DNA mismatch anchoring compounds and uses thereof

Abstract

Mismatch anchoring compounds (MACs) are disclosed that recognize and bind to specific base-pair mismatches (mmBP) present within single stranded or double stranded DNA, RNA, and oligonucleotide sequences, and enable the ex vivo identification of DNA / RNA point mutations (DNAPM / RNAPM), including disease-associated, rare, and low abundance DNAPM / RNAPM, and the isolation and elimination of mmBP-positive cells. The use of MACs in vitro and in vivo (a) blocks mmBP-positive DNA replication and gene transcription / expression, (b) inhibits mmBP-positive cell proliferation, (c) reverses, prevents, and / or treats mmBP-rnediated disease, aging, and age-related disorders, (d) blocks mmBP-positive RNA and / or RNA-DNA duplex translation and inhibits the production of abnormal disease-causing proteins, (e) silence mmBP-positive genes, and (f) blocks intracellular pathogen replication. MAC-conjugates and their uses are disclosed, including MACs radiolabeled with SPECT / PET / particle-emitting isotopes for radioimaging and / or radiotherapy of mmBP-positive diseases.

Description

DNA MISMATCH ANCHORING COMPOUNDS AND USES THEREOFFIELD OF THE INVENTION

[0001] The invention provides novel Mismatch Anchoring Compounds (MACs) which form multiple specific hydrogen bonds with mismatched base pairs (mmBPs) in DNA, RNA, and other oligonucleotides, and their uses.CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to the filing of U.S. Provisional Patent Application No. 63 / 695,970, filed September 8, 2024, the disclosure of which is incorporated by reference herein in its entirety.BACKGROUND OF THE INVENTION

[0003] The tissues and organs of adult mammals consist of various cell types. Most of these cells (e.g., neurons, skeletal and cardiac muscle cells) do not or cannot proliferate while some (e.g., hair follicles, skin cells) are constantly dividing. Throughout life, the DNA of each of these proliferating and nonproliferating cells gradually accumulate “base pair mismatches” (mmBPs), mainly as a result of exposure to exogenous mutagenic chemicals and physical agents (e.g., tobacco, UV irradiation) or endogenous reactive metabolites (e.g., reactive oxygen, free radicals), that cause changes in DNA bases. For example, spontaneous deamination of cytosine and its conversion to uracil is estimated to occur >100 times per mammalian cell per day and creates a U:G mismatch (instead of C:G).mmBPs also result from mis-repair or unrepair ofmmBPs errors due to the absence of one or more DNA mismatch repair proteins (MMR) (e.g., MLH1, MLH3, MSH2, MSH3, MSH6, PMS1, and / or PMS2), and / or deficiencies in MMR processes consequent to the occurrence of mutations in MMR-associated genes or their epigenetic silencing.

[0004] In non-proliferating cells, such DNA damage - as well as deficiencies, impairments, and / or absence of MMR processes - leads to the production and accumulation of canonical base pair DNA point mutations (CDNAPMor DNAPM) andmmBP-positive DNA point mutations (mmDNAPMormmDNA) that have been implicated in various diseases including cancer and neurodegenerative diseases (e.g., Huntington's and Alzheimer’s disease). In proliferating cells,mmBPs also appear, particularly consequent to random or stochastic DNA copying errors that occur during normal aberrant DNA processing reactions each time a cell replicates its DNA and divides. Unless repaired, these alterations can lead to DNA™ and epigenetic changes (such as altered DNAmethylation patterns) that may affect the quantity, structure, and / or activity of the gene or gene product and cause various diseases.

[0005] In dividing cells (FIG. 1A),mmBP errors generated during DNA replication will lead, if unrepaired / misrepaired, to the production of aCBPPMfollowing the next cell division. In nondividing cells, where one or more base substitution(s) occurred in the noncoding template strand of DNA because of oxidative stress, slippage during DNA repair, and / or the existence of poorly efficient or nonfunctional MMR systems resulting from mutations in the MMR genes,mmDNAPMandCDNAPMwill accumulate and increase in numbers over time (FIG. IB). When the aberrant base within the mismatch is in the noncoding template strand of a DNA’s gene, the changed codon may result in a codon that expresses (i) the same amino acid and therefore the production of the same protein (i.e., silent mutations), or (ii) a different amino acid that leads to the production of a defective pathogenic protein (e.g., amyloid beta, tau) that misfolds, aggregates, impairs synaptic function, and / or disrupts cellular processes, all of which contributing to the onset and progression of e.g., neurodegenerative (Alzheimer’s, Huntington, Parkinson, etc.) diseases.

[0006] Since such mutations are predominantly neutral passenger mutations, most of these changes are inconsequential. However, some of these are proliferatively advantageous driver mutations that often precede disease diagnosis by many years, if not decades. The long-term continued accumulation of these genomic events in a normal cell can lead in rare occasions to (i) the production, secretion, and accumulation of altered proteins (e.g., extracellular amyloid beta (AP) plaques (between neurons) and intracellular tau neurofibrillary tangles (within neurons), both leading to Alzheimer’s disease), and / or (ii) its transformation into a malignant cell. It is estimated that most cancers carry multiple somatic point mutations while harboring fewer insertions, deletions, and rearrangement.

[0007] A key concern facing screening and / or diagnostic applications is the ability to detect clinically significant ultralow-level mutations, especially for early cancer detection from bodily fluids and / or tissue biopsies. Efficient detection of disease-relevant mutations will depend on the method(s) employed to analyze various types of samples, including precancerous or cancerous cells or tissue, wherein the sample is typically composed of both wild-type DNA and point mutationcontaining DNA, and the quantity of the former exceeds that of the latter by several orders of magnitude. Since standard polymerase chain reaction (PCR) will amplify both the major (wild type) and minor (mutant) alleles with the same efficiency, the ability to easily detect the presence of low- level mutations is often occluded. While the use of specialized PCR techniques can specifically amplify low frequency mutant alleles in the presence of excess wild-type DNA and improve detectionsensitivity, the accurate detection, identification, and quantitation of the ultralow abundance mutations (particularly <0.01%) continues to be extremely difficult. As such, it would be highly advantageous to develop methods that can easily and rapidly enrich disease-associated known or unknownCDNAPMandmmDNAPMpresent within very high excesses of wild-type DNA (e.g., ratio of 1 in 108or more).

