. 10 illustrates normalized fluorescence intensity plots that pertain to the internalization dynamics of DNA nanostructures within U87MG brain cancer cells. Each graph presents data points corresponding to a DNA nanocube with cholesterol, represented by circles, and a DNA nanocube combined with L5 and cholesterol, represented by squares. The scale bars in FIG. 10 measure 20 micrometers, providing a reference for spatial dimensions w ithin the depicted cellular environment.

[0042] FIGS. 11A-11D depict data from a cell viability analysis conducted on U87MG brain cancer cells maintained at a temperature of 4 °C. FIG. 11A shows data from a control group, showing changes in cell vi abi 1 i ty over incubation time without exposure to DNA nanostructures (control). FIGS. 11B-11D show cell viability response after treatment with three different DNA nanostructures over 40 minutes at 4 °C, with FIG. 1 IB treated with a four-helix DNA nanostructure, FIG. 11 C treated with a DNA nanocube hereof, and FIG. 1 ID treated with a DNA nanocube hereof with an inner strand. The error bars indicate standard deviation (SD). The statistical significance of the results is indicated as follows: a single asterisk (*) denotes a p-value less than 0.05, two asterisks (**) denote a p-value less than 0.01, three asterisks (***) denote a p-70808-02 value less than 0.001, and four asterisks (****) denote a p-value less than 0.0001. The notation "ns" indicates results that are not statistically significant. The statistical analysis was performed using a one-way analysis of variance (ANOVA), with multiple comparisons corrected using Dunnett's method.

[0043] FIGS. 12A-12F depict data from a cell viability analysis conducted on U87MG brain cancer cells, examining the effects of varying incubation times, evaluated at two different concentrations. FIG. 12A illustrates results from cells treated with 50 nm of a four-helix DNA nanostructure (control). FIGS. 12B and 12E each present data from cells (10,000 cells per well) were treated with aDNA nanocube structure as described herein. FIGS. 12C and 12F each present data from cells (10,000 cells per well) treated with a DNA nanocube structure as described herein, further comprising an inner DNA strand. In FIGS. 12A, 12B and 12C, the cells were treated with 50 nm of DNA nanostructures, and in FIGS. 12D, 12E, and 12F, the cells were treated with 100 nm of DNA nanostructures. All incubations were carried out at 4 °C (n = 3). Error bars are included to represent the SD. The statistical significance of the results is indicated as follows: a single asterisk (*) denotes a p-value less than 0.05, two asterisks (**) denote a p-value less than 0.01, three asterisks (***) denote a p-value less than 0.001, and four asterisks (****) denote a p- value less than 0.0001. The notation "ns" indicates results that are not statistically significant. The statistical analysis was performed using ANOVA. with multiple comparisons corrected using Dunnett's method.

[0044] FIGS. 13A-13C depict data from a cell viability' analysis conducted on U87MG brain cancer cells, examining the effects of varying incubation times and employing three distinct DNA nanostructures. FIG. 13 A illustrates a four-helix DNA nanostructure (control). FIG. 13B presents a DNA nanocube structure as described herein. FIG. 13C displays a DNA nanocube structure as described herein, further comprising an inner DNA strand. Error bars are included to represent the SD. The statistical significance of the results is indicated as follows: a single asterisk (*) denotes a p-value less than 0.05, two asterisks (**) denote a p-value less than 0.01, three asterisks (***) denote a p-value less than 0.001. and four asterisks (****) denote a p-value less than 0.0001. The notation "ns" indicates results that are not statistically significant. The statistical analysis was performed using ANOVA, with multiple comparisons corrected using Dunnet's method.

[0045] FIGS. 14A-14C illustrate data pertaining to the transport efficiency of molecular and protein components facilitated by DNA nanostructures within U87MG brain cancer cells, as evaluated through flow- cytometry (no DNA = control: four-helix DNA nanostructure = control 2; DNA nanocube structure described herein; DNA nanocube structure with internal strand). The fluorescence intensity of Cy5, at a concentration of 5 ng, was measured after a 5-minute interval, as depicted in FIG. 14A. The fluorescence intensity of green fluorescent protein (GFP), at a70808-02 concentration of 1 pg, was assessed after a 20-minute interval, as shown in FIG. 14B. Similarly, the fluorescence intensity of FAP-FITC w as measured after a 20-minute interval, as illustrated in FIG. 14C.

[0046] FIGS. 15A-15D illustrate confocal microscopy images obtained from a small molecule transport analysis involving Cy5-labeled DNA nanostructures within U87MG brain cancer cells (fluorescence marked F in the images). FIG. 15A presents merged fluorescence images in the absence of DNA nanostructures. FIG. 15B displays merged fluorescence images with the four- helix DNA nanostructures. FIG. 15C shows merged fluorescence images with the DNA Cube nanostructures. FIG. 15D illustrates merged fluorescence images with the DNA Cube nanostructures that include an inner DNA strand. The scale bar represents 200 pm.

[0047] FIGS. 16A-16B depict confocal microscopy images obtained from an analysis of smallsized particle transport using GFP fluorescence in U87MG brain cancer cells. FIG. 16A shows merged fluorescence images in the absence of DNA nanostructures, FIG. 16B shows merged fluorescence images in the presence of four-helix DNA nanostructures, FIG. 16C shows merged fluorescence images in the presence of DNA cube nanostructures, and FIG. 16D shows merged fluorescence images in the presence of DNA cube nanostructures with an inner DNA strand. The scale bar represents a length of 200 gm.

[0048] FIGS. 17A-17D illustrate confocal microscopy images obtained from an analysis of largesized particle transport utilizing FAP-FITC (10 pg) in U87MG brain cancer cells (fluorescence marked F in the images). FIG. 17A presents merged fluorescence images in the absence of DNA nanostructures, serving as a control. FIG. 17B displays merged fluorescence images with the presence of four-helix DNA nanostructures. FIG. 17C shows merged fluorescence images with DNA cube nanostructures. FIG. 17D illustrates merged fluorescence images with DNA cube nanostructures that include an inner DNA strand. In the images, yellow- indicates the Cy3 fluorescence intensity of the DNA nanostructures, while green denotes the FAP-FITC fluorescence intensity. The scale bar in each image represents 200 pm.

[0049] FIGS. 18A-18C depict confocal microscopy images of H9 human embryonic stem cells (hESCs), with a total cell count of 100,000, subjected to 50 nM concentrations of two distinct DNA nanostructures in conjunction with bone morphogenetic protein 4 (BMP-4). FIG. 18A illustrates the control group, which was not exposed to any DNA nanostructures, serving as a baseline for comparison. FIG. 18B shows cells treated with the DNA cube nanostructure, highlighting the interaction and potential influence of this structure on the cells. FIG. 18C presents cells treated with the DNA Cube nanostructure that incorporates an additional inner DNA strand, providing insight into the effects of this modified structure on cellular differentiation. The scale70808-02 bar represents 100 pm, with a magnified image scale of 20 pm, to facilitate detailed observation of cellular and structural interactions.

[0050] FIGS. 19A-19C illustrate flow cytometry analysis of stem cell differentiation yield in response to incubation conditions and the presence of 50 nM DNA nanostructures, specifically a DNA Cube and a DNA Cube with an inner DNA strand. FIG. 19A depicts a scenario where DNA nanostructures were incubated with BMP-4 at a temperature of 37 °C to promote cell differentiation. FIG. 19B illustrates the condition where DNA nanostructures were incubated with BMP-4 at 4 °C for a duration of 40 minutes, followed by cell differentiation without the removal of excess BMP-4 and DNA nanostructures. FIG. 19C shows the condition where DNA nanostructures were incubated with BMP-4 at 4 °C for 40 minutes, after which the BMP-4 and DNA nanostructures were washed out prior to cell differentiation. In all cases, H9 hESCs, numbering 100,000 cells, were incubated for a period of 48 hours. Differentiation was assessed using the Brachyury marker, which was detected in the FITC channel.DETAILED DESCRIPTION

[0051] The present disclosure provides deoxyribonucleic acid (DNA)-based nanostructures comprising tunable configurations capable of interacting with prokaryotic and eukaryotic cell membranes. These nanostructures can function as synthetic channels, facilitating the transfer of biomolecules of varying dimensions across cellular membranes, which allows for the circumvention of natural cellular processes and thus enables a range of diagnostic and therapeutic applications.

[0052] The nanostructure described herein enables adaptable design configurations. The term "nanopore" refers to a hollow or substantially hollow nanostructure comprising a stem that defines an internal cavity. The stem can integrate with and span a lipid membrane, facilitating its incorporation into biological systems.

[0053] The internal cavity is a hollow space that communicates with two open and opposing ends of the stem of the nanopore. When positioned within or integrated with a cell membrane, the nanopore can function as a pore through the cell membrane. This configuration permits a molecule located outside the cell to traverse the first open end of the nanopore, enter its internal cavity, and subsequently exit through the second open end into the cell. When applied, for instance, as part of a cellular wall, the nanopores hereof can facilitate the controlled translocation of molecular cargo across a cellular boundary.

[0054] The stem comprises a plurality of nucleic acid strands that are single-stranded (ssDNA) and can self-assemble into a three-dimensional (3D) polyhedral structure with two open ends. The 3D polyhedral structure can be a tetrahedron, for example. The three-dimensional polyhedral70808-02 structure can be a cube. In certain embodiments, the three-dimensional polyhedral structure is selected from the group consisting of a tetrahedron, cube, octahedron, dodecahedron, torus, and icosahedron.

[0055] In certain embodiments, the nanopore includes three or more nucleic acid strands arranged in a substantially parallel orientation, forming the structural pillars of the nanopore. For instance, the nanopore can comprise a first nucleic acid strand, a second nucleic acid strand, and a third nucleic acid strand, each positioned to collectively define the internal cavity. In certain embodiments, the nanopore incorporates a fourth nucleic acid strand, further contributing to the definition of the internal cavity. The number of nucleic acid strands utilized to define the internal cavity can vary, providing structural flexibility, programmability, and the potential for diverse customization.

