Molecular proximity and amplification

Abstract

Disclosed herein are compositions and methods for detecting target sites in proximity to each other. Disclosed herein is a composition comprising; A) a first detection molecule conjugated to a first single stranded oligonucleotide tag, wherein the first detection molecule binds a first target site; B) a second detection molecule conjugated to a second single stranded oligonucleotide tag, wherein the second detection molecule binds a second target site; and C) a first proximity connection agent (PCA), wherein the first PCA comprises: i) a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence hybridizes to the first single stranded oligonucleotide tag and the second nucleic acid sequence hybridizes to the second single stranded oligonucleotide tags when the first and second target sites are in proximity.

Description

MOLECULAR PROXIMITY AND AMPLIFICATIONCROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of priority from U.S. Provisional Application No. 63 / 695,508, filed September 17, 2024, and U.S. Provisional Application No. 63 / 750,553, filed January 28, 2025, the entire contents of which are incorporated herein by reference.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The Sequence Listing submitted as an XML file named42964WO_CST401PCT_SequenceListing.xml created on September 15, 2025, and having a size of 10,990 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.834(c)(1).BACKGROUND

[0003] The amplification of nucleic acids (NAs) in vitro is the basis of most modem methods in molecular and cell biology as it can be used for biomarker discovery and measurement, disease discovery, diagnostics of various diseases, and the analysis of food products, biological traces, and environmental objects. Of the variety of amplification methods, the polymerase chain reaction (PCR) has been most widely used. The development of immunoassays and advances in methods of nucleic acid amplification have significantly advanced the art of the detection of biological analytes. Proximity Ligation Assay (PLA) technology uses a pair of antibodies labeled with oligonucleotides which, when present within 40 nm, undertake amplification to generate a specific fluorescent signal after the addition of labeled probes. Two primary antibodies from different species bind to a target antigen. Species-specific secondary antibodies (each with a unique short DNA strand), bind to the primary antibodies. When the secondary antibodies are in close proximity, the DNA strands can interact through the subsequent addition of two other DNA oligonucleotides. However, the PLA in the art use a specific rolling circle amplification method involving circular DNA template, which is usually in the form of a plasmid or circularized oligonucleotide.

[0004] Rolling circle amplification has its shortcomings, including high background interference (false positives) and the cost of required specialized equipment. As such, there remains a need to optimize the detection of target sites within proximity.SUMMARY

[0005] Disclosed herein are compositions and methods for detecting target sites when in proximity to each other.

[0006] Some aspects of the disclosure are directed to a composition comprising:A) a first detection molecule conjugated to a first single stranded oligonucleotide tag, wherein the first detection molecule binds a first target site;B) a second detection molecule conjugated to a second single stranded oligonucleotide tag, wherein the second detection molecule binds a second target site; andC) a first proximity connection agent (PCA), wherein the first PCA comprises: i) a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence hybridizes to the first single stranded oligonucleotide tag and the second nucleic acid sequence hybridizes to the second single stranded oligonucleotide tag when the first and second target sites are in proximity.

[0007] In some embodiments, the first and second nucleic acid sequences are linked to each other directly on a same contiguous nucleic acid molecule, and wherein (i) the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag, and / or (ii) the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag.

[0008] In some embodiments, the composition comprises:A) the first detection molecule conjugated to the first single stranded oligonucleotide tag, wherein the first detection molecule binds the first target site;B) the second detection molecule conjugated to the second single stranded oligonucleotide tag, wherein the second detection molecule binds the second target site; andC) the first proximity connection agent (PCA), wherein the first PCA comprises: i) the first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag; andii) the second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence hybridizes to the first single stranded oligonucleotide tag and the second nucleic acid sequence hybridizes to the second single stranded oligonucleotide tag when the first and second target sites are in proximity; and the first and second nucleic acid sequences are linked to each other through an oligonucleotide or chemical linker. In some embodiments, (i) the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag, and / or (ii) the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag. In some embodiments, the composition further comprises:D) a complementary oligonucleotide, wherein the complementary oligonucleotide hybridizes with the nucleotides of the first nucleic acid sequence that form the 5’ overhang or with the nucleotides of the second nucleic acid sequence that form the 3’ overhang, and wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the first or second nucleic acid sequence in the PCA; andE) an amplification oligonucleotide conjugated to a detection tag, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the first or second nucleic acid sequence in the PCA.

[0009] In some embodiments, the composition comprises:A) the first detection molecule conjugated to the first single stranded oligonucleotide tag, wherein the first detection molecule binds the first target site;B) the second detection molecule conjugated to the second single stranded oligonucleotide tag, wherein the second detection molecule binds the second target site; andC) the first proximity connection agent (PCA), wherein the first PCA comprises: i) the first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag; and ii) the second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence hybridizes to the first single stranded oligonucleotide tag and the second nucleic acid sequence hybridizes to the second singlestranded oligonucleotide tag when the first and second target sites are in proximity; and the PCA further comprises a third nucleic acid sequence, wherein the first and second nucleic acid sequences are linked to each other through the third nucleic acid sequence.

[0010] In some embodiments, the first, second, and third nucleic acid sequences of the PCA are linked through a direct linkage, an oligonucleotide linker, or a chemical linker. In some embodiments, the composition further comprises:D) a complementary oligonucleotide, wherein the complementary oligonucleotide hybridizes with the third nucleic acid sequence, and wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the third nucleic acid; andE) an amplification oligonucleotide conjugated to a detection tag, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the third nucleic acid.

[0011] In some embodiments, the composition comprises:A) the first detection molecule conjugated to the first single stranded oligonucleotide tag, wherein the first detection molecule binds the first target site;B) the second detection molecule conjugated to the second single stranded oligonucleotide tag, wherein the second detection molecule binds the second target site; andC) the first proximity connection agent (PCA), wherein the first PCA comprises: i) the first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag; and ii) the second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence hybridizes to the first single stranded oligonucleotide tag and the second nucleic acid sequence hybridizes to the second single stranded oligonucleotide tags when the first and second target sites are in proximity; and wherein the first nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the first single stranded oligonucleotide tag, and the second nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the second single stranded oligonucleotide tag. In some embodiments, the composition further comprises:D) a complementary oligonucleotide, wherein the complementary oligonucleotide hybridizes with the nucleotides in the first nucleic acid sequence that form the 3’ overhang and the nucleotides in the second nucleic acid sequence that form the 5’ overhang, and wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the first and second nucleic acid sequences; andE) an amplification oligonucleotide conjugated to a detection tag, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the first and second nucleic acid sequences.

[0012] In some embodiments, at least one of the nucleotide sequences of the first PCA is folded into a secondary structure providing increased selectivity of hybridization.

[0013] In some embodiments, the composition further comprises:F) a second PCA, wherein the second PCA comprises: i) a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag of the first detection molecule, wherein the first nucleic acid sequence of the second PCA and the first nucleic acid sequence of the first PCA bind to different portions of the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; of the second detection molecule, wherein the second nucleic acid sequence of the second PCA and the second nucleic acid sequence of the first PCA bind to different portions of the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence and the second nucleic acid sequence of the second PCA are linked directly to each other on the same contiguous nucleic acid molecule or through a chemical or oligonucleotide linker.

[0014] In some embodiments, the first detection molecule and the first single stranded oligonucleotide tag are directly conjugated to each other; and / or the second detection molecule and the second single stranded oligonucleotide tag are directly conjugated to each other.

[0015] Some embodiments further comprise a first adapter, wherein the first detection molecule is indirectly conjugated to the first oligonucleotide tag through a first adapter; and / or a second adapter wherein the second detection molecule is indirectly conjugated to the second single stranded oligonucleotide tag through a second adapter. In some embodiments, the first adapter isa single stranded oligonucleotide covalently attached to the first detection molecule wherein the first adapter hybridizes to the first single stranded oligonucleotide tag at the 5’ or 3 ’end of the first single stranded oligonucleotide tag; and / or the second adapter is a single stranded oligonucleotide covalently attached to the second detection molecule wherein the second adapter hybridizes to the second single stranded oligonucleotide tag at the 5’ or 3 ’end of the second single stranded oligonucleotide tag. In some embodiments, the first adapter comprises a barcode, Unique Molecular Identifier (UMI), and / or primer. In some embodiments, the second adapter comprises a barcode, UMI, and / or primer. In some embodiments, the first adapter and second adapter each comprise a barcode, UMI, and / or primer.

[0016] In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 60 nm of each other.

[0017] In some embodiments, the first detection molecule and / or the second detection molecule is an antibody or antibody fragment thereof. In some embodiments, the first detection molecule is a first primary antibody or fragment thereof which binds directly to the first target site, or a first secondary antibody or fragment thereof that binds to the first primary antibody or fragment thereof which binds directly to the first target site; and / or the second detection molecule is a second primary antibody or fragment thereof which binds directly to the second target site, or a second secondary antibody or fragment thereof that binds to the second primary antibody or fragment thereof which binds directly to the second target site.

[0018] In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 130, no more than 120, no more than 110, no more than 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 25, no more than 20, no more than 18, no more than 16, no more than 14, no more than 12, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, or no more than 4 nm in length.

[0019] In some embodiments, the amplification oligonucleotide is a double-stranded DNA and comprises at least one overhang of one or more unpaired nucleotides which hybridizes with the overhang of nucleotides of the complementary oligonucleotide. In some embodiments, thedetection tag conjugated to the amplification oligonucleotide comprises a fluorophore. In some embodiments, the fluorophore comprises coumarin, rhodamine, xanthese, fluorescein, cyanine, Alexa Fluor 488, Alexa Fluor 592, Alexa Fluor 647, or Alexa Fluor 750.

[0020] In some embodiments, the first target molecule and / or the second target molecule is a protein. In some embodiments, the first and second target molecules are molecules in a sample and the sample is a tissue sample. In some embodiments, the proximity of the first and second target molecules is 40 nm or less. In some embodiments, the second PCA comprises a hairpin structure. In some embodiments, the first target molecule and second target molecule are the same molecule. In some embodiments, the first target molecule and second target molecule are different molecules. In some embodiments, the first detection molecule and / or the second detection molecule comprise multiple single stranded oligonucleotide tags.

[0021] In some embodiments, the single stranded oligonucleotide tag(s) on the first detection molecule is / are different in length than the single stranded oligonucleotide tag(s) on the second detection molecule. In some embodiments, the single stranded oligonucleotide tag(s) on the first detection molecule is / are the same length as the single stranded oligonucleotide tag(s) on the second detection molecule. In some embodiments, the first and / or the second PCA is no more than 40 nucleotides in length. In some embodiments, the linker in the first and / or the second PCA is no more than 125, no more than 120, no more than 110, no more than 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 25, no more than 24, no more than 23, no more than 22, no more than 20, no more than 18, no more than 16, no more than 14, no more than 12, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nm in length. In some embodiments, the linker is 0 nm in length. In some embodiments, the linker in the first and / or the second PCA is a chemical linker, amino linker, or nucleic acid linker. In some embodiments, the first and or second PCA is a dsDNA helical turn, an alkane, alkene, alkyne, or an aromatic compound. In some embodiments, the dsDNA helical turn is no more than 16, no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, or no more than 10 base pairs in length. In some embodiments, the alkane is selected from the group consisting of: methane, ethane, propane, butane, pentane, hexane, heptane, octane, nonane,and decane. In some embodiments, the alkene is selected from the group consisting of: ethene, propene, butene, pentene, hexene, heptene, octene, nonene, and decene. In some embodiments, the alkyne is selected from the group consisting of: ethyne, propyne, butyne, pentyne, hexyne, heptyne, octyne, nonyne, and decyne. In some embodiments, the alkane, alkene, alkyne, or aromatic compound comprises side groups.

[0022] In some embodiments, the linker is a 5’-5’ amino modifier. In some embodiments, the linker is selected from the group consisting of:

[0023] Certain aspects of the current disclosure are directed to a method of detecting target sites in proximity, the method comprising:A) contacting target molecules with the first detection molecule and the second detection molecule in a composition disclosed herein, to permit the first detection molecule to bind to a first target site in a first target molecule, and the second detection molecule to bind to a second target site in a second target molecule, wherein the first and second target molecules are the same or different molecules;B) contacting the target molecules with the first PCA in the composition, to permit the first nucleic acid sequence in the first PCA to hybridize to the first single stranded oligonucleotide tag conjugated to the first detection molecule and the second nucleic acid sequence to hybridize to the second single stranded oligonucleotide tag conjugated to the second detection molecule, when the first target site and the second target site are in proximity; andC) detecting binding of the first PCA to the first and second detection molecules, thereby determining that the first and second target sites are in proximity.

[0024] In some embodiments, the first target site and the second target site are in the same target molecule. In some embodiments, the target molecules are in a biological sample. In some embodiments, the biological sample is a tissue sample, blood, serum, or cell cultures. In some embodiments, the sample is brought into contact with a solid support to permit the target molecules in the sample to bind to the solid support. In some embodiments, the tissue sample is a tissue section which is fixed and / or stained. In some embodiments, the sample is in solution, and steps A and B are performed in solution. In some embodiments, the sample is a cell lysate comprising the target molecules.

[0025] In some embodiments, the target molecules are released from the solid support after step B and before step C. In some embodiments, the release is achieved by adding a protease. In some embodiments, the protease is a Proteinase K. In some embodiments, the protease is inactivated or removed after an incubation period and before step C.

[0026] In some embodiments, the detecting of the binding of the first PCA in step C is performed by Polymerase Chain Reaction (PCR), sequencing, Enzyme Linked Immunosorbent Assay (ELISA), multiplex ligation-dependent probe amplification (MLP A), serial analysis of gene expression (SAGE), dot blot, flow cytometry, or immunohistochemistry. In some embodiments, the sequencing includes next generation sequencing (NGS), high throughput sequencing, sequencing by ligation, sequencing by hybridization, tag sequencing, or sequencing by synthesis.

[0027] In some embodiments, the method further comprises washing the sample between any one of steps A-C or any two of steps A-C, wherein step A is the step of contacting target molecules with the first detection molecule and the second detection molecule in a composition disclosed herein, step B is the step of contacting the target molecules with the first PCA in a composition disclosed herein, and step C is the step of detecting binding of the first PCA to the first and second detection molecules thereby determining that the first and second target sites are in proximity.

[0028] In some embodiments, the steps are performed in sequential order. In some embodiments, the method further comprises a step of:D) contacting the target molecules with the second PCA of as described herein; wherein step D occurs after step A and before step C.

[0029] In some embodiments, step A and step D occur simultaneously. In some embodiments, the sample is brought into contact with a solid support to permit the target molecules to bind to the solid support prior to step A, and the target molecules are released from the solid support after step A and before step D. In some embodiments, the sample is brought into contact with a solid support to permit the target molecules to bind to the solid support prior to step A, and the target molecules are released from the solid support after step D and before step B. Some embodiments further comprise a wash step after the target molecules are contacted with the second PCA of step D. In some embodiments, the contacting the target molecules of any one of steps A, B, and D occurs for about 5 minutes to overnight for each of the steps. In some embodiments, the contacting the target molecules of steps A, B, and D occurs for the same period of time. In some embodiments, the contacting the target molecules of steps A, B, and D occurs for different periods of time wherein each period of time ranges from about 5 minutes to overnight. In some embodiments, the contacting the target molecules of any one of steps A, B, and D each occurs for any period of time, wherein each period of time ranges from about 5 minutes to overnight. In some embodiments, the contacting the target molecules of steps A, B, and D occurs between about 4°C and 40°C. In some embodiments, the contacting the target molecules of steps A, B, and D occurs at the same temperature for all steps. In some embodiments, the contacting the target molecules of steps A, B, and D occurs at a different temperature wherein the temperature of each step is between about 4°C and 40°C.

[0030] Some embodiments further comprise a step of cleaning up the sample after step B and before step C. In some embodiments, the cleaning up comprises use of a spin column, ethanol precipitation, High-Performance Liquid Chromatography (HPLC), polyacrylamide gel electrophoresis (PAGE), magnetic / paramagnetic beads, Solid Phase Reversible Immobilization (SPRI) beads, enzymatic digestion, immunoprecipitation, or ion exchange chromatography.

[0031] Certain aspects of the disclosure are directed to a kit comprising a composition as described herein. In some embodiments, the components A, B, C, D, and E of the composition are packaged separately. In some embodiments, the kit further comprises instructions and / or a protocol. Some embodiments further comprise a solid support for conducting the assay. In some embodiments, the solid support is a slide. In some embodiments, the solid support is a preparation of beads.BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIG. 1 represents an embodiment of the disclosure where 1) the first detection molecule and second detection molecule bind to the first target site and second target site, respectively; 2) the proximity connection agent (PCA) binds to both detection molecules through the single stranded oligonucleotide tags of the first and second detection molecules; 3) complementary oligo binds to the proximity connection agent; and 4) signal amplification occurs.

[0033] FIGS. 2A-C depict three exemplary embodiments of the disclosure. FIG. 2A) An embodiment with one proximity oligonucleotide. FIG. 2B) An embodiment with two proximity oligonucleotides. FIG. 2C) An embodiment comprising a folded proximity oligonucleotide.