[0008] Current pathology-based biomarkers of disease (e.g., cancer) suffer from low interobserver concordance and therefore yield incomplete information on the most likely clinical course for the patient. Current technologies that aim to differentiate and identify rare differences / mutations / mismatches in DNA amongst a mostly wild-type genome and / or use hybridization prior to / during / post amplification and sequencing are expensive, time consuming, often complicated, and fraught with problems that lower their specificities, sensitivities, and accuracies and as such, limiting their utility in clinical decision making. For example, since the melting temperature (Zm) of DNA containingCDNAPMor one or moremmBP is often only slightly lower than that for the wild type canonical DNA (FIG. 4), it is necessary to use a high-resolution melting curve apparatus that is expensive and time consuming. As such, there is a need for improved and cost- efficient methods that can accurately differentiate between wild type DNA (DNAWT) and disease- associated known or unknownCDNAPMandmmDNAPM.

[0009] There continues to be a need for highly accurate and noninvasive genomic analyses platforms that allow the detection and / or differentiation of one or multiple DNA point mutations and mismatches that underly diseases and disorders.SUMMARY OF THE INVENTION

[0010] In one aspect, the present invention provides novel Mismatch Anchoring Compounds (MACs) which form multiple specific hydrogen bonds with mismatched base pairs (mmBPs) and / or canonical base pairs which flankmmBPs, and / or nonspecific intermolecular electrostatic bonds between MAC -bound positively charged groups (e.g., ammonium groups) and the negatively charged phosphate groups present within a DNA backbone.

[0011] In another aspect, the invention provides methods of using MACs to enable the rapid and accurate detection ofCDNAPM / RNAPMpresent within any DNA / RNA test sample, including those where the mutant allele is mixed with vast excesses of DNAWT / RNAWT

[0012] In another aspect, the invention provides methods of using MACs for the isolation, detection, identification, and quantitation of known or unknown disease-associatedCDNAPMand / ormmDNAPMpresent within double stranded oligonucleotides or within hairpin(s) of single strandedoligonucleotides.

[0013] In another aspect, the invention provides methods of using MACs for the enrichment of disease-associatedCDNAPMandmmDNAPM(orCRNAPMandmmRNAPM) variant that is / are present within DNA / RNA samples isolated from bodily fluids, cells, and / or tissues, or those present in synthetic oligonucleotides.

[0014] In another aspect, the invention provides methods of sing MACs to capture and eliminate all or specificmmDNAPM / mmRNAPMfrom DNA / RNA samples prior to or post amplification.

[0015] In another aspect, the invention provides methods of using MACs to eliminate PCR inhibitors and non-targetmmBP-containing amplicons from DNA samples.

[0016] In another aspect, the invention provides using MACs to inhibit the amplification ofmmBP errors generated during amplification of DNA test samples.

[0017] In another aspect, the invention provides methods of using MACs for the quantification ofmmDNAPMmutational burdens in normal and diseased cells, tissues, and bodily fluids.

[0018] In another aspect, the invention provides methods of using MACs for the quantification of tumor mutational burdens in tumor cells, tumor biopsies, and bodily fluids.

[0019] In another aspect, the invention provides methods of using MACs for molecular profiling of tissue biopsies and bodily fluids obtained from patients with various diseases (to aid in screening, diagnosis, targeted therapy selection, treatment response monitoring, post-treatment tumor surveillance, and recurrence and / or residual disease).

[0020] In another aspect, the invention provides methods of using MACs for binding intracellularmmDNAPMand / ormmRNAPMin vitro or in vivo post administration, including but not limited to (1) blocking the replication ofmmDNAPMin cancerous and / or non-cancerousmmBP positive cells, (2) inhibiting the proliferation of prokaryotic and eukaryotic cells whose DNA / RNA ismmBP positive, (3) killing prokaryotic and eukaryotic cells whose DNA / RNA ismmBP positive, (4) killing cancerous and / or non-cancerousmmBP positive cells, (5) blocking DNA transcription ofmmBP positive genes, (6) regulating the expression ofmmBP positive genes, (7) silencing allmmBP-containing genes, (8) silencing one or more specificmmBP-containing genes, (9) blocking transcription ofmmBP-positive mRNA molecules, (10) inducing cellular reprogramming, tissue repair, tissue regeneration, tissue rejuvenation, organ regeneration, (11) preventing, treating, and / or reversing aging, aging-related disorder, autoimmune diseases, acute injuries, cancers, cardiovascular diseases, chronic diseases, diseases affecting any tissue in a subject, genetic diseases, hematological diseases, inflammatory diseases, metabolic disorders, neurodegenerative disease, neurological diseases, proliferativediseases, psychiatric disorders, and / or any combination thereof, and (12) radioimaging and radiotherapy of cancerous lesions and other non-cancerous disease

[0021] In another aspect, the invention provides methods of contacting MACs with ammBP- positive DNA sample in order to (1) substantially and selectively increase the thermal stabilities - and therefore the melting temperature (Zm) ofmmDNA, and (2) enable (i) rapid and accurate differentiation (by, e.g., melting curve analysis) betweenCDNAPM,mmDNAPM, and DNAWT, and (ii) detection and / or identification ofmmBP(s) present within a DNA test samples.

[0022] In another aspect, the invention provides methods of contacting one or more MACs with a DNA sample prior to its amplification (e.g., by PCR) in order to (1) form (i) multiple H-bonds between MACs and one or moremmBP present in the sample DNA, (ii) intermolecular electrostatic bonds between positively charged groups on said MACs and the negatively charged phosphate groups in the sample DNA, and (iii) H-bonds and covalent bonds - in the presence or absence of UV irradiation - between DNA crosslinking molecules (covalently attached to MACs) and nucleosides that are in close proximitymmBPs, and (2) block the extension ofmmBP-containing amplicon / oligonucleotide at every amplification cycle.

