Three-mutation alzheimer's disease mouse model, construction method, and use thereof

Abstract

Provided are a three-mutation Alzheimer's disease mouse model, a construction method, and use thereof. The construction method comprises: (1) preparing a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1, and a transgenic fragment of a third exogenous gene hMAPT; (2) inserting the three transgenic fragments into a genome of a fertilized ovum of a mouse; (3) transplanting the fertilized ovum into a pseudo-pregnant female mouse body, and screening to obtain an F0-generation mouse of which the three exogenous genes are all identified to be positive; and (4) acquiring, on the basis of the F0-generation mouse, a 3-FAD homozygous positive mouse of an Alzheimer's disease mouse model.

Description

A three-mutation Alzheimer's disease mouse model, construction method and application thereof CROSS-REFERENCE

[0001] This application claims priority to Chinese Patent Application No. 202411313775.4, filed on September 20, 2024, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0002] The present specification relates to the field of genetic engineering, in particular to a three-mutation Alzheimer's disease mouse model, construction method and application thereof. BACKGROUND

[0003] Alzheimer's disease (AD) is a common central nervous system degenerative disease in the elderly or pre-elderly, and is the main type of dementia, accounting for 60-70%. Its typical manifestations are early memory loss and cognitive impairment, followed by anxiety, delusion and other behavioral and mental symptoms. The main pathological features of AD include intracerebral amyloid plaques, neurofibrillary tangles (NFTs) and neurodegeneration in the hippocampus and cortex. Beta amyloid protein (Aβ) is produced by amyloid precursor protein (APP) cleaved by beta and gamma secretase, and Aβ42 is more toxic due to its high aggregation. The accumulation of amyloid plaques formed by Aβ42 will cause neuronal damage and death through various mechanisms, and exacerbate neurodegeneration. Tau protein is abnormally phosphorylated in AD, dissociates from microtubules and aggregates to form NFTs, which destroy the structure and function of neurons and lead to severe cognitive impairment.

[0004] To study the pathological mechanisms and develop therapies for AD, scientists have constructed various transgenic mouse models by introducing mutations in AD-related genes (such as APP, PS1 and Tau genes) to simulate pathological features. A common strategy is to mutate the human APP gene to simulate Aβ accumulation, and mice carrying mutations in human APP and PS1 genes can develop amyloid plaques and cognitive impairment at an early age. Double transgenic mice show memory and synaptic transmission impairment at 6 months of age, making them ideal models for studying early pathology, but they do not reproduce Tau protein aggregation in human patients well. Although there are models that edit three mutant genes, mice develop Aβ pathology at 6 months of age and form NFTs at 12 months of age, but the behavioral and pathological changes are not completely consistent with those of clinical patients, and can only be used to study specific relationships. In addition, there are non-transgenic models that induce AD-like pathological changes by injecting toxins or natural aging. However, to date, although various AD-related mouse models have been constructed, none of them can match the disease progression changes in human patients.

[0005] Therefore, it is desirable to construct a mouse model that can match the disease progression changes in human Alzheimer's disease patients. SUMMARY

[0006] In order to provide a mouse model capable of matching the disease progression of human Alzheimer's disease patients, to provide a more accurate and effective way for the research and treatment of Alzheimer's disease, one or more embodiments of the specification provide a method for constructing a three-mutation Alzheimer's disease mouse model, the method comprising: (1) preparing a transgenic fragment of a first foreign gene hAPP, a transgenic fragment of a second foreign gene hPSEN1 and a transgenic fragment of a third foreign gene hMAPT; (2) inserting the three transgenic fragments into the genome of a mouse zygote; (3) transplanting the zygote into a pseudopregnant female mouse, and screening to obtain F0 generation mice with positive identification of the three foreign genes; (4) based on the F0 generation mice, obtaining 3-FAD homozygous positive Alzheimer's disease mouse models.

[0007] The transgenic fragment of the first foreign gene hAPP carries a Swedish mutation; the transgenic fragment of the second foreign gene hPSEN1 carries a hPSEN1 M146V mutation; and the transgenic fragment of the third foreign gene hMAPT carries a hMAPT P243L mutation.

[0008] One or more embodiments of the specification provide an application of a three-mutation Alzheimer's disease mouse model in researching the pathological mechanism of Alzheimer's disease or screening drugs for treating Alzheimer's disease, the genome of the mouse model comprising a transgenic fragment of a first foreign gene hAPP, a transgenic fragment of a second foreign gene hPSEN1 and a transgenic fragment of a third foreign gene hMAPT; wherein the transgenic fragment of the first foreign gene hAPP carries a Swedish mutation; the transgenic fragment of the second foreign gene hPSEN1 carries a hPSEN1 M146V mutation; and the transgenic fragment of the third foreign gene hMAPT carries a hMAPT P243L mutation.

[0009] One or more embodiments of the specification provide a three-mutation Alzheimer's disease mouse model, the genome of the mouse model comprising a transgenic fragment of a first foreign gene hAPP, a transgenic fragment of a second foreign gene hPSEN1 and a transgenic fragment of a third foreign gene hMAPT; wherein the transgenic fragment of the first foreign gene hAPP carries a Swedish mutation; the transgenic fragment of the second foreign gene hPSEN1 carries a hPSEN1 M146V mutation; and the transgenic fragment of the third foreign gene hMAPT carries a hMAPT P243L mutation. BRIEF DESCRIPTION OF DRAWINGS

[0010] The specification will be further described in the form of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are not limiting, and in these embodiments, the same numbers represent the same structures, wherein:

[0011] Figure 1 is a graph showing the detection results of blood test indicators of Alzheimer's clinical early stage in the blood of 3-FAD mice according to some embodiments of the present specification;

[0012] Figure 2 is a graph showing the detection results of Aβ deposition in the brain regions of 2-month-old 3-FAD mice according to some embodiments of the present specification;

[0013] Figure 3 is a graph showing the detection results of Aβ deposition in the brain regions of 3-FAD mice showing aggregation and plaque formation as the disease progresses according to some embodiments of the present specification;

[0014] Figure 4 is a graph showing the detection results of p-Tau181 in the brain regions of 1-month-old 3-FAD mice according to some embodiments of the present specification;

[0015] Figure 5 is a graph showing the detection results of p-Tau217 in the brain regions of 2-month-old 3-FAD mice according to some embodiments of the present specification;

[0016] Figure 6 is a graph showing the detection results of p-Tau(Thr231) in the brain regions of 2-month-old 3-FAD mice according to some embodiments of the present specification;

[0017] Figure 7 is a graph showing the detection results of p-Tau(Ser202, Thr205) in the brain regions of 3-month-old 3-FAD mice according to some embodiments of the present specification;

[0018] Figure 8 is a graph showing the detection results of p-Tau(Ser396) in the brain regions of 3-month-old 3-FAD mice according to some embodiments of the present specification;