[0056] Each of the plurality of nucleic acid strands of the nanopore can comprise an oligonucleotide. As used herein, the term "oligonucleotide" means a short sequence of nucleotides, typically composed of about 2 to about 100 nucleotide units (nts), that can be synthesized to have a specific sequence for use in various molecular biology applications, such as hybridization. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 5 nts to about 97 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 8 nts to about 94 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 11 nts to about 91 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 14 nts to about 88 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 17 nts to about 85 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore compnses at or between about 20 nts to about 82 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 23 nts to about 79 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 26 nts to about 76 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 29 nts to about 73 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 32 nts to about 70 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 35 nts to about 67 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 38 nts to about 64 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 41 nts to about 61 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 44 nts to about 58 nts. In certain embodiments, one70808-02 or more of the nucleic acid strands of the nanopore comprises at or between about 47 nts to about 55 nts. In certain embodiments, one or more of the nucleic acid strands of the nanopore comprises at or between about 50 nts to about 52 nts. In certain embodiments, the oligonucleotide of the internal strand comprises at or about 98 nts or at or about 100 nts. The ranges described in this paragraph are inclusive of their stated end points and all 1 nt increments encompassed thereby.

[0057] In certain embodiments, plurality of nucleic acid strands comprises a first oligonucleotide, a second oligonucleotide, a third oligonucleotide, and a fourth oligonucleotide. Each of the first oligonucleotide and third oligonucleotide can be, for example, partially hybridized to the second and fourth oligonucleotide such that the oligonucleotides form a four-sided structure defining the internal cavity.

[0058] As shown in Figure 2A, a nanopore structure can be formed by combining the components LI, L2, L3 and L4 (see also Table 1).

[0059] Table 1. Oligonucleotide sequences of DNA nanopores.Strand Sequence (5' — 3') SEQ ID NO:LI TCTCACTGACTTTTTCCTATATCCGCACCTGCTCTTTTCA 1CAATACTGTCTCACTGACTTTTTCCTATATCCGCACCTGC TCTTTTCACAATACTGL2 CTATGCGTTCTTTTGCACGAAGTTCCATCCACTCTTTTATGT 2GTCCGACAGTATTGTGTTTTAAGCCAGTAGGTCTAGTAGGTT TTCAACAAGCGGCv3-L2 / 5Cv3 / CTATGCGTTCTTTTGCACGAAGTTCCATCCACTCTTTT 3ATGTGTCCGACAGTATTGTGTTTTAAGCCAGTAGGTCTAGTA GGTTTTCAACAAGCGGL3 CCCTGGACTCTTTTATCCTCGTACACACTCCGTCTTTTGAAC 4GCATAGCCGCTTGTTGTTTTCGGTCTCGGTTAGTTAGGTCTT TTTGAATGCTGAL4 GTGATCTAGCTTTTCTGTAGGTTAATTCGAGCGATTTTGAGT 5CCAGGGTCAGCATTCATTTTGATGTCAGATTCTAGTCGAGTT TTGTCAGTGAGAL5 GAACCACTTAGAGGCGTGATGTTACCTTTCGATTTTGACGG 6AGTGTGTAC GAGGATL2-Choll GAGTGGATGGAACTTCGTGC / 3CholTEG / 7L2-Chol2 CCTACTAGACCTACTGGCTT / 3CholTEG / 8L4-Choll TCGCTCGAATTAACCTACAG / 3CholTEG / 9L4-Chol2 CTCGACTAGAATCTGACATC / 3CholTEG / 10

[0060] In certain embodiments, the nanopore comprises four pillar nucleic acid strands, with the first nucleic acid strand (e.g., LI) having at least 68%, at least 70%, at least 75%, at least 78%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 1, the second nucleic acid strand (e.g., L2) having at least 68%, at least 70%, at least 75%, at least 78%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 2, the third nucleic acid70808-02 strand (e.g., L3) having at least 68%, at least 70%, at least 75%, at least 78%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 4, and the fourth nucleic acid strand (e.g., L4) having at least 68%, at least 70%, at least 75%, at least 78%, at least 80%. at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 5. There, the second nucleic acid strand (e.g., L2) can further comprise SEQ ID NO: 7 and SEQ ID NO: 8 (or a nucleic acid sequence having at least 68%, at least 70%, at least 75%, at least 78%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 7 and a nucleic acid sequence having at least 68%, at least 70%, at least 75%, at least 78%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 8) and / or the fourth nucleic acid strand (e.g., L4) can further comprise SEQ ID NO: 9 and SEQ ID NO: 10 (or a nucleic acid sequence having at least 68%, at least 70%, at least 75%, at least 78%. at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 9 and a nucleic acid sequence having at least 68%, at least 70%, at least 75%, at least 78%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 10).

[0061] As used herein, "sequence identity" or "percent (%) sequence identity” with respect to a reference to a sequence is defined as the percentage of nucleic acid residues, respectively, in a candidate sequence that are identical with the residues in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill of the art, for instance, using publicly available computer softw are. For example, determination of percent identity or similarity between sequences can be done, for example, by using the GAP program (Genetics Computer Group, software; now available via Accelrys online), and alignments can be done using, for example, the ClustalW algorithm (VNTI software, InforMax Inc., Gaithersburg, MD). Further, a sequence database can be searched using the nucleic acid or amino acid sequence of interest. Algorithms for database searching are typically based on the BLAST software (Altschul et al., 1990), but those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. In some embodiments, the percent identity7can be determined along the full-length of the nucleic acid sequence.

[0062] The dimensions of the DNA nanopore are at the nanoscale, typically measured in nanometer dimensions concerning length, width, and / or height. The nucleic acid pillars of the70808-02 nanopore can self-assemble to form thermodynamically stable, 3D nanostructures using Watson- Crick base-pairing interactions between the ssDNA oligomers. As used herein, the term "selfassemble" refers to an oligonucleotide or other component capable of organizing into a regular arrangement concurrently with expression, without the assistance of a specific inducer.

[0063] The internal cavity of the nanopore can have a diameter between about 0.5 nm and about 200 nm. In certain embodiments, the internal cavity has a diameter of between about 1.0 nm and about 100 nm. In certain embodiments, the internal cavity has a diameter of between about 1.5 nm and about 99.5 nm. In certain embodiments, the internal cavity has a diameter of between about 2.0 nm and about 99 nm. In certain embodiments, the internal cavity has a diameter of between about 2.5 nm and about 98.5 nm. In certain embodiments, the internal cavity has a diameter of between about 3 nm and about 98 nm. In certain embodiments, the internal cavity has a diameter of between about 3.5 nm and about 97.5 nm. In certain embodiments, the internal cavity has a diameter of between about 4 nm and about 97 nm. In certain embodiments, the internal cavity has a diameter of between about 4.5 nm and about 96.5 nm. In certain embodiments, the internal cavity has a diameter of between about 5 nm and about 96 nm. In certain embodiments, the internal cavity has a diameter between about 5.5 nm and about 95.5 nm. In certain embodiments, the internal cavity has a diameter of between about 6 nm and about 95 nm. In certain embodiments, the internal cavity has a diameter of between about 6.5 nm and about 94.5 nm. In certain embodiments, the internal cavity has a diameter of between about 7 nm and about 94 nm. In certain embodiments, the internal cavity has a diameter of between about 7.5 nm and about94.5 nm. In certain embodiments, the internal cavity has a diameter between about 8 nm and about 94 nm. In certain embodiments, the internal cavity has a diameter between about 8.5 nm and about93.5 nm. In certain embodiments, the internal cavity has a diameter between about 9 nm and about 93 nm. In certain embodiments, the internal cavity has a diameter of between about 9.5 nm and about 92.5 nm. In certain embodiments, the internal cavity has a diameter of at or about 1 nm, at or about 3 nm, at or about 5 nm, at or about 7 nm, at or about 10 nm, or at or about 12 nm. In certain embodiments, the internal cavity has a diameter of between about 10 nm and about 190 nm, between about 15 nm and about 185 nm, between about 20 nm and about 180 nm, between about 25 nm and about 175 nm, between about 30 nm and about 170 nm, between about 35 nm and about 165 nm, between about 40 nm and about 160 nm, between about 45 nm and about 155 nm, between about 50 nm and about 150 nm, between about 55 nm and about 145 nm, between about 60 nm and about 140 nm, between about 65 nm and about 135 nm, between about 70 nm and about 130 nm, between about 75 nm and about 125 nm, between about 80 nm and about 120 nm, between about 85 nm and about 115 nm, between about 90 nm and about 110 nm, between70808-02 about 95 nm and about 105 nm, or about 100 nm. All ranges specified in this paragraph are inclusive of the stated end points and all 0. 1 nm increments therein.

[0064] Due to the use of ssDNA, interactions are possible on all sides of the nanopore; in this manner, the nanopore can be “tuned” for a particular use. Where the nanopore comprises a cube shape (e.g., a "nanocube"), at least eight additional modalities can be incorporated into the nanopore (e g., by functionalizing each of the 8 faces of the nanocube). The term "nanocube" is used interchangeably with "nanopore" herein to convey the general shape, geometry, and / or size of the constructs disclosed. This terminology does not imply or necessitate the presence of six faces characteristic of a geometric cube, nor does it exclude such a structure. Instead, it indicates that the general geometry of the constructs can be described in this manner without requiring a geometrically perfect cube with six equal-sized, shaped, equidistant, or otherwise precise forms of the components.

[0065] In certain embodiments, the nanopore has four different DNA strands, and comprises 7 nm long DNA duplexes, which collectively assemble to form about a 0.5 nm. a 1 nm, or a 5 nm cavity representing the nanopore structure, for example. Each DNA strand can, for example, comprise 96 nucleotides (nts). In certain embodiments, each strand of the nanopore comprises four consecutive thymines (T) positioned at the comers of the nanopore to enhance structural flexibility. Additionally, 20 nts, equivalent to two turns, can be situated at each of the four edges to enhance the structural stability of the DNA when hybridized (either fully or partially) with other DNA strands.