[0023] In another aspect, the invention provides MACs conjugated to a fluorophore (F-MACs) and methods of using F-MACs having affinity for a specificmmBP to enable the detection, identification, and / or quantitation of the BP forming the mismatch.

[0024] In another aspect, the invention provides F-MACs and methods of using F-MACs that are specific to allmmBP to enable the quantification of mutational burdens, including tumor mutational burdens, in diseased cells, tissues, and DNA isolated from bodily fluids.

[0025] In another aspect, the invention provides methods of using F-MACs to detect or treat cancerous lesions (e.g., melanoma) wherein said lesion is irradiated (e.g., laser) following the incubation of the F-MAC that is specific tommBP(s) present within the cells of said lesion.

[0026] In another aspect, the invention provides methods of using one or more F-MACs having unique fluorophores to identifymmDNA-positive cells / tissues, and enabling the rapid and accurate (i) detection ofmmBPs present within probed cells / tissues, (ii) identification of nucleobases forming mismatch(es), (iii) isolation ofmmDNA-positive cells (e.g., by fluorescence activated cell sorting (FACS), and / or (iv) elimination ofmmDNA-positive cells post FACS.

[0027] In another aspect, the invention provides biotinylated MACs (B-MACs) and methods of contacting one or more B-MACs specific to one or moremmBP(s) with a sample that contains a DNAWT-mmDNAPMmixture to enable the rapid and specific (i) capture, isolation, and purification ofthemmDNAPMand its subsequent use, (ii) detection and identification of the bases forming the mismatch(es), (iii) enrichment of themmDNAPM, or (iv) elimination of all or specificmmDNAPMfrom a sample prior to / post amplification and / or sequencing.

[0028] In another aspect, the invention provides MACs that are used to capture, isolate, and purify guide RNA (gRNA) used in CRISPR (as well as any hairpin- / loop- / stem-loop-positive DNA or RNA molecules, e.g., telomere-G-quadruplexes, tRNA, ribozymes, aptamers, MS2 bacteriophage), the method comprising contacting a gRNA sample with a MAC that is specific to themmBPs present within the loop of said gRNA, and isolating the gRNA.

[0029] In another aspect, the invention provides MACs that are used to capture, isolate, and purify pri-miRNA and pre-miRNA from bodily fluids and tissue biopsies, the method comprising contacting a miRNA Sample with a MAC that is specific to themmBPs present within the loop of said miRNA, and isolating miRNA.

[0030] In another aspect, the invention provides methods of using MACs to detect and quantify aberrant methylation patterns in DNAWT,CDNAPMandmmDNAl> Ipresent in bodily fluids and tissues.

[0031] In another aspect, the invention provides methods of using MACs to enable the rapid and accurate detection of one or more multiple disease-associatedmmDNAPMandmmBP-positive DNA- RNA heteroduplex hybrids.

[0032] In another aspect, the invention provides methods for the topical application of MACs (e.g., creams, lotions, foams, pastes, ointments, gels, sprays, and patches) for the transdermal administration and binding of said MACs to intracellularmmBP-positive DNA present in one or more disease- or aging-associated genes, wherein said binding blocks DNA helicase-mediated H-bond disruption, stalling DNA Polymerase, blocking DNA replication, and inhibiting further proliferation and / or killing of such dividing skin cells.

[0033] In another aspect, the invention provides methods for the in vitro or in vivo incubation of MACs with eukaryotic or prokaryotic cells and binding of MACs to specific intracellularmmBP- positive DNA present in one or more disease-causing genes of cancerous or non-cancerous proliferating diseased cells, wherein said binding blocks DNA helicase-mediated H-bond disruption, stalling DNA Polymerase, blocking DNA replication, and inhibiting the proliferation and / or killing of such dividing cells.

[0034] In another aspect, the invention provides methods for administering MACs to an animal to bind MACs to specific intracellularmmBP-positive DNA present in one or more disease-causing genes of cancerous or non-cancerous proliferating diseased cells, wherein said binding blocks DNAhelicase-mediated H-bond disruption, stalling DNA Polymerase, blocking DNA replication, and inhibiting the proliferation and / or killing of such dividing cells.

[0035] In another aspect, the invention provides methods for administering MACs to an animal to bind MACs to specific intracellularmmBP-positive DNA present in one or more condition- or diseasecausing genes of cancerous or non-cancerous proliferating diseased cells, wherein the disease or condition is one or more of aging and age-related disorders, autoimmune / cardiovascular / bone / chronic (e.g., Diabetes) / communicable disease, diseases affecting a tissue in a subject, genetic / hematological / inflammatory / neurodegenerative (e.g., Alzheimer’s, Parkinson, Huntingtonj / neurological / proliferative diseases (e.g., cancer), metabolic / psychiatric disorders.

[0036] In another aspect, the invention provides methods of administering MACs to an animal to cause binding of MACs to intracellularmmBP present within pre-mRNA-DNA duplex molecules or withinmmBP-positive loops present within mRNA molecules, wherein said binding blocks translation, production of abnormal disease-causing proteins, and / or biological effects of gene expression

[0037] In another aspect, the invention provides radioactive MACs and their use in positron emission topography (PET) (e.g.,18F or124I) or single photon emission computed tomography (SPECT) (e.g., "mTc,U 1ln,1231,131I) imaging and / or radiotherapy (e.g.,33P,67Cu,77Br,90Y,n iIn,123I,125I,1311,211At,213Bi,223Ra,225AC) ofmmBP-containing cancerous and precancerous cells and lesions.

[0038] In another aspect, the invention provides assays to identify one or moremmBP in DNA and / or RNA that alone, or in combination with patient clinical information, will enable the identification of disease signatures in a subject.

[0039] In another aspect, the invention provides methods for assessing the risk of developing a disease or condition, predicting a disease, monitoring disease progression or regression, assessing the efficacy of a treatment, treating or preventing a disease, or identifying a drug capable of ameliorating or treating a disease. For example, the disclosed compositions and methods may be used to determine whether a primary tumor will progress into metastatic cancer.