[0019] Figure 9 is a graph showing the detection results of p-Tau181 in the brain regions of 3-FAD mice as the disease progresses according to some embodiments of the present specification;

[0020] Figure 10 is a graph showing the detection results of p-Tau(Ser202, Thr205) in the brain regions of 3-FAD mice as the disease progresses according to some embodiments of the present specification;

[0021] Figure 11 is a graph showing the experimental results of the Morris water maze experiment on 3-month-old 3-FAD mice according to some embodiments of the present specification;

[0022] Figure 12 is a graph showing the detection results of the blood of mice after administration according to some embodiments of the present specification;

[0023] Figure 13 is a graph showing the detection results of the brain regions of mice after administration according to some embodiments of the present specification. DETAILED DESCRIPTION

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present specification, the drawings needed to be used in the embodiment description will be briefly introduced as follows. Obviously, the drawings in the following description are only some examples or embodiments of the present specification, and for those skilled in the art, the present specification can also be applied to other similar scenarios without creative labor on the basis of these drawings. Unless the context clearly indicates otherwise or otherwise stated, the same reference numbers in the drawings represent the same structures or operations.

[0025] As shown in the specification and claims, unless the context clearly indicates otherwise or otherwise stated, the words "one", "a", "an", and / or "the" do not specifically refer to the singular, but can also include the plural. Generally speaking, the terms "comprise" and "include" only indicate the inclusion of the steps and elements explicitly identified, and these steps and elements do not constitute an exclusive list, and the method or device can also include other steps or elements.

[0026] The one or more embodiments of the present specification provide a three-mutation Alzheimer's disease (3-FAD) mouse model, a construction method and an application. By means of gene editing, three transgenic fragments of exogenous genes (including hPSEN1 M146V mutation, hAPP Swedish mutation and hMAPT P243L mutation) are randomly inserted into the mouse genome. Under the regulation of the promoter neural-specific element, the three transgenic fragments of exogenous genes can be specifically expressed in the brain region of the mouse, so as to obtain a three-mutation Alzheimer's disease (3-FAD) mouse model which can be stably inherited and has a disease progression basically consistent with that of human patients.

[0027] The embodiments of the present specification provide a construction method of a three-mutation Alzheimer's disease (3-FAD) mouse model, which comprises the following steps:

[0028] (1) Preparing a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1 and a transgenic fragment of a third exogenous gene hMAPT.

[0029] The hAPP gene (human Amyloid Precursor Protein gene, i.e., human amyloid precursor protein gene) is a gene encoding amyloid precursor protein (Amyloid Precursor Protein, APP), located on the long arm of human chromosome 21 (21q21.3), and has important significance in the fields of biomedicine and neuroscience, especially in relation to Alzheimer's disease (Alzheimer's Disease, AD).

[0030] In some embodiments, the transgene fragment of the first exogenous gene hAPP carries a Swedish mutation. The Swedish mutation is a specific mutation of the hAPP gene, and is named “Swedish mutation” because it was first discovered in several families in Sweden. The mutation is closely related to early-onset familial Alzheimer's disease (FAD). The Swedish mutation involves two nucleotide changes in the coding region of the hAPP gene, specifically at amino acids 670 and 671 in the encoded amyloid precursor protein (APP).

[0031] In some embodiments, the transgene fragment of the first exogenous gene hAPP comprises a nucleotide sequence as set forth in SEQ ID NO: 1.

[0032] In some embodiments, the transgene fragment of the first exogenous gene hAPP comprises a hAPP 5’ UTR and a mutant hAPP CDS sequence, the mutant hAPP CDS sequence carrying a Swedish mutation. The mutant hAPP CDS sequence can be a protein coding region (Coding DNA Sequence, CDS) sequence of a mutant hAPP gene.

[0033] In some embodiments, the transgene fragment of the first exogenous gene hAPP further comprises a nucleotide sequence as set forth in SEQ ID NO: 2.

[0034] The hPSEN1 gene (human Presenilin-1 gene) is a gene encoding the Presenilin-1 protein (PS1), which is a catalytic subunit of γ-secretase responsible for processing amyloid precursor protein (APP) to generate Aβ. The hPSEN1 gene is located on the long arm of human chromosome 14 (14q24.3), and PSEN1 gene mutation is one of the main pathogenic factors of early-onset familial Alzheimer's disease (FAD).

[0035] In some embodiments, the transgene fragment of the second exogenous gene hPSEN1 carries a hPSEN1 M146V mutation.

[0036] As used herein, the “hPSEN1 M146V mutation” refers to the mutation of the 146th methionine M to valine V in the hPSEN1 protein transcribed and translated after the mutation of the hPSEN1 gene. The 146th methionine M is obtained based on the hPSEN1 protein sequence (GI: 15079861) or a homologous sequence thereof.

[0037] In some embodiments, the transgene fragment of the second exogenous gene hPSEN1 comprises a sequence as set forth in SEQ ID NO: 3.

[0038] In some embodiments, the transgene fragment of the second exogenous gene hPSEN1 comprises a mutant hPSEN1 CDS sequence, which carries a hPSEN1 M146V mutation. The mutant hPSEN1 CDS sequence can be a protein-coding region (CDS) sequence of a mutant hPSEN1 gene.

[0039] The MAPT gene encodes microtubule-associated protein Tau. Tau is a microtubule binding protein, and the Tau protein in cells is over-phosphorylated to reduce solubility, and the over-phosphorylated Tau competes with microtubulin to bind normal Tau and other microtubule-associated proteins, thereby losing the biological activity of promoting microtubule assembly, leading to microtubule disassembly and impaired axonal transport, thereby causing neuronal degeneration and neuronal apoptosis, and ultimately leading to the occurrence of AD. Mutations in the microtubule-associated protein Tau (MAPT) gene are a major factor leading to AD, cortical syndrome, and other Tau protein disease neurodegenerative diseases such as progressive supranuclear palsy (PSP) syndrome.

[0040] In some embodiments, the transgene fragment of the third exogenous gene hMAPT carries a hMAPT P243L mutation.

[0041] As used herein, the "hMAPT P243L mutation" refers to a mutation in the hMAPT gene that results in a proline P at position 243 in human microtubule-associated protein Tau (MAPT) being mutated to a leucine L. The proline P at position 243 is obtained based on the hMAPT protein sequence (GI: 8400711) or a homologous sequence thereof.

[0042] In some embodiments, the transgene fragment of the third exogenous gene hMAPT comprises a mutant hMAPT CDS sequence, which carries a hMAPT P243L mutation. The mutant hMAPT CDS sequence can be a protein-coding region (CDS) sequence of a mutant hMAPT gene.

[0043] In some embodiments, the transgene fragment of the third exogenous gene hMAPT comprises a nucleotide sequence as set forth in SEQ ID NO: 5.