[0034] FIGS. 3 A-E depict several exemplary embodiments of the disclosure. FIG. 3 A) is an embodiment comprising a PCA comprising a linker (dashed lines) where (i) the first nucleic acid sequence of the PCA comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag, and / or (ii) the second nucleic acid sequence comprises nucleotides that form a 3 ’ overhang upon hybridization to the second single stranded oligonucleotide tag that allows for the amplification molecule to bind to the complex. FIG. 3B) shows one embodiment of the method of how the embodiment represented in FIG. 3 A combines to form a complex. FIG. 3C) represents an embodiment where the PCA further comprises a third nucleic acid sequence, wherein the first and second nucleic acid sequences are linked to each other through the third nucleic acid sequence. The first, second, and third nucleic acid sequences of the PCA are linked through a direct linkage, an oligonucleotide linker, or a chemical linker (dashed lines) and the amplification molecule to bind to the complex through the overhang on the complementary oligonucleotide. FIG. 3D) shows an embodiment where the first nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the first singlestranded oligonucleotide tag, and the second nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the second single stranded oligonucleotide tag. The amplification molecule binds to the complex through the overhang on the complementary oligonucleotide. FIG. 3E) represents an embodiment comprising a second PCA, wherein the second PCA comprises i) a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag of the first detection molecule, wherein the first nucleic acid sequence of the second PCA and the first nucleic acid sequence of the first PCA bind to different portions of the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; of the second detection molecule, wherein the second nucleic acid sequence of the second PCA and the second nucleic acid sequence of the first PCA bind to different portions of the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence and the second nucleic acid sequence of the second PCA are linked directly to each other on the same contiguous nucleic acid molecule.

[0035] FIG. 4 depicts an embodiment of the disclosure where the first detection molecule and second detection molecule bind to the first target site and second target site, respectively; the PCA binds to both detection molecules through the single stranded oligonucleotide tags of the first and second detection molecules; the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag, and / or (ii) the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag, and the captured target sites within proximity to each other are amplified by polymerase chain reaction and sequenced through next generation sequencing.

[0036] FIGS. 5A-C show graphs representing FITC measurement obtained for bead-based flow cytometry assay as seen in FIG. 3E where the first and / or second detection molecules with unique single stranded oligonucleotide tags are bound to a bead by Protein A / G binding. All samples were incubated with first PCA, which hybridizes to both detection molecules through the single stranded oligonucleotide tags of the first and second detection molecules; and second PCA which also hybridizes to both detection molecules through the single stranded oligonucleotide tags of the first and second detection molecules, and also to the signal output oligonucleotide comprising AlexaFluor488. FIG. 5A) FITC flow cytometry data for Protein A / Gbeads bound by only the first detection molecule (antibody that detects phosphorylated NF-KB p65 protein) with the first single stranded oligonucleotide tag incubated with both first and second PCA as well as the signal output oligonucleotide comprising AlexaFluor488. FIG. 5B) FITC flow cytometry for Protein A / G beads bound by only the second detection molecule (antibody that detects total NF-KB p65 protein) with the second single stranded oligonucleotide tag incubated with both first and second PCA as well as the signal output oligonucleotide comprising AlexaFluor488. FIG. 5C) FITC flow cytometry data for Protein A / G beads bound to both the first and the second detection molecules (anti-phospho-NF-KB p65 and anti-NF-KB p65) at a 50:50 ratio, incubated with both first and second PCA as well as the signal output oligonucleotide comprising AlexaFluor488. Signal is only seen when both antibodies are included and in proximity of each other.

[0037] FIG. 6 is a schematic showing one example of one embodiment where the first single stranded oligonucleotide tag (61) and the second single stranded oligonucleotide tag (64) each hybridize to the first PCA (63) and second PCA (64) where the first detection molecule (62) is conjugated to the first single stranded oligonucleotide tag (61) and the second detection molecule (65) is conjugated to the second single stranded oligonucleotide tag (64).

[0038] FIG. 7 is a schematic showing one example of one embodiment where the first single stranded oligonucleotide tag (71) and the second single stranded oligonucleotide tag (75) each hybridize to the first PCA (73) and second PCA (77) where the first detection molecule (72) is attached to the first single stranded oligonucleotide tag (71) through an adapter (74) and the second detection molecule (76) is attached to the second single stranded oligonucleotide tag (75) through a second adapter (78).

[0039] FIGS. 8A-8C. FIG. 8A is a schematic showing one example of an embodiment where the first single stranded oligonucleotide tag (81) and the second single stranded oligonucleotide tag (85) each hybridize to the first PCA (83) and second PCA (87) where the first detection molecule (82) is conjugated to the first single stranded oligonucleotide tag (81) through an adapter (84) and the second detection molecule (86) is conjugated to the second single stranded oligonucleotide tag (85) through a second adapter (88). FIG. 8B magnifies the first detection molecule (82) and adapter (84) shown in FIG. 8A. FIG. 8B shows an embodiment where theadapter (84) comprises a barcode (84b), UMI (84c), and primer (84d). 84a is the portion of the adapter that hybridizes to the first single stranded oligonucleotide tag (81). FIG. 8C magnifies the second detection molecule (86) and adapter (88) shown in FIG. 8A. FIG. 8C shows an embodiment where the adapter (88) comprises a barcode (88b), UMI (88c), and primer (88d). 88a is the portion of the adapter that hybridizes to the second single stranded oligonucleotide tag (85).

[0040] FIG. 9 is a schematic showing one example of an embodiment where the first single stranded oligonucleotide tag (91) and the second single stranded oligonucleotide tag (95) each hybridize to the first PCA (93) and second PCA (97) which cross in this example of an embodiment. The first detection molecule (92) is conjugated to the first single stranded oligonucleotide tag (91) through an adapter (94) and the second detection molecule (96) is conjugated to the second single stranded oligonucleotide tag (95) through a second adapter (98). FIG. 9 then shows how the selection process occurs, either ligation occurs through a phosphodiester linkage when the first PCA (93) and second PCA (97) place the first detection molecule and the second detection molecule in proximity to each other through the hybridization of the first single stranded oligonucleotide tag (91) and the second single stranded oligonucleotide tag (95) (the right side of the double arrow) or oligonucleotides that are not in proximity either ligate through single site ligation or remain in solution, as shown occurring through the left side of the double arrow. Once ligated with a phosphodi ester linkage, the ligated complex can undergo PCR for analysis.

[0041] FIG. 10 shows a histogram of FITC positive signal for three samples. Each sample contains the following: bead attached with antibody 2 (A), antibody 1 (B), and antibody 1 and 2 (C). All samples contain a first PCA and a second PCA which also hybridize to signal output Oligonucleotide containing AlexaFluoro488.

[0042] FIG. 11 is a representative DNA gel showing that the ligation using the four adapters can be performed in vitro and results in a successful ligation product that can be PCR amplified to the expected size. Conditions of lanes are as follows: lane 1 - ligation + PCR with bead clean-up = 168 bp; lane 2 - ligation + PCR = 168 bp; lane 3 - ligation with no PCR amplification; lane 4 - negative control without ligation; lane 5 - oligo 1 without PCR (DNA template) = 54 bp(control); lane 6 - oligo3 without PCR (DNA template) = 108 bp (control); lane 7 - oligo4 without PCR (DNA template) = 126 bp (positive control for ligation); lane 8 - oligo3 (DNA template + PCR) = 150 bp (control); and lane 9 - oligo4 (DNA template + PCR) = 168 bp (positive control for ligation + PCR).

[0043] FIGS. 12A-B show proof of concept for the proximity assay using beads for detecting purified PD-1 using oligo-conjugated (OC) primary antibodies. FIG. 12A is a representative DNA gel demonstrating the proximity assay using the on-bead protocol can be used to detect purified PD-1. The strong band in Lane 7 indicates detection of PD-1 when using the Mouse (Ms) and Human (Hu) oligo-conjugated antibodies that target PD-1. Conditions of lanes are as follows: lane 1 - no antibody; lane 2 - human oligo-conjugated PD-1 antibody; lane 3 - mouse oligo-conjugated PD-1 antibody; lane 4 - mouse oligo-conjugated PD-1 antibody and anti -human secondary antibody; lane 5 - human oligo-conjugated PD-1 antibody and anti -mouse secondary antibody; lane 6 - mouse oligo-conjugated PD-1 antibody and human oligo-conjugated PD-1 antibody without presence of PD-1; lane 7 - mouse oligo-conjugated PD-1 and human oligo- conjugated PD-1; lane 8 - control PCR. FIG. 12B shows Sanger sequencing of sample for lane 7 in 12A has the exact anticipated sequence. The sequence on top (SEQ ID NO: 06) is the sample sequence as shown in lane 7 of FIG. 12A, and the bottom sequence (SEQ ID NO: 07) is the anticipated sequence. The two barcodes (matching the barcode on each of the two oligos) are boxed. The UMI is a series of Ns (where N is any nucleotide) in the sample sequence, and that is validated via the sequencing.

[0044] FIG. 13 is a representative DNA gel showing that the proximity assay can be used with oligo-conjugated (OC) secondary antibodies in place of OC primary antibodies. One example of an embodiment of the disclosure was used to detect purified PD-1 when using OC secondary antibodies. Conditions of lanes are as follows: lane 1 - no secondary antibody; lane 2 - antihuman oligo-conjugated secondary antibody; lane 3 - anti-mouse oligo-conjugated secondary antibody; lane 4 - anti-human oligo-conjugated secondary antibody and anti-mouse oligo- conjugated secondary antibody without presence of PD-1; lane 5 - anti -human oligo-conjugated secondary antibody and anti-mouse oligo-conjugated secondary antibody; lane 6 - control PCR. The band in lane 5 indicates detection of PD-1 when using the oligo-conjugated anti-human and oligo-conjugated anti-mouse secondary antibodies.

[0045] FIGS. 14A-B show proof of concept for biotin-streptavidin pulldown using the on-bead proximity embodiment. FIG. 14A is a workflow of the 3 conditions tested. FIG. 14B is a representative DNA gel of the three conditions tested in 14 A. Conditions are as follows: lane 1 - Proteinase K digestion followed by PCR; lane 2 - Proteinase K digestion with streptavidin pulldown followed by PCR; lane 3 - streptavidin pulldown with no Proteinase K digestion followed by PCR; lane 4 - PCR control.

[0046] FIG. 15 is a representative DNA gel of assay performed through the in-solution embodiment of proximity assay. PD-1 was used as target protein and anti-PD-1 oligoconjugated primary antibodies were used to perform the assay. Proteinase K digestion was implemented after the ligation. This embodiment additionally included streptavidin sample clean up after Proteinase K digestion. Conditions are shown in FIG. 15.INCORPORATION BY REFERENCE

[0047] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material.DETAILED DESCRIPTION

[0048] The following description and examples illustrate embodiments of the present disclosure in detail. It is to be understood that this disclosure is not limited to the particular embodiments described herein and as such can vary. Those of skill in the art will recognize that there are numerous variations and modifications of this disclosure, which are encompassed within its scope.

[0049] All terms are intended to be understood as they would be understood by a person skilled in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.

[0050] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0051] Although claimed subject matter will be described in terms of certain examples, other examples, including examples that do not provide all the benefits and features set forth herein, are also within the scope of this disclosure. Various structural, logical, and process step changes may be made without departing from the scope of the disclosure.

[0052] Ranges of values are disclosed herein. The ranges set out a lower limit value and an upper limit value. Unless otherwise stated, the ranges include the lower limit value, the upper limit value, and all values between the lower limit value and the upper limit value, including, but not limited to, all values to the magnitude of the smallest value (either the lower limit value or the upper limit value).

[0053] In the description that follows, certain conventions will be followed as regards to the usage of terminology. Generally, terms used herein are intended to be interpreted consistently with the meaning of those terms as they are known to those of skill in the art. In practicing the present disclosure, many conventional techniques in molecular biology, microbiology, cell biology, biochemistry, and immunology are used, which are within the skill of the art. These techniques are described in greater detail in, for example, Molecular Cloning: a Laboratory Manual 4th edition, J.F. Sambrook and D.W. Russell, ed. Cold Spring Harbor Laboratory Press 2012; Recombinant Antibodies for Immunotherapy, Melvyn Little, ed. Cambridge University Press 2009; “Oligonucleotide Synthesis” (M. J. Gait, ed., 1984); “Animal Cell Culture” (R. I. Freshney, ed., 1987); “Methods in Enzymology” (Academic Press, Inc.); “Current Protocols in Molecular Biology” (F. M. Ausubel et al., eds., 1987, and periodic updates); “PCR: The Polymerase Chain Reaction”, (Mullis et al., ed., 1994); “A Practical Guide to Molecular Cloning” (Perbal Bernard V., 1988); “Phage Display: A Laboratory Manual” (Barbas et al., 2001). The contents of these references and other references containing standard protocols, widely known to and relied upon by those of skill in the art, including manufacturers’ instructions are hereby incorporated by reference as part of the disclosure.

[0054] Temperatures as used herein are not meant to be exact. -20°C as used herein refers to an ordinary laboratory freezer. -80°C as used herein refers to laboratory deep freezer. 4 °C as usedherein refers to an ordinary laboratory refrigerator. Room temperature as used herein refers to the normal temperature of a laboratory which is usually around 22°C to 27°C. In some embodiments, steps of the methods can be performed at room temperature while the cells in the single cell form are on ice. In some embodiments, steps of the methods can be performed at a range of 4°C to 40°C. On ice temperature ranges between 0°C and room temperature and is commonplace to those of skill in the art. All temperatures used throughout the disclosure can fluctuate and one having skill in the art understands the definition of these temperatures.

[0055] The following definitions supplement those in the art and are directed to the current application and are not to be imputed to any related or unrelated case, e.g., to any commonly owned patent or application. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present disclosure, the preferred materials and methods are described herein. Accordingly, the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0056] In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0057] In this application, the use of “or” means “and / or” unless stated otherwise. The terms “and / or” and “any combination thereof" and their grammatical equivalents as used herein, can be used interchangeably. These terms can convey that any combination is specifically contemplated. Solely for illustrative purposes, the following phrases “A, B, and / or C” or “A, B, C, or any combination thereof" can mean “A individually; B individually; C individually; A and B; B and C; A and C; and A, B, and C.” The term “or” can be used conjunctively or disjunctively, unless the context specifically refers to a disjunctive use.

[0058] Furthermore, use of the term “including” as well as other forms, such as “include”, “includes,” and “included,” is not limiting.

[0059] Reference in the specification to “some embodiments,” “an embodiment,” “ embodiment” or “other embodiments” means that a particular feature, structure, or characteristicdescribed in connection with the embodiments is included in at least some embodiments, but not necessarily all embodiments, of the present disclosures.

[0060] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the present disclosure, and vice versa. Furthermore, compositions of the present disclosure can be used to achieve methods of the present disclosure.

[0061] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system.

[0062] As used herein, the term “amino acid” refers to a molecule containing both an amino group and a carboxyl group. Amino acids include alpha-amino acids and beta-amino acids. In certain forms, an amino acid is an alpha-amino acid. Amino acids can be natural or synthetic. Amino acids include, but are not limited to, the twenty standard or canonical amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic Acid (Asp, D), Cysteine (Cys, C), Glutamine (Gin, Q), Glutamic Acid (Glu, E), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (V al, V). Common non-standard or non-canonical amino acids include, but are not limited to, selenocysteine, ornithine, pyrrolysine, and N-formylmethionine.

[0063] “Conjugate,” “conjugation,” and related terms, refer to the linkage of a molecule to another molecule, or one part of a molecule to a different part of the same molecule. The linkage can involve covalent or non-covalent linkage and can be direct or indirect. Direct linkages are linkages where the two molecules are connected directly, i.e., without any intermediate molecule such as an adaptor, linker, or bridge. When two molecules are conjugated directly, i.e., through direct linkage (i.e., without an intermediate molecule), the direct linkage may involve covalent ornon-covalent interactions, or a combination of covalent and non-covalent interactions. Indirect linkages are linkages where the two molecules are connected indirectly and through an intermediate molecule such as an adapter, linker, or bridge. Indirect linkage may also involve covalent or non-covalent interactions, or a combination of covalent and non-covalent interactions. Non-covalent interactions include electrostatic interactions, hydrogen bonding interactions, metal coordination, physical adsorption, host-guest interactions, hydrophobic interactions, π-stacking interactions, van der Waals interactions, magnetic interactions, hybridization, and dipole-dipole interactions.

[0064] “Peptide” refers to a chain of amino acids having a length of between 2 and 50 amino acids in length.

[0065] As used herein, “protein” refers to a chain of amino acids having a length of greater than 50 amino acids, such as greater than 50 amino acids and less than thirty-six thousand amino acids.

[0066] As used herein, “small molecule” refers to an organic molecule that is less than about 2500 g / mol in molecular weight, less than about 2000 g / mol, less than about 1500 g / mol, less than about 1000 g / mol, less than about 800 g / mol, or less than about 500 g / mol. In some forms, small molecules are non-polymeric and / or non-oligomeric.

[0067] The term “treating,” “preventing,” and a related term such as “treatment” mean to ameliorate, reduce or otherwise stop a disease, disorder, or condition from occurring or progressing in an animal which may be predisposed to the disease, disorder, and / or condition but has not yet been diagnosed as having it; inhibiting the disease, disorder, or condition, e.g., impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and / or condition. Treating the disease or condition includes ameliorating at least one symptom of the particular disease or condition, even if the underlying pathophysiology is not affected. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating, or palliating the disease state, and remission or improved prognosis. For example, an individual is successfully “treated” if one or more symptoms are mitigated or eliminated, including, but are not limited to, reducing and / or inhibiting rate of progress of the disease, increasing the quality of life of those suffering from the disease,decreasing the dose of other medications required to treat the disease, delaying the progression of the disease, and / or prolonging survival of individuals.