[0040] In another aspect, the invention provides a method for determining the presence and / or levels of one or moremmBP(s) biomarkers, wherein the identified biomarker(s) is indicative of the diagnosis (e.g., presence or absence), prognosis, or the risk of developing a disease.

[0041] In another aspect, the invention provides methods for assessing the efficacy of a treatment for a disease, monitoring the progression or regression of a disease, or identifying a compoundcapable of ameliorating or treating a disease, in a subject wherein the identification of saidmmBP is indicative of the efficacy of the treatment for the disease, or the progression or regression of the disease, or whether the compound is capable of ameliorating or treating the disease, in the subject.

[0042] It should be noted that the methods of this invention can be used together with any known diagnostic method(s), such as physical inspection, visual inspection, biopsy, scanning, histology, radiology, imaging, ultrasound, genetic testing, and / or immunological testing. Accordingly, the invention provides non-invasive assays for the early detection of a disease, i.e., before the disease can be diagnosed by conventional diagnostic techniques, e.g., imaging techniques, and, therefore, provide a foundation for improved decision-making relative to the needs and strategies for intervention, prevention, and treatment of individuals with such a disease or condition.BRIEF DESCRIPTIONS OF THE DRAWINGS

[0043] FIG. 1 (A and B) shows certain schematics of the disclosed MACs.

[0044] FIG. 2 shows schematics ofmmBP, loops, and stem loops found within double stranded polynucleotides (dsPN) and single stranded polynucleotides (ssPN) that are targeted by the disclosed MACs.

[0045] FIG. 3 shows certain schematics of intracellular events that lead to the production of disease-causingmmDNAPMandCDNAPMin proliferating (A) and quiescent (B) cells.

[0046] FIG. 4 is a graph depicting the dissociation (melting) curves of DNAWTandmmDNAPM(±MAC) as a function of temperature.

[0047] FIG. 5 shows embodiments of (i) single-ring aromatic, (ii) multi-ring aromatic, (iii) fused aromatic, (iv) single-bond conjugated aromatic, (v) multi-bond conjugated aromatic, and (vi) linear MACs that form 4, 5, 6, 7, 8, 9, or 10 H-bonds specifically with adenine-adeninemmBP(s) present in dsPN and ssPN.

[0048] FIG. 6 shows embodiments of (i) single-ring aromatic, (ii) multi-ring aromatic, (iii) fused aromatic, (iv) single-bond conjugated aromatic, (v) multi-bond conjugated aromatic, and (vi) linear MACs that form 6, 7, 8, 9, or 10 H-bonds specifically with cytosine-cytosinemmBP(s) present in dsPN and ssPN.

[0049] FIG. 7 shows embodiments of (i) single-ring aromatic, (ii) multi-ring aromatic, (iii) fused aromatic, (iv) single-bond conjugated aromatic, (v) multi-bond conjugated aromatic, and (vi) linear MACs that form 6, 7, 8, 9, 10, 11, 12, 13, or 14 H-bonds specifically with guanine-guaninemmBP(s) present in dsPN and ssPN.

[0050] FIG. 8 shows embodiments of (i) single-ring aromatic, (ii) multi-ring aromatic, (iii) fused aromatic, (iv) single-bond conjugated aromatic, (v) multi-bond conjugated aromatic, and (vi) linear MACs that form 4, 5, 6, 7, 8, 9, or 10 H-bonds specifically with thymine-thymine, uracil-thymine, thymine-uracil, and uracil-uracilmmBP(s) present in dsPN and ssPN.

[0051] FIG. 9 shows embodiments of (i) single-ring aromatic, (ii) multi-ring aromatic, (iii) fused aromatic, (iv) single-bond conjugated aromatic, (v) multi-bond conjugated aromatic, and (vi) linear MACs that form 5, 6, 7, 8, 9, or 10 H-bonds specifically with adenine-cytosine and / or cytosineadeninemmBP(s) present in dsPN and ssPN.

[0052] FIG. 10 shows embodiments of (i) single-ring aromatic, (ii) multi-ring aromatic, (iii) fused aromatic, (iv) single-bond conjugated aromatic, (v) multi-bond conjugated aromatic, and (vi) linear MACs that form 5, 6, 7, 8, 9, 10, 11, or 12 H-bonds specifically with adenine-guanine and / or guanine- adeninemmBP(s) present in dsPN and ssPN.

[0053] FIG. 11 shows embodiments of (i) single-ring aromatic, (ii) multi-ring aromatic, (iii) fused aromatic, (iv) single-bond conjugated aromatic, (v) multi-bond conjugated aromatic, and (vi) linear MACs that form 5, 6, 7, 8, 9, or 10 H-bonds specifically with cytosine-thymine, cytosine-uracil, thymine-cytosine, and / or uracil-cytosinemmBP(s) present in dsPN and ssPN.

[0054] FIG. 12 shows embodiments of (i) single-ring aromatic, (ii) multi-ring aromatic, (iii) fused aromatic, (iv) single-bond conjugated aromatic, (v) multi-bond conjugated aromatic, and (vi) linear MACs that form 5, 6, 7, 8, 9, 10, 11, or 12 H-bonds specifically with guanine-thymine, guanine- uracil, thymine-guanine, and / or uracil-guanine,mmBP(s) present in dsPN and ssPN.

[0055] FIG. 13 shows embodiments of various compositions of (i) >1 MACs (selected from one of the general structures shown in FIGS. 5-12) that are covalently bound to each other (FIG. 13. A) or (ii) a MAC that is conjugated to (a) 1 or 2 phosphodiester deoxyribonucleotide chain(s) (FIG. 13B) or 1 or 2 phosphodiester ribonucleotide chain(s) (FIG. 13C), or (b) 1, 2, 3, or 4 phosphodiester deoxyribonucleotide chain(s) (FIG. 13D), said bases being complementary to the bases flanking themmBP within single stranded DNA (ssDNA), double stranded DNA (dsDNA), single stranded RNA (ssRNA), single stranded RNA (dsRNA), single stranded Oligonucleotides (ssOligos), or double stranded Oligonucleotides (dsOligos).