[0044] In some embodiments, the transgene fragment of the first exogenous gene hPSEN1, the transgene fragment of the second exogenous gene hAPP, and the transgene fragment of the third exogenous gene hMAPT each comprises a Thyl promoter. The Thyl promoter can be a DNA regulatory sequence located upstream of the Thymus cell antigen 1 gene, which is capable of driving the expression of a downstream gene in a specific cell or tissue.

[0045] In some embodiments, the transgene fragment of the first exogenous gene hAPP comprises, in the following order from 5' to 3', the elements operably linked and arranged: a Thyl promoter, a hAPP 5' UTR, a mutant hAPP CDS sequence (carrying the Swedish mutation). The transgene fragment of the first exogenous gene hAPP further comprises a sequence as set forth in SEQ ID NO: 2.

[0046] In some embodiments, the transgene fragment of the second exogenous gene hPSEN1 comprises, in the following order from 5' to 3', the elements operably linked and arranged: a Thyl promoter, a mutant hPSEN1 CDS sequence (carrying the hPSEN1 M146V mutation). The transgene fragment of the second exogenous gene hPSEN1 further comprises a sequence as set forth in SEQ ID NO: 4.

[0047] In some embodiments, the transgene fragment of the third exogenous gene hMAPT comprises, in the following order from 5' to 3', the elements operably linked and arranged: a Thyl promoter, a mutant hMAPT CDS sequence (carrying the hMAPT P243L mutation). The transgene fragment of the third exogenous gene hMAPT further comprises a sequence as set forth in SEQ ID NO: 6.

[0048] The transgene fragments of the exogenous genes can be obtained in various ways. For example, the transgene fragments can be obtained directly by artificial in vitro synthesis. In some embodiments, the transgene fragments can be obtained by PCR amplification of a plasmid constructed, etc.

[0049] In some embodiments, preparing the transgene fragments comprises:

[0050] a. obtaining a Thyl promoter and PCR products of the first exogenous gene hAPP, the second exogenous gene hPSEN1, and the third exogenous gene hMAPT.

[0051] In some embodiments, primers are designed to obtain PCR products of the Thyl promoter, the hAPP CDS, the hPSEN1 CDS, and the hMAPT CDS by PCR, respectively.

[0052] b. The Thy1 promoter is linked to the PCR product of the first exogenous gene hAPP, the PCR product of the second exogenous gene hPSEN1, and the PCR product of the third exogenous gene hMAPT, respectively, and a backbone vector to form a recombinant vector, and the recombinant vector is transformed into a competent cell.

[0053] The backbone vector can be an artificially modified circular DNA molecule (such as a plasmid, etc.) for assembling the Thy1 promoter and the exogenous gene (hAPP or hPSEN1 or hMAPT) into a recombinant vector.

[0054] The competent cell can be a cell treated by chemical or electric shock, etc., which can absorb exogenous DNA (such as a recombinant vector, etc.).

[0055] In some embodiments, the recombinant vectors formed by the Thy1 promoter and the three fragments of the hAPP CDS, the hPSEN1 CDS, and the hMAPT CDS, respectively, can be transformed into the competent cell by heat shock, etc., and then cultured in an incubator at a preset temperature (such as 37°C) overnight to obtain multiple colonies.

[0056] As used herein, the "recombinant vector" refers to a tool for carrying, replicating, and expressing an exogenous gene fragment. In some embodiments, the vector of the recombinant vector includes but is not limited to at least one of a plasmid vector, a eukaryotic cell expression vector, a lentivirus vector, an adenovirus vector, or an adeno-associated virus vector, etc.

[0057] c. After transformation, PCR identification and sequencing are performed, and a correctly sequenced clone is selected as a transgenic vector.

[0058] In some embodiments, the transformed single colony is selected for PCR identification, and the positive clone (i.e., the single colony) is transferred to a test tube, the plasmid is extracted, and enzyme digestion identification is performed, and the correctly digested clone is sequenced, and a correctly sequenced clone is selected as a transgenic vector of the exogenous gene.

[0059] d. A transgenic fragment is prepared based on the transgenic vector.

[0060] In some embodiments, the transgenic vector constructed is prepared into a transgenic fragment of the exogenous gene by enzyme digestion, etc.

[0061] (2) Three transgenic fragments are inserted into the genome of a mouse zygote.

[0062] In some embodiments, the "insertion" of the three transgenic fragments into the mouse zygote refers to adding integration and / or integration replacement in the mouse genome. The insertion method can include random insertion or site-directed insertion, etc.

[0063] In some embodiments, the transgenic fragment is microinjected into a fertilized egg of a mouse, and randomly inserted into the mouse genome.

[0064] (3) The fertilized egg is transplanted into a pseudopregnant female mouse, and F0 generation mice in which the exogenous gene is identified as positive are screened. The F0 generation mice refer to the first generation of mice born after the fertilized egg is directly manipulated by transgenic technology.

[0065] In some embodiments, the identification is completed by a PCR reaction using a primer pair as shown in SEQ ID NO: 7 and SEQ ID NO: 8 and SEQ ID NO: 9; SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13; SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, respectively. Among them, SEQ ID NO: 7 and SEQ ID NO: 8 and SEQ ID NO: 9 are used to identify the first exogenous gene hAPP. SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13 are used to identify the second exogenous gene hPSEN1. SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17 are used to identify the third exogenous gene hMAPT.

[0066] (4) Based on the F0 generation mice, 3-FAD homozygous positive mouse models of Alzheimer's disease are obtained.

[0067] In some embodiments, the F0 generation mice are backcrossed with wild type (WT) mice until F0N5 generation mice are obtained, and 3-FAD homozygous positive mouse models of Alzheimer's disease are obtained by self-crossing the F0N5 generation mice. The F0N5 generation mice can be the offspring after backcrossing the F0 generation mice with the F0N5 generation mice for 5 times.

[0068] The homozygous positive mouse can be a mouse carrying a mutant gene in both alleles of the transgenic insertion site.

[0069] The embodiments of the present specification provide an application of a three-mutation Alzheimer's disease mouse model obtained by the construction method as described above in the research of the pathological mechanism of Alzheimer's disease.

[0070] The embodiments of the present specification provide an application of a three-mutation Alzheimer's disease mouse model obtained by the construction method as described above in the screening of drugs for treating Alzheimer's disease.

[0071] The embodiments of the present specification also provide a triple-mutation Alzheimer's disease mouse model, the genome of which comprises a transgene fragment from a first exogenous gene hAPP, a transgene fragment from a second exogenous gene hPSEN1, and a transgene fragment from a third exogenous gene hMAPT. The "mouse model" described herein corresponds to a homozygous positive mouse.

[0072] In some embodiments, the transgene fragment of the first exogenous gene hAPP carries a Swedish mutation.

[0073] In some embodiments, the transgene fragment of the first exogenous gene hAPP comprises a sequence as shown in SEQ ID NO: 1.

[0074] In some embodiments, the transgene fragment of the second exogenous gene hPSEN1 carries a hPSEN1 M146V mutation.