[0066] As used herein, the tenns “hybridize”, “hybridization” and “hybridized," used alone or in reference “to” and / or “with” mean the formation of a bond, complementary base pair, or base pairing of nucleic acids which are found in the disclosed components (z.e., strands). This encompasses at least one but can be more than one base pair combination(s), which can be contiguous, interrupted, transient, intermittent and / or reversible. The interaction can occur (a) between two or more distinct oligonucleotide-containing strands, (b) within a single strand to form secondary structures such as hairpins or loops, or (c) as a combination thereof. For example, an internal strand can form hairpin and or loop structures within the nucleic acid chain and also provide for hybridization to one or more nanopore component strand. Hybridization can be full (perfect complementarity ) or partial (mismatches or bulges permitted), and may also involve hybridization to one or more nanopore component strands.

[0067] The nanopore can further comprise one or more internal oligonucleotide strands positioned at least partially within the internal cavity7of the nanopore. The nanopore can comprise one internal strand, two internal strands, three internal strands, or any other number of internal strands desired.70808-02

[0068] Each internal strand can be strategically engineered to hybridize (fully or partially) and / or establish connections with at least one of the plurality of nucleic acid strands (i.e., pillars) of the nanopore. In certain embodiments, the internal strand is configured to fully or partially hybridize with two or more edges (pillars) of the nanopore. In certain embodiments, wherein the one or more internal oligonucleotide strand (e.g., L5) has at least 68%, at least 70%, at least 75%, at least 78%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 6.

[0069] In certain embodiments, the oligonucleotide comprises one or more hairpin formations, loops, and / or other secondary or tertiary structures. In certain embodiments, an internal oligonucleotide strand comprises five hairpin motifs, with the three most-central hairpin motifs available for functionalization. As used herein, the term “available for functionalization” means a structural feature of a nucleotide or oligonucleotide strand or portion thereof that is accessible for chemical modification without substantially impairing the hybridization or stability of the strand. Availability for functionalization encompasses bases, nucleotides, motifs (e.g., hairpins or loops), or regions of the strand that are sterically exposed or otherwise positioned to permit attachment of one or more chemical groups, labels, ligands, biomolecules, or other moieties, either directly or through a linker. Such availability can be inherent in the spatial configuration of the oligonucleotide structure or conferred by design, and includes embodiments in which the site is fully exposed, partially exposed, or conformationally dynamic but nonetheless capable of undergoing functionalization.

[0070] The nanopores hereof are modular in nature and allow for versatile design. As such, the internal and external surfaces of the nanopore components (including, without limitation, the internal strand(s)) can be customized to accommodate (or be available for functionalization with) various biomolecules, including nucleic acids, proteins, dyes, and small molecules. Further, the incorporation of particular internal strands, for example, can enable the nanopore to modulate the flow of particular biomolecules therethrough (i.e. through the internal cavity) by restricting flowrate - even to the extent that the nanopore can function similar to a gate via transient binding, charge effects, or other molecular interactions mediated by the one or more internal strands.

[0071] The one or more internal strands can hybridize at least partially to at least one of the structural components of the nanopore. In this manner, the internal strand can be anchored within the nanopore structure (FIG. 2B and FIG. 7 and 7B). The nucleotide sequence of such an internal stand can be designed to incorporate internal structural conformational elements such as forming hairpins and loops, or other secondary and even tertiary structures. The combined use of tw o or more internal strands is contemplated (FIG. 7B).70808-02

[0072] As shown in FIG. 2B, the internal strand L5 hybridized with the LI component, and L5 has the nucleic acid sequence as shown in Table 1. However, it is envisioned and encompassed in the scope of this disclosure that the internal strand can be designed to hybridize with any of the four (4) components that form the walls of the nanopore. In certain embodiments, the nanopore can comprise more than one internal stand incorporated therein.

[0073] In certain embodiments, one or more of the plurality of nucleic acid strands (pillars) of the nanopore is functionalized (e.g., by incorporated 5-7 nts therein) to result in a desired charge or facilitate a desired reaction. As used herein, the term ‘‘functionalized’' means the state of an oligonucleotide strand, motif, or region that has been chemically modified by the attachment of one or more groups, hydrophobic moieties (such as cholesterol), labels, ligands, biomolecules, reporter moieties, or other functional entities. Functionalization can be covalent or non-covalent, direct or through a linker, and can be employed to impart new properties (e.g., binding affinity, signaling, catalytic activity, or therapeutic effect) to enable detection or to facilitate interaction with other molecules or structures.

[0074] DNA nanoparticles have a negative charge, which allows for the integration of positively charged substances through electrostatic attraction, for example. In certain embodiments, one or more nucleotide strands of the nanopore further comprise a cholesterol tag. The nucleotide strand can comprise the cholesterol tag at the 3' end thereof.

[0075] In certain embodiments, the nanopore comprises a minimum of four symmetrical cholesterol moieties positioned within the oligonucleotide strands of the nanopore. For example, where the nanopore comprises a cube-like structure, four distinct short DNA strands (each, for example, about 20 nts) can each be tagged with cholesterol at the 3’ end, which can be incorporated into the four edges of the nanopore structure.

[0076] In certain embodiments, one or more of the internal strands can be functionalized with different functional molecules, such as polymers, targeting ligands, or therapeutic nucleic acids, peptides, dyes, and proteins, with precise control over valency and orientation. For example, one or more of the components that form the walls of the nanopore can be tagged (or functionalized) with a dye, such as a Cy3 label. In certain embodiments, for example, L2 (or any of the other nucleic acid sequences of the pillars of the nanopore) is tagged with a fluorescent label. In certain embodiments, the fluorescent label comprises cyanine dye, such as Cys3 having a sequence of SEQ ID NO: 3.

[0077] The DNA nanopores described herein are capable of interacting with both prokaryotic and eukaryotic cell membranes. As demonstrated by the Examples provided below, the nanopores can spontaneously integrate with prokaryotic and eukaryotic cells when combined under appropriate conditions, as illustrated in FIGS. 5A-5C. In certain embodiments, the DNA nanopore can be70808-02 inserted into and span a lipid bilayer of a cell membrane, thereby forming a synthetic and stable channel. This channel can facilitate the transfer of biomolecules across the cell membrane through the first and second open ends and the internal cavity of the nanopore. This configuration allows for the circumvention of natural cellular processes, such as endocytosis and active transport, providing a direct pathway for the movement of molecules into and out of cells. Additionally, the presence of one or more internal strands within the nanopore can modulate the transfer of biomolecules, as depicted in FIGS. 6A-6N.

[0078] In some embodiments, the nanopore structures described herein possess a capacity for membrane specificity modifications. For example, one or more surfaces of the nanopore can be functionalized to increase its specificity for various cell membranes, thereby facilitating targeted delivery to particular cell types. Such functionalization can include, without limitation, the attachment of chemical ligands, cytokines, protein markers, antigens, oligonucleotides, aptamers, or other small molecules known in the art to confer binding specificity or receptor selectivity.

[0079] In certain embodiments, the nanopore can be utilized in targeted drug delivery, biosensing, and intercellular communication. The nanopore framework can facilitate selective binding to cellular receptors, thereby enhancing the efficacy of drug delivery systems by delivering therapeutic agents directly to specific cells and improving treatment efficacy, while minimizing off- target effects.

[0080] In additional embodiments, the structural integrity of the nanopore under physiological conditions facilitates its application in biosensing, including detecting, reporting, or responding to specific biomolecular signals. For instance, the nanopores described herein can interact with cellular membranes and facilitate the transfer of molecules across them, providing a platform for detecting cellular responses or the presence of specific biomolecules in real time.

[0081] In further embodiments, the nanopore can be configured to facilitate the controlled or stimuli-responsive release of therapeutic agents, thereby modulating intercellular communication and cellular pathways. By enabling the transfer of signaling molecules across cellular membranes, the nanopore can be used to influence or regulate cellular behavior in a controlled manner.

[0082] In certain embodiments, the nanopore can further function as a synthetic pore or poreforming structure to promote the uptake of exogenous nucleic acids, such as DNA or RNA, across cell membranes. Such configurations can enhance the cost-effectiveness, efficiency, and reproducibility of synthetic biology applications and genetic modification processes in both eukaryotic and prokaryotic cells. In certain embodiments, the nanopore can thereby serve as a delivery vehicle for genome editing systems, expression constructs, or other nucleic acid-based therapeutics.70808-02

[0083] In some embodiments, the nanopore can be configured such that the controlled or stimuli- responsive release of therapeutic agents is triggered by one or more environmental or physiological cues. For example, and without limitation, the environmental or physiological cue can comprise a change in pH; an elevated or reduced temperature; enzymatic cleavage; light, magnetic field, or electrical stimulation; and / or ligand binding at the nanopore surface.

[0084] In further embodiments, the nanopore can be configured such that its synthetic pore function is selective for one or more classes of biomolecules. For example, and without limitation, the nanopore can be functionalized to selectively facilitate uptake of nucleic acids, proteins or peptides, small-molecule therapeutics, and / or metabolites or signaling molecules.

[0085] In certain embodiments, the nanopore structures can provide a stable and versatile platform that is adaptable for drug delivery, biomolecular sensing, synthetic pore formation, and genetic engineering. In some embodiments, the nanopore structures can be engineered to achieve celltype specificity, enhance therapeutic outcomes, and expand applications in precision medicine, diagnostics, and cellular engineering.

[0086] The DNA nanopores described herein can be utilized to stimulate the proliferation and differentiation of stem cells, thereby modulating their biological behavior. In certain embodiments, the nanopores can interact with the cell surface or be internalized into the cell membrane to influence intracellular signaling pathways that govern cell cycle progression and lineage specification. By presenting defined structural motifs or functional moieties, the nanopores can alter the responsiveness of stem cells to growth factors, cytokines, or other environmental cues. This modulation of sensitivity to external stimuli can result in the acquisition of altered or enhanced cellular functions, including directed differentiation into specific lineages, improved regenerative potential, or modified metabolic or immunological activity.

[0087] Accordingly, the DNA nanpores provide a versatile platform for stem cell engineering, regenerative medicine, and tissue repair, offering a controllable means of influencing stem cell fate decisions under physiological or engineered conditions.