[0068] The term “effective amount” as used herein, refers to a particular amount of a pharmaceutical composition comprising a therapeutic agent that achieves a clinically beneficial result (i.e., for example, a reduction of symptoms). Toxicity and therapeutic efficacy of such compositions can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit large therapeutic indices are preferred. The data obtained from these cell culture assays and additional animal studies can be used in formulating a range of dosage for human use. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.

[0069] The term “pharmaceutically” or “pharmacologically acceptable”, as used herein, refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.

[0070] The term, “pharmaceutically acceptable carrier’ ’, as used herein, includes any and all solvents, or a dispersion medium including, but not limited to, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils, coatings, isotonic and absorption delaying agents, liposome, commercially available cleansers, and the like. Supplementary bioactive ingredients also can be incorporated into such carriers.

[0071] “Nucleic acid sequence”, “polynucleotide sequence”, and “nucleotide sequence” as used herein refer to an oligonucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand. Oligonucleotides referred to in this disclosure include oligonucleotides having common modifications. Examples of common modifications tooligonucleotides include, but are not limited to, phosphorothi oates, 2'-O-methyl or 2' -fluoro modifications, locked nucleic acids (LNAs), and biotinylation.

[0072] The term “an isolated nucleic acid”, as used herein, refers to any nucleic acid molecule that has been removed from its natural state (e.g., removed from a cell and is, in a preferred embodiment, free of other genomic nucleic acid). In the context of this disclosure, nucleic acid includes DNA, RNA, or nucleic acid analogues. Examples of nucleic acid analogues include, but are not limited to, peptide nucleic acid, morpholino- and locked nucleic acid, glycol nucleic acid, and threose nucleic acid.

[0073] The terms “amino acid sequence” and “polypeptide sequence” as used herein, are interchangeable and refer to a sequence of amino acids.

[0074] As used herein, the term “fluorescent protein” refers to a protein domain that comprises at least one organic compound moiety that emits fluorescent light in response to the appropriate wavelengths. For example, fluorescent proteins may emit red, blue and / or green light. Such proteins are readily commercially available including, but not limited to: i) mCherry (Clonetech Laboratories): excitation: 556 / 20 nm (wavelength / bandwidth); emission: 630 / 91 nm; ii) sfGFP (Invitrogen): excitation: 470 / 28 nm; emission: 512 / 23 nm; iii) TagBFP (Evrogen): excitation 387 / 11 nm; emission 464 / 23 nm.

[0075] DNA and RNA molecules are said to have “5' ends” and “3' ends” because mononucleotides are reacted to make oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction via a phosphodiester linkage. Therefore, an end of an oligonucleotide is referred to as the “5' end” if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring. An end of an oligonucleotide is referred to as the “3' end” if its 3' oxygen is not linked to a 5' phosphate of another mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5' and 3' ends. In either a linear or circular DNA or RNA molecule, discrete elements are referred to as being “upstream” or 5' of the “downstream” or 3' elements. This terminology reflects the fact that transcription proceeds in a 5' to 3' fashion along the DNA or RNA strand. The promoter and enhancer elements which direct transcription of a linked gene are generally located 5' or upstream of the coding region.However, enhancer elements can exert their effect even when located 3* of the promoter element and the coding region. Transcription termination and polyadenylation signals are located 3' or downstream of the coding region.

[0076] “Sequencing”, “sequence determination” and the like means determination of information relating to the nucleotide base sequence of a nucleic acid. Such information may include the identification or determination of partial as well as full sequence information of the nucleic acid. Sequence information may be determined “with varying degrees of statistical reliability or confidence”. In one aspect, the term includes the determination of the identity and ordering of a plurality of contiguous nucleotides in a nucleic acid. “High throughput digital sequencing” or “next generation sequencing” means sequence determination using methods that determine many (typically thousands to billions) of nucleic acid sequences in an intrinsically parallel manner, i.e. where DNA templates are prepared for sequencing not one at a time, but in a bulk process, and where many sequences are read out preferably in parallel, or alternatively using an ultra-high throughput serial process that itself may be parallelized. Such methods include but are not limited to pyrosequencing (for example, as commercialized by 454 Life Sciences, Inc., Branford, Conn.); sequencing by ligation (for example, as commercialized in the SOLiD™ technology, Life Technology, Inc., Carlsbad, Calif.); sequencing by synthesis using modified nucleotides (such as commercialized in TruSeq™ and HiSeg™ technology by Illumina, Inc., San Diego, Calif., Heli Scope™ by Helicos Biosciences Corporation, Cambridge, Mass., and PacBio RS by Pacific Biosciences of California, Inc., Menlo Park, Calif.), sequencing by ion detection technologies (Ion Torrent, Inc., South San Francisco, Calif.); sequencing of DNA nanoballs (Complete Genomics, Inc., Mountain View, Calif.); nanopore-based sequencing technologies (for example, as developed by Oxford Nanopore Technologies, LTD, Oxford, UK), and like highly parallelized sequencing methods.

[0077] The term “Barcode” or “construct Barcode” describes a defined polymer, e.g., a polynucleotide, which when it is a functional element of the polymer construct, is specific for a single ligand. As used in the various methods described herein the term Barcode can be a “cell Barcode” or “substrate Barcode”, which describes a defined polynucleotide, specific for identifying a particular cell or substrate. In some embodiments, the Barcode can be formed of a defined sequence of DNA, RNA, modified bases or combinations of these bases, as well as anyother polymer defined above. In some embodiments, the Barcode is about 2 to 4 monomeric components, e.g., nucleotide bases, in length. In other embodiments, the Barcode is at least about 1 to 100 monomeric components, e.g., nucleotides, in length. Thus, in some embodiments, the Barcode is formed of a sequence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 80, 91, 92, 93, 94,95, 96, 97, 98, 99 or up to 100 monomeric components, e.g., nucleic acids. In some embodiments the barcode is present along with a Unique Molecular Identifier (UMI). In some embodiments, the barcode is present without a UMI.

[0078] The term “Unique Molecular Identifier” (UMI), also called equivalently a “Random Molecular Tag” (RMT), is a random sequence of monomeric components of a polymer as described above, e.g., nucleotide bases, which when it is a functional element of the polymer construct, is specific for that polymer construct. UMIs are valuable tools for both quantitative sequencing applications as well as genomic variant detection, especially the detection of rare mutations. UMI sequence information in conjunction with alignment coordinates enables grouping of sequencing data into read families representing individual sample DNA or RNA fragments. Many sequencing library preparation protocols enable high-throughput sequencing (HTS) from low amounts of starting material. Their preparation requires PCR amplification of the libraries. While the PCR polymerases and reagents have been improved greatly in recent years enabling a mostly unbiased amplification of sequencing libraries, some biases still remain against sequences with extreme GC contents and against long fragments. When starting from ultra-low input samples, stochastic effects in the first rounds of the PCR add to the problems. These issues can potentially cause erroneous quantitation data. Removal of PCR duplicates using alignment coordinate information is especially inefficient for low input situations but also for deep sequencing data. Alignment coordinate-based de-duplification can remove large numbers of biological duplicate reads from the data, especially for the most abundant transcripts. UMIs can alleviate the PCR duplicate problem by adding unique molecular tags to the sequencing library molecules before amplification. In some embodiments, the UMI permits identification of amplification duplicates of the polymer construct / construct oligonucleotide sequence with which it is associated. In some embodiments, a UMI may be associated with apolymer, e.g., an oligo or polynucleotide sequence, used in a particular assay format or with a polymer, e.g., an oligo or polynucleotide, that is immobilized on a substrate. Each UMI for each polymer construct, e.g., oligonucleotide or polynucleotide, is different from any other UMI used in the disclosed methods. In some embodiments, the UMI is formed of a random sequence of DNA, RNA, modified bases or combinations of these bases or other monomers of the polymers identified above. In some embodiments, a UMI is about 8 monomeric components, e.g., nucleotides, in length. In some embodiments, each UMI can be at least about 1 to 100 monomeric components, e.g., nucleotides, in length. Thus in some embodiments, the UMI is formed of a random sequence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 80, 91, 92, 93, 94, 95, 96,97, 98, 99 or up to 100 monomeric components, e.g., nucleic acids. In some embodiments, the UMI is formed by a non-random oligonucleotide sequence.

[0079] A “biological sample” may be obtained directly from an organism or from a sample obtained from an organism, e.g., from blood (e.g., a whole blood sample, serum sample, or plasma sample), urine, cerebrospinal fluid, seminal fluid, saliva, sputum, stool, and tissue. In some embodiments, the sample is a tissue extract. In some embodiments, the sample is a cell lysate. The cells used in the disclosure can also be from a biological sample or cultured cells, such as a primary cell culture or a cell line. The cells or tissues from which the cells are obtained may be infected with a virus or other intracellular pathogen. In some embodiments, the sample may be from a mammal. In some embodiments, the sample may be from an animal. The term “animal” includes mammals, for example, human, horse, camel, dog, cat, pig, cow, goat and sheep.General Description

[0080] One aspect of the disclosure is directed to a composition. In some embodiments, the composition can be used for detecting target molecules of interest or target sites of interest that are in proximity. In some embodiments, the composition comprises:A) a first detection molecule conjugated to a first single stranded oligonucleotide tag, wherein the first detection molecule binds a first target site;B) a second detection molecule conjugated to a second single stranded oligonucleotide tag, wherein the second detection molecule binds a second target site; andC) a first proximity connection agent (PCA), wherein the first PCA comprises: i) a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence hybridizes to the first single stranded oligonucleotide tag and the second nucleic acid sequence hybridizes to the second single stranded oligonucleotide tag when the first and second target sites are in proximity.

[0081] In accordance with this aspect of the disclosure, the first detection molecule and the second detection molecule need to be bound to their target site and in proximity to each other in order for the first nucleic acid sequence of the first PCA to hybridize to the first single stranded oligonucleotide tag of the first detection molecule and the second nucleic acid sequence of the first PCA to hybridize to the second single stranded oligonucleotide tag of the second detection molecule.

[0082] In some embodiments, the first and second nucleic acid sequences in the first PCA are linked to each other directly on a same contiguous nucleic acid molecule. In some embodiments, the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag. In some embodiments, the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag. In some embodiments, the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag and the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag. FIG. 4 shows a non-limiting example of such an embodiment.

[0083] In some embodiments, the first and second nucleic acid sequences in the first PCA are linked to each other through an oligonucleotide or chemical linker. In some embodiments, the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag. FIGS. 3A and 3B show a non-limiting example ofsuch an embodiment where the dashed line is the linker. In some embodiments, the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag. In some embodiments, the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag and the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag. In some embodiments, the composition further comprises a complementary oligonucleotide, wherein the complementary oligonucleotide hybridizes with the nucleotides of the first nucleic acid sequence that form the 5’ overhang or with the nucleotides of the second nucleic acid sequence that form the 3’ overhang, and wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the first or second nucleic acid sequences. In some embodiments, the composition further comprises an amplification oligonucleotide, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the first or second nucleic acid sequences in the PCA. In some embodiments, the complementary oligonucleotide is conjugated to a detection tag.

[0084] In some embodiments, the first PCA further comprises a third nucleic acid sequence, wherein the first and second nucleic acid sequences are linked to each other through the third nucleic acid sequence. In some embodiments, the first, second, and third nucleic acid sequences of the PCA are linked through a direct linkage, an oligonucleotide linker, or a chemical linker. FIG. 3C presents a non-limiting example of such an embodiment. In some embodiments, the composition further comprises a complementary oligonucleotide, wherein the complementary oligonucleotide hybridizes with the third nucleic acid sequence, and wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the third nucleic acid. In some embodiments, the composition further comprises an amplification oligonucleotide, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the third nucleic acid. In some embodiments, the complementary oligonucleotide is conjugated to a detection tag.

[0085] In some embodiments, the first nucleic acid sequence in the PCA comprises nucleotides that form a 3’ overhang upon hybridization to the first single stranded oligonucleotide tag andthe second nucleic acid sequence in the PCA comprises nucleotides that form a 5’ overhang upon hybridization to the second single stranded oligonucleotide tag. In some embodiments, the composition further comprises a complementary oligonucleotide wherein the complementary oligonucleotide hybridizes with the nucleotides in the first nucleic acid sequence in the PCA that form the 3’ overhang and the nucleotides in the second nucleic acid sequence in the PCA that form the 5’ overhang, and wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the first and second nucleic acid sequences in the PCA. In some embodiments, the composition further comprises an amplification oligonucleotide, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the first and second nucleic acid sequences in the PCA. In some embodiments, the complementary oligonucleotide is conjugated to a detection tag. FIG. 3D shows a non-limiting example of such an embodiment.

[0086] In some embodiments, the composition further comprises a second PCA, wherein the second PCA comprises: a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag of the first detection molecule, wherein the first nucleic acid sequence of the second PCA and the first nucleic acid sequence of the first PCA bind to different portions of the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; of the second detection molecule, wherein the second nucleic acid sequence of the second PCA and the second nucleic acid sequence of the first PCA bind to different portions of the second single stranded oligonucleotide tag. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence of the second PCA are linked directly to each other on the same contiguous nucleic acid molecule or through a chemical or oligonucleotide linker. FIG. 2B shows a non-limiting example of a composition comprising a second PCA.

[0087] The compositions and methods disclosed herein offer advantages over compositions and methods available in the art. One of the advantages of the compositions and methods disclosed herein is that the compositions and methods disclosed herein enable the use of two detection molecules that may or may not have high specificity and sensitivity for the protein of interest. Methods in the art rely on imaging a signal from each detection molecule individually which result in unwanted non-specific background. However, the compositions and methods asdisclosed allow for imaging a signal that is produced only when the two detection molecules are both binding the protein (in a precise proximity to each other) eliminating non-specific background noise. Another advantage of the compositions and methods disclosed herein is that the disclosed compositions and methods enable the use of two detection molecules that may or may not have high specificity and sensitivity for a post-translationally modified residue of interest of a protein of interest. Methods in the art rely on imaging a signal from the detection molecule(s) that recognize phospho-tyrosine residues in a manner largely independent of the surrounding amino acid sequence which results in signal from a large number of modified proteins. However, the compositions and methods as disclosed allow for the imaging of a signal that is produced only when the two detection molecules are both binding in proximity is a better indication that the post-translationally modified residue being detected is on your protein of interest. Strategies as disclosed herein can be employed for all post-translational modifications, including but not limited to phosphorylation, glycosylation, ubiquitination, methylation, and acetylation.

[0088] In some embodiments, the disclosed composition comprises Unique Molecular Identifiers (UMI) and / or barcodes embedded within each single stranded oligonucleotide tag(s), each proximity connection agent (PCA), each detection molecule, and / or each individual adapter. Including the barcode aids with identification of which detection conjugate was used for sequencing. Including the UMI aids with quantifying the detection conjugate through sequencing. Barcodes and UMI also assist in multiplexing detection molecules and the quantification of detection molecules through sequencing.Detection Molecule

[0089] In some embodiments, the first detection molecule is selected from the group of antibodies, antibody fragments, lectins, receptors, single chain antibodies, cofactors, oligonucleotides, aptamers, and other non-protein molecules which have affinity for and bind a target site. In some embodiments, the first detection molecule is an antibody or antibody fragment thereof. In some embodiments, the second detection molecule is selected from the group of antibodies, antibody fragments, lectins, receptors, single chain antibodies, cofactors, oligonucleotides, aptamers, and other non-proteins which have affinity for a target site. In some embodiments, the second detection molecule is an antibody or antibody fragment thereof. Insome embodiments, the first detection molecule and the second molecule are different from each other.

[0090] The first and second detection molecules bind to a first and second target site, respectively. In some embodiments, the first detection molecule is a first primary antibody or fragment thereof which binds directly to the first target site. In some embodiments, the first detection molecule is a first secondary antibody or fragment thereof that binds to a first primary antibody or fragment thereof which then binds directly to the first target site - in these embodiments, the binding of the first detection molecule to the first target site may be indirect, the first detection molecule nevertheless binds to the first target site. In some embodiments, the second detection molecule is a second primary antibody or fragment thereof which binds directly to the second target site. In some embodiments, the second detection molecule is a second secondary antibody or fragment thereof that binds to a second primary antibody or fragment thereof which then binds directly to the second target site - in these embodiments, the binding of the second detection molecule to the second target site may be indirect, the second detection molecule nevertheless binds to the second target site.

[0091] In some embodiments, the first detection molecule comprises multiple single stranded oligonucleotide tags. In some embodiments, the second detection molecule comprises multiple single stranded oligonucleotide tags. In some embodiments, both the first detection molecule and the second detection molecule comprise multiple single stranded oligonucleotide tags.

[0092] In some embodiments, the first detection molecule comprises a barcode and / or a UMI. In some embodiments, the second detection molecule comprises a barcode and / or a UMI. In some embodiments, each detection molecule of the composition comprises a barcode and / or a UMI.Target Site

[0093] The target site is a site of interest that is recognized and bound by a detection molecule described herein. In some embodiments, the target site is located on a target molecule or a molecule of interest. The term “site” refers to a region, a portion or a fragment of a molecule. For example, in cases where a target molecule is a protein, a target site can be a region or an epitope of the protein defined by amino acids of the protein that are either contiguous or noncontiguous. In some embodiments, the first target site and the second target site are on differenttarget molecules. In some embodiments, the first target site and the second target site are on the same target molecule.