[0075] In some embodiments, the transgene fragment of the second exogenous gene hPSEN1 comprises a sequence as shown in SEQ ID NO: 3.

[0076] In some embodiments, the transgene fragment of the third exogenous gene hMAPT carries a hMAPT P243L mutation.

[0077] In some embodiments, the transgene fragment of the third exogenous gene hMAPT comprises a sequence as shown in SEQ ID NO: 5.

[0078] In some embodiments, the transgene fragment of the first exogenous gene hAPP, the transgene fragment of the second exogenous gene hPSEN1, and the transgene fragment of the third exogenous gene hMAPT each comprises a Thy1 promoter.

[0079] The embodiments of the present specification provide a triple-mutation Alzheimer's disease mouse model, in some embodiments, the triple-mutation Alzheimer's disease mouse model is prepared by the aforementioned construction method.

[0080] The embodiments of the present specification provide a triple-mutation Alzheimer's disease mouse model, which can be used to study the pathological mechanism of Alzheimer's disease or screen drugs for treating Alzheimer's disease.

[0081] The embodiments of the present specification also provide a method for studying the pathological mechanism of Alzheimer's disease using the aforementioned triple-mutation Alzheimer's disease mouse model, and a method for screening drugs for treating Alzheimer's disease using the aforementioned triple-mutation Alzheimer's disease mouse model.

[0082] In some embodiments, the method for studying the pathological mechanism of Alzheimer's disease comprises the following steps:

[0083] (1) randomly insert transgenic fragments of three exogenous genes into the mouse genome to prepare a triple-mutant Alzheimer's disease mouse model.

[0084] (2) on this basis, add specific markers or cross with other mice to conduct research related to disease mechanisms, regularly detect the biological characteristics of the mice, and collect tissue blocks of mouse tissue structures when Alzheimer's disease biological markers appear.

[0085] (3) evaluate the expression of DNA, RNA or protein in the tissue blocks collected in step (2).

[0086] (4) identify genes or proteins in the tissue blocks that are related to the hierarchical organization of diseased cells, disease processes or changes in biological characteristics.

[0087] In some embodiments, the specific marker can be a virus or a lentivirus, including an adeno-associated virus (AAV), a lentivirus, etc.

[0088] In some embodiments, the method of screening drugs for treating Alzheimer's disease comprises the following steps:

[0089] (1) randomly insert transgenic fragments of three exogenous genes into the mouse genome to prepare a triple-mutant Alzheimer's disease mouse model.

[0090] (2) administering the drug to be screened to the mouse model.

[0091] (3) regularly detecting biological characteristics related to Alzheimer's disease in the mouse model, the biological characteristics including but not limited to at least one of blood, cerebrospinal fluid, pathology and behavior indicators, etc., and the detection objects including but not limited to proteins, DNA or RNA, etc.

[0092] (4) screening drugs that inhibit the appearance of biological characteristics related to Alzheimer's disease in the mouse model.

[0093] The embodiments of the present specification provide a triple-mutant Alzheimer's disease mouse, the genome of the mouse comprising a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1 and a transgenic fragment of a third exogenous gene hMAPT.

[0094] In some embodiments, the transgenic fragment of the first exogenous gene hAPP carries a Swedish mutation. The transgenic fragment of the second exogenous gene hPSEN1 carries a hPSEN1 M146V mutation. The transgenic fragment of the third exogenous gene hMAPT carries a hMAPT P243L mutation.

[0095] In some embodiments, the triple mutant Alzheimer's disease mouse is prepared by the aforementioned construction method.

[0096] The embodiments of the present disclosure provide a method for researching the pathological mechanism of Alzheimer's disease or screening drugs for treating Alzheimer's disease using a triple mutant mouse, the method comprising: providing a triple mutant mouse as a test group, providing a homologous mouse as a control group, administering the same test reagent and placebo to the test group and the control group, and detecting target indicators of the test group and the control group. The pathological mechanism of Alzheimer's disease is researched or it is determined whether the test reagent can be used for treating Alzheimer's disease according to the detection results. For the description of researching the pathological mechanism of Alzheimer's disease or determining whether the test reagent can be used for treating Alzheimer's disease according to the detection results, see the following embodiments.

[0097] In some embodiments, the homologous mouse can include a C57BL / 6J2 mouse, etc.

[0098] In some embodiments, the target indicators include expression changes of multiple phosphorylated Tau protein sites and Aβ plaque tangles, etc. The target indicators also include memory loss and basic behavioral decline exhibited by Alzheimer's patients, etc.

[0099] The embodiments of the present disclosure have at least the following beneficial effects: the transgenic fragments of the first exogenous gene (containing the hAPP Swedish mutation), the second exogenous gene (containing the hPSEN1 M146V mutation), and the third exogenous gene (containing the hMAPT P243L mutation) are randomly inserted into the mouse genome by gene editing, and under the regulation of the Thy1 promoter neural-specific element, the transgenic fragments containing the hPSEN1 M146V mutation, the hAPP Swedish mutation, and the hMAPT P243L mutation are specifically expressed in the brain region of the mouse, thereby obtaining a triple mutant Alzheimer's disease (3-FAD) mouse model which can be stably inherited and has a completely consistent disease progression with human patients. The 3-FAD mouse is consistent with human patients in the disease progression of Alzheimer's disease, and presents blood markers first, then pathological characteristics, and finally behavioral characteristics, which provides a more precise and effective approach for the research and drug treatment of Alzheimer's disease.

[0100] The technical solutions of the present application will be described clearly and completely below in combination with the embodiments in the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Some of the contents in these embodiments can also be replaced or combined with the corresponding contents in other embodiments, so as to form new embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application. In the following embodiments, the experimental methods are conventional methods unless otherwise specified. In the following embodiments, the test materials are purchased from conventional biochemical reagent companies unless otherwise specified. In the following embodiments, the quantitative tests are set with three repeated experiments, and the average value is taken. It should be understood that the following embodiments are for better explaining the present application, and are not intended to limit the present application. Embodiment Embodiment 1: Construction of Alzheimer's disease mouse (3-FAD mouse) model

[0101] The construction of the 3-FAD mouse model includes the following steps:

[0102] (1) Preparation of the transgenic fragments of the first exogenous gene hAPP, the transgenic fragments of the second exogenous gene hPSEN1 and the transgenic fragments of the third exogenous gene hMAPT, specifically including:

[0103] a. Design primers to obtain the PCR products of the four fragments of Thy1 promoter, hAPP CDS, hPSEN1 CDS and hMAPT CDS by PCR respectively;

[0104] b. In vitro ligation of the Thy1 promoter with the three fragments of hAPP CDS, hPSEN1 CDS and hMAPT CDS and the backbone vector, transformation into competent cells by heat shock, and overnight culture on plates;

[0105] c. PCR identification of single colonies on the plates, transfer of the positive clones to test tubes, extraction of plasmids and enzyme digestion identification, submission of the clones with correct enzyme digestion for testing, and finally selection of the clones with correct sequencing as the three transgenic vectors of Thyl-APP, Thyl-PSEN1 and Thyl-MAPT respectively;

[0106] d. Preparation of the transgenic fragments of the exogenous genes by enzyme digestion of the constructed transgenic vectors.