[0088] Also provided is a composition (e.g, a pharmaceutical composition) for delivery of nanopores to a subject. The pharmaceutical composition can comprise the nanopores hereof and a pharmaceutically acceptable carrier or excipient. “Pharmaceutically acceptable carrier” includes any of the standard pharmaceutical carriers, such as, but not limited to, a buffering agent, a preserving agent, an anesthetic agent, a solubilizing agent, an isotonic agent, a wetting agent, and a stabilizer. The term also encompasses any of the agents approved by a regulator}' agency, such as the U.S. Food and Drug Administration, or listed in the U.S. Pharmacopeia for use in animals (e.g, mammals, such as humans). The carrier can be a phosphate-buffered saline solution, water, or an emulsion such as an oil / water or water / oil emulsion.70808-02

[0089] Further provided is a combination of separate pharmaceutical compositions for selective delivery of one or more molecules to an intracellular environment. The combination can comprise (i) a nanopore hereof, or a pharmaceutical composition comprising a nanopore hereof and pharmaceutically acceptable carrier or excipient; and (ii) one or more molecules (e.g., biomolecules, therapeutic agents, proteins, etc.). The one or more molecules can be any molecules that are desired for uptake into a targeted cell (e.g., the cell targeted by the nanopores thereof).

[0090] The nanopores can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human patient, in a variety of forms adapted to the chosen route of administration. For example, the pharmaceutical composition can be formulated for and administered via parenteral, intravenous, intraarterial, intraperitoneal, intrathecal, epidural, intracerebroventricular, intraurethral, intrastemal, intracranial, intratumoral, intramuscular, topical, inhalation and / or subcutaneous routes. Indeed, in at least one embodiment, a nanopore and / or composition as described herein can be administered directly into the blood stream, into muscle, or into an internal organ.

[0091] For example, in at least one embodiment, the nanopores can be systemically administered in combination with a pharmaceutically acceptable vehicle such as an inert diluent. The percentage of the compositions and preparations can vary' and can be between about 1 to about 99% of the active ingredient(s) and a binder, excipients, a disintegrating agent, a lubricant, and / or a sweetening agent (as are known in the art). The amount of active compound (e.g., nanopores) in such therapeutically useful compositions is such that an effective dosage level will be obtained.

[0092] The nanopores and pharmaceutical compositions hereof can be formulated as parenteral formulations. Parenteral formulations are typically aqueous solutions, yvhich can contain carriers or excipients such as salts, carbohydrates, and buffering agents (preferably at a pH of from 3 to 9), but they can be more suitably formulated as a sterile, non-aqueous solution or as a dried from to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water or sterile saline. Preparation under sterile conditions, by lyophilization to produce a sterile, lyophilized powder for a parenteral formulation, can be accomplished using methods well-known in the art. The solubility of the nanopore for parenteral formulation can be increased by the use of appropriate formulation techniques, such as the incorporation of solubility-enhancing agents.

[0093] The nanopores / compositions can also be administered via infusion or injection (e.g. , using needle (including microneedle) injectors and / or needle-free injectors). Solutions of the composition can be aqueous, optionally mixed with a nontoxic surfactant and / or can contain carriers or excipients such as salts, carbohydrates and buffering agents (preferably at a pH of from 3 to 9), but, for some applications, they can be more suitably formulated as a sterile non-aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile,70808-02 pyrogen-free water or phosphate- buffered saline (PBS). For example, dispersions can be prepared in glycerol, liquid PEGs, triacetin, and mixtures thereof and in oils. Under ordinary' conditions of storage and use, these preparations can further contain a preservative to prevent the growth of microorganisms.

[0094] The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredients that are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example and without limitation, water, ethanol, a polyol (e.g., glycerol, propylene glycol, liquid PEG(s), and the like), vegetable oils, nontoxic glyceryl esters, and / or suitable mixtures thereof. In at least one embodiment, the proper fluidity can be maintained by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The action of microorganisms can be prevented by7the addition of various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In certain cases, it will be desirable to include one or more isotonic agents such as sugars, buffers, or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the incorporation of agents formulated to delay absorption, for example, aluminum monostearate and gelatin.

[0095] Sterile injectable solutions can be prepared by incorporating the nanopore(s) and / or composition in the required amount of the appropriate solvent with one or more of the other ingredients set forth above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparations are vacuum dry ing and freeze-dry' ing techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.

[0096] For topical administration, it can be desirable to administer the nanopores to the skin as compositions or formulations in combination with a dermatologically acceptable carrier, which can be a solid or a liquid. For example, in certain embodiments, solid carriers can include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Similarly, useful liquid carriers can comprise water, alcohols or glycols or water-alcohol / glycol blends, in which the nanopores can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Additionally or alternatively, adjuvants such as fragrances and antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and / or other70808-02 dressings, sprayed onto the targeted area using pump-type or aerosol sprayers, or simply applied directly to a desired area of the subject.

[0097] Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like for application directly to the skin of the subject.

[0098] The amount of the nanopore to be administered to a subject can vary significantly, depending on the cancer being treated, the route of administration, and tissue distribution. As used herein, the terms “therapeutically effective,” “therapeutically effective dose.” “therapeutically effective amount,” “prophylactically effective amount,” or “prophylactically effective dose” mean (unless specifically stated otherwise) a quantity' of a nanopore which, when administered either one time or over the course of a treatment cycle affects the health, wellbeing or mortality of a subject (e.g., and without limitation, facilitates uptake of a desired molecule into a targeted cell, for example). Useful dosages of the nanopores can be determined by companng their in vitro activity’, and the in vivo activity in animal models. Methods of the extrapolation of effective dosages in mice and other animals to human subjects are known in the art. Indeed, the dosage of the nanopore can vary significantly depending on the condition of the host subject, the treatment with which the nanopores are being used, how advanced the pathology of the patient is, the route of administration of the nanopore and tissue distribution, and the possibility of co-usage of other therapeutic treatments. The amount of the composition required for use in treatment (e.g., the therapeutically or prophylactically effective amount or dose) will vary not only with the particular application, but also with the characteristics of the subject (such as, for example, age, condition, sex, the subject’s body surface area and / or mass, tolerance to drugs) and will ultimately be at the discretion of the attendant physician, clinician, or otherwise.

[0099] The amount to be administered to a subject can range, for example, from about 0.05 mg to about 30 mg, about 0.05 mg to about 25 mg, about 0.05 mg to about 20 mg, about 0.05 mg to about 15 mg. about 0.05 mg to about 10 mg. about 0.05 mg to about 9 mg, about 0.05 mg to about 8 mg, about 0.05 mg to about 7 mg, about 0.05 mg to about 6 mg, about 0.05 mg to about 5 mg, about 0.05 mg to about 4 mg, about 0.05 mg to about 3 mg, about 0.05 mg to about 2 mg, about 0.05 mg to about 1 mg, about 0.05 mg to about 0.5 mg, about 0.05 mg to about 0.4 mg, about 0.05 mg to about 0.3 mg, about 0.05 mg to about 0.2 mg, about 0.05 mg to about 0.1 mg, about 0.01 mg to about 20 mg, about 0.3 mg to about 10 mg, about 0. 1 mg to about 20 mg, or about 0.8 mg to about 3 mg. The ordinarily skilled artisan will readily appreciate that the dose can vary w ithin the various ranges provided above based on the factors pointed out above and can be at the treating physician’s discretion.70808-02

[0100] Therapeutically effective or prophylactically effective amounts or doses can range, for example, from about 0.05 mg / kg of patient body weight to about 30.0 mg / kg of patient body weight, or from about 0.01 mg / kg of patient body weight to about 5.0 mg / kg of patient body weight, including but not limited to 0.01 mg / kg, 0.02 mg / kg. 0.03 mg / kg, 0.04 mg / kg, 0.05 mg / kg, 0.1 mg / kg. 0.2 mg / kg. 0.3 mg / kg. 0.4 mg / kg. 0.5 mg / kg. 1.0 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, 3.0 mg / kg, 3.5 mg / kg, 4.0 mg / kg, 4.5 mg / kg, and 5.0 mg / kg, all of which are kg of patient body weight. The total therapeutically or prophylactically effective amount of the nanopores can be administered in single or divided doses and can, at the practitioner’s discretion, fall outside of the typical range given herein.

[0101] In another embodiment, the nanopore can be administered in a therapeutically or prophylactically effective amount of from about 0.5 g / m2 to about 500 mg / m2, from about 0.5 g / m2 to about 300 mg / m2, or from about 100 g / m2 to about 200 mg / m2. In other embodiments, the amounts can be from about 0.5 mg / m2 to about 500 mg / m2, from about 0.5 mg / m2 to about 300 mg / m2, from about 0.5 mg / m2 to about 200 mg / m2, from about 0.5 mg / m2 to about 100 mg / m2, from about 0.5 mg / m2 to about 50 mg / m2, from about 0.5 mg / m2 to about 600 mg / m2, from about 0.5 mg / m2 to about 6.0 mg / m2, from about 0.5 mg / m2 to about 4.0 mg / m2, or from about 0.5 mg / m2 to about 2.0 mg / m2. The total amount can be administered in single or divided doses and can, at the physician's discretion, fall outside of the typical range given herein. These amounts are based on meters of body surface area. All ranges specified in this paragraph are inclusive of the stated end points and include all 0.5 g / m2 increments encompassed in each specified range.

[0102] In other embodiments, the amount of the nanopore to be administered to a subject can range, for example, from about 50 nmol / kg to about 3,000 nmol / kg of subject body weight, about 50 nmol / kg to about 2,000 nmol / kg, about 50 nmol / kg to about 1,000 nmol / kg, about 50 nmol / kg to about 900 nmol / kg, about 50 nmol / kg to about 800 nmol / kg, about 50 nmol / kg to about 700 nmol / kg, about 50 nmol / kg to about 600 nmol / kg, about 50 nmol / kg to about 500 nmol / kg. about 50 nmol / kg to about 400 nmol / kg. about 50 nmol / kg to about 300 nmol / kg, about 50 nmol / kg to about 200 nmol / kg, about 50 nmol / kg to about 100 nmol / kg, about 100 nmol / kg to about 300 nmol / kg, about 100 nmol / kg to about 500 nmol / kg, about 100 nmol / kg to about 1,000 nmol / kg, or about 100 nnmol / kg to about 2,000 nmol / kg of subject body weight. In other embodiments, the dose can be about 100 nmol / kg, about 150 nmol / kg, about 200 nmol / kg, about 250 nmol / kg, about 300 nmol / kg, about 350 nmol / kg, about 400 nmol / kg, about 450 nmol / kg, about 500 nmol / kg, about 600 nmol / kg, about 700 nmol / kg, about 800 nmol / kg, about 900 nmol / kg, about 1,000 nmol / kg, about 2,000 nmol / kg, or about 3,000 nmol / kg of subject body weight. In other embodiments, between about 20 pg / kg to about 3 mg / kg of subject body weight can be70808-02 administered. The amount can be between about 0.2 mg / kg to about 0.4 mg / kg of subject body weight or about 50 pg / kg subject body weight. All ranges specified in this paragraph are inclusive of the stated end points and include all 1 nmol / kg or 10 pg / kg increments, as applicable, encompassed in each specified range.