[0094] In some embodiments, the first target molecule is a protein. In some embodiments, the second target molecule is a protein. In some embodiments, the first target molecule and the second target molecule are each a protein. In some embodiments, the first target molecule and the second target molecule are different from each other. In some embodiments, the first target molecule and the second target molecule are different. In some embodiments, the target molecule comprises more than one target site.

[0095] In some embodiments, the target molecule is in a biological sample. A biological sample may be obtained directly from an organism or from a sample obtained from an organism, e.g., from blood (e.g., a whole blood sample, serum sample, or plasma sample), urine, cerebrospinal fluid, seminal fluid, saliva, sputum, stool, and tissue. In some embodiments, the sample is from a biological sample or cultured cells, such as a primary cell culture or a cell line. In some embodiments, the biological sample includes cultures, i.e. cultured cells, cultured tissues, and laboratory cultures. The cells or tissues from which the samples are obtained may be infected with a virus or other intracellular pathogen. In some embodiments, the sample may be from a mammal. In some embodiments, the sample may be from an animal. The term "animal" includes mammals, for example, human, horse, camel, dog, cat, pig, cow, goat and sheep. In some embodiments, the sample is an intact tissue sample.

[0096] In some embodiments, the proximity of the first and second target sites is about 40 nm or less. In some embodiments, the proximity of the first and second target sites is about 35 nm or less. In some embodiments, the proximity of the first and second target sites is about 30 nm or less. In some embodiments, the proximity of the first and second target sites is about 25 nm or less. In some embodiments, the proximity of the first and second target sites is about 24 nm or less. In some embodiments, the proximity of the first and second target sites is about 23 nm or less. In some embodiments, the proximity of the first and second target sites is about 22 nm or less. In some embodiments, the proximity of the first and second target sites is about 21 nm or less. In some embodiments, the proximity of the first and second target sites is about 20 nm or less. In some embodiments, the proximity of the first and second target sites is about 19 nm orless. In some embodiments, the proximity of the first and second target sites is about 18 nm or less. In some embodiments, the proximity of the first and second target sites is about 17 nm or less. In some embodiments, the proximity of the first and second target sites is about 16 nm or less. In some embodiments, the proximity of the first and second target sites is about 15 nm or less. In some embodiments, the proximity of the first and second target sites is about 14 nm or less. In some embodiments, the proximity of the first and second target sites is about 13 nm or less. In some embodiments, the proximity of the first and second target sites is about 12 nm or less. In some embodiments, the proximity of the first and second target sites is about 11 nm or less. In some embodiments, the proximity of the first and second target sites is about 10 nm or less.Single Stranded Oligonucleotide Tag

[0097] The single stranded oligonucleotide tag is a short series of nucleotides arranged in a single strand and conjugated to a detection molecule as described herein. The single stranded oligonucleotide provides the nucleotides to which the proximity connection agent (PCA) hybridizes, allowing the PCA to connect two detection molecules in proximity to each other. The nucleotides of the single stranded oligonucleotide tag are complementary to the nucleic acid sequences which the PCA comprises, allowing the PCA to hybridize to the single stranded oligonucleotide tag. In some embodiments, the first detection molecule comprises a single stranded oligonucleotide tag. In some embodiments, the first detection molecule comprises multiple single stranded oligonucleotide tags. In some embodiments, the second detection molecule comprises a single stranded oligonucleotide tag. In some embodiments, the second detection molecule comprises multiple single stranded oligonucleotide tags. In some embodiments, the first detection molecule comprises a single stranded oligonucleotide tag and the second detection molecule comprises a single stranded oligonucleotide tag. In some embodiments, the first detection molecule comprises a single stranded oligonucleotide tag and the second detection molecule comprises multiple single stranded oligonucleotide tags. In some embodiments, the first detection molecule comprises multiple single stranded oligonucleotide tags and the second detection molecule comprises a single stranded oligonucleotide tag. In some embodiments, the first detection molecule comprises multiple single stranded oligonucleotide tags and the second detection molecule comprises multiple single stranded oligonucleotide tags.

[0098] In some embodiments, the single stranded oligonucleotide tag on the first detection molecule is different in length than the single stranded oligonucleotide tag on the second detection molecule. In some embodiments, the single stranded oligonucleotide tag(s) on the first detection molecule is / are the same length as the single stranded oligonucleotide tag(s) on the second detection molecule.

[0099] In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 30 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 25 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than no more than 20 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 18 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 16 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 14 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 12 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 10 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 9 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 8 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 7 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 6 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 5 nm in length. In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 4 nm in length.

[0100] In some embodiments, the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than about 130 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 125 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than no more than 120 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 115 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than no more than 110 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 105 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 100 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 95 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single strandedoligonucleotide tag are no more than 90 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 85 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 80 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 75 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 70 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 65 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 60 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 55 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 50 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 45 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single strandedoligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 40 nm in length. In some embodiments, wherein the first single stranded oligonucleotide and / or the second single stranded oligonucleotide comprise a sequencing barcode and / or UMI, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 35 nm in length.

[0101] In some embodiments, the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag each hybridize to both the first proximity connection agent (PCA) and the second PCA. In such embodiments, the hybridization of the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag with both the first and second PCA stabilizes the complex formed when the PCAs bind to the single stranded oligonucleotides. FIG. 6 shows an example of an embodiment where the first single stranded oligonucleotide tag (61) and the second single stranded oligonucleotide tag (64) each hybridize to the first PCA (63) and second PCA (66) where the first detection molecule (62) is conjugated directly to the first single stranded oligonucleotide tag (61) and the second detection molecule (65) is conjugated directly to the second single stranded oligonucleotide tag (64).

[0102] In some embodiments, the first single stranded oligonucleotide tag and the first detection molecule are conjugated to each other directly, e.g., covalently without an intermediate. In some embodiments, the second single stranded oligonucleotide tag and the second detection molecule are conjugated to each other directly, e.g., covalently without an intermediate. In some embodiments, the first single stranded oligonucleotide tag and the first detection molecule are conjugated to each other through an adapter. In some embodiments, the second single stranded oligonucleotide tag and the second detection molecule are conjugated to each other through an adapter.

[0103] The adapter, which connects the detection molecule and the single stranded oligonucleotide tag, can be anything which allows the detection molecule and single stranded oligonucleotide tag to connect to each other. In some embodiments, the adapter is an oligonucleotide sequence. In some embodiments, the adapter is a small molecule. In some embodiments, the adapter is a single stranded oligonucleotide which is covalently attached to the detection molecule and hybridizes to a single stranded oligonucleotide tag at the 5’ or 3 ’end ofthe single stranded oligonucleotide tag. In some embodiments, an adapter hybridizes to a sequence at the 5’ or 3’ end of a single stranded oligonucleotide tag where the sequence the adapter hybridizes to is located outside of the region of the single stranded oligonucleotide tag to which a PCA hybridizes.

[0104] A non-limiting example of such an embodiment can be seen in FIG. 7. FIG. 7 shows an example of an embodiment where the first single stranded oligonucleotide tag (71) and the second single stranded oligonucleotide tag (75) each hybridize to the first PCA (73) and second PCA (77) where the first detection molecule (72) is conjugated to the first single stranded oligonucleotide tag (71) through an adapter (74) and the second detection molecule (76) is conjugated to the second single stranded oligonucleotide tag (75) through a second adapter (78).

[0105] In some embodiments, the single stranded oligonucleotide tag comprises a barcode and / or a UMI. In some embodiments, each single stranded oligonucleotide tag of the disclosed composition comprises a barcode and / or a UMI.

[0106] In some embodiments, the adapter comprises a barcode, a UMI, and / or a primer. In some embodiments, each adapter of the disclosed composition comprises a barcode, a UMI, and / or a primer. In some embodiments, an adapter hybridizes to a sequence at the 5’ or 3’ end of a single stranded oligonucleotide tag wherein the sequence to which the adapter hybridizes to is located outside of the region of the single stranded oligonucleotide tag to which a PCA hybridizes and the adapter comprises a barcode, UMI, and / or primer. Non-limiting examples of such embodiments can be seen in FIG. 8A and FIG. 9. FIG. 8A shows an example of an embodiment where the first single stranded oligonucleotide tag (81) and the second single stranded oligonucleotide tag (85) each hybridize to the first PCA (83) and second PCA (87) where the first detection molecule (82) is conjugated to the first single stranded oligonucleotide tag (81) through an adapter (84) and the second detection molecule (86) is conjugated to the second single stranded oligonucleotide tag (85) through a second adapter (88). FIG. 8B is a magnification of 82 and 84 in FIG. 8A. FIG. 8B shows an example of an embodiment where the adapter (84) comprises a barcode (84b), UMI (84c), and primer (84d). 84a is the portion of the adapter that hybridizes to the first single stranded oligonucleotide tag (81). FIG. 8C is a magnification of 86 and 88 in FIG. 8A. FIG. 8C shows an example of an embodiment where the adapter (88) comprises a barcode (88b), UMI (88c), and primer (88d). 88a is the portion of theadapter that hybridizes to the second single stranded oligonucleotide tag (85). Primers are used for polymerase chain reaction (PCR) and next generation sequencing (NGS) readouts of the proximity assay. Methods for PCR / NGS readouts are known in the art. A benefit of including the primer in the disclosed system is the ability to ligate the first and second detection molecules through a phosphodiester linkage using a DNA ligase; however, with the disclosed system the ligation selectively happens only if the first and second detection molecules are in proximity.

[0107] FIG. 9 shows an example of an embodiment where the first single stranded oligonucleotide tag (91) and the second single stranded oligonucleotide tag (95) each hybridize to the first PCA (93) and second PCA (97), which cross in this example of an embodiment. The first detection molecule (92) is conjugated to the first single stranded oligonucleotide tag (91) through an adapter (94) and the second detection molecule (96) is conjugated to the second single stranded oligonucleotide tag (95) through a second adapter (98). FIG. 9 then shows how the selection process occurs, either ligation occurs through a phosphodiester linkage when the first PCA (93) and second PCA (97) place the first detection molecule and the second detection molecule in proximity to each other through the hybridization of the first single stranded oligonucleotide tag (91) and the second single stranded oligonucleotide tag (95) (the right side of the double arrow) or oligonucleotides that are not in proximity either ligate through single site ligation or remain in solution, as shown occurring through the left side of the double arrow. Once ligated with a phosphodiester linkage, the ligated complex can undergo PCR for analysis.Proximity Connection Agent

[0108] In some embodiments, the composition comprises a first proximity connection agent (PCA). The PCA hybridizes to the single stranded oligonucleotide tags which are conjugated to the detection molecules of the composition. The PCA hybridizes with the single stranded oligonucleotide tags through the two nucleic acid molecules the PCA is comprised of. The hybridization occurs as the single stranded oligonucleotide tag is made of nucleotides that are complementary to the nucleic acids in the PCA. The PCA is only able to bind both single stranded oligonucleotide tags of the two detection molecules when the two single stranded oligonucleotide tags are in proximity to each other.

[0109] In some embodiments, the first PCA comprises a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag and a second nucleic acid sequence thathybridizes to the second single stranded oligonucleotide tag. In some embodiments, the first nucleic acid sequence of the first PCA hybridizes to the first single stranded oligonucleotide tag that is conjugated to the first detection molecule, while the second nucleic acid sequence of the first PCA hybridizes to the second single stranded oligonucleotide tag that is conjugated to the second detection molecule. In some embodiments, the hybridizations of the first and second nucleic acid sequences of the PCA to the first and second single stranded oligonucleotide tags occurs only when the first and second target sites are in proximity to each other.

[0110] In some embodiments, the first and second nucleic acid sequences of the first PCA are linked to each other directly on a same contiguous nucleic acid molecule, wherein the first nucleic acid sequence of the first PCA comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag. In some embodiments, the first and second nucleic acid sequences of the first PCA are linked to each other directly on a same contiguous nucleic acid molecule, wherein the second nucleic acid sequence of the PCA comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag. In some embodiments, the first and second nucleic acid sequences of the first PCA are linked to each other directly on a same contiguous nucleic acid molecule, wherein the first nucleic acid sequence of the first PCA comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag, and the second nucleic acid sequence of the PCA comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag.

[0111] In some embodiments, the first and second nucleic acid sequences of the first PCA are linked to each other through an oligonucleotide linker. In some embodiments, the first and second nucleic acid sequences of the first PCA are linked to each other through a chemical linker.

[0112] In some embodiments, the first PCA is long enough to allow for hybridization and any necessary overhang but is short enough to keep the correct distance of proximity. As such, in some embodiments, the first PCA is no more than about 40 nucleotides in length. In some embodiments, the first PCA is no more than about 35 nucleotides. In some embodiments, the first PCA is no more than about 30 nucleotides in length. In some embodiments, the first PCA isno more than about 25 nucleotides in length. In some embodiments, the first PCA is no more than about 20 nucleotides in length.

[0113] In some embodiments, the first PCA is at least 8 nucleotides in length. In some embodiments, the first PCA is at least 10 nucleotides in length. In some embodiments, the first PCA is at least 12 nucleotides in length. In some embodiments, the first PCA is at least 14 nucleotides in length. In some embodiments, the first PCA is at least 16 nucleotides in length.

[0114] In some embodiments, the first PCA comprises a sequencing barcode and / or UMI. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 140 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 135 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 130 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 125 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 120 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 115 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 110 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 105 nucleotides in length. In some embodiments, the first PCA is no more than about 100 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 95 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 90 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 85 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 80 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 75 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencingbarcode and / or UMI, the first PCA is no more than about 70 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 65 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 60 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 55 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 50 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 45 nucleotides in length. In some embodiments, wherein the first PCA comprises a sequencing barcode and / or UMI, the first PCA is no more than about 40 nucleotides in length.

[0115] In some embodiments, the second PCA is long enough to allow for hybridization and any necessary overhang but is short enough to keep the correct distance of proximity. As such, in some embodiments, the second PCA is no more than about 40 nucleotides in length. In some embodiments, the second PCA is no more than about 35 nucleotides. In some embodiments, the second PCA is no more than about 30 nucleotides in length. In some embodiments, the second PCA is no more than about 25 nucleotides in length. In some embodiments, the second PCA is no more than about 20 nucleotides in length.

[0116] In some embodiments, the second PCA is at least 8 nucleotides in length. In some embodiments, the second PCA is at least 10 nucleotides in length. In some embodiments, the second PCA is at least 12 nucleotides in length. In some embodiments, the second PCA is at least 14 nucleotides in length. In some embodiments, the second PCA is at least 16 nucleotides in length.

[0117] In some embodiments, the second PCA comprises a sequencing barcode and / or UMI. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 140 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 135 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 130 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / orUMI, the second PC A is no more than about 125 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 120 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 115 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 110 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 105 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 100 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 95 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 90 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 85 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 80 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 75 nucleotides in length. In some embodiments, the second PCA is no more than about 70 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 65 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 60 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 55 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 50 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 45 nucleotides in length. In some embodiments, wherein the second PCA comprises a sequencing barcode and / or UMI, the second PCA is no more than about 40 nucleotides in length.

[0118] In some embodiments, both the first PCA and the second PCA are each no more than 40 nucleotides in length. In some embodiments, both the first PCA and the second PCA are each at least 8 nucleotides in length.

[0119] In some embodiments, the first PCA further comprises a third nucleic acid sequence, wherein the first and second nucleic acid sequences are linked to each other through the third nucleic acid sequence. In some embodiments, the third nucleic acid sequence of the first PCA directly links the first nucleic acid sequence of the first PCA and the second nucleic acid sequence of the first PCA. In some embodiments, the third nucleic acid sequence of the first PCA is linked to the first nucleic acid sequence of the first PCA through an oligonucleotide linker. In some embodiments, the third nucleic acid sequence of the first PCA is linked to the first nucleic acid sequence of the first PCA through chemical linker. In some embodiments, the third nucleic acid sequence of the first PCA is linked to the first nucleic acid sequence of the first PCA and the second nucleic acid sequence of the first PCA through an oligonucleotide linker. In some embodiments, the third nucleic acid sequence of the first PCA is linked to the first nucleic acid sequence of the first PCA and the second nucleic acid sequence of the first PCA through chemical linker. In some embodiments, the third nucleic acid sequence of the first PCA is linked to the first nucleic acid sequence of the first PCA through an oligonucleotide linker while the third nucleic acid sequence of the first PCA is linked to the second nucleic acid sequence of the first PCA through a chemical linker. In some embodiments, the third nucleic acid sequence of the first PCA is linked to the first nucleic acid sequence of the first PCA through a chemical linker while the third nucleic acid sequence of the first PCA is linked to the second nucleic acid sequence of the first PCA through an oligonucleotide linker.

[0120] In some embodiments, at least one of the nucleotide sequences of the first PCA is folded into a secondary structure providing increased selectivity of hybridization.

[0121] In some embodiments, the composition further comprises a second proximity connection agent (PCA) comprising a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag of the first detection molecule and a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag, wherein the first nucleic acid sequence of the second PCA binds to a different portion of the first single stranded oligonucleotide tag than the first nucleic acid sequence of the first PCA binds and the secondnucleic acid sequence of the second PCA binds to a different portion of the second single stranded oligonucleotide tag than the second nucleic acid sequence of the first PCA binds.