[0107] The specific information of the three exogenous genes is as follows:

[0108] The first exogenous gene includes the Thy1 promoter, the hAPP 5'UTR and the mutant hAPP CDS sequence, and the mutant hAPP CDS sequence carries the Swedish mutation;

[0109] The second foreign gene comprises a Thy1 promoter and a mutant hPSEN1 CDS sequence carrying a hPSEN1 M146V mutation;

[0110] The third foreign gene comprises a Thy1 promoter and a mutant hMAPT CDS sequence carrying a hMAPT P243L mutation;

[0111] To keep the transcription and translation efficiency of hAPP, hPSEN1 and hMAPT stable, a Kozak (GCCGCCACC) sequence is added at the N-terminus of the three genes.

[0112] The three foreign gene sequences are specifically as follows:

[0113] The mutant hAPP CDS sequence of the transgenic fragment of the first foreign gene is shown in SEQ ID NO: 1 (wherein the bold font is the mutation site sequence, and the direction is 5'-3'):

[0114] It should be noted that the purpose of the mutation sequence (aatctg in bold) here is to cause the amino acid mutation at the corresponding position of the protein after transcription and translation. Therefore, sequences with the same transcription and translation results (such as aacctt, aacctc and aaccta, etc.) can be used to replace the mutation sequence here.

[0115] The sequence of the Thy1-hAPP transgenic fragment of the first foreign gene is shown in SEQ ID NO: 2 (italic for the Thy1 promoter sequence, underlined for the Kozak sequence, capital letters for the 5'UTR sequence, bold for the hAPP CDS sequence with mutation, wherein the bold and underlined is the mutation site sequence, and the direction is 5'-3'):

[0116]

[0117] The mutant hPSEN1 CDS sequence of the transgenic fragment of the second foreign gene is shown in SEQ ID NO: 3 (wherein the bold font is the mutation site sequence, and the direction is 5'-3'):

[0118] It should be noted that the purpose of the mutation sequence (gtg in bold) here is to cause the protein after transcription and translation to have amino acid mutation at the corresponding position. Therefore, sequences with the same transcription and translation results (such as gtt, gtc and gta, etc.) can be used instead of the mutation sequence here.

[0119] The sequence of the second foreign gene Thy1-hPSEN1 transgene fragment is shown in SEQ ID NO: 4 (the italicized part is the Thy1 promoter sequence, the underlined part is the Kozak sequence, and the bold part is the hPSEN1 CDS sequence with mutations, wherein the bold and underlined part is the mutation site sequence, and the direction is 5'-3'):

[0120]

[0121] The mutant hMAPT CDS sequence of the third foreign gene transgene fragment is shown in SEQ ID NO: 5 (wherein the bold font is the mutation site sequence, and the direction is 5'-3'):

[0122] It should be noted that the purpose of the mutation sequence (ctg in bold) here is to cause the protein after transcription and translation to have amino acid mutation at the corresponding position. Therefore, sequences with the same transcription and translation results (such as ctt, ctc and cta, etc.) can be used instead of the mutation sequence here.

[0123] The sequence of the third foreign gene Thy1-hMAPT transgene fragment is shown in SEQ ID NO: 6 (the italicized part is the Thy1 promoter sequence, the underlined part is the Kozak sequence, and the bold part is the hMAPT CDS sequence with mutations, wherein the bold and underlined part is the mutation site sequence, and the direction is 5'-3'):

[0124]

[0125] (2) Microinject the above three transgene fragments into fertilized eggs of mice, and randomly target insertion into the mouse genome.

[0126] (3) Implant the fertilized eggs into pseudopregnant female mice, and identify and screen to obtain three F0 generation mice with positive identification of the three foreign genes.

[0127] The primer pair sequence used for PCR identification is as follows:

[0128] Primer pairs for identifying the first exogenous gene hAPP: Primer pair 1: AAGTAATGAAGTCACCCAGCAGG (SEQ ID NO: 7) and CGTTTCTCCCCATGTTCTGAGA (SEQ ID NO: 8); Primer pair 2: GGGTTGACAAATATCAAGACGGAG (SEQ ID NO: 9) and CGTTTCTCCCCATGTTCTGAGA (SEQ ID NO: 8);

[0129] Primer pairs for identifying the second exogenous gene hPSEN1: Primer pair 1: AAGTAATGAAGTCACCCAGCAGG (SEQ ID NO: 10) and CGTACAGTATTGCTCAGGTGGTTG (SEQ ID NO: 11); Primer pair 2: AGGAACTTTCCAGCAGTATCCTC (SEQ ID NO: 12) and CGTTTCTCCCCATGTTCTGAGA (SEQ ID NO: 13);

[0130] Primer pairs for identifying the third exogenous gene hMAPT: Primer pair 1: AAGTAATGAAGTCACCCAGCAGG (SEQ ID NO: 14) and TGCCTGCTTCTTCAGCTTTCAG (SEQ ID NO: 15); Primer pair 2: CAAGTGTGGCTCATTAGGCAAC (SEQ ID NO: 16) and CGTTTCTCCCCATGTTCTGAGA (SEQ ID NO: 17);

[0131] Primer pairs for the internal reference gene: GTGCTGCTCACGCTGACCTTTAG (SEQ ID NO: 18) and CAGAGTGGAATACTGTTGCACC (SEQ ID NO: 19).

[0132] (4) Backcrossing the F0 generation mice with wild type (WT) mice until F0N5 generation mice are obtained, and obtaining Alzheimer's disease mouse model 3-FAD homozygous positive mice by self-crossing the F0N5 generation mice.

[0133] In some embodiments, the detection method of the present application is used to detect the blood biomarkers of Alzheimer's disease in the blood plasma of mice. The detection method is based on the automatic ultra-sensitive immunoassay-single molecule array. The detection objects include 3 one-month-old 3-FAD (1M) mice, 3 two-month-old 3-FAD (2M) mice and 3 six-month-old C57BL / 6J control mice (WT) as a control group. The ultra-sensitivity refers to the detection limit of the target molecule concentration at the level of fmol or amol. The automaticity refers to the full-process instrument. The C57BL / 6J control mice refer to the standardized inbred mice used as the benchmark control group, which have highly consistent genetic background, physiological characteristics and experimental responses.

[0134] Figure 1 is a graph showing the detection results of the blood biomarkers of Alzheimer's disease in the blood of 3-FAD mice according to some embodiments of the present application.

[0135] The experimental results are shown in Figure 1. In Figure 1, (a), (b), (c) represent the blood (plasma) detection results of Aβ42 / 40, p-Tau181 and p-Tau217 (unit: pg / mL), respectively. Aβ42 / 40 refers to the ratio of β-amyloid 42 and 40. p-Tau181 refers to the Tau protein phosphorylated at the 181st threonine. p-Tau217 refers to the Tau protein phosphorylated at the 217th threonine.