[0056] FIG. 14. A shows embodiments of MAC compositions (selected from one of the general structures shown in FIGS. 5-12) that are covalently conjugated to 1, 2, 3, or 4 artificial nucleic acid (ANA -FIG. 1); shown are PNA (peptide nucleic acid oligomers - FIG. 14. B) whose N-(2- aminoethyl)glycine PNA structure has nucleobases connected via tertiary amide groups and SNA(serinol nucleic acid oligomer - FIG. 14. C), an acyclic phosphodiester backbone based on 2-amino- 1,3-propanediol wherein (i) said MACs having the capacity to form multiple H-bonds with specificmmBP(s) present within DNA, RNA or oligonucleotides, and (ii) the bases within said ANAs being complementary to the bases flanking themmBP within DNA, RNA or Oligos.

[0057] FIG. 15 shows embodiments of bimodal ANA-MAC compositions (FIG. 15. A) wherein “opposing” nucleobases are covalently bound to the N-(2-aminoethyl)glycine backbone. In one example of the embodiment (FIG. 15.B), one of the 2 nucleobases connects via a tertiary amide group on the repeating aminoethyl glycine units of said PNA while the other base connects via a side chain (at Ca) of the PNA backbone linking through a triazole ring. In another example of the embodiment (FIG. 15.C), the first nucleobase in this PNA example also connects via a tertiary amide group on the repeating aminoethyl glycine units while the second nucleobase is attached via an amide spacer to a side chain (at CY) of the PNA backbone. In addition to bimodal PNA, bimodal SNA, bimodal GNA, bimodal LNA, bimodal MNA, bimodal D-aTNA, bimodal L-aTNA, bimodal tcDNA, bimodal ZNA, or other bimodal ANAs are included in this embodiment wherein (i) said MACs having the capacity to form multiple H-bonds with specificmmBP(s) present within DNA, RNA or oligonucleotides, and (ii) the bases within said ANAs being complementary to the bases flanking themmBP within DNA, RNA or oligonucleotides.

[0058] FIG. 16 shows embodiments of MAC-artificial nucleic acids (MAC- ANAs) dimers composed of two covalently-bonded PNAs, said PNA-MAC dimers having (a) >1 nucleobase pair(s) that form multiple H-bonds with the specificACBP(s) present within the target DNA, RNA or oligonucleotides, and (b) nucleobases that (i) flank saidACBP-binding nucleobase pair(s), and (ii) are complementary to the nucleobases flanking theACBP within the targeted DNA, RNA or oligonucleotides (not shown are GNA dimers, LNA dimers, MNA dimers, SNA dimers, tcDNA dimers, D-aTNA dimers, L-aTNA dimers, and ZNA dimers).

[0059] FIG. 17 shows MAC embodiments composed of circular DNA (FIG. 17. A), circular RNA (FIG. 17.B), circular PNA (FIG. 17. C), circular SNA (FIG. 17. D), and combinations thereof (FIG. 17.E), each containing (i) at least one opposing mismatch / non-complementary base pairs, (ii) zero or >1 opposing complementary base pairs, and (iii) >1 positively charged molecules (e.g., theNH3+ions shown in FIG. 17. C) that will further increase the stability and Tmof the MAC: : : :mmDNAPMcomplex consequent to intermolecular electrostatic ion-ion bond formation between any positively charged groups (e.g., NHC) and the negatively charged PO4- groups present within DNA’s backbone.

[0060] FIG. 18 lists functional groups used to enhance the hybridization properties of the disclosed MACs withmmBP and to further increase the binding stability and TmofmmBP-positive nucleic acids.

[0061] FIG. 19 lists examples of propargyl and backbone derivatives used to enhance the hybridization properties of the disclosed MACs withmmBP-positive nucleic acids and thus increase the binding stability and TmofmmBP-positive nucleic acidsDETAILED DESCRIPTION OF THE INVENTIONDefinitions

[0062] As used herein, the term “nucleic acid” refers to a nucleotide, an analog of a nucleotide, an oligonucleotide composed of nucleotide analogs, polymers of nucleotides (e.g., deoxyribonucleotides, ribonucleotides, nucleotide analogs), a nucleoside, an analog of a nucleoside, an oligonucleoside composed of nucleoside analogs, polymers of nucleosides (e.g., deoxyribonucleosides, ribonucleosides, nucleoside analogs), analogs of DNA or RNA that are generated using nucleotide analogs, double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, multi -stranded DNA, multi-stranded RNA, genomic DNA, non-coding DNA, complementary DNA (cDNA), messenger RNA (mRNAs), hairpin / stem-loop / loop-positive DNA and RNA, pri-microRNA (pri-miRNA), pre-microRNA (Pre-miRNA), microRNA miRNAs, small nucleolar RNA (snoRNAs), ribosomal RNA (rRNA), transfer RNA (tRNA), small interfering RNA (siRNA), heterogeneous nuclear RNAs (hnRNA), small hairpin RNA (shRNA), DNA-RNA hybrids, aptamers, and artificial nucleic acids (ANAs), e.g., peptide nucleic acid (PNA), morpholino nucleic acid (MNA) and locked nucleic acid (LNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), serinol nucleic acid (SNA), acyclic D / L-threoninol nucleic acid (D / L-aTNA), and the like. A nucleic acid is typically single-stranded or double-stranded and will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have alternate backbones, including, for example, phosphorodithioate, phosphoramide, phosphorothioate, O-methylphosphoroamidite linkages, and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positively charged backbones, non-ionic backbones and non-ribose backbones. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids. These modifications of the ribose-phosphate backbone may be done to facilitate the addition of additional moieties such as labels, or to alter the stability and half-life of such molecules in physiological environments.

[0063] In some aspect, the nucleic acid is a natural component that is present within eukaryotic or prokaryotic organisms and whole cells, cell nuclei, mitochondria, intracellular pathogens, or extracellular pathogens.