[0122] In some embodiments, the first nucleic acid sequence of the second PCA and the second nucleic acid sequence of the second PCA are linked directly to each other. In some embodiments, the first nucleic acid sequence of the second PCA and the second nucleic acid sequence of the second PCA are linked to each other through an oligonucleotide linker. In some embodiments, the first nucleic acid sequence of the second PCA and the second nucleic acid sequence of the second PCA are linked to each other through a chemical linker.

[0123] In some embodiments, the first PCA comprises a barcode and / or a UMI. In some embodiments, the second PCA comprises a barcode and / or a UMI. In some embodiments, both the first and second PCAs comprise a barcode and / or a UMI.Adapters

[0124] In some embodiments, the first single stranded oligonucleotide tag and the first detection molecule are conjugated to each other directly, e.g., covalently without an intermediate molecule. In some embodiments, the second single stranded oligonucleotide tag and the second detection molecule are conjugated to each other directly, e.g., covalently without an intermediate molecule. In some embodiments, the first single stranded oligonucleotide tag and the first detection molecule are indirectly conjugated to each other through an adapter. In some embodiments, the second single stranded oligonucleotide tag and the second detection molecule are indirectly conjugated to each other through an adapter.

[0125] The adapter, which connects the detection molecule and the single stranded oligonucleotide tag, can be anything which allows the detection molecule and single stranded oligonucleotide tag to connect to each other. In some embodiments, the adapter is an oligonucleotide sequence. In some embodiments, the adapter is a small molecule. In some embodiments, the adapter is a single stranded oligonucleotide which is covalently attached to the detection molecule and hybridizes to the single stranded oligonucleotide tag at the 5’ or 3 ’end of the single stranded oligonucleotide tag. In some embodiments, an adapter hybridizes to a sequence at the 5’ or 3’ end of a single stranded oligonucleotide tag where the sequence theadapter hybridizes to is located outside of the region of the single stranded oligonucleotide tag to which a PCA hybridizes.

[0126] A non-limiting example of such an embodiment can be seen in FIG. 7. FIG. 7 shows an example of an embodiment where the first single stranded oligonucleotide tag (71) and the second single stranded oligonucleotide tag (75) each hybridize to the first PCA (73) and second PCA (77) where the first detection molecule (72) is conjugated indirectly to the first single stranded oligonucleotide tag (71) through an adapter (74) and the second detection molecule (76) is conjugated indirectly to the second single stranded oligonucleotide tag (75) through a second adapter (78).

[0127] In some embodiments, the adapter is in the range of 2-16 nucleotides in length. In some embodiments, the adapter is in the range of 2-14 nucleotides in length. In some embodiments, the adapter is in the range of 2-12 nucleotides in length. In some embodiments, the adapter is in the range of 2-10 nucleotides in length. In some embodiments, the adapter is in the range of 2-8 nucleotides in length.

[0128] In some embodiments, the adapter comprises a sequencing barcode and / or a UMI. A non-limiting example of such an embodiment can be seen in FIG. 8. FIG. 8 A shows an example of an embodiment where the first single stranded oligonucleotide tag (81) and the second single stranded oligonucleotide tag (85) each hybridize to the first PCA (83) and second PCA (87) where the first detection molecule (82) is conjugated to the first single stranded oligonucleotide tag (81) through an adapter (84) and the second detection molecule (86) is conjugated to the second single stranded oligonucleotide tag (85) through a second adapter (88). FIG. 8B is a magnification of 82 and 84 in FIG. 8A. FIG. 8B shows an example of an embodiment where the adapter (84) comprises a barcode (84b), UMI (84c), and primer (84d). 84a is the portion of the adapter that hybridizes to the first single stranded oligonucleotide tag (81). FIG. 8C is a magnification of 86 and 88 in FIG. 8A. FIG. 8C shows an example of an embodiment where the adapter (88) comprises a barcode (88b), UMI (88c), and primer (88d). 88a is the portion of the adapter that hybridizes to the second single stranded oligonucleotide tag (85).

[0129] FIG. 9 shows a non-limiting example of an embodiment where the first single stranded oligonucleotide tag (91) and the second single stranded oligonucleotide tag (95) each hybridize to the first PCA (93) and second PCA (97), which cross in this example of an embodiment. Thefirst detection molecule (92) is conjugated to the first single stranded oligonucleotide tag (91) through an adapter (94) and the second detection molecule (96) is conjugated to the second single stranded oligonucleotide tag (95) through a second adapter (98). The adapters of FIG. 9 each comprise a barcode, UMI, and primer.

[0130] In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-120 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-115 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-110 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-105 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-100 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-95 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-90 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-85 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-80 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-75 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-70 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-65 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-60 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-55 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-50 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-45 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-40nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 10-35 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 5-30 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 5-25 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 5-20 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 5-19 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 5-18 nucleotides in length. In some embodiments, wherein the adapter comprises a sequencing barcode and / or a UMI, the adapter is in the range of 5-17 nucleotides in length.Linkers

[0131] As described above, the first PCA, and in some embodiments the second PCA, of the disclosure comprises a first nucleic acid sequence and a second nucleic acid sequence that are linked together either directly or through a linker. The overall length of the PCA is a determining factor of what defines “proximity” of the target sites. If the overall length of the PCA is long, proximity of the target sites increases, whereas if the overall length of the PCA is short, proximity of the target sites is small. As such, the use of a linker and the length of the linker may directly correlate to the proximity of the target sites. For this disclosure, the common unit of length for a single nucleotide used is 0.676 nm.

[0132] In some embodiments, the linker in the first PCA is no more than 22 nm in length. In some embodiments, the linker in the first PCA is no more than 20 nm in length. In some embodiments, the linker in the first PCA is no more than 18 nm in length. In some embodiments, the linker in the first PCA is no more than 16 nm in length. In some embodiments, the linker in the first PCA is no more than 14 nm in length. In some embodiments, the linker in the first PCA is no more than 12 nm in length. In some embodiments, the linker in the first PCA is no more than 10 nm in length. In some embodiments, the linker in the first PCA is no more than 9 nm in length. In some embodiments, the linker in the first PCA is no more than 8 nm in length. In some embodiments, the linker inthe first PC A is no more than 7 nm in length. In some embodiments, the linker in the first PC A is no more than 6 nm in length. In some embodiments, the linker in the first PCA is no more than 5 nm in length. In some embodiments, the linker in the first PCA is no more than 4 nm in length. In some embodiments, the linker in the first PCA is no more than 3 nm in length. In some embodiments, the linker in the first PCA is no more than 2 nm in length. In some embodiments, the linker in the first PCA is no more than 1 nm in length. In some embodiments, the linker in the first PCA is less than 1 nm in length. In some embodiments, the linker is 0 nm in length, i.e. there is no linker and the nucleic acid sequences of the first PCA are directly linked.

[0133] In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 105 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 100 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 95 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 90 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 85 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 80 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 75 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 70 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 65 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 60 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 55 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 50 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 45 nm in length. Insome embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 40 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 35 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 30 nm in length. In some embodiments, wherein the linker in the first PCA comprises a sequencing barcode or UMI, the linker in the first PCA is no more than 25 nm in length.

[0134] In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 150 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 145 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 140 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 135 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 130 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 135 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 130 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 125 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 120 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 115 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 110 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no morethan 105 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 100 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 95 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 90 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 85 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the first PCA comprises no more than 80 nucleotides.

[0135] In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 75 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 70 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 65 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 60 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 55 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 50 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 45 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 40 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 35 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 30 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 25 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 20 nucleotides. In some embodiments, wherein the linker in the first PCA is anoligonucleotide, the linker in the first PCA comprises no more than 15 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 14 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 13 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 12 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 11 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 10 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 9 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 8 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 7 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 6 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 5 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 4 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 3 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 2 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the first PCA comprises no more than 1 nucleotide. In some embodiments, there is no linker in the first PCA and the nucleic acid sequences of the first PCA are directly linked.

[0136] In some embodiments, the linker in the first PCA is a chemical linker. In some embodiments, the linker in the first PCA is an amino linker. In some embodiments, the linker in the first PCA is a 5’-5’ amino modifier. In some embodiments, the linker in the first PCA is a nucleic acid linker. In some embodiments, the linker in the first PCA is a dsDNA helical turn (see FIG. 2C for an exemplary embodiment). In some embodiments, the dsDNA helical turn is no more than 16 base pairs in length. In some embodiments, the dsDNA helical turn is no morethan no more than 15 base pairs in length. In some embodiments, the dsDNA helical turn is no more than no more than 14 base pairs in length. In some embodiments, the dsDNA helical turn is no more than base pairs in length. In some embodiments, the dsDNA helical turn is no more than 12 base pairs in length. In some embodiments, the dsDNA helical turn is no more than 11 base pairs in length. In some embodiments, the dsDNA helical turn is no more than 10 base pairs in length.

[0137] In some embodiments, the linker in the first PCA is an alkane. In some embodiments, the alkane is selected from the group consisting of: methane, ethane, propane, butane, pentane, hexane, heptane, octane, nonane, and decane. In some embodiments, the linker in the first PCA is an alkene. In some embodiments, the alkene is selected from the group consisting of: ethene, propene, butene, pentene, hexene, heptene, octene, nonene, and decene. In some embodiments, the linker in the first PCA is an alkyne. In some embodiments, the alkyne is selected from the group consisting of: ethyne, propyne, butyne, pentyne, hexyne, heptyne, octyne, nonyne, and decyne. In some embodiments, the linker in the first PCA is an aromatic compound. In some embodiments, the alkane, alkene, alkyne, or aromatic compound comprise side groups.

[0138] In some embodiments, the linker in the first PCA is Formula I. In some embodiments, the linker in the first PCA is Formula II. In some embodiments, the linker in the first PCA is Formula III. In some embodiments, the linker in the first PCA is Formula IV. In some embodiments, the linker in the first PCA is Formula V.

[0139] In some embodiments, the linker in the second PCA is no more than 22 nm in length. In some embodiments, the linker in the second PCA is no more than 20 nm in length. In some embodiments, the linker in the second PCA is no more than 18 nm in length, In some embodiments, the linker in the second PCA is no more than 16 nm in length, In some embodiments, the linker in the second PCA is no more than 14 nm in length, In some embodiments, the linker in the second PCA is no more than 12 nm in length, In some embodiments, the linker in the second PCA is no more than 10 nm in length, In some embodiments, the linker in the second PCA is no more than 9 nm in length, In some embodiments, the linker in the second PCA is no more than 8 nm in length, some embodiments, the linker in the second PCA is no more than 7 nm in length, In some embodiments, the linker in the second PCA is no more than 6 nm in length, embodiments, the linker in the second PCA is no more than 5 nm in length, In some embodiments, the linker in the second PCA is no more than 4 nm in length, embodiments, the linker in the second PCA is no more than 3 nm in length, In some embodiments, the linker in the second PCA is no more than 2 nm in length, embodiments, the linker in the second PCA is no more than 1 nm in length. In some embodiments, the linker is 0 nm in length, i.e. there is no linker and the nucleic acid sequences of the second PCA are directly linked.

[0140] In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 75 nucleotides. In some embodiments,wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 70 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 65 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 60 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 55 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 50 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 45 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 40 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 35 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 30 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 25 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the second PCA comprises no more than 20 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 15 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 14 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 13 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide, the linker in the second PCA comprises no more than 12 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 11 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 10 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 9 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 8 nucleotides. In some embodiments,wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 7 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 6 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 5 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 4 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 3 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 2 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide, the linker in the second PCA comprises no more than 1 nucleotide. In some embodiments, there is no linker in the second PCA and the nucleic acid sequences of the second PCA are directly linked.

[0141] In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 105 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 100 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 95 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 90 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 85 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 80 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 75 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 70 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 65 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 60 nm in length. In some embodiments,wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 55 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 50 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 45 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 40 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 35 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 30 nm in length. In some embodiments, wherein the linker in the second PCA comprises a sequencing barcode or UMI, the linker in the second PCA is no more than 25 nm in length.

[0142] In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 150 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 145 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 140 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 135 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 130 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 135 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 130 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 125 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCAcomprises no more than 120 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 115 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 110 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 105 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 100 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 95 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 90 nucleotides. In some embodiments, wherein the linker in the second PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 85 nucleotides. In some embodiments, wherein the linker in the first PCA is an oligonucleotide and comprises a sequencing barcode or UMI, the linker in the second PCA comprises no more than 80 nucleotides.

[0143] In some embodiments, the linker in the second PCA is a chemical linker. In some embodiments, the linker in the second PCA is an amino linker. In some embodiments, the linker in the second PCA is a 5’ -5’ amino modifier. In some embodiments, the linker in the second PCA is a nucleic acid linker. In some embodiments, the linker in the second PCA is a dsDNA helical turn. In some embodiments, the dsDNA helical turn is no more than 16 base pairs in length. In some embodiments, the dsDNA helical turn is no more than no more than 15 base pairs in length. In some embodiments, the dsDNA helical turn is no more than no more than 14 base pairs in length. In some embodiments, the dsDNA helical turn is no more than base pairs in length. In some embodiments, the dsDNA helical turn is no more than 12 base pairs in length. In some embodiments, the dsDNA helical turn is no more than 11 base pairs in length. In some embodiments, the dsDNA helical turn is no more than 10 base pairs in length.

[0144] In some embodiments, the linker in the second PCA is an alkane. In some embodiments, the alkane is selected from the group consisting of: methane, ethane, propane, butane, pentane, hexane, heptane, octane, nonane, and decane. In some embodiments, the linker in the second PCA is an alkene. In some embodiments, the alkene is selected from the group consisting of: ethene, propene, butene, pentene, hexene, heptene, octene, nonene, and decene. In some embodiments, the linker in the second PCA is an alkyne. In some embodiments, the alkyne is selected from the group consisting of: ethyne, propyne, butyne, pentyne, hexyne, heptyne, octyne, nonyne, and decyne. In some embodiments, the linker in the second PCA is an aromatic compound. In some embodiments, the alkane, alkene, alkyne, or aromatic compound comprise side groups.

[0145] In some embodiments, the linker in the second PCA is Formula I. In some embodiments, the linker in the second PCA is Formula II. In some embodiments, the linker in the second PCA is Formula III. In some embodiments, the linker in the second PCA is Formula IV. In some embodiments, the linker in the second PCA is Formula V.

[0146] In some embodiments, the linker in the first PCA and the linker in the second PCA are the same length. In some embodiments, the linker in the first PCA and the linker in the second PCA are different. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 60 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 55 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 50 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 45 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 40 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 35 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 30 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 25 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 20 nm of each other. In some embodiments, the first and second nucleic acidsequences of the first PC A are within the proximity of 15 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 10 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 9 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 8 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 7 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 6 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 5 nm of each other. In some embodiments, the first and second nucleic acid sequences of the first PCA are within the proximity of 4 nm of each other.

[0147] In some embodiments, the linker comprises a barcode and / or a UMI.Complementary Oligonucleotide

[0148] In some embodiments, the composition comprises a complementary oligonucleotide. In some embodiments, the complementary oligonucleotide hybridizes with the nucleotides of the first nucleic acid sequence of the first PCA that form the 5’ overhang. In some embodiments, the complementary oligonucleotide hybridizes with the nucleotides of the second nucleic acid sequence that form the 3’ overhang. In some embodiments, the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the third nucleic acid sequence. In some embodiments, the complementary oligonucleotide hybridizes with the third nucleic acid sequence, wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the third nucleic acid.Amplification oligonucleotide

[0149] In some embodiments, the composition comprises an amplification oligonucleotide conjugated to a detection tag, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the first and second nucleic acid sequences. In some embodiments, the amplification oligonucleotide is a double-stranded DNA. In some embodiments, the double-stranded DNAcomprises at least one overhang of one or more unpaired nucleotides which hybridizes with the overhang of nucleotides of the complementary oligonucleotide.

[0150] In some embodiments, the detection tag conjugated to the amplification oligonucleotide comprises a fluorophore. In some embodiments, the fluorophore comprises coumarin, rhodamine, xanthese, fluorescein, cyanine, Alexa Fluor 488, Alexa Fluor 592, Alexa Fluor 647, or Alexa Fluor 750.

[0151] In some embodiments, the composition comprises an amplification oligonucleotide conjugated to a detection tag, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the third nucleic acid sequence.Methods of Detecting Target Sites in Proximity

[0152] Certain aspects of the current disclosure are directed to a method of detecting target sites in proximity, the method comprising: contacting target molecules with the first detection molecule and the second detection molecule in a composition for detecting target sites in proximity as described herein, to permit the first detection molecule to bind to a first target site in a first target molecule, and the second detection molecule to bind to a second target site in a second target molecule, wherein the first and second target molecules are the same or different molecules; contacting the target molecules with the first PCA in a composition as described herein, to permit the first nucleic acid sequence in the first PCA to hybridize to the first single stranded oligonucleotide tag conjugated to the first detection molecule and the second nucleic acid sequence to hybridize to the second single stranded oligonucleotide tag conjugated to the second detection molecule, when the first target site and the second target site are in proximity; and detecting binding of the first PCA to the first and second detection molecules, thereby determining that the first and second target sites are in proximity.