[0103] The nanopores and compositions hereof can be synthesized in accordance with methods known in the art. Various methods of synthesis are exemplified herein. In certain embodiments, methods of constructing the nanopores are also provided. In certain embodiments, a method of constructing a nanopore structure hereof comprises combining, under suitable conditions, an equal proportion of a first oligonucleotide, a second oligonucleotide, a third oligonucleotide, and a fourth oligonucleotide, wherein the first oligonucleotide, second oligonucleotide, third oligonucleotide, and fourth oligonucleotide self-assemble to form a nanocage defining an internal cavity in communication with two open ends. In certain embodiments, the first oligonucleotide partially hybridizes to the second and fourth oligonucleotides, and the third oligonucleotide partially hybridizes to the second and fourth oligonucleotides such that the four oligonucleotides form a four-sided, open nanopore structure.

[0104] The self-assembly can occur through Watson-Crick base pairing, complementary strand hybridization, and / or structural motifs such as sticky ends, hairpin loops, or crossover junctions, thereby yielding a stable and predictable nanopore geometry. In certain embodiments, the assembly process can be facilitated by thermal annealing, ionic strength adjustment, or the addition of stabilizing agents (e.g., Mg2+or other divalent cations).

[0105] In certain embodiments, the combining step further comprises combining an equal portion of one or more internal oligonucleotides, wherein the one or more internal oligonucleotides selfassemble, are positioned (at least partially) within the internal cavity of the nanopore, and at least partially hybridize to one or more of the first, second, third, or fourth oligonucleotides. The method can further comprise functionalizing one or more of the first, second, third, fourth oligonucleotides, or the one or more internal oligonucleotide strands to facilitate selective transfer of nucleic acid, a protein, peptide, and / or small-molecule through the two open ends and internal cavity of the nanopore.

[0106] The resulting nanopore structure can define a hollow internal cavity' (lumen) in communication with two open ends such that, when the nanopore is internalized within a cell membrane, the two open ends and internal cavity enable the transport of molecules across the cell membrane and / or between distinct environments. In some embodiments, the nanopore can be further functionalized by the incorporation of modified bases, chemical linkers, peptide conjugates, or targeting ligands to enhance membrane insertion, specificity7, or regulatory7control of molecular passage.70808-02

[0107] Methods of use of the nanopores hereof are also provided. In certain embodiments, the nanopores (or compositions) hereof can be used to treat a condition in a subject, wherein the method comprises administering a therapeutically effective amount of the nanopore or the pharmaceutical composition to the subject and / or administering a second set of one or more molecules to be internalized into the targeted cells by selective passage through the nanopores. The terms “treat,” “treating,” “treated,” and “treatment” refer to therapeutic treatment. Such treatment can have a prophylactic effect, for example. The term “subject,” as used herein, means an animal, such as a mammal, and in particular a human. In veterinary' applications, the subject can be a laboratory, an agricultural, a domestic, or a wild animal. Examples of such animals include, but are not limited to, a rodent, a rabbit, a monkey, a chimpanzee, a dog, a cat, a cow, a horse, a pig, a sheep, a goat, a bear, a panda, a lion, a tiger, a leopard, an elephant, a zebra, a giraffe, a gorilla, a dolphin, or a whale.

[0108] The nanopore or pharmaceutical composition comprising the same, or a combination thereof and an additional therapeutic or other molecules can be administered to the subject using any suitable method known in the art. The terms “administer,” “administering,” “administered,” and “administration” refer to methods of introducing the nanopore or a pharmaceutical composition comprising the nanopore to the subject. Examples of suitable routes of administration include, but are not limited to, oral, intravenous, intramuscular, subcutaneous, and transdermal. The components can be administered directly into the blood stream, into muscle, or into an internal organ. Suitable routes for parenteral administration include, but are not limited to, intravenous, intra-arterial, intraperitoneal, intrathecal, epidural, intracerebroventricular, intraurethral, intrastemal, intracranial, intratumoral, intramuscular, and subcutaneous. Use can be made of needle injectors, including microneedles, needle-free injectors, and infusions. The aforementioned components can be administered in unit dosage forms and / or formulations containing conventional non-toxic pharmaceutically acceptable carriers or excipients (or vehicles or adjuvants).

[0109] Where multiple therapeutics and / or therapies are co-administered, dosages may be adjusted accordingly, as is recognized in the pertinent art. “Co-administration” and combination therapy are not limited to simultaneous administration.

[0110] The nanopores are also applicable for use in the preparation of medicaments for transporting molecules into a targeted cell. The nanopores described herein offer potential therapeutic benefits by modulating selective passage into the targeted cell(s) of one or more molecules.

[0111] In certain embodiments, a method is provided for creating a transmembrane channel through a target membrane comprising contacting the target membrane with a nanopore70808-02 thereof. Upon contacting, the nanopore can insert into or associate with the lipid bilayer of the target membrane to form a pore that spans the membrane and establishes communication between an extracellular environment and an intracellular environment. The target membrane can be, for example, a cell membrane. In certain embodiments, the target membrane is a lipid membrane. In certain embodiments, the cell membrane is a prokaryotic cell membrane or a eukaryotic cell membrane.

[0112] In some embodiments, the transmembrane channel can facilitate the selective passage of molecules, including without limitation ions, nucleic acids, proteins, peptides, metabolites, or small-molecule therapeutics. In further embodiments, the nanopore can be designed to permit stimuli-responsive or gated transport, wherein molecular passage is triggered or regulated by one or more cues such as pH, temperature, light, enzymatic activity, or ligand binding.

[0113] Accordingly, when inserted into or associated with the target membrane, the nanopore can facilitate uptake of a nucleic acid, a protein, a peptide, and / or a small-molecule therapeutic across the target membrane. Indeed, the nanopore can form a synthetic pore in the target membrane that is selective for one or more classes of molecules. The one or more classes of molecules can be selected from the group consisting of ions, proteins, nucleases, molecules, chemical compounds, oligonucleotides, enzy mes and signal molecules. Furthermore, one or more surfaces of the transmembrane channel and / or the one or more internal oligonucleotide strand of the nanopore can be functionalized (e.g. , to facilitate the selective uptake or gating through the internal cavity and / or into the intracellular environment).

[0114] In certain embodiments, the method is applied to deliver therapeutic or diagnostic agents into a cell, to promote uptake of exogenous nucleic acids for genetic modification, or to enable exchange of signaling molecules for modulating cellular communication pathways. In additional embodiments, the nanopores can be used in biosensing platforms to detect the presence or concentration of analytes by monitoring transmembrane current or molecular passage.

[0115] Methods for transporting molecules into a cell using the nanopores hereof are also provided. In certain embodiments, a method for transporting molecules into a cell comprises: contacting a target cell with a nanopore hereof, wherein the nanopore inserts into a cell membrane and creates a transmembrane channel between an extracellular environment and an intracellular environment. One or more molecules can then be administered to the extracellular environment, and the molecules are transported into the intercellular environment by selective passage through the transmembrane channel mediated by the nanopore.

[0116] The nanopores of this method can be any described herein. In certain embodiments, the nanopore comprises one or more internal oligonucleotide strands functionalized to modulate transport through the internal cavity formed by the nanopore. In other words, the internal strand(s)70808-02 can prevent untargeted molecules from flowing into the internal cavity of the nanopore (and thus into the intracellular environment) while concurrently allowing targeted molecules to enter the internal cavity7of the nanopore and flow into the intracellular environment of the cell.

[0117] In some embodiments, the one or more molecules can comprise nucleic acids, proteins, peptides, lipids, carbohydrates, metabolites, ions, or small-molecule therapeutics. In additional embodiments, the nanopore can be engineered to provide selective or gated transport, such that molecular passage occurs in response to one or more stimuli, including without limitation changes in pH, temperature, ionic strength, light exposure, enzymatic cleavage, or ligand binding.

[0118] In further embodiments, the method can be applied to deliver therapeutic or diagnostic agents, to promote uptake of exogenous nucleic acids for genome editing or gene expression, or to enable controlled introduction of signaling molecules for modulation of cellular communication and pathway activation. In some embodiments, the nanopores can enhance the efficiency and reproducibility of synthetic biology and genetic engineering workflows by facilitating the cost- effective transfer of macromolecules into eukaryotic or prokaryotic cells.

[0119] Accordingly, the methods of transporting molecules described herein provide a controllable and versatile approach for intracellular delivery, suitable for use in precision medicine, gene therapy, diagnostics, biosensing, and cellular engineering applications.

[0120] Methods for modulating stem cell function utilizing the nanopores described herein are also provided. In certain embodiments, a method for modulating stem cell function comprises contacting a population of stem cells with a nanopore as described herein, wherein the nanopore stimulates proliferation and / or differentiation of the stem cells. The stimulation can occur through interaction of the nanopore with the cell membrane, insertion into the membrane to alter ion flux or signaling, or presentation of functional moieties that engage stem cell receptors and intracellular pathways governing self-renewal and lineage specification.

[0121] In some embodiments, the DNA nanopore can further comprise one or more functional groups, ligands, peptides, proteins, growth factors, or biomolecules that facilitate interaction with a stem cell receptor or signaling pathway. In certain embodiments, such ligands or biomolecules may be selected to modulate bone morphogenetic protein 4 (BMP-4), Wnt, Notch, Hedgehog, TGF-P, MAPK, or other developmental signaling pathways that are recognized to regulate stem cell proliferation and differentiation.