[0064] In another aspect, the nucleic acid is a cell free nucleic acid (cfDNA) isolated from bodily fluids or tissues, and originating from whole cells, cell nuclei, mitochondria, intracellular pathogens,or extracellular pathogens.

[0065] The term “allele” refers to alternative forms of a gene, portion thereof, or noncoding region of DNA that occupy the same locus or position on homologous chromosomes that have at least one difference in the nucleotide sequence.

[0066] “Variant,” refers to a nucleic acid sequence that differs in sequence from a reference nucleic acid sequence but retains essential properties of the reference molecule. Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations.

[0067] The term “wild-type” (WT) as used herein refers to a gene or allele which has the characteristics of that gene or allele when isolated from a naturally occurring source. A WT gene or a WT allele is the most frequently observed in a population and is arbitrarily designated as the “normal” or “wild-type” form of the gene or allele.

[0068] As used herein, point mutations (PMs) refer to(a) a substitution of one or more canonical base pair(s) by another canonical base pair(s) (e.g., AT is substituted TA, CG, or GC; CG is substituted by GC, AT, or TA; GC is substituted by CG, AT, or TA; TA is substituted AT, CG, or GC). Canonical base pair DNA Point Mutations are referred to herein asCDNAPMorCBPPM, single nucleotide polymorphism (SNP), or single nucleotide variations (SNV);(b) a substitution of a single base of a canonical base pair(s) in the coding or noncoding DNA / RNA strand, this leading to the production of ammBP: AA instead of AT, AU, TA, or UA; CC instead of CG or GC; GG instead of CG or GC; TT instead of AT or TA; UU instead of AU or UA; AC instead of AT, AU, or GC; CA instead of CG, TA, or UA; AG instead of AT, AU or CG; GA instead of GC, TA or UA; CT instead of AT or CG; CU instead of AU or CG; TC instead of GC or TA; UC instead of GC or UA; GT instead of AT or GC; GU instead of AU or GC; TG instead of CG or TA; UG instead of CG or UA; and wherein saidmmBP are denoted AABp CCBp GGBp TTBp UUgp TUgp UTgp ACgp CAgp AGgp GAgp CTgp TCgp CUgp UCBP,GTBP,TGBP,GUBP, and / orUGBP;(c) a deletion of a single base or multiple bases leading to the downstream production of a number ofmmBPPM; and(d) an insertion of a single base that could also lead to the downstream production of a number ofmmBP and / or canonical base pair positive point mutations (CBPPM).

[0069] In contrast, the term “mutant” or “mutated” refers to a gene or allele which displaysmodifications in sequence when compared to the wild-type (WT) gene or allele. The term “mutation” refers to a change in the sequence of nucleotides of a normally conserved nucleic acid sequence resulting in the formation of a point mutation or point mutations:(1) one or more different canonical (fully complementary) base pair(s):(i)CDNAPM / DNAPM, i.e., G:::C is substituted by C:::G, A::T, or T::A; C:::G is substituted by G:::C, A::T, or T::A; A::T is substituted T::A, C:::G, or G:::C; T::A is substituted A::T, C:::G, or G:::G; or(ii)CRNAPM / RNAPM, i.e., G:::C is substituted by C:::G, A::U, or U::A; C:::G is substituted by G:::C, A::U, or U::A; A::U is substituted U::A, C:::G, or G:::C; U::A is substituted A::U, C:::G, or G:::G; and / or(2) one or more noncomplementary / unmatching base pair(s):(i)mmBP-positive DNA / mmDNAPM, i.e., AA instead of AT or TA; CC instead of CG or GC; GG instead of CG or GC; TT instead of AT or TA; AC instead of AT or GC; CA instead of CG or TA; AG instead of AT or CG; GA instead of GC or TA; CT instead of AT or CG; TC instead of GC or TA; GT instead of AT or GC; TG instead of CG or TA, or TA, as differentiated from the normal / complementary / canonical or WT sequence; or(ii)mmBP-positive RNA / mmRNAPM, i.e., AA instead of AU or UA; CC instead of CG or GC; GG instead of CG or GC; UU instead of AU or UA; AC instead of AU or GC; CA instead of CG or UA; AG instead of AU or CG; GA instead of GC or UA; CU instead of AU or CG; UC instead of GC or UA; GU instead of AU or GC; UG instead of CG or UA, or UA, as differentiated from the normal / complementary / canonical or WT sequence.

[0070] As used herein, the termsmmBP-positive DNA / RNA andmmDNAPM / mmRNAPMrefer to genomic heteroduplex sequences that are either (i) naturally found within eukaryotic or prokaryotic organisms / cells, or (ii) artificially formed in vitro following the sequential denaturation and renaturation of DNAWT-CDNAPMor RNAWT-RNAPMmixtures (e.g., post heating and cooling) that induces the generation ofmmBP-positive heteroduplexes.

[0071] As used herein, an “alteration” of a gene or gene product (e.g., a marker gene or gene product) refers to the presence of a mutation or mutations within the gene or gene product which affects the quantity or activity of the gene or gene product as compared to the normal or WT gene. The genetic alteration can result in changes in the quantity, structure, and or activity of the gene orgene product in a cancer cell, as compared to its quantity, structure, and or activity in a normal or healthy tissue or cell. Exemplary mutations include, but are not limited to, point mutations (PM), including substitutions (either one canonical base pair is substituted by another canonical base pair or a single base is altered thereby producing a mismatched base pair-containing PM (““BP™), deletions (either one or more canonical base pair is / are deleted or a single / multiple base(s) is / are deleted thereby producing a number ofmmBPs), and insertions (either one or more canonical base pair(s) is / are inserted thereby producing a number ofmmBPs. Mutations can be present in the coding or non-coding region of the gene. In certain embodiments, the alterations are associated with a phenotype, e.g., cancerous phenotype.