[0153] In some embodiments, the first target site and / or the second target site are on antibodies, and the antibodies are bound to their epitopes. In some embodiments, the first detection molecule and / or the second detection molecule bind to the target site located on an antibody that is bound to its epitope.

[0154] In some embodiments, the first target site and the second target site are in the same target molecule.

[0155] In some embodiments, the target molecules are in a biological sample. In some embodiments, the biological sample is a tissue sample, blood, serum, or cell cultures. Any tissue or body fluid specimen may be used as a source for target sites for use in the disclosed methods. In some embodiments, the tissue sample is a tissue section which is fixed and / or stained.

[0156] In referring to the contacting the target sites or target molecules with the first detection molecule and the second detection molecule, the target sites or target molecules are incubated in a solution comprising the first detection molecule, the second detection molecule, or the first and the second detection molecule. In referring to the contacting the target molecules with the first PCA and / or the second PCA, the target sites or target molecules which are bound by the first or second detection molecule are incubated in a solution comprising the first PCA, the second PCA, or the first PCA and the second PCA.

[0157] In some embodiments, the target sites or molecules are attached, directly or indirectly, to a solid support (e.g., a culture flask, a slide, or beads). For example, the tissue sample containing the target sites or molecules may be attached to a solid support. In some embodiments, the samples are digested or lysed, i.e., tissue extraction or cell lysate. In some embodiments, the target sites or molecules are attached to beads. Beads can include any that are able to aid protein purification through unbiased capture of the proteome. Unbiased capture of the entire proteome includes not skewing the capture of proteins to charge, size, or acidity of protein or peptides. Examples of such unbiased materials include polystyrene core beads with magnetite layers and carboxylated polymer surfaces. Such beads are known in the art and are commercially available, including Sera-Mag™ Carboxylate-Modified Magnetic Beads & SpeedBeads, AMPure XP beads, SPRI beads, activated N-hydroxy-succinimide (NHS) beads, and the like.

[0158] In some embodiments where the target molecules are attached to a solid support, the molecules are released from the solid support after the hybridization steps (i.e., after the first nucleic acid sequence in the first PCA hybridizes to the first single stranded oligonucleotide tag conjugated to the first detection molecule and the second nucleic acid sequence hybridizes to the second single stranded oligonucleotide tag conjugated to the second detection molecule) and before downstream detection and analysis. Methods for release of target molecules and othermolecules from a solid support are known in the art. Examples include enzyme digestion, heat, denaturing buffer, altering pH, and the like. In some embodiments, the enzymatic protein digestion is performed through proteases, including, peptidases (enzymes which hydrolyze peptide bonds between terminal amino acids) and proteinases (enzymes which hydrolyze internal peptide bonds. Some examples of proteases include, but are not limited to, trypsin, chymotrypsin, pepsin, GluC, Lys-C, and Proteinase K. In some embodiments, the proteinase is a Proteinase K. In some embodiments, the Proteinase K is a thermolabile Proteinase K.

[0159] In some embodiments, the Proteinase K is used at a concentration range of about 1% v / v to about 10% v / v. In some embodiments, the proteinase K is used at a concentration of about 1% v / v. In some embodiments, the proteinase K is used at a concentration of about 2% v / v. In some embodiments, the proteinase K is used at a concentration of about 3% v / v. In some embodiments, the proteinase K is used at a concentration of about 4% v / v. In some embodiments, the proteinase K is used at a concentration of about 5% v / v. In some embodiments, the proteinase K is used at a concentration of about 6% v / v. In some embodiments, the proteinase K is used at a concentration of about 7% v / v. In some embodiments, the proteinase K is used at a concentration of about 8% v / v. In some embodiments, the proteinase K is used at a concentration of about 9% v / v. In some embodiments, the proteinase K is used at a concentration of about 10% v / v.

[0160] In some embodiments, the enzymatic protein digestion is performed for about 15 minutes to about 3 hours, e.g. for about 15 minutes, for about 20 minutes, for about 25 minutes, for about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, about 75 minutes, about 90 minutes, about 105 minutes, about 120 minutes, about 135 minutes, about 150 minutes, about 165 minutes, and about 180 minutes.

[0161] In embodiments using protein digestion, the protein digestion method used is effectively halted or stopped after a period of time effective to sufficiently digest the proteins. In some embodiments, the method of halting the digestion includes, but is not limited to, heat deactivation, removal of digestion agent, or purification.

[0162] In some embodiments, the protein digestion method is halted by heat inactivation. In some embodiments, the heat inactivation occurs at a temperature above 50°C. In someembodiments, the heat inactivation occurs at a temperature above about 55°C. In some embodiments, the heat inactivation occurs at a temperature above about 60°C.

[0163] In some embodiments, the heat inactivation occurs in a range of time from about 5 minutes to about 30 minutes. In some embodiments, the heat inactivation occurs for about 5 minutes. In some embodiments, the heat inactivation occurs for about 10 minutes. In some embodiments, the heat inactivation occurs for about 15 minutes. In some embodiments, the heat inactivation occurs for about 20 minutes. In some embodiments, the heat inactivation occurs for about 25 minutes. In some embodiments, the heat inactivation occurs for about 30 minutes.

[0164] In embodiments where proteins are released from a solid support, the step of protein release occurs after step B and before step C.

[0165] In some embodiments, the target sites or target molecules are in suspension, i.e., solution.

[0166] The “contacting” or incubation of the target sites or target molecules can be performed for at least several minutes, for example, at least 5 minutes. In some embodiments, the contacting can be performed for at least 10 minutes. In some embodiments, the contacting can be performed for at least 15 minutes. In some embodiments, the contacting can be performed for at least 30 minutes. In some embodiments, the contacting can be performed for at least 45 minutes. In some embodiments, the contacting can be performed for at least an hour. In some embodiments, the contacting can be performed for at least 2 hours. In some embodiments, the contacting can be performed for at least 3 hours. In some embodiments, the contacting can be performed for at least 4 hours. In some embodiments, the contacting can be performed for at least 5 hours. In some embodiments, the contacting can be performed for at least 6 hours. In some embodiments, the contacting can be performed for at least 12 hours. In some embodiments, the contacting can be performed for at least 15 hours. In some embodiments, the contacting can be performed for at least 18 hours. In some embodiments, the contacting can be performed for at least 24 hours.

[0167] In some embodiments, the contacting is performed between 4°C and 40°C. In some embodiments, the contacting is performed at room temperature (about 27°C). In some embodiments, the contacting is performed at 4°C. Embodiments where the contacting isperformed at room temperature incur a shorter incubation period than embodiments where the contacting is performed at 4°C.

[0168] In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.001 μg to about 5 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.01 μg to about 4 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.05 μg to about 3.5 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.06 μg to about 3.4 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.07 μg to about 3.3 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.08 μg to about 3.2 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.09 μg to about 3.1 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.1 μg to about 3.0 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.15 μg to about 2.9 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.20 μg to about 2.8 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.25 μg to about 2.7 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.3 μg to about 2.6 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.35 μg to about 2.5 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.5 μg to about 2.5 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.6 μg to about 2.5 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.7 μg to about 2.5 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.8 μg to about 2.5 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 0.9 μg to about 2.5 μg. In some embodiments, the contacting with the first detection molecule is performed at a concentration range of about 1.0 μg to about 2.5 μg.

[0169] In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.001 μg to about 5 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.01 μg to about 4 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.05 μg to about 3.5 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.06 μg to about 3.4 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.07 μg to about 3.3 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.08 μg to about 3.2 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.09 μg to about 3.1 μg. In some embodiments, t the contacting with the second detection molecule is performed at a concentration range of about 0.1 μg to about 3.0 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.15 μg to about 2.9 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.20 μg to about 2.8 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.25 μg to about 2.7 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.3 μg to about 2.6 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.35 μg to about 2.5 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.5 μg to about 2.5 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.6 μg to about 2.5 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.7 μg to about 2.5 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.8 μg to about 2.5 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 0.9 μg to about 2.5 μg. In some embodiments, the contacting with the second detection molecule is performed at a concentration range of about 1.0 μg to about 2.5 μg.

[0170] The step(s) of contacting with the first and / or second detection molecule occurs with the detection molecules in an incubation buffer. In some embodiments, the buffer comprises PBS comprising a range of about 0.005% to about 0.5% detergent, a range of about 0.01% to about 0.1% dextran sulfate, and about 0. IX to 20X SSC buffer. In some embodiments, the detergent is selected from the group consisting of Tween-20, Tween-40, Tween-60, Tween-80, NP-40, Triton X-100, and Digitonin.

[0171] In some embodiments, the detecting the binding of the first PCA to the first and second detection molecules of step C) is performed by Polymerase Chain Reaction (PCR), sequencing, Enzyme Linked Immunosorbent Assay (ELISA), multiplex ligation-dependent probe amplification (MLP A), serial analysis of gene expression (SAGE), dot blot, flow cytometry, or immunohistochemistry. In some embodiments, the sequencing includes next generation sequencing (NGS), high throughput sequencing, sequencing by ligation, sequencing by hybridization, tag sequencing, or sequencing by synthesis.

[0172] In some embodiments, the method further comprises washing the sample between any one of steps A-C or any two of steps A-C.

[0173] In some embodiments, the steps are performed in sequential order. In some embodiments, the method further comprises a step of: D) contacting the target molecules with the second PCA of as described herein; wherein step D occurs after step A and before step C.

[0174] In some embodiments, step A and step D occur simultaneously. In some embodiments, the sample is washed after the sample is contacted with the second PCA of step D.

[0175] In some embodiments, the contacting the target molecules of any one of steps A, B, and D is performed for about 5 minutes to overnight for each of the steps. In some embodiments, the contacting the target molecules of steps A, B, and D is performed for the same period of time. In some embodiments, the contacting the target molecules of steps A, B, and D occurs for different periods of time wherein each period of time ranges from about 5 minutes to overnight. In some embodiments, the contacting the target molecules of any one of steps A, B, and D each is performed for any period of time, wherein each period of time ranges from about 5 minutes to overnight. In some embodiments, the contacting the target molecules the target sites or target molecules of any one of steps A, B, and D each can be performed for at least several minutes, forexample, at least 5 minutes. In some embodiments, the contacting can be performed for at least 10 minutes. In some embodiments, the contacting can be performed for at least 15 minutes. In some embodiments, the contacting can be performed for at least 30 minutes. In some embodiments, the contacting can be performed for at least 45 minutes. In some embodiments, the contacting can be performed for at least an hour. In some embodiments, the contacting can be performed for at least 2 hours. In some embodiments, the contacting can be performed for at least 3 hours. In some embodiments, the contacting can be performed for at least 4 hours. In some embodiments, the contacting can be performed for at least 5 hours. In some embodiments, the contacting can be performed for at least 6 hours. In some embodiments, the contacting can be performed for at least 12 hours. In some embodiments, the contacting can be performed for at least 15 hours. In some embodiments, the contacting can be performed for at least 18 hours. In some embodiments, the contacting can be performed for at least 24 hours.

[0176] In some embodiments, the contacting the target molecules of steps A, B, and D is performed at a temperature between about 4°C and 40°C. In some embodiments, the contacting the target molecules of steps A, B, and D is performed at the same temperature for all steps. In some embodiments, the contacting the target molecules of steps A, B, and D is performed at a different temperature wherein the temperature of each step is between about 4°C and 40°C.

[0177] Some embodiments of the method of the disclosure include an additional step of purification of, or "cleaning up", the oligonucleotide fragments, before the analysis in step C. Methods of purification of oligonucleotide fragments are known in the art. Some examples of methods to "clean up" the fragments include, but are not limited to, spin column, ethanol precipitation, High-Performance Liquid Chromatography (HPLC), polyacrylamide gel electrophoresis (PAGE), magnetic beads, Solid Phase Reversible Immobilization (SPRI) beads, enzymatic digestion, immunoprecipitation, and other affinity-based methods (e.g., ion exchange chromatography). In some embodiments, the clean up includes immunoprecipitating biotinylated oligonucleotides with streptavidin.Kits

[0178] Certain aspects of the disclosure are directed to a kit comprising any one or more of the elements disclosed in the above methods and compositions. In some embodiments, the kit comprises a composition as described herein. In some embodiments, the composition comprises:A) a first detection molecule conjugated to a first single stranded oligonucleotide tag, wherein the first detection molecule binds a first target site;B) a second detection molecule conjugated to a second single stranded oligonucleotide tag, wherein the second detection molecule binds a second target site; andC) a first proximity connection agent (PCA), wherein the first PCA comprises: i) a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence hybridizes to the first single stranded oligonucleotide tag and the second nucleic acid sequence hybridizes to the second single stranded oligonucleotide tags when the first and second target sites are in proximity.

[0179] In some embodiments, the composition further comprises D) a complementary oligonucleotide. In some embodiments, the composition further comprises E) an amplification oligonucleotide. In some embodiments, the amplification oligonucleotide is conjugated to a detection tag. In some embodiments, the components A, B, C, D, and E of the composition are packaged separately. In some embodiments, kit components are provided in combinations. In some embodiments, kit components are provided in any suitable container, such as a vial, a bottle, or a tube. In some embodiments, the kit further comprises instructions and / or a protocol.

[0180] In some embodiments, the kit comprises one or more reagents for use in a method for detecting target sites in proximity. For example, a kit may provide one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH from about 6 to about 10.EXAMPLESExample 1: Detection of One Protein In Situ

[0181] The disclosed technology is an assay capable of detecting one protein with high specificity and sensitivity, such as Proliferation marker protein Ki-67 (Ki-67), in a single sample, cells, or tissues, and imaging the signal produced. In this example, one detection molecule conjugated to a first single stranded oligonucleotide tag binds to a first region of the Ki-67 protein, and a second detection molecule with a second single stranded oligonucleotide tag binds to a second region of the same Ki-67 protein. A first PCA and a second PCA hybridize to the first and second single stranded oligonucleotide tags, respectively. The PCAs only hybridize when both first and second single stranded oligonucleotide tags are in close proximity to each other. The PCAs form 5’ or 3’ overhangs that enable the hybridization of complementary nucleic acids sequences. Once the PCAs hybridize stably, additional fluorescently labeled complementary oligonucleotides are added for hybridization and imaging. The 5’ and 3’ overhangs may be ligated to increase stability of the resulting double stranded oligonucleotide structures. A fluorescent signal can be visualized in samples, cells, or tissues only when both first and second detection molecules are in close proximity to each other on the same Ki-67 protein.

[0182] Such a strategy enables the use of two detection molecules that may or may not have high specificity and sensitivity for the protein of interest. For example, imaging a signal from each detection molecule individually may result in unwanted non-specific background. However, imaging a signal that is produced only when the two detection molecules are both binding the protein (in a precise proximity to each other) eliminates non-specific background noise.Example 2: Detecting Phosphorylation of One Protein In Situ

[0183] The disclosed technology is an assay capable of detecting post-translational phosphorylation of a protein. Here, detection of post-translational phosphorylation of one protein with two detection molecules is exemplified by detecting the phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) at serine 536, in a single sample, cells, or tissues, and imaging the signal produced (FIG. 5). In this example, one detection molecule conjugated to a first single stranded oligonucleotide tag(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGGTTCCGGTGCTGCTTTAAGGCCGGTCCTAGC*A*A (SEQ ID NO: 1)) binds to the NF-κB protein at residues surrounding Glu498, and a second detection molecule with a second single stranded oligonucleotide tag (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAGGTCTACCATTCAGCTTTAAG GCCGGTCCTAGC*A*A (SEQ ID NO: 2)) binds to the phosphorylated residue Ser536 of NF- KB protein. The first PCA (ACGTCTGAACTACAGCACCGTAGACCTTAG (SEQ ID NO: 3)) and the second PCA (GCTGAATGGGAACCTCGA (SEQ ID NO: 4)) hybridize to the first and second single stranded oligonucleotide tags. The first and second PCAs only hybridize to the first and second single stranded oligonucleotide tags when both first and second single stranded oligonucleotide tags are in close proximity to each other. The PCAs form 5’ or 3’ overhangs that enable the hybridization of additional fluorescent complementary nucleic acids sequences (TAGTTCAGACGT / 36-FAM / (SEQ ID NO: 5)). The 5’ and 3’ overhangs may be ligated to increase stability of the resulting double stranded oligonucleotide structures. A fluorescent signal can be visualized in samples, cells, or tissues only when NF-κB is phosphorylated at serine 536.Example 3: Detecting Post-translational Modifications of Proteins In Situ[0184J The proximity technology disclosed herein can detect post-translational modifications of proteins with high specificity and sensitivity. Such post-translational modifications can be, as a non-limiting example, the phosphorylation of signal transducer and activator of transcription 3 (STAT3) at tyrosine 705, in a single sample, cells, or tissues, and the signal produced can be detected and assessed in an imaging analysis. In this case, one or more detection molecules each conjugated to a first single stranded oligonucleotide tag bind to phospho-tyrosine residues in a manner largely independent of the surrounding amino acid sequence. A second detection molecule conjugated to a second single stranded oligonucleotide tag binds to the STAT3 protein. The first PCA and second PCA hybridize to the first and second single stranded oligonucleotide tags. The PCAs only hybridize stably when both first and second single stranded oligonucleotide tags are in close proximity to each other. The PCAs form 5’ or 3’ overhangs that enable the hybridization of complementary nucleic acids sequences. Once the PCAs hybridize stably, additional fluorescently labeled complementary oligonucleotides are added for hybridization and imaging. The 5’ and 3’ overhangs may be ligated to increase stability of the resulting double stranded oligonucleotide structures. A fluorescent signal can be visualized in samples, cells, ortissues only when both detection molecules are in close proximity to each other on the same STAT3 protein.