[0136] As can be seen from Figure 1, first, the three biomarkers of Aβ42 / 40, p-Tau181 and p-Tau217 are simultaneously detected in the blood of 1M 3-FAD mice. Currently, there is no model on the market that can simultaneously detect these three biomarkers from blood, and there is no case of detection at the age of one month.

[0137] Secondly, the Aβ42 / 40 ratio is up-regulated. Specifically, compared with the control group where no Aβ42 is detected, Aβ42 appears in 3-FAD mice at the age of one month, and with the passage of time, the Aβ42 / 40 ratio increases in 2M, but does not show a significant upward trend with the progress of the disease, which is consistent with the clinical progression of Alzheimer's disease.

[0138] Finally, the concentrations of p-Tau181 and p-Tau217 gradually increase with the passage of time, which is consistent with the detection indicators in clinical patients.

[0139] Therefore, it can be concluded that 3-FAD mice can successfully detect Aβ42 / 40, p-Tau181 and p-Tau217 in blood plasma at the same time, and the disease indicators presented are consistent with the standard of clinical blood early detection.

[0140] The hallmark neuropathological changes of Alzheimer's disease are diffuse neuroinflammatory plaques, marked by extracellular β-amyloid deposits (Aβ deposits), and neurofibrillary tangles (formed by intracellular aggregation of hyperphosphorylated Tau protein). Among them, Aβ aggregation occurs throughout the development of Alzheimer's disease.

[0141] Detection step: 6 3-FAD mice were taken, and euthanized at 2 months old. Then perfusion was performed to take the brain and fix and embed, and immunohistochemical staining was performed to detect the expression of Aβ plaques, and immunohistochemical (IHC) results were obtained. The same method was used to process 2-month-old C57BL / 6J2 mice (control group, WT) and 4-month-old and 6-month-old 3-FAD mice, and IHC results were obtained.

[0142] FIG. 2 is a diagram of detection results of Aβ deposition in brain regions of 2-month-old 3-FAD mice according to some embodiments of the present specification. FIG. 3 is a diagram of detection results of Aβ deposition in brain regions of 3-FAD mice showing aggregation and plaque formation with the development of the disease course according to some embodiments of the present specification.

[0143] As can be seen from the results: on the one hand, as shown in FIG. 2, compared with the mice in the control group, no Aβ deposition occurred, and in the cortex (Ctx) and subiculum (Sub) of 2-month-old 3-FAD mice, Aβ was detected and showed a scattered plaque state. And as shown in FIG. 3, in 1-month-old 3-FAD mice, Aβ deposition did not occur, while in 2-month-old 3-FAD mice, Aβ deposition was detected, and in combination with the aforementioned detection of Aβ42 in the blood of 1-month-old 3-FAD mice, this situation is consistent with the actual clinical manifestations. In addition, with the development of the disease course, Aβ deposition in the cortex and subiculum of 3-FAD mice showed aggregation and plaque formation, and Aβ plaque deposition occurred at 6 months old, while the control group at 6 months old did not show Aβ deposition. This shows that 3-FAD mice are consistent with the clinical manifestations of Alzheimer's disease in terms of gradual Aβ plaque deposition and expression of this pathological characteristic.

[0144] FIG. 4 is a diagram of detection results of p-Tau181 in brain regions of 1-month-old 3-FAD mice according to some embodiments of the present specification. FIG. 5 is a diagram of detection results of p-Tau217 in brain regions of 2-month-old 3-FAD mice according to some embodiments of the present specification.

[0145] Figure 6 is a graph showing the detection of p-Tau(Thr231) in brain regions of 2-month-old 3-FAD mice, according to some embodiments of the present specification. Figure 7 is a graph showing the detection of p-Tau(Ser202, Thr205) in brain regions of 3-month-old 3-FAD mice, according to some embodiments of the present specification.

[0146] Figure 8 is a graph showing the detection of p-Tau(Ser396) in brain regions of 3-month-old 3-FAD mice, according to some embodiments of the present specification. Figure 9 is a graph showing the detection of p-Tau181 in brain regions of 3-FAD mice over the course of the disease, according to some embodiments of the present specification. Figure 10 is a graph showing the detection of p-Tau(Ser202, Thr205) in brain regions of 3-FAD mice over the course of the disease, according to some embodiments of the present specification.

[0147] On the other hand, various hyperphosphorylated Tau proteins were detected in 3-FAD mice at different ages. As shown in Figure 4, p-Tau 181 was detected in the cortex (Ctx), hippocampus (Hip), and cerebellum (Cere) of 1-month-old 3-FAD mice. As shown in Figure 5, p-Tau 217 was detected in the cortex (Ctx), hippocampus (Hip), and cerebellum (Cere) of 2-month-old 3-FAD mice. As shown in Figure 6, p-Tau(Thr231) was also detected in 2-month-old 3-FAD mice. As shown in Figure 7, p-Tau(Ser202, Thr205) was detected in the cortex (Ctx), hippocampus (Hip), and cerebellum (Cere) of 3-month-old 3-FAD (3M) mice. As shown in Figure 8, p-Tau(Ser396) was detected in the cortex (Ctx), hippocampus (Hip), and cerebellum (Cere) of 3-month-old 3-FAD mice. As shown in Figure 9, p-Tau181 was phosphorylated more and more over time, and gradually formed a tangle morphology. As shown in Figure 10, p-Tau(Ser202, Thr205) appeared after the detection of Aβ deposition, and intensified over the course of the disease.

[0148] Thus, according to FIGS. 2-10, it can be concluded that in the brain regions of 3-FAD mice, p-Tau181, p-Tau217, p-Tau(Thr231), p-Tau(Ser202, Thr205) and p-Tau(Ser396) appear in time sequence, and in the brain of 3-FAD mice, p-Tau181 appears before Aβ deposition, p-Tau(Ser202, Thr205) appears after Aβ deposition, and intensifies with the progression of the disease. This development of pathological process or stage is consistent with the situation of clinical patients, and has the prospect of being used for studying the pathological mechanism of Alzheimer's disease and for screening drugs for treating Alzheimer's disease. p-Tau(Thr231) refers to Tau protein phosphorylated at Thr231. p-Tau(Ser202, Thr205) refers to Tau protein phosphorylated at Ser202 and Thr205. p-Tau(Ser396) refers to Tau protein phosphorylated at Ser396. Example 4 Behavioral verification

[0149] The loss of visuospatial memory is a typical behavioral characteristic in the development of Alzheimer's disease. The Morris water maze experiment is an experimental method widely used in the field of neuroscience, which mainly evaluates the spatial learning, memory ability and direction sense of experimental animals. The experiment is based on the instinctive response of animals to escape from the water environment, that is, by observing the time and path required for the animals to find the hidden platform under the water in the water maze, the spatial memory ability of the animals is evaluated.