[0072] The terms “complementary” or “complementarity” are used in reference to antiparallel strands of polynucleotides related by the Watson-Crick base-pairing rules. The terms “perfectly complementary” or “100% complementary” refer to complementary sequences that have Watson- Crick pairing of all the bases between the antiparallel strands, i.e., there are no mismatches between any two bases in the polynucleotide duplex. However, duplexes are formed between antiparallel strands even in the absence of perfect complementarity. The terms “partially complementary” or “incompletely complementary” refer to any alignment of bases between antiparallel polynucleotide strands that is less than 100% perfect (e.g., there exists at least one mismatch or unmatched base in the polynucleotide duplex). The duplexes between partially complementary Strands are generally less stable than the duplexes between perfectly complementary strands.

[0073] As used herein, the terms “treat,” “treating,” or “treatment” refer to obtaining a desired pharmacologic and / or physiologic effect including, but not limited to, alleviation or amelioration of one or more signs or symptoms of a disease or condition, diminishing the extent of disease, stability state of disease, palliation of the disease state, diminishing rate / time to progression, and partial or total remission. The disease treatment may be an agent that modulates the activity or expression, or disrupts the function, of at least one or more of the MAC -identifiedmmBP-positive gene(s). For example, ammBP detected within a gene according to the methods of the present invention may be used as a molecular target for a therapeutic agent, including one or more of the disclosed MACs, as well as radiotheranostic MACs that are used either to monitor (e.g., radioimaging) the progression or regression of a disease or condition or to treatmmBP-rnediated disease.Mismatch Anchoring Compounds (MACs)

[0074] The mismatch anchoring compounds (MACs) of the present invention are designed to form multiple H-bonds with specificmmBPs , as well as H-bonds and covalent bonds with nearby bases and / or ionic bonds with a negatively charged DNA backbone. MACs of the present invention are depicted in FIGS. 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18.Adenine-Adenine Mismatch Anchoring Compounds

[0075] In one set of embodiments, the MACs comprise compounds that can form 4, 5, 6, 7, 8, 9, or 10 H-bonds specifically with adenine-adenine (AA) mismatch base pairs (mmBP(s) present withinmmDNAPMas depicted in FIGS. 5.i-5.vi. TheseAABP-binding MACs will increase the thermal stabilities (as reflected in an increase in the melting temperature (Tm) ofAABP-containing DNA (AADNAPM), thereby enabling the identification and detection ofAABP(s) present withinAADNAPMsamples. For example, since the formation of multiple H-bonds between theseAABP-binding MACs and the mismatchedAABP(s) will increase the Tmof theAADNAPM(see FIG. 4), these MACs will enable discrimination betweenAABP- and canonical -base pair-containing DNA (i.e., DNAWT).Cytosine-Cytosine Mismatch Anchoring Compounds

[0076] In one set of embodiments, the MACs comprise compounds that can form 6, 7, 8, 9, or 10 H-bonds specifically with cytosine-cytosine (CC) mismatch base pairs (mmBP(s) present withinmmDNAPMas depicted in FIGS. 6.i-6.vi. TheseccBP-binding MACs will increase the thermal stabilities (as reflected in an increase in the melting temperature Tm ofccBP-containing DNA (CCDNAPM), thereby enabling the identification and detection ofccBP(s) present withinCCDNAPMsamples. For example, since the formation of multiple H-bonds between theseccBP-binding MACs and the mismatchedccBP(s) will increase the Tmof theCCDNAPM(see FIG. 4), these MACs will enable discrimination betweenCCBP- and canonical -base pair-containing DNA (i.e., DNAWT).Guanine-Guanine Mismatch Anchoring Compounds

[0077] In one set of embodiments, the MACs comprise compounds that can form 6, 7, 8, 9, 10, 11, 12, 13, or 14 H-bonds specifically with guanine-guanine (GG) mismatch base pairs (mmBP(s) present withinmmDNAPMas depicted in FIGS. 7.i-7.vi. TheseGGBP-binding MACs will increase the thermal stabilities (as reflected in an increase in the melting temperature (Tm ofGGBP-containing DNA (GGDNAPM), thereby enabling the identification and detection ofGGBP(s) present withinGGDNAPMsamples. For example, since the formation of multiple H-bonds between theseGGBP-binding MACs and the mismatchedGGBP(s) will increase the Tm of theGGDNAPM(see FIG. 4), these MACs willenable discrimination betweenGGBP- and canonical -base pair-containing DNA (i.e., DNAWT).Thymine-Thymine, Uracil-Uracil, Thymine-Uracil, or Uracil-Thymine Mismatch Anchoring Compounds

[0078] In one set of embodiments, the MACs comprise compounds that can form 4, 5, 6, 7, 8, 9, or 10 H-bonds specifically with thymine-thymine (TT), uracil-uracil (UU), thymine-uracil (TU), or uracil-thymine (UT) mismatch base pairs (mmBP(s) present withinmmDNAPMas depicted in FIGS. 8.i-8.vi. These ^BP-Z^BP-^BP-Z^BP-binding MACs will increase the thermal stabilities (as reflected in an increase in the melting temperature (Tm) ofTTBP-ZuuBP-ZTUBP-ZUTBP-positive DNA, thereby enabling the identification and detection ofTTBP(S)-ZUUBP(S)ZTUBP(S)-ZUTBP(S) present withinTTDNAPMZUUDNAPMZTUDNAPMZUTDNAPMsamples. For example, since the formation of multiple H-bonds between these ^BP-Z^BP-Z^BP-Z^BP-binding MACs and the mismatchedTTBP(S)-ZUUBP(S)ZTUBP(S)ZUTBP(S) will increase the Tmof theTTDNAPMZUUDNAPMZTUDNAPMZUTDNAPM(see FIG. 4), these MACs will enable discrimination betweenTTBP-ZUUBP- and canonical -base pair-containing DNA (i.e., DNAWT).Adenine-Cytosine and Cytosine-Adenine Mismatch Anchoring Compounds