[0185] This strategy enables the use of two detection molecules that may or may not have high specificity and sensitivity for the post-translationally modified residue of interest. For example, imaging a signal from the detection molecule(s) that recognize phospho-tyrosine residues in a manner largely independent of the surrounding amino acid sequence results in signal from a large number of modified proteins. However, imaging a signal that is produced only when the two detection molecules are both bound and in proximity can better indicate the modified residue being detected is actually on your protein of interest. This strategy can be employed for all post- translational modifications, including but not limited to phosphorylation, glycosylation, ubiquitination, methylation, and acetylation.Example 4: Detection of Two Proteins in Proximity In Situ

[0186] The proximity technology disclosed herein is used as an assay for detecting two unique proteins, such as Programmed death-ligand 1 (PD-L1) and Programmed cell death protein 1 (PD- 1), in a single sample, cells, or tissues, and imaging the signal produced only when these proteins are within close proximity of each other. PD-L1 and PD-1 are protein receptors expressed on the cell membrane that are known to bind and interact with each other in trans to induce downstream signaling within the cells. In this assay of the disclosed technology, a first detection molecule conjugated to a first single stranded oligonucleotide tag binds to the PD-L1 protein and a second detection molecule conjugated to a second single stranded oligonucleotide tag binds to the PD-1 protein. The first PCA and second PCA hybridize to the first and second single stranded oligonucleotide tags, respectively. The PCAs only hybridize when both the first detection molecule and second detection molecule are bound to the PD-L1 and PD-1 epitopes and both first and second single stranded oligonucleotide tags are in close proximity to each other. The PCAs form 5’ or 3’ overhangs that enable the hybridization of additional complementary nucleic acids sequences. Once the PCAs hybridize stably, additional fluorescently labeled complementary oligonucleotides are added for hybridization and imaging. The 5’ and 3’ overhangs may be ligated to increase stability of the resulting double stranded oligonucleotide structures. A fluorescent signal can be visualized in samples, cells, or tissues only when PD-L1 and PD-1 proteins are in a predefined range of proximity to each other.Example 5: Multiplex Protein Detection Assay Tn Situ

[0187] The proximity technology disclosed herein is used as an assay capable of simultaneously detecting two or more proteins, such as Glycoprotein 130 (gp130), Janus kinase (JAK), and Signal transducer and activator of transcription 3 (STAT3), in a single sample, cells, or tissues, and imaging the signal produced when all proteins are in proximity. In this example, one detection molecule conjugated to a first single stranded oligonucleotide tag binds to the gp!30 protein, a second detection molecule with a second single stranded oligonucleotide tag binds to the JAK protein, and a third detection molecule with a third single stranded oligonucleotide tag binds to the STAT3 protein. To achieve detection of additional proteins, additional detection molecules with unique single stranded oligonucleotide tags could be utilized. PCAs hybridize to each unique single stranded oligonucleotide tags. The PCAs only hybridize when both all single stranded oligonucleotide tags are in close proximity to each other. The PCAs form 5’ or 3’ overhangs that enable the hybridization of additional complementary nucleic acids sequences. Once the PCAs hybridize stably, additional fluorescently labeled complementary oligonucleotides are added for hybridization and imaging. The 5’ and 3’ overhangs may be ligated to increase stability of the resulting double stranded oligonucleotide structures. A fluorescent signal can be visualized in samples, cells, or tissues only when all proteins are in close proximity.

[0188] This strategy enables the use of multiple detection molecules to detect protein complexes that form, for example, during the signaling pathways that result in changes to cellular function. Another example would include the detection of protein complexes formed to induce chromatin remodeling for DNA transcription.

[0189] Several analytes may be simultaneously detected by using several proximity-probe pairs, each specific for their distinct analyte. The proximity-probe pairs have unique nucleic acid sequences in order to distinguish them from other pairs. In one embodiment, the oligonucleotides all have the same PCR primer sites and the same ligation junction but unique identifier sequences. If different PCR primer sites and different ligation junctions are used, the risk of generating false PCR products due to cross reactivity greatly increases and that scenario should be avoided. During the PCR, the different amplicons representing the existence of different proteins are simultaneously amplified. These different PCR products may be detectedby any of several methods, such as DNA microarrays, mass spectrometry, gel electrophoresis (different lengths of products), or others. A true positive ligation must contain both sequence identification tags from correct pairs of oligonucleotides in order to score as a true positive. It is possible to use a DNA micro array for sorting unique amplification products corresponding to the presence of a certain protein.Example 6: Antibodies and Adapters for Proximity In Situ

[0190] The disclosed technology is an assay capable of using secondary detection molecules and universal adaptors for detecting one or more proteins. In this example, primary antibodies and adaptors are used for the detection of two proteins.

[0191] A first primary antibody binds to the PD-L1 protein, and a second primary antibody binds to the PD-1 protein. Following this, a first detection molecule conjugated to a first single stranded oligonucleotide tag indirectly binds to the target site through the first primary antibody bound to the PD-L1 protein. A second detection molecule conjugated to a second single stranded oligonucleotide tag indirectly binds to the target site through the second primary antibody bound to the PD-1 protein. Next, one adaptor binds to the first single stranded oligonucleotide tag and a second adaptor binds to the second single stranded oligonucleotide tag. A first PCA and second PCA hybridize to the first and second adaptor, respectively. The PCAs only hybridize when both first and second adaptors are in close proximity to each other. The PCAs form 5’ or 3’ overhangs that enable the hybridization of complementary nucleic acids sequences. Once the PCAs hybridize stably, additional fluorescently labeled complementary oligonucleotides are added for hybridization and imaging. The 5’ and 3’ overhangs may be ligated to increase stability of the resulting double stranded oligonucleotide structures. A fluorescent signal can be visualized in samples, cells, or tissues only when PD-L1 and PD-1 proteins are in close proximity.

[0192] This strategy enables enhanced flexibility when compared to Examples 1-4. The detection molecules are used to detect a variety of primary antibodies across different experiments, negating the need for each primary antibody to be conjugated to a unique single stranded oligonucleotide tag. Additionally, adaptors can be used to bind to a variety of single stranded oligonucleotide tags across different experiments, while maintaining the capability to hybridize to the PCAs required for the proximity readout.Example 7: In vitro Ligation with Adapters

[0193] As a proof of principle, an experiment was conducted to confirm that the complex (see FIG. 9 for example) can form and a ligated product can be made in vitro. As such, the complex was formed in the absence of detection molecules (i.e., (92) and (96) of FIG. 9). The first PCA, second PCA, first single stranded oligonucleotide tag, first adapter, second single stranded oligonucleotide tag, and second adapter were prepared and mixed. The mixture was ligated and then PCR amplified, and the PCR product was run on a DNA gel. FIG. 11 is a representative of the DNA gel and shows that the complex can form and a successful ligation product can be made in vitro. Differently designed oligonucleotides were used to show that the concept works with several sizes of oligos (Oligo 1 = 54 bp; Oligo 3 108 bp; and Oligo 4 (126 bp). The PCR amplified products in FIG. 11 are shown at the expected size. Controls used were lane 3 - ligation with no PCR amplification performed; lane 4 -negative control without ligation; lane 5 - oligo 1 without PCR (DNA template) = 54 bp (control); lane 6 - oligo3 without PCR (DNA template) = 108 bp (control); lane 7 - oligo4 without PCR (DNA template) = 126 bp (positive control for ligation); lane 8 - oligo3 (DNA template + PCR) = 150 bp (control); and lane 9 - oligo4 (DNA template + PCR) = 168 bp (positive control for ligation + PCR). As such, the first single stranded oligonucleotide tag (91) and the second single stranded oligonucleotide tag (95) each hybridize to the first PCA (93) and second PCA (97). While there were no detection molecules in this example, the first single stranded oligonucleotide tag (91) and an adapter (94) and the second single stranded oligonucleotide tag (95) through a second adapter (98) ligated to create the complex.Example 8: Bead Based Proximity Assay In Vitro Using Oligo-Conjugated Primary Antibodies

[0194] To show proof of concept for the proximity assay using beads, an experiment was run to detect purified PD-1 using oligo-conjugated (OC) primary antibodies. Cells were lysed to a protein concentration of ~2μg / μL or higher in lysis buffer comprising a detergent concentration of 0-10% and a salt concentration less than 1 M. The lysed cells were then sonicated and protein concentration was measured. In some instances, the lysates were frozen until further preparation.

[0195] Sera-Mag™ Carboxylate-Modified Magnetic Beads & SpeedBeads were used in this example; however, any similar polystyrene core beads with magnetite layers and carboxylatedpolymer surfaces or equivalent magnetic beads designed to bind proteins efficiently and unbiasedly are sufficient. The SP3 beads were washed with DNase and RNase free water and then resuspended in 100% ethanol. The resuspended beads and 150 ug protein lysate were combined and lysis buffer used to bring the final volume to 500 μL. The bead / protein combination was incubated at 22°C (room temperature) with shaking for 30 min. The bead / protein combination was then washed with ethanol. After the beads / protein combination was washed, the beads / protein combination was blocked with blocking buffer comprising detergent, protease / phosphatase inhibitor (PPI), denatured ssDNA, and reducing agent for 1.5 h at 4°C with rotation. After blocking, the blocked beads / protein combination was incubated with 0.1 μg of each primary antibody in 500 μL blocking solution without reducing agent at 4 °C overnight. After incubation with primary antibodies, the beads were washed in wash buffer.

[0196] In some embodiments, oligo-conjugated secondary antibodies were used and the washed beads comprising target proteins bound to primary antibodies were incubated with the oligo- conjugated secondary antibodies for at least an hour. The beads, bound primary antibodies, and bound secondary antibodies were then washed with wash buffer after incubation with oligo- conjugated secondary antibodies

[0197] The beads with bound oligo-conjugated antibodies were resuspended in Phosphate Buffered Saline (PBS), transferred to PCR tubes, and the PBS was then discarded using a magnetic rack.

[0198] The beads and bound antibodies then underwent ligation reaction with lx molar excess of each oligo compared to antibody comprising first single-stranded oligonucleotide tag, second single-stranded oligonucleotide tag, biotinylated first proximity connection agent (PCA), second PCA, ligation buffer, T4 ligase, and water. The combination was incubated in a thermal cycler for 45 min at 22°C, followed by heat inactivation for 10 min at 65°C. The tube was placed on a magnetic rack and supernatant discarded. Then the beads and bound antibodies were digested with Proteinase K where the beads were resuspended in thermolabile Proteinase K (5% v / v) in PBS and incubated at 37°C for 1.5 h with shaking. After incubation, the Proteinase K was heat inactivated by incubating for 10 min at 55°C.

[0199] The samples were cleaned up using streptavidin beads. Pre-prepared streptavidin beads were added to each sample and incubated at room temperature or 22°C with shaking for Ih.Tubes were placed on a magnet for 1 minute and supernatant removed. The beads were washed with DMSO followed by washes with PBS. The beads were suspended in PBS after the last wash.

[0200] The samples were then prepared for and run through PCR. The strong band in Lane 7 indicates detection of PD-1 when using the Mouse (Ms) and Human (Hu) oligo-conjugated antibodies that target PD-1. OC Anti -Hu and OC Anti -Ms were used as controls when OC Hu anti-PDl and OC Ms anti-PDl were not added to the assay, respectively.Example 9: Bead Based Proximity Assay In Vitro Using Oligo-Conjugated Secondary Antibodies

[0201] An experiment was performed to analyze if oligo-conjugated (OC) secondary antibodies would produce similar results as seen with OC primary antibodies. Cells were lysed and samples prepared as in Example 7 above. Then, the washed beads comprising target proteins bound to primary antibodies were incubated with the oligo-conjugated secondary antibodies for at least an hour. The beads, PD-1 bound primary antibodies, and bound OC secondary antibodies were then washed with wash buffer.

[0202] The beads with bound OC secondary antibodies were resuspended in PBS, transferred to PCR tubes, and the PBS was then discarded using a magnetic rack.

[0203] The beads and bound antibodies then underwent ligation reaction with lx molar excess of each oligo compared to antibody comprising first single-stranded oligonucleotide tag, second single-stranded oligonucleotide tag, biotinylated first proximity connection agent (PCA), second PCA, ligation buffer, T4 ligase, and water. The combination was incubated in a thermal cycler for 45 min at 22°C, followed by heat inactivation for 10 min at 65°C. The tube was placed on a magnetic rack and supernatant discarded. Then the beads and bound antibodies were digested with Proteinase K where the beads were resuspended in thermolabile Proteinase K (5% v / v) in PBS and incubated at 37°C for 1.5 h with shaking. After incubation, the Proteinase K was heat inactivated by incubating for 10 min at 55°C.

[0204] The samples were cleaned up using streptavidin beads. Pre-prepared streptavidin beads were added to each sample and incubated at room temperature or 22°C with shaking for Ih. Tubes were placed on a magnet for 1 minute and supernatant removed. The beads were washedwith DMSO followed by washes with PBS. The beads were suspended in PBS after the last wash.

[0205] FIG. 13 shows a representative PCR gel demonstrating that the proximity assay using the on-bead protocol can be used to detect purified PD-1 when using OC secondary antibodies. Both anti-human and anti-mouse OC secondary antibodies were tested, separately (lanes 2 and 3 of FIG. 13) and combined (lane 5 of FIG. 13). The band in Lane 5 indicates detection of PD-1 when using the anti-human and anti-Ms OC secondary antibodies. Lane 4 was a negative control where both anti-human and anti-Ms OC secondary antibodies were used but in the absence of an anti-PDl primary antibody. The band in lane 5 indicates detection of PD-1 when using the oligo-conjugated anti-human and oligo-conjugated anti-mouse secondary antibodies.Example 10: Solution Based Proximity Assay In Vitro

[0206] Cells were lysed to a protein concentration of ~2μg / μL or higher in lysis buffer comprising a detergent concentration of 0-10% and a salt concentration less than 1 M. The lysed cells were then sonicated and protein concentration was measured. In some instances, the lysate was frozen until further preparation.

[0207] 10-300 μg (e.g., 50 μg, 75 μg, 100 μg, 125 μg, 150 μg, 175 μg, 200 μg) protein lysate was incubated overnight at 4°C with 0.05 μg of each primary oligo-conjugated antibody in antibody incubation buffer.

[0208] The samples were allowed to warm at room temperature and then the ligation reaction was performed with lx molar excess of each oligo compared to Ab comprising first singlestranded oligonucleotide tag, second single-stranded oligonucleotide tag, proximity connection agent (PCA) biotinylated, PC A 2, ligation buffer, T4 ligase, and water. The combination was incubated in a thermal cycler for 45 min at 22°C, followed by heat inactivation for 10 min at 65°C.

[0209] After thermal cycler incubation, samples were transferred to Lo-Bind tube and thermolabile Proteinase K was added (5% v / v) in a total volume of 40 μL. The sample / Proteinase K mixture was incubated at 37°C for 1.5 h with shaking. After incubation, the Proteinase K was heat inactivated by incubating for 10 min at 55°C.

[0210] Streptavidin cleanup was performed. Pre-prepared streptavidin beads were added to each sample and incubated at 22°C with shaking for lh. Tubes were placed on a magnet for 1 minute and supernatant removed. The beads were washed with DMSO followed by washes with PBS. The beads were suspended in PBS after the last wash and ready for future applications.

[0211] FIG. 15 is a representative DNA gel of assay performed through the in-solution embodiment of proximity assay. PD-1 was used as target protein and anti-PD-1 oligoconjugated primary antibodies were used to perform the assay. Proteinase K digestion was implemented after the ligation. This embodiment additionally included streptavidin sample clean up after Proteinase K digestion.Example 11: DNA from Proximity Technology in PCR.

[0212] The DNA detected or isolated from the methods disclosed herein may be used in a number of polymerase chain reaction (PCR) technologies. These PCR technologies include, but are not limited to PCR, quantitative PCR, Reverse Transcriptase PCR, Nested PCR, Hot Start PCR, Long-Range PCR, and Multiplex PCR. The DNA from the proximity isolation can be used in PCR settings by way of multiple common readout methods. These readouts include, but are not limited to, electrophoresis and fluorescence. The electrophoresis readouts include, but are not limited to, agarose gel electrophoresis, capillary electrophoresis, and pulsed-field gel electrophoresis. The fluorescence readouts include, but are not limited to, fluorescent probes that interact with DNA of interest, fluorescence PCR with real-time monitoring, and quantification of fluorescent tagged DNA.

[0213] In an example of an embodiment of the disclosure, samples were prepared as described in Example 7 above. PCR analysis was run using a total of 15-30 cycles. Then PCR product was gel run on a 2% agarose DNA gel placed on a magnet so that only the supernatant was used for the gel run. Run at 135 V for 20-60 minutes and then visualize the gel.

[0214] In an example of an embodiment of the disclosure, samples were prepared as described in Example 9 above. PCR analysis was run using a total of 19-30 cycles. Then PCR product was gel run on a 2% agarose DNA gel placed on a magnet so that only the supernatant was used for the gel run. Run at 135 V for 20-60 minutes and then visualize the gel.Example 12: DNA from Proximity Assay for Use in Sequencing.