[0122] In further embodiments, the nanopores can be employed to bias differentiation toward a desired lineage (e.g., neuronal, hematopoietic, mesenchymal, or epithelial), to enhance regenerative capacity7of adult stem cells, or to modify the sensitivity of stem cells to growth factors or extracellular stimuli. In some embodiments, the method can be carried out in vitro for cell70808-02 culture and tissue engineering applications, or in vivo for regenerative medicine, transplantation, or therapeutic intervention.

[0123] General

[0124] Those skilled in the art will recognize that numerous modifications can be made to the specific implementations described above. The implementations should not be limited to the particular embodiments described. Other implementations may be possible.

[0125] While the methods are illustrated and described in detail in the foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only certain embodiments have been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected.

[0126] It is intended that that the scope of the present compositions and methods are defined by the following claims. However, this disclosure can be practiced otherwise than is specifically explained and illustrated without departing from its spirit or scope. Those skilled in the art will understand that various alternatives to the embodiments described herein can be employed in practicing the claims without departing from the spirit and scope as defined in the following claims.

[0127] All publications, patents, patent application publications, journal articles, textbooks, and other publications referred to in this document are indicative of the level of skill of those in the art to which the disclosure pertains. All such publications are incorporated herein by reference to the same extent as if each individual publication were specifically and individually indicated to be incorporated by reference. In the event of inconsistent usages between this document and those documents so incorporated by reference, the usage in the incorporated reference should be considered supplementary to that of this document; for irreconcilable inconsistencies, the usage in this document controls.

[0128] The terms and expressions employed are used as terms of description and not of limitation. Where certain terms are defined and are otherwise described or discussed elsewhere in the “'Detailed Description,” all such definitions, descriptions, and discussions are intended to be attributed to such terms. There also is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof. Furthermore, while subheadings may be used in the “Detailed Description,” such use is solely for ease of reference and is not intended to limit any disclosure made in one section to that section only; rather, any disclosure made under one subheading is intended to constitute a disclosure under each and evety other subheading.70808-02

[0129] Certain Definitions

[0130] As used herein, the following terms and phrases shall have the meanings set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary’ skill in the art.

[0131] The term "about” or "approximately” means within an acceptable range for the particular value as determined by one of ordinary' skill in the art, w hich will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. By way of further example, “about” or "approximately” can mean within 90%, within 95%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more of a stated value or of a stated limit of a range. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Unless otherwise stated, the term "about” means within an acceptable error range for the particular value, such as ± 1-20%, preferably ± 1-10% and more preferably ±1-5%.

[0132] Where a range of values is provided, it is understood that each interv ening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed. The upper and lower limits of these smaller ranges can independently be included in the smaller ranges, and are also encompassed, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both limits, ranges excluding either or both of those limits are also included.

[0133] A phrase referring to "one or more" or "at least one of’ a list of items refers to any combination of those items, including single members. As an example, "at least one of a, b, or c” is intended to cover: a, b, c, a-b, a-c, b-c, and a-b-c.

[0134] The terms “a,” “an,” or “the” are used to include one or more than one unless the context clearly dictates otherwise. The term “or” is used to refer to a nonexclusive “or” unless otherwise indicated. In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation.EXAMPLES

[0135] The following examples sen e to illustrate the present disclosure. The examples are not intended to limit the scope of the claimed methods in any way.70808-02Materials

[0136] All HPLC and PAGE purified DNA oligonucleotides were procured from Integrated DNA Technologies (IDT). The 40% acrylamide / bis-acrylamide solution with a 19:1 ratio (catalog number 1610144) and tetramethylethylenediamine (TEMED) (catalog number 1610800), along with the 50x Tris / Acetic Acid / EDTA solution (catalog number 1610743EDU), were obtained from Bio-Rad Laboratories. GelRED Nucleic Acid Stain (catalog number SCT122), glycerol (catalog number G5516), Tris Base (catalog number 10708976001), sodium hydroxide solution (catalog number 72068), and ammonium persulfate (APS) (catalog number 248614) were sourced from Sigma- Aldrich. The GeneRuler Ultra Low Range DNA Ladder (catalog number SM1213), ethylenediaminetetraacetic acid (EDTA) (catalog number 118432500), magnesium chloride hexahydrate (catalog number 447155000), IM Tris-HCl (catalog number 15567027), nuclease- free water (catalog number AM9937), acetic acid (catalog number 327292500), and SureCast™ Gel Handcast Bundle B (catalog number HC 1000S) were acquired from Thenno Fisher Scientific Inc. The UV cuvette (catalog number 67.758) was purchased from SARSTEDT. A compressed air dispenser (catalog number 911280) was obtained from Office Depot. The Quick-Load Purple 50 bp DNA Ladder (catalog number N0556S) was procured from New England Biolabs, Inc. Mica sheets (catalog number NC9655733) were purchased from Ted Pella, Inc.Example 1DNA Nanocube Structure

[0137] The initial sequences of the DNA cube structure were generated utilizing the TIAMAT designing program. This nanostructure comprised four distinct deoxyribonucleic acid (DNA) strands and included 7 nm long DNA duplexes, which was collectively assembled to form a cavity approximately 5 nm in size, representing the DNA cube structure (FIGS. 1 and 2A). Each DNA strand consisted of 96 nucleotides (nts), with four consecutive thymines (T) strategically positioned at the four comers to enhance structural flexibility-. Additionally, 20 nts, which is roughly equivalent to two helical turns, were situated at each of the four edges to improve the structural stability of the DNA when hybridized with other DNA strands (FIGS. 2C-2F).

[0138] To optimize the specificity' of the four distinct DNA strands, computational analysis was conducted using the web-based DNA analysis tool, IDT Oligo-Analyzer. This analysis included a comprehensive evaluation of parameters such as hairpin formation, self-dimerization, heterodimerization, strand lengths, guanine-cytosine (GC) contents, and buffer conditions. Following these assessments and guided by free energy calculations, iterative refinements and adjustments were made to the DNA sequences.70808-02

[0139] Embedding a DNA nanostructure in a membrane can be facilitated by incorporating four symmetrical cholesterol moieties (for example, of SEQ ID NOS. 7-10). In the structural design, four additional short DNA strands, each 20 nts in length, were incorporated, with each strand tagged with cholesterol at the 3’ end. These additional DNA strands were configured to hybridize at the four edges of the DNA cube structure (FIG. 2A).

[0140] The IDT Oligo-Analyzer was utilized to verify the compatibility of the additional DNA strands with the DNA Cube structure and to optimize the sequences. This process aimed to minimize the formation of undesired base pairs between the DNA nanocube and the newly designed short strands, thereby facilitating membrane interfacing via cholesterol tags.Example 2DNA Cube Nanostructure with Inner Strand

[0141] Employing the framework from Example 1 comprising eight distinct DNA strands, an additional DNA strand spanning 100 nts was designed within the DNA cube structure while maintaining its structural dimensions and membrane interfacing capabilities. This supplementary' strand was engineered to hybridize and establish connections with two edges of the DNA cube structure (FIG. 2B).

[0142] To bolster the design against undesired hybridization with pre-existing strands, IDT OligoAnalyzer was employed. A comprehensive assessment of various parameters was performed, including hairpin formation, self-dimerization, hetero-dimerization, strand lengths, GC contents, and buffer conditions. Following these evaluations and guided by free energy calculations, iterative refinements and adjustments were made.Example 3Assembly of DNA Cube Nanostructure

[0143] DNA structure was annealed with ProFlex PCR system (Thermo Fischer Scientific Inc., Waltham, MA. USA). Equimolar amount of four DNA cube strands (50 pmole each) was mixed in 50 pl of IxTAMg buffer (45 mM tris(hydroxymethyl)aminomethane, 20 mM acetic acid and 12.5 mM MgC12 6H2O, pH ~8.0 adjusted with glacial acetic acid) to the final DNA cube concentration of 1 pM. After vortexing for 60 seconds, the DNA nanostructures w ere annealed by heating the solution to 95 °C for 5 minutes, then cooled to 4 °C using a linear cooling ramp.

[0144] Subsequently, four cholesterol-modified DNA strands, each at a concentration of 100 pmole, w ere added in a 2X molar excess at a temperature of 20 °C overnight. Upon completion of the annealing procedure, resulting in a nanocube of the structure depicted in FIG. 2A, the sample was maintained in a solution state at 4 °C for subsequent use.70808-02

[0145] Dynamic Light Scatering (DLS) analysis was conducted to evaluate the assembly characteristics and uniformity of DNA cages incorporating these various cholesterol motifs. The analysis revealed consistent assembly and minimal aggregation. FIG. 4A provides the DLS analysis of a monomeric DNA nanocube assembled from components LI, L2, L3, L4, and L5. FIG. 4B presents the DLS analysis of a monomeric DNA nanocube constructed from components LI, L2, L3, L4, and L5, with the addition of L2Choll. FIG. 4C displays the DLS analysis of a monomeric DNA nanocube formed from components LI, L2, L3, L4, and L5, incorporating both L2Choll and L2Chol2. FIG. 4D illustrates the DLS analysis of a monomeric DNA nanocube assembled from components LI, L2, L3, and L4. with the inclusion of LICholl, LlChol2. and L4Choll. FIG. 4E demonstrates the DLS analysis of an aggregation formed by nanocube components LI, L2, L3, and L4, with the incorporation of LICholl, LlChol2, L4Choll, and L4Chol2.Example 4DNA Cube Nanostructure with Inner Strand

[0146] The DNA structure was annealed using the ProFlex PCR system (Thermo Fischer Scientific Inc., Waltham, MA, USA). An equimolar quantity of four DNA cube strands, each at 25 pmol, was combined with one inner DNA strand at 0.86 stoichiometric equivalents, amounting to 21.5 pmol. These components were mixed in a total volume of 50 pl of IxTAMg buffer (comprising 45 mM tris(hydroxymethyl)aminomethane, 20 mM acetic acid, and 12.5 mM MgC12 6H2O), with the pH adjusted to approximately 8.0 using glacial acetic acid, resulting in a final DNA cube concentration of 1 pM.