[0150] FIG. 11 is a graph of experimental results of the Morris water maze experiment on 3-month-old 3-FAD mice, according to some embodiments of the present specification.

[0151] The Morris water maze experiment was performed on 3-month-old 3-FAD mice, and 3-month-old C57BL / 6J mice were used as a control group (WT). Specifically, in a circular pool as shown in FIG. 11(a), the pool was divided into four quadrants (Q1, Q2, Q3 and Q4), and the water temperature of the pool was maintained at 23±1℃. On the first day, a hidden fixed platform (10 cm in diameter) was placed in Q2 about 1 cm above the water surface, and 2 visual training was performed. On days 2-5, the hidden fixed platform was placed in Q2 submerged 1 cm below the water surface, and 4 training was performed each day. On the 6th day, the platform was removed from the maze, and the mice were allowed to swim freely for 60 seconds. The time and distance of each mouse crossing the effective area (hidden fixed platform), the time and distance of exploring in the target quadrant (the quadrant where the hidden fixed platform is located), and the number of entries were monitored and recorded.

[0152] As shown in (b) and (c) of FIG. 11, compared with the control group, the 3-FAD mice had no significant difference in swimming distance (unit: m) or swimming speed (unit: mm / s), indicating that the 3-FAD mice of 3M were consistent with the control group in terms of locomotor function, i.e., the motor function was not impaired. As shown in (d) and (e) of FIG. 11, compared with the control group, the 3-FAD mice had a significantly shortened residence time and a significantly reduced number of entries into the second quadrant (Probe qua) where the platform was located. In combination with the fact that the motor function was not impaired, it was indicated that the 3-FAD mice failed to remember the location of the platform, i.e., the memory ability was decreased. Meanwhile, compared with the control group, the 3-FAD mice took a significantly longer time to reach the platform after being placed in the pool, as shown in (f) of FIG. 11, and had a significantly smaller number of shuttling around the platform, as shown in (g) of FIG. 11. In combination with the fact that the motor function was not impaired, it was also indicated that the memory ability of the 3-FAD mice was decreased.

[0153] Therefore, it can be concluded that the motor function of the 3-FAD mice at the age of 3 months was not impaired, but the spatial memory ability decreased, which was consistent with the clinical symptoms. Moreover, compared with the pathological characteristics of Aβ deposition starting at the age of 2 months, the behavioral characteristics started at the age of 3 months, which was consistent with the clinical progression of Alzheimer's disease.

[0154] In summary, the 3-FAD mice can effectively simulate a mouse model of human Alzheimer's disease patients from clinical diagnostic markers, pathology to behavioral changes, which is of great significance for in-depth exploration of the pathogenesis of Alzheimer's disease, discovery of new therapeutic targets, and promotion of drug development.

[0155] The 3*FAD mice were treated with the drug Lecanemab, specifically, 4 1-month-old 3*FAD mice were given intraperitoneal injections of the drug, with a dosage of 12 mpk per mouse per time, once a week, for 4 consecutive weeks, which was recorded as the experimental group (3*FAD+Lecanemab). Meanwhile, two control groups were set up, one of which was a group of 3 6-month-old C57BL / 6J mice (WT) without drug administration, and the other was a group of 4 3*FAD mice without drug administration (3*FAD).

[0156] FIG. 12 is a graph showing the detection results of mouse blood after drug administration according to some embodiments of the present specification.

[0157] The contents of p*Tau181 and p*Tau217 in the blood of mice were detected after 4 weeks, and the results are shown in FIG. 12, wherein (a) and (b) represent the detection results of the contents of p*Tau181 and p*Tau217 in the blood, respectively. As can be seen from FIG. 12, the contents of p*Tau181 and p*Tau217 in the blood of 3*FAD mice are significantly higher than those in C57BL / 6J mice under the condition of no administration, but the contents of p*Tau181 and p*Tau217 in 3*FAD mice (3*FAD+Lecanemab) after administration are lower than those in 3*FAD mice (3*FAD) without administration, which is consistent with the trend of clinical AD patients. Moreover, the decreasing trend of p*Tau217 is more obvious than that of p*Tau181, which is also consistent with the detection results of patients treated by Lecanemab.

[0158] FIG. 13 is a detection result diagram of the brain region of mice after administration according to some embodiments of the present specification.

[0159] The present application also detects brain sections of the control group and the experimental group after 4 weeks of administration, and obtains the IHC results shown in FIG. 13. Compared with C57BL / 6J mice, there is obvious Aβ deposition in 3*FAD mice (3*FAD+Vehicle) without administration, while the Aβ deposition in 3*FAD mice (3*FAD+Lecanemab) after administration is slowed down, and the plaque area is smaller, which is consistent with the detection results of patients treated by Lecanemab, indicating that the 3*FAD mice of the present application can be used for drug screening of Alzheimer's disease.

[0160] The above detailed description has been described, and it is obvious that the above detailed description is only used as an example and does not limit the present specification. Although the present specification does not explicitly describe it, those skilled in the art can make various modifications, improvements and corrections to the present specification. Such modifications, improvements and corrections are suggested in the present specification, so such modifications, improvements and corrections still belong to the spirit and scope of the exemplary embodiments of the present specification.

[0161] Meanwhile, specific words are used in the present specification to describe the embodiments of the present specification. As “one embodiment”, “an embodiment”, and / or “some embodiments” means a certain feature, structure or characteristic related to at least one embodiment of the present specification. Therefore, it should be emphasized and noted that the “an embodiment” or “one embodiment” or “one alternative embodiment” mentioned in different positions in the present specification does not necessarily mean the same embodiment. In addition, certain features, structures or characteristics in one or more embodiments of the present specification can be properly combined.

[0162] For simplicity and to facilitate understanding of one or more embodiments, a description of an embodiment sometimes refers to a plurality of features in a single embodiment, drawing, or description of an embodiment. However, this method of disclosure is not to be interpreted as meaning that the claimed embodiment requires more features than are explicitly recited in the claims. In fact, claims that do not specifically claim a combination of features are intended to cover the various

[0163] Some embodiments use numerical values to describe components, quantities of attributes. It should be understood that such numerical values used in the description of embodiments are in some examples modified by the adjectives "about," "approximately," or "substantially." Unless otherwise stated, "about," "approximately," or "substantially" indicate that the described value allows for a ±20% variation. Accordingly, numerical parameters in the description and claims are approximations, and can vary depending upon the desired characteristics set forth in each instance. In some embodiments, numerical parameters are determined by the use of standard techniques for making such determinations, such as the standard techniques of rounding off log values to the nearest whole number, and the like. Although numerical ranges and parameters setting forth the broadest scope of embodiments herein are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, can contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0164] Each patent, patent application, patent publication, and other material, such as articles, books, specifications, publications, documents, and the like, referenced herein are hereby incorporated by reference in their entirety for the teachings relevant to the sentence and / or paragraph in which the reference is made. Discrepancies between applications history documents and the present specification, other than limitations on the scope of the claims, are excepted. It is specifically intended that the description, definitions, and / or terminology used in the incorporated material be governed by the disclosures in the present specification, which are only meant to be methods of illustration. In the event of a discrepancy between the incorporated material and the present disclosure, the present disclosure will control.