[0215] The DNA isolated from the proximity technology disclosed herein can be used as an input for a multitude of sequencing assays. These assays include next-generation sequencing (NGS), dideoxy sequencing (i.e. Sanger sequencing), and sequencing assays which rely on chemical modification of DNA followed by cleavage at specific bases (i.e. Maxam-Gilbert sequencing). The DNA isolated from the proximity technology disclosed herein can be used as input for NGS libraries (i.e. Illumina sequencing, Nanopore sequencing. Ion Torrent sequencing, PacBio sequencing). Such a use in NGS includes isolating or purifying DNA. fragments that contain sequences originating from the proximity technology for an NGS assay by way of size selection with magnetic beads or gel electrophoresis. The DNA isolated from the proximity technology disclosed herein can also be used for performing DNA shearing / fragmentation of sequences originating from the proximity technology including enzymatic shearing (i.e. restriction enzymes), mechanical shearing (i.e. sonication), or using transposase-based fragmentation (i.e. tagmentation). Additionally, the DNA isolated from the proximity technology disclosed herein can be used for introducing DNA sequences on the proximity technology (i.e. adapters) to enable or facilitate NGS after introducing additional sequences on the proximity technology using the tagmentation method or by introducing DNA sequences into primers in a PCR step. Once the adapter sequences are introduced to the DNA, adapter ligations are performed.

[0216] Applications using the DNA from the proximity technology for NGS include NGS methods that employ fluorescently labeled nucleotides to identify bases incorporated during DNA synthesis, NGS methods that employ real-time sequencing of single DNA molecules, NGS methods that employ protein channels to detect the passage of single DNA molecules, and NGS methods that detect pH changes using a semiconductor when incorporating nucleotides.

[0217] In an example, samples were prepared as described in Example 7 above. The beads suspended in PBS were prepared for NGS by running a first PCR with 5-20 cycles, capture of supernatant and AMPure bead cleanup performed. Size and concentration were confirmed after cleanup. Then PCR was run with Illumina indices for 5-10 cycles. Supernatant was captured and AMPure bead cleanup performed. Size and concentration were confirmed after cleanup. The samples were then analyzed through NGS.

[0218] In another example, the samples were prepared for NGS analysis. Preparation included running first PCR with 5-20 cycles, capture of supernatant and AMPure bead cleanup performed. Size and concentration were confirmed after cleanup. Then PCR was run with Illumina indices for 5-10 cycles. Supernatant was captured and AMPure bead cleanup performed. Size and concentration were confirmed after cleanup. The samples were then analyzed through NGS.Example 13: DNA from Proximity Technology in Multiplexing.

[0219] The DNA isolated from the proximity technology disclosed herein can be used for multiplexing in NGS or qPCR. The DNA sequences isolated from the proximity technology can be used as barcodes or Unique Molecular Identifiers (UMIs). This can be in the form of any DNA nucleotide ranging from 1 nucleotide to 100 nucleotides.

Claims

WHAT IS CLAIMED IS:

1. A composition comprising:A) a first detection molecule conjugated to a first single stranded oligonucleotide tag, wherein the first detection molecule binds a first target site;B)a second detection molecule conjugated to a second single stranded oligonucleotide tag, wherein the second detection molecule binds a second target site; andC) a first proximity connection agent (PC A), wherein the first PC A comprises: i) a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence hybridizes to the first single stranded oligonucleotide tag and the second nucleic acid sequence hybridizes to the second single stranded oligonucleotide tags when the first and second target sites are in proximity.

2. The composition of claim 1, wherein the first and second nucleic acid sequences are linked to each other directly on a same contiguous nucleic acid molecule, and wherein (i) the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag, and / or (ii) the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag.

3. The composition of claim 1, wherein the first and second nucleic acid sequences are linked to each other through an oligonucleotide or chemical linker.

4. The composition of claim 3, wherein (i) the first nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the first single stranded oligonucleotide tag, and / or (ii) the second nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the second single stranded oligonucleotide tag.

5. The composition of claim 1, wherein the PCA further comprises a third nucleic acid sequence, wherein the first and second nucleic acid sequences are linked to each other through the third nucleic acid sequence.

6. The composition of claim 5, wherein the first, second, and third nucleic acid sequences of the PCA are linked through a direct linkage, an oligonucleotide linker, or a chemical linker.

7. The composition of claim 1, wherein the first nucleic acid sequence comprises nucleotides that form a 3’ overhang upon hybridization to the first single stranded oligonucleotide tag, and the second nucleic acid sequence comprises nucleotides that form a 5’ overhang upon hybridization to the second single stranded oligonucleotide tag.

8. The composition of claim 4, further comprising:D) a complementary oligonucleotide, wherein the complementary oligonucleotide hybridizes with the nucleotides of the first nucleic acid sequence that form the 5’ overhang or with the nucleotides of the second nucleic acid sequence that form the 3’ overhang, and wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the first or second nucleic acid sequence in the PCA; andE) an amplification oligonucleotide conjugated to a detection tag, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the first or second nucleic acid sequence in the PCA.

9. The composition of claim 5, further comprising:D) a complementary oligonucleotide, wherein the complementary oligonucleotide hybridizes with the third nucleic acid sequence, and wherein the complementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the third nucleic acid; andE) an amplification oligonucleotide conjugated to a detection tag, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the third nucleic acid.

10. The composition of claim 7, further comprising:D) a complementary oligonucleotide, wherein the complementary oligonucleotide hybridizes with the nucleotides in the first nucleic acid sequence that form the 3’ overhang and the nucleotides in the second nucleic acid sequence that form the 5’ overhang, and wherein thecomplementary oligonucleotide comprises nucleotides that form an overhang after hybridization to the first and second nucleic acid sequences; andE) an amplification oligonucleotide conjugated to a detection tag, wherein the amplification oligonucleotide hybridizes with the nucleotides of the complementary oligonucleotide that form the overhang after hybridization to the first and second nucleic acid sequences.

11. The composition of any one of claims 1-10, wherein at least one of the nucleotide sequences of the first PCA is folded into a secondary structure providing increased selectivity of hybridization.

12. The composition of any one of claims 1-11, further comprising:F) a second PCA, wherein the second PCA comprises: i) a first nucleic acid sequence that hybridizes to the first single stranded oligonucleotide tag of the first detection molecule, wherein the first nucleic acid sequence of the second PCA and the first nucleic acid sequence of the first PCA bind to different portions of the first single stranded oligonucleotide tag; and ii) a second nucleic acid sequence that hybridizes to the second single stranded oligonucleotide tag of the second detection molecule, wherein the second nucleic acid sequence of the second PCA and the second nucleic acid sequence of the first PCA bind to different portions of the second single stranded oligonucleotide tag; wherein the first nucleic acid sequence and the second nucleic acid sequence of the second PCA are linked directly to each other on the same contiguous nucleic acid molecule or through a chemical or oligonucleotide linker.

13. The composition of any one of claims 1-12, wherein the first single stranded oligonucleotide tag and the second single stranded oligonucleotide tag are no more than 130, no more than 120, no more than 110, no more than 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 25, no more than 20, no more than 18, no more than 16, no more than 14, no more than 12, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, or no more than 4 nm in length.

14. The composition of any one of claims 1-13, wherein:the first detection molecule and the first single stranded oligonucleotide tag are directly conjugated to each other; and / or the second detection molecule and the second single stranded oligonucleotide tag are directly conjugated to each other.

15. The composition of claim 12, further comprising: a first adapter wherein the first detection molecule is indirectly conjugated to the first oligonucleotide tag through the first adapter; and / or a second adapter wherein the second detection molecule is indirectly conjugated to the second single stranded oligonucleotide tag through the second adapter.

16. The composition of claim 15, wherein the first adapter is a single stranded oligonucleotide covalently attached to the first detection molecule wherein the first adapter hybridizes to the first single stranded oligonucleotide tag at the 5’ or 3’end of the first single stranded oligonucleotide tag; and / or the second adapter is a single stranded oligonucleotide covalently attached to the second detection molecule wherein the second adapter hybridizes to the second single stranded oligonucleotide tag at the 5’ or 3’end of the second single stranded oligonucleotide tag.

17. The composition of claim 15 or 16, wherein the first adapter comprises a barcode, Unique Molecular Identifier (UMI), and / or primer; and / or the second adapter comprises a barcode, UMI, and / or primer.

18. The composition of any one of claims 1-17, wherein the first and second nucleic acid sequences of the first PC A are within the proximity of 60 nm of each other.

19. The composition of any one of claims 1-18, wherein the first detection molecule and / or the second detection molecule is an antibody or fragment thereof.

20. The composition of claim 19, wherein the first detection molecule is a first primary antibody or fragment thereof which binds directly to the first target site, or a first secondary antibody or fragment thereof that binds to the first primary antibody or fragment thereof which binds directly to the first target site; and / orthe second detection molecule is a second primary antibody or fragment thereof which binds directly to the second target site, or a second secondary antibody or fragment thereof that binds to the second primary antibody or fragment thereof which binds directly to the second target site.

21. The composition of any one of claims 1-20, wherein the amplification oligonucleotide is a double-stranded DNA and comprises at least one overhang of one or more unpaired nucleotides which hybridizes with the overhang of nucleotides of the complementary oligonucleotide.

22. The composition of any one of claims 1-21, wherein the detection tag conjugated to the amplification oligonucleotide comprises a fluorophore.

23. The composition of claim 22, wherein the fluorophore comprises coumarin, rhodamine, xanthese, fluorescein, cyanine, Alexa Fluor 488, Alexa Fluor 592, Alexa Fluor 647, or Alexa Fluor 750.

24. The composition of any one of claims 1-23, wherein the first target molecule and / or the second target molecule is a protein.

25. The composition of any one of claims 1-24, wherein the first and second target molecules are molecules in a sample and the sample is a tissue sample.

26. The composition of any one of claims 1-25, wherein the proximity of the first and second target molecules is 40 nm or less.

27. The composition of any one of claims 1-26, wherein the second PCA comprises a hairpin structure.

28. The composition of any one of claims 1-27, wherein the first target molecule and second target molecule are the same molecule.

29. The composition of any one of claims 1-27, wherein the first target molecule and second target molecule are different molecules.

30. The composition of any one of claims 1-29, wherein the first detection molecule and / or the second detection molecule comprise multiple single stranded oligonucleotide tags.

31. The composition of any one of claims 1-30, wherein the single stranded oligonucleotide tag(s) on the first detection molecule is / are different in length than the single stranded oligonucleotide tag(s) on the second detection molecule.

32. The composition of any one of claims 1-30, wherein the single stranded oligonucleotide tag(s) on the first detection molecule is / are the same length as the single stranded oligonucleotide tag(s) on the second detection molecule.

33. The composition of any one of claims 1-32, wherein the first and / or the second PC A is no more than 40 nucleotides in length.

34. The composition of any one of claims 1-33, wherein the linker in the first and / or the second PCA is no more than 125, no more than 120, no more than 110, no more than 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 25, no more than 24, no more than 23, no more than 22, no more than 20, no more than 18, no more than 16, no more than 14, no more than 12, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nm in length.

35. The composition of claim 34, wherein the linker is 0 nm in length.

36. The composition of any one of claims 1-35, wherein the linker in the first and / or the second PCA is a chemical linker, amino linker, or nucleic acid linker.

37. The composition of claim 36, wherein the linker in the first and or second PCA is a dsDNA helical turn, an alkane, alkene, alkyne, or an aromatic compound.

38. The composition of claim 37, wherein the dsDNA helical turn is no more than 16, no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, or no more than 10 base pairs in length.

39. The composition of claim 37, wherein the alkane is selected from the group consisting of: methane, ethane, propane, butane, pentane, hexane, heptane, octane, nonane, and decane.

40. The composition of claim 37, wherein the alkene is selected from the group consisting of: ethene, propene, butene, pentene, hexene, heptene, octene, nonene, and decene.

41. The composition of claim 37, wherein the alkyne is selected from the group consisting of: ethyne, propyne, butyne, pentyne, hexyne, heptyne, octyne, nonyne, and decyne.

42. The composition of claim 37, wherein the alkane, alkene, alkyne, or aromatic compound comprises side groups.

43. The composition of claim 42, wherein the linker is a 5’ -5’ amino modifier.

44. The composition of claim 43, wherein the linker is selected from the group consisting of:

45. A method of detecting target sites in proximity, the method comprising:A) contacting target molecules with the first detection molecule and the second detection molecule in the composition of any one of claims 1-44, to permit the first detection molecule to bind to a first target site in a first target molecule, and the second detection molecule to bind to a second target site in a second target molecule, wherein the first and second target molecules are the same or different molecules;B) contacting the target molecules with the first PCA in the composition of any one of claims 1-44, to permit the first nucleic acid sequence in the first PCA to hybridize to the first single stranded oligonucleotide tag conjugated to the first detection molecule and the second nucleic acid sequence to hybridize to the second single stranded oligonucleotide tag conjugated to the second detection molecule, when the first target site and the second target site are in proximity; andC) detecting binding of the first PCA to the first and second detection molecules, thereby determining that the first and second target sites are in proximity.

46. The method of claim 45, wherein the first target site and the second target site are in the same target molecule.

47. The method of claim 45, wherein the target molecules are in a biological sample.

48. The method of claim 47, wherein the biological sample is a tissue sample, blood, serum, or cell cultures.

49. The method of any one of claims 45-48, wherein prior to step A, the sample is brought into contact with a solid support to permit the target molecules in the sample to bind to the solid support.

50. The method of claim 49, wherein the sample is a tissue sample and the tissue sample is fixed and / or stained.

51. The method of any one of claims 45-48, wherein the sample is in solution, and steps A and B are performed in solution.

52. The method of claim 51, wherein the sample is a cell lysate comprising the target molecules.

53. The method of either claim 49 or 50, wherein the target molecules are released from the solid support after step B and before step C.

54. The method of claim 53, wherein the release is achieved by adding a protease.

55. The method of claim 54, wherein the protease is a Proteinase K.

56. The method of claim 54 or 55, wherein the protease is inactivated or removed after an incubation period and before step C.

57. The method of any one of claims 45 to 56, wherein the detecting of step C is performed by Polymerase Chain Reaction (PCR), sequencing, Enzyme Linked Immunosorbent Assay (ELISA), multiplex ligation-dependent probe amplification (MLPA), serial analysis of gene expression (SAGE), dot blot, flow cytometry, or immunohistochemistry.

58. The method of claim 57, wherein the sequencing includes next generation sequencing (NGS), high throughput sequencing, sequencing by ligation, sequencing by hybridization, tag sequencing, or sequencing by synthesis.

59. The method of claim 45, further comprising washing the sample between any one of steps A-C or any two of steps A-C.

60. The method of either claim 45 or claim 57, wherein the steps are performed in sequential order.

61. The method of any one of claims 45-60, further comprising a step of:D) contacting the target molecules with the second PCA of any one of claims 12-44; wherein step D occurs after step A and before step C.

62. The method of claim 54, wherein step A and step D occur simultaneously.

63. The method of claim 54, wherein the sample is brought into contact with a solid support to permit the target molecules to bind to the solid support prior to step A, and the target molecules are released from the solid support after step A and before step D.

64. The method of claim 54, wherein the sample is brought into contact with a solid support to permit the target molecules to bind to the solid support prior to step A, and the target molecules are released from the solid support after step D and before step B.

65. The method of either claim 61 or 64, further comprising a wash step after the target molecules are contacted with the second PCA of step D.

66. The method of any one of claims 45-65, wherein the contacting the target molecules of any one of steps A, B, and D occurs for about 5 minutes to overnight for each of the steps.

67. The method of claim 66, wherein the contacting the target molecules of steps A, B, and D occurs for the same period of time.

68. The method of claim 66, wherein the contacting the target molecules of steps A, B, and D occurs for different periods of time wherein each period of time ranges from about 5 minutes to overnight.

69. The method of claim 66, wherein the contacting the target molecules of any one of steps A, B, and D each occurs for any period of time, wherein each period of time ranges from about 5 minutes to overnight.

70. The method of any one of claims 45-69, wherein the contacting the target molecules of steps A, B, and D occurs between about 4°C and 40°C.

71. The method of claim 70, wherein the contacting the target molecules of steps A, B, and D occurs at the same temperature for all steps.

72. The method of claim 70, wherein the contacting the target molecules of steps A, B, and D occur at a different temperature wherein the temperature of each step is between about 4°C and 40°C.

73. The method of any one of claims 45-72, further comprising a step of cleaning up the sample after step B and before step C.

74. The method of either claim 73, wherein the cleaning up comprises use of a spin column, ethanol precipitation, High-Performance Liquid Chromatography (HPLC), polyacrylamide gel electrophoresis (PAGE), Solid Phase Reversible Immobilization (SPRI), magnetic bead, enzymatic digestion, immunoprecipitation, or ion exchange chromatography.

75. A kit comprising the composition of any one of claims 1-44.

76. The kit of claim 75, wherein component A, B, C, D, and E of the composition are packaged separately.

77. The kit of either claim 75 or 76, further comprising instructions and / or a protocol.

78. The kit of any one of claims 75-77, further comprising a solid support for conducting the assay.

79. The kit of claim 78 wherein the solid support is a slide.

80. The kit of claim 78, wherein the solid support is a preparation of beads.

Images