[0147] The mixture was subjected to vortexing for a duration of 60 seconds. This was followed by an annealing process, wherein the solution was initially heated to a temperature of 95 °C for a period of 5 minutes. Subsequently, the temperature was cooled to 4 °C using a linear cooling ramp 6 minutes per degree Celsius. Following the cooling process, four cholesterol-modified DNA strands, each at a concentration of 100 pmol, were introduced in a 2X molar excess at a temperature of 20 °C. Each internal strand of the nanopore contained five hairpin motifs, as depicted in FIG. 7B, with the three central motifs available for the incorporation of aptamer sequences.

[0148] Upon completion of the annealing procedure, resulting in a nanocube comprising an inner strand as shown in FIGS. 2B, 7A, and 7B, the sample was maintained in a solution state at 4 °C for subsequent use.

[0149] The DNA nanopores structure described herein was constructed utilizing the oligonucleotide components listed in Table 1 and is depicted in the accompanying figures. FIGS.70808-023A-3F illustrate atomic force microscope images of five distinct cages, demonstrating consistent assembly and uniformity across the various embodiments. The images provide visual confirmation of the structural integrity and reproducibility of the DNA nanopores, indicating the precision of the assembly process and the stability of the resulting structures.Example 5DNA Nanocube Interaction with Cells

[0150] The interaction of the DNA nanopores with both prokaryotic and eukaryotic cells was evaluated using a series of experimental protocols. The DNA nanopores were labeled with Cy3 and cholesterol to facilitate visualization. FIGS. 5A-5C provide images demonstrating these interactions with various cell types.

[0151] To assess interaction with prokaryotic cells, specifically Lactobacillus crispatus (a grampositive human commensal), a culture of the bacteria was prepared in a suitable growth medium. The DNA nanopores were then introduced to the bacterial culture at a concentration of approximately 10 pg / mL. After incubation at 37 °C for 1 hour, the cells were washed with phosphate-buffered saline (PBS) to remove unbound nanopores. FIG. 5A illustrates the interaction of the DNA nanopores with the prokaryotic cells, as evidenced by fluorescence microscopy.

[0152] For eukaryotic cell interaction, the U87MG brain cancer cell line was cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). The DNA nanopores were added to the cell culture at a concentration of approximately 10 pg / mL. Following a 2-hour incubation at 37 °C in a humidified atmosphere with 5% CO2, the cells were washed with PBS. FIG. 5B shows a photograph and magnified insert of the spontaneous interaction with the U87MG cells, captured using fluorescence microscopy.

[0153] Similarly, the interaction with eukaryotic 293TN producer cell lines was assessed. The 293TN cells were cultured under standard conditions in DMEM with 10% FBS. The DNA nanopores were introduced at a concentration of approximately 10 pg / mL and incubated for 2 hours at 37 °C with 5% CO2. Post-incubation, the cells were washed with PBS to remove any unbound nanopores. FIG. 5C presents a photograph and magnified insert, demonstrating the interaction of the DNA nanopores with the 293TN cells.

[0154] Each figure provides visual evidence of the binding and interaction characteristics of the DNA nanopores with the respective cell types, highlighting their potential for cellular targeting applications.70808-02Example 6 Biomaterial Transport into U87 Brain Cancer Cells

[0155] Flow cytometry analysis was utilized to assess the transport of biomolecules into U87 brain cancer cells, facilitated by DNA nanostructures. Initially, U87 brain cancer cells were cultured under conditions optimized to maintain cell viability and promote proliferation. A control group was maintained without the introduction of DNA nanostructures (FIGS. 6A, 6E, and 61), while three experimental groups were established as follows: (1) a DNA nanopore with a pore size of approximately 0.8 nm (FIGS. 6B, 6F, and 6J), (2) a DNA cage with a pore size of approximately 7 nm, as described in Example 3 (FIGS. 6C, 6G, and 6K), and (3) a DNA cage incorporating an additional central strand, as detailed in Example 4 (FIGS. 6D, 6H, and 6L). The experimental setup was designed to evaluate the efficacy of each DNA nanostructure in facilitating biomolecule transport, with flow cytometry7providing quantitative data on the uptake and distribution of biomolecules within the U87 cells.

[0156] The biomolecules analyzed included Cy5, GFP, and FAP-FITC, each conjugated to the DNA nanostructures. The transportation process was monitored using flow cytometry7, enabling the quantification of biomolecule uptake by the cells. Representative confocal images were captured to visualize the DNA cage structure associated with each biomolecule. Specifically, Cy5 transportation was observed with confocal imaging of the DNA Cube structure (FIGS. 6A-6D), followed by GFP (FIGS. 6E-6H) and FAP-FITC (FIGS. 6I-6L) transportation, each with corresponding confocal images.

[0157] The transportation yield of the biomolecules was plotted as a function of the molecular size of the DNA nanostructures, as depicted in FIGS. 6M and 6N.Example 7Membrane Localization of Cy3-labeled DNA Nanostructures

[0158] To evaluate the localization of the DNA nanostructures on the cell membrane, U87MG brain cancer cells were incubated with 50 nM Cy3-labeled DNA nanostructures at 4 °C for a duration of 40 minutes. Subsequent to incubation, the nuclei were stained using Hoechst dye, which emits a blue fluorescence (labelled B in the Figures), and the cell membranes were stained with CellMask, which emits a deep red fluorescence (labelled R in the Figures).

[0159] Fluorescence intensity profiles were obtained by measuring the fluorescence along an arbitrary line drawn across each analyzed cell, indicated by a line in the images on the left. The representative fluorescence images illustrate the following conditions: cells incubated: (1) in the absence of DNA structures (FIG. 8A), (2) with DNA nanocubes lacking cholesterol (FIG. 8B), (3) with DNA nanocubes incorporating cholesterol (FIG. 8C), (4) with DNA nanocubes combined70808-02 with L5 lacking cholesterol (FIG. 8D), and (5) with DNA nanocubes combined with L5 incorporating cholesterol (FIG. 8E).Example 8Evaluation of DNA Nanostructure Membrane Interfacing Capability in U87MG Brain Cancer Cells Utilizing Cholesterol Tagging

[0160] The interaction of the DNA nanostructures described herein with a cell membrane was assessed, including the impact of cholesterol modification on enhancing or altering this interaction.

[0161] U87MG cells w ere incubated with various test groups of DNA nanocubes, comprising: (1) DNA nanocubes without cholesterol; (2) DNA nanocubes with cholesterol; (3) DNA nanocubes with L5 (no cholesterol tag); and (4) DNA nanocubes with L5 and cholesterol. The fluorescence intensities of U87MG cells incubated with each set of DNA nanocubes were quantitatively measured. FIG. 9A illustrates DNA nanocubes with and without cholesterol, and FIG. 9B illustrates DNA nanocubes with L5, both with and without cholesterol tags.

[0162] Subsequently, U87MG cells were incubated with 50 nM DNA nanostructures at 4 °C for 40 minutes, followed by cell membrane staining with CellMask. Live-cell imaging was performed every 10 minutes for up to 60 minutes. FIG. 10 provides representative fluorescence images up to 30 minutes, showing DNA Cube with cholesterol (left) and DNA Cube + L5 with cholesterol (right). To quantify internalization, the fluorescence intensity of internalized DNA nanostructures per cell (n = 5) was measured from 0 to 60 minutes and normalized.Example 9Biocompatibility of DNA Nanostructures

[0163] A cell viability7analysis of U87MG brain cancer cells 4 °C was conducted to assess the impact of DNA nanostructures at thereon. FIG. 11A illustrates the control group, which demonstrates changes in cell viability over the incubation period without exposure to DNA nanostructures. In contrast, FIGS. 11B-11D depict the cell viability response following treatment with three distinct DNA nanostructures over a 40-minute period at 4 °C. Specifically, FIG. 11B shows the response to a four-helix DNA nanostructure, FIG. 11C to a DNA nanocube hereof, and FIG. 1 ID to a DNA nanocube with an inner strand. A total of 10,000 cells were incubated under these conditions, with each experiment conducted in triplicate (n = 3).

[0164] Further analysis was performed to evaluate the cell viability of U87MG brain cancer cells with varying incubation times and concentrations of three distinct DNA nanostructures. The DNA nanostructures tested include four-helix DNA nanostructures (FIG. 12A and FIG. 12D), DNA70808-02 cube nanostructures (FIG. 12B and FIG. 12E), and DNA cube nanostructures with an inner DNA strand (FIG. 12C and FIG. 12F). In FIGS. 12A-12C, cells were treated with 50 nM of DNA nanostructures, while in FIGS. 12D-12F, the concentration was increased to 100 nM. All incubations were performed at 4 °C, with each condition tested in triplicate (n = 3).

[0165] Additionally, the cell viability analysis was extended to include varying incubation times of the three DNA nanostructures, as shown in FIGS. 13A-13C. The structures tested were four- helix DNA nanostructures (FIG. 13A), DNA cube nanostructures (FIG. 13B), and DNA cube nanostructures with an inner DNA strand (FIG. 13C). In these experiments, 10.000 cells per well were treated with 50 nM of DNA nanostructures. Following an initial 40-minute incubation at 4 °C, excess DNA nanostructures were removed by washing, and the cells were subsequently incubated at 37 °C. Each experiment was conducted in triplicate (n = 3).Example 10Molecular and Protein Transportation Aia DNA Nanopores

[0166] Molecular and protein transport analysis of DNA nanostructures in U87MG brain cancer cells was conducted using flow7cytometry and confocal microscopy. The study evaluated the transport efficiency of three cholesterol-tagged DNA nanostructures: a Four-helix DNA nanostructure (FIG. 14A), a DNA Cube nanostructure (FIG. 14B), and a DNA Cube with an inner DNA strand (FIG. 14C). These structures were incubated with 100,000 U87MG brain cancer cells. Initial incubation occurred at 4 °C for 40 minutes to facilitate membrane interaction.

[0167] Subsequent incubations were performed with Cy5, GFP, and FAP-FITC under conditions optimized for molecular transport efficiency assessment.