[0165] Finally, it should be understood that the embodiments described herein are merely exemplary of the principles of the embodiments described herein. Other variations having essentially the same structure and function but different values for components, and / or different materials and arrangements are intended to be covered by the claims. Thus, although the present embodiments have been described in detail with reference to the examples outlined above, alternative embodiments can be implemented and are within the scope of the present embodiments. Accordingly, the present embodiments are not limited to the above examples, but are intended to cover any and all alternatives resulting from combining features of the above examples in any manner.

Claims

The application relates to an application of a three-mutation Alzheimer's disease mouse model in research on pathological mechanisms of Alzheimer's disease or screening of drugs for treating Alzheimer's disease, characterized in that, The genome of the mouse model comprises a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1, and a transgenic fragment of a third exogenous gene hMAPT; The transgenic fragment of the first exogenous gene hAPP carries a Swedish mutation; the transgenic fragment of the second exogenous gene hPSEN1 carries a hPSEN1 M146V mutation; and the transgenic fragment of the third exogenous gene hMAPT carries a hMAPT P243L mutation. The use as claimed in claim 1, characterized in that The transgenic fragment of the first exogenous gene hAPP comprises a sequence as shown in SEQ ID NO:

1. The use as claimed in claim 1, characterized in that The transgenic fragment of the second exogenous gene hPSEN1 comprises a sequence as shown in SEQ ID NO:

3. Use according to claim 1, characterized in that The transgenic fragment of the third exogenous gene hMAPT comprises a sequence as shown in SEQ ID NO:

5. A method for constructing a three-mutation Alzheimer's disease mouse model, the method comprising: (1) preparing a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1, and a transgenic fragment of a third exogenous gene hMAPT; (2) inserting the transgenic fragment of the first exogenous gene hAPP, the transgenic fragment of the second exogenous gene hPSEN1, and the transgenic fragment of the third exogenous gene hMAPT into the genome of a mouse zygote; (3) transplanting the zygote into a pseudopregnant female mouse, and screening to obtain an F0 generation mouse in which all three exogenous genes are positive; (4) based on the F0 generation mouse, obtaining an Alzheimer's disease mouse model 3-FAD homozygous positive mouse; The transgenic fragment of the first exogenous gene hAPP carries a Swedish mutation; the transgenic fragment of the second exogenous gene hPSEN1 carries a hPSEN1 M146V mutation; and the transgenic fragment of the third exogenous gene hMAPT carries a hMAPT P243L mutation. The construction method as claimed in claim 5, wherein, Step (1) of preparing a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1, and a transgenic fragment of a third exogenous gene hMAPT comprises: a. obtaining a Thy1 promoter and PCR products of the first exogenous gene hAPP, the second exogenous gene hPSEN1, and the third exogenous gene hMAPT; b. connecting the Thy1 promoter with the PCR products of the first exogenous gene hAPP, the second exogenous gene hPSEN1, and the third exogenous gene hMAPT, respectively, and a backbone vector to form a recombination vector, and transforming the recombination vector into a competent cell; c. after transformation, performing PCR identification and sequencing, and selecting a correctly sequenced clone as a transgenic vector; d. preparing the transgenic fragments based on the transgenic vector. The construction method as set forth in claim 5, wherein The step (2) comprises: Microinjecting the transgenic fragments into mouse zygotes for random targeting insertion into the mouse genome. The construction method as set forth in claim 5, wherein The identification in step (3) is completed by a PCR reaction using primer pairs as shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9; SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13; SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, respectively. The construction method as set forth in claim 5, wherein The step (4) comprises: Backcrossing the F0 generation mice with wild type mice until F0N5 generation mice are obtained; Self-crossing the F0N5 generation mice to obtain the Alzheimer's disease mouse model 3-FAD homozygous positive mice. An Alzheimer's disease mouse with three mutations, the genome of the mouse comprising a transgenic fragment of a first foreign gene hAPP, a transgenic fragment of a second foreign gene hPSEN1 and a transgenic fragment of a third foreign gene hMAPT. wherein The transgenic fragment of the first foreign gene hAPP carries a Swedish mutation; the transgenic fragment of the second foreign gene hPSEN1 carries a hPSEN1 M146V mutation; and the transgenic fragment of the third foreign gene hMAPT carries a hMAPT P243L mutation. The triple mutant Alzheimer's mouse of claim 10, wherein The transgenic fragment of the first foreign gene hAPP comprises a sequence as shown in SEQ ID NO:

1. The triple mutant Alzheimer's mouse of claim 10, wherein The transgenic fragment of the second foreign gene hPSEN1 comprises a sequence as shown in SEQ ID NO:

3. The triple mutant Alzheimer's mouse of claim 10, wherein The transgenic fragment of the third foreign gene hMAPT comprises a sequence as shown in SEQ ID NO:

5. A triple mutant Alzheimer's mouse, characterized in that, The mouse is prepared by the construction method of claim 5. A method for studying the pathomechanism of Alzheimer's disease or screening a drug for treating Alzheimer's disease using a triple mutant mouse, characterized in that, The genome of the three-mutation mouse comprises a transgenic fragment of a first foreign gene hAPP, a transgenic fragment of a second foreign gene hPSEN1 and a transgenic fragment of a third foreign gene hMAPT; and The transgenic fragment of the first foreign gene hAPP carries a Swedish mutation; the transgenic fragment of the second foreign gene hPSEN1 carries a hPSEN1 M146V mutation; and the transgenic fragment of the third foreign gene hMAPT carries a hMAPT P243L mutation, The method comprises: providing the three-mutation mouse as a test group; providing a homologous mouse as a control group; administering the same test reagent and placebo to the test group and the control group; detecting target indicators for the test group and the control group; and studying the pathological mechanism of Alzheimer's disease or determining whether the test reagent can be used for treating Alzheimer's disease according to the detection results. The method of claim 15, wherein The transgenic fragment of the first foreign gene hAPP comprises a sequence as shown in SEQ ID NO:

1. The method of claim 15, wherein The transgenic fragment of the second foreign gene hPSEN1 comprises a sequence as shown in SEQ ID NO:

3. The method of claim 15, wherein The transgenic fragment of the third foreign gene hMAPT comprises a sequence as shown in SEQ ID NO:

5. The method of claim 15, wherein The target indicators include changes in the expression of various phosphorylated Tau protein sites and the expression of Aβ plaque tangles. The method of claim 15, wherein The target indicators include loss of memory and decline in basic behavioral abilities as exhibited by Alzheimer's patients.

Images