[0168] Flow cytometry data indicated fluorescence intensity of Cy5 (5 ng) after 5 minutes at 37 °C (FIG. 15A), GFP (1 pg) after 20 minutes at 37 °C (FIG. 15B), and FAP-FITC (10 pg) after 20 minutes at 37 °C (FIG. 15C). For small molecule transport analysis, confocal microscopy was employed to visualize the three DNA nanostructures incubated with U87MG cells. FIG. 15A shows the control without DNA structures. Following the initial 40-minute incubation at 4 °C, a 5-minute incubation with Cy5 (5 ng) was conducted. Yellow indicates Cy3 fluorescence of the DNA nanostructures, while red represents Cy5 fluorescence.

[0169] Small-sized protein transport was analyzed using confocal microscopy, with images of the DNA nanostructures shown in FIGS. 16B-16D. FIG. 16A serves as the control. After the initial incubation, a 20-minute incubation with GFP (1 pg) was performed. Yellow denotes Cy3 fluorescence, and green indicates GFP fluorescence.

[0170] Large-sized protein transport analysis utilized confocal microscopy, with images of the DNA nanostructures presented in FIGS. 17B-17D. FIG. 17A is the control. Following the initial70808-02 incubation, a 20-minute incubation with FAP-FITC (10 pg) was conducted. Yellow represents Cy3 fluorescence, and green indicates FAP-FITC fluorescence.Example 11Applications of Protein Transportation Via DNA Nanopores

[0171] Applications of protein transport through DNA nanopores include the use of DNA nanostructures to assist in the differentiation of stem cells. The DNA nanopores were evaluated in relation to protein transport involving bone morphogenetic protein 4 (BMP -4) to facilitate the differentiation of human stem cells.

[0172] Confocal microscopy images were obtained of H9 human embryonic stem cells (hESCs), numbering 100,000, which were exposed to 50 nM concentrations of two distinct DNA nanostructures in conjunction with BMP-4. The exposure occurred at a temperature of 4 °C for a duration of 40 minutes, followed by a 48-hour incubation period to promote stem cell differentiation. The DNA nanostructures were labeled with Cy3, which emits a red fluorescence, while the cell nuclei were stained with Hoechst, appearing blue. The differentiation of stem cells was visualized using the Brachyury marker, which fluoresced green.

[0173] FIG. 18A illustrates images of a control group that was not treated with DNA nanostructures. In contrast, FIG. 18B presents images of cells treated with the DNA nanopore, and FIG. 18C depicts cells treated with the DNA nanopore containing an inner DNA strand.

[0174] Further analysis was conducted utilizing flow cytometry to assess the yield of stem cell differentiation under various incubation conditions, specifically in the presence of 50 nM DNA nanostructures. These nanostructures include the DNA nanopores described herein and DNA nanopores containing an inner DNA strand. FIG. 19A presents images of a test set where DNA nanostructures were incubated with BMP-4 at a temperature of 37 °C to promote cell differentiation. FIG. 19B depicts the scenario in which DNA nanostructures were incubated with BMP-4 at 4 °C for a duration of 40 minutes, followed by cell differentiation without the removal of excess BMP -4 and DNA nanostructures. In contrast. FIG. 19C illustrates the condition where DNA nanostructures were incubated with BMP-4 at 4 °C for 40 minutes, after which the BMP -4 and DNA nanostructures were washed out prior to initiating cell differentiation. The H9 hESCs, totaling 100,000 cells, were subjected to a 48-hour incubation period, and differentiation was evaluated using the Brachyury marker, which was detected in the FITC channel.

Claims

70808-02CLAIMS1. A nanopore comprising a plurality of nucleic acid strands that self-assemble into a three-dimensional polyhedral structure defining an internal cavity.

2. The nanopore of claim 1, wherein the three-dimensional polyhedral structure is selected from the group consisting of a tetrahedron, cube, octahedron, dodecahedron, and icosahedron.

3. The nanopore of claim 1. further comprising one or more internal oligonucleotide strand positioned at least partially within the internal cavity and fully or partially hybridized to one or more of the plurality of nucleic acid strands of the nanopore.

4. The nanopore of claim 1, wherein the internal cavity has a diameter of between about 0.5 nm and about 200 nm.

5. The nanopore of claim 1, wherein each of the nucleic acid strands comprises between about 20 nucleotides (nts) to about 100 nts.

6. The nanopore of claim 5, wherein one or more of the nucleic acid strands is linked to a cholesterol moiety.

7. The nanopore of claim 1, wherein the plurality of nucleic acid strands comprises a first oligonucleotide, a second oligonucleotide, a third oligonucleotide, and a fourth oligonucleotide, wherein each of the first oligonucleotide and third oligonucleotide is partially hybridized to the second and fourth oligonucleotide such that the oligonucleotides form a foursided structure defining the internal cavity.

8. The nanopore of claim 1, wherein one or more of the plurality of nucleic acid strands has at least 68% sequence identity to SEQ ID NO: 1, at least 68% sequence identity to SEQ ID NO: 2, at least 68% sequence identity to SEQ ID NO: 4, and / or at least 68% sequence identity to SEQ ID NO: 5.

9. The nanopore of claim 3, wherein the one or more internal oligonucleotide strand has at least 68% sequence identity7to SEQ ID NO: 6.70808-0210. The nanopore of claim 3 or 9, wherein the one or more internal oligonucleotide strand promotes formation of a secondary structure which is, optionally, one or more loops or hairpin motifs.

11. The nanopore of claim 3 or 9. wherein the one or more internal oligonucleotide strand comprises five hairpin motifs, with the three most-central hairpin motifs available for functionalization.

12. The nanopore of claim 1, wherein at least one of the plurality of nucleotide strands is functionalized with one or more ligands.

13. The nanopore of claim 3, wherein the one or more internal oligonucleotide strand is functionalized with one or more ligands.

14. The nanopore of claim 12 or claim 13, wherein the one or more ligands is / are each independently selected from the group consisting of a targeting ligand, a fluorescent marker, and a therapeutic agent.

15. The nanopore of claim 7, wherein at least one of the plurality of nucleotide strands further comprises a cholesterol motif.

16. The nanopore of claim 15. wherein the first oligonucleotide further comprises a nucleic acid sequence that has at least 68% sequence identity to SEQ ID NO: 7, the second oligonucleotide further comprises a nucleic acid sequence that has at least 68% sequence identity to SEQ ID NO: 8, the third oligonucleotide further comprises a nucleic acid sequence that has at least 68% sequence identity to SEQ ID NO: 9, and / or the fourth oligonucleotide further comprises a nucleic acid sequence that has at least 68% sequence identity to SEQ ID NO: 10.

17. The nanopore of claim 1, wherein the nanopore is configured for spontaneous interaction with a prokaryotic or eukaryotic cell membrane.

18. A pharmaceutical composition comprising a nanostructure of any one of claims 1- 17 and a pharmaceutically acceptable carrier.70808-0219. A method for creating a transmembrane channel through a target membrane, the method comprising contacting the target membrane with the nanopore of any one of claims 1-17 or the pharmaceutical composition of claim 18.

20. The method of claim 19. wherein the target membrane is a cell membrane and / or a lipid membrane.

21. The method of claim 20, wherein the cell membrane is a prokary otic cell membrane or a eukaryotic cell membrane.

22. The method of claim 19, wherein the nanopore facilitates uptake of a nucleic acid, a protein, peptide, and / or a small-molecule therapeutic across the target membrane.

23. The method of claim 19, wherein the nanopore forms a synthetic pore in the target membrane selective for one or more classes of molecules.

24. The method of claim 23, wherein the one or more classes of molecules is selected from the group consisting of ions, proteins, nucleases, molecules, chemical compounds, oligonucleotides, enzymes and signal molecules.

25. The method of claim 19, wherein one or more surfaces of the transmembrane channel and / or the one or more internal oligonucleotide strand of the nanopore is / are functionalized.

26. A method of constructing a nanopore structure of any one of claims 1-17 or the pharmaceutical composition of claim 18, the method comprising combining, under suitable conditions, an equal proportion of a first oligonucleotide, a second oligonucleotide, a third oligonucleotide, and a fourth oligonucleotide, wherein the first oligonucleotide, second oligonucleotide, third oligonucleotide, and fourth oligonucleotide self-assemble to define an internal cavity therebetween in communication with two open ends.

27. The method of claim 26, wherein combining under suitable conditions further comprises combining an equal portion of one or more internal oligonucleotides, wherein the one or more internal oligonucleotides self-assemble, are positioned, at least partially, within the70808-02 internal cavity of the nanopore, and at least partially hybridize to one or more of the first, second, third, or fourth oligonucleotides.

28. The method of claim 26 or 27, wherein the first oligonucleotide partially hybridizes to the second and fourth oligonucleotides, and the third oligonucleotide partially hybridizes to the second and fourth oligonucleotides such that the four oligonucleotides form a four-sided, open nanopore structure.

29. The method of claim 26, further comprising functionalizing one or more of the first, second, third, fourth oligonucleotides, or the one or more internal oligonucleotide strands to facilitate selective transfer of nucleic acid, a protein, peptide, and / or small molecule through the two open ends and internal cavity7of the nanopore.

30. A method for transporting molecules into a cell comprising: contacting a target cell with a nanopore of any one of claims 1-17 or the pharmaceutical composition of claim 18, wherein the nanopore inserts into a cell membrane and creates a transmembrane channel between an extracellular environment and an intracellular environment; and administering one or more molecules to the extracellular environment; wherein the one or more molecules are transported into the intercellular environment by selective passage through the cell membrane mediated by the nanopore.

31. The method of claim 30, wherein the nanopore comprises one or more internal oligonucleotide strands functionalized to modulate transport through the internal cavity7formed by the nanopore.

32. A method for modulating stem cell function, the method comprising contacting a population of stem cells with a nanopore of any one of claims 1-17 or the pharmaceutical composition of claim 18, wherein the nanopore stimulates proliferation and / or differentiation of the stem cells.

33. The method of claim 32, wherein contacting the nanopore modifies the sensitivity' of the stem cells to one or more external stimuli.70808-0234. The method of claim 32, wherein the stem cells comprise embryonic stem cells, induced pluripotent stem cells, or adult stem cells.

35. The method of claim 32, wherein the nanopore further comprises one or more functional groups, ligands, or biomolecules that facilitate interaction with a stem cell receptor or signaling pathway.

Images