[0079] In one set of embodiments, the MACs comprise compounds that can form 5, 6, 7, 8, 9, or 10 H-bonds specifically with adenine-cytosine (AC) mismatch base pairs (mmBP(s) present withinmmDNAPMas depicted in FIGS. 9.i-9.vi. TheseACBP-ZCABP-binding MACs will increase the thermal stabilities (as reflected in an increase in temperature Tm) ofACBP-ZCABP-containing DNA (ACDNAPMZCADNAPM), thereby enabling the identification and detection ofACBP(s)ZCABP(s) present withinACDNAPMZCADNAPMsamples. For example, since the formation of multiple H-bonds between theseACBP-ZCABP-binding MACs and the mismatchedACBP(s)ZCABP(s) will increase the Tmof theACDNAPMZCADNAPM(see FIG. 4), these MACs will enable discrimination betweenACBPZCABP and canonical-base pair-containing DNA (i.e., DNAWT).Adenine-Guanine and Guanine- Adenine Mismatch Anchoring Compounds

[0080] In one set of embodiments, the MACs comprise compounds that can form 5, 6, 7, 8, 9, 10, 11, or 12 H-bonds specifically with adenine-guanine (AG) or guanine-adenine (GA) mismatch base pairs (mmBP(s) present withinmmDNAPMas depicted in FIGS. 10.i-10.vi. TheseAGBPZGABP-binding MACs will increase the thermal stabilities (as reflected in an increase in the melting temperature Tm) ofAGBPZGABP-containing DNA (AGDNAPMZGADNAPM) and enable the identification and detection ofAGBP(s)ZGABP(s) present withinAGDNAPMZGADNAPMsamples. For example, since the formation of multiple H-bonds between theseAGBPZGABP-binding MACs and the mismatchedAGBP / GABP(S) will increase the Tm of theAGDNAPM / GADNAPPM(see FIG. 4), these MACs will enable discrimination betweenAGBP / GABP- and canonical -base pair-containing DNA (i.e., DNAWT).Cytosine-Thymine / Uracil and Thymine / Uracil-Cytosine Mismatch Anchoring Compounds

[0081] In one set of embodiments, the MACs comprise compounds that can form 5, 6, 7, 8, 9, or 10 H-bonds specifically with cytosine-thymine / uracil (CT or CU) or thymine / uracil-cytosine (TC or UC) mismatch base pairs (mmBP(s) present withinmmDNAPMas depicted in FIGS. 11.i-11.vi. TheseCTBP- / cuBP- / TCBP- / ucBP-binding MACs will increase the thermal stabilities (as reflected in an increase in temperature (Tm) ofCTBP- / cuBP- / TCBP- / ucBP-containing DNA (CTDNAPM / CUDNAPM / TCDNAPM / UCDNAPM) and enable the identification and detection ofCTBP(S) / CUBP(S) / TCBP(S) / UCBP(S) present withinCTDNAPM / CUDNAPM / TCDNAPM / UCDNAPMsamples. For example, since the formation of multiple H-bonds between theseCTBP- / CUBP- / TCBP- / ucBP-binding MACs and the mismatchedCTBP(S) / CUBP(S) / TCBP(S) / UCBP(S) will increase the Tm of theCTDNAPM / CUDNAPM / TCDNAPM / UCDNAPM(see FIG. 4), these MACs will enable discrimination betweenCTBP- / CUBP- / TCBP- / UCBP- and canonical-base pair-containing DNA (i.e., DNAWT).Guanine-Thymine / Uracil and Thymine / Uracil-Guanine Mismatch Anchoring Compounds

[0082] In one set of embodiments, the MACs comprise compounds that can form 5, 6, 7, 8, 9, 10, 11, or 12 H-bonds specifically with guanine-thymine / uracil (GT or GU) or thymine / uracil-guanine (TG or UG) mismatch base pairs (mmBP(s) present withinmmDNAPMas depicted in FIGS. 12.i- 12. vi . TheseGTBP- / GUBP- / TGBP- / UGBP-binding MACs will increase the thermal stabilities (as reflected in an increase in temperature Tm ofGTBP- / GUBP- / TGBP- / UGBP-containing DNAGTDNAPM / GUDNAPM / TGDNAPM / UGDNAPMand enable the identification and detection ofGTBP(S) / GUBP(S) / TGBP(S) / UGBP(S) present withinGTDNAPM / GUDNAPM / TGDNAPM / UGDNAPMsamples. For example, since the formation of multiple H-bonds between theseGTBP- / GUBP- / TGBP- / UGBP-binding MACs and the mismatchedGTBP(s) / GUBP(s) / TGBP(s) / UGBP(s) will increase the T of theGTDNAPM / GUDNAPM / TGDNAPM / UGDNAPM(see FIG. 4), these MACs will enable discrimination betweenGTBP- / GUBP- / TGBP- / UGBP- and canonical -base pair-containing DNA (i.e., DNAWT).MAC Dimers and Multimers

[0083] In one set of embodiments, the MACs comprise dimers, trimers, and other multimers of MAC(s) comprising a MAC selected from one of the MACs depicted in FIGS. 5-17 covalently attached to another MAC as shown in FIG. 13. A, and which form multiple H-bonds specifically withmmBP(s) present in series within DNA, RNA or other oligonucleotides, said MAC dimers, trimers and multimers being useful in all the in vitro and in vivo uses disclosed herein.MAC -Phosphodiester Deoxyribonucleotide Compounds

[0084] In one set of embodiments, the MACs comprise a MAC conjugated to 1 or 2 phosphodiester deoxyribonucleotide chain(s) (FIG. 13B), 1 or 2 phosphodiester ribonucleotide chain(s) (FIG. 13C), or 1, 2, 3, or 4 phosphodiester deoxyribonucleotide chain(s) (FIG. 13D), said MAC chains being complementary to the bases flanking themmBP within a segment of DNA, RNA or oligonucleotide, said MACs useful in all the in vitro and in vivo uses disclosed herein.MAC-ANA Conjugates

[0085] In another set of embodiments, the invention provides MAC conjugates comprising a MAC selected from one of the general structures shown in FIGS. 5-17 covalently conjugated to 1, 2, 3, or 4 antinuclear antibodies (ANA(s) as shown in FIG. 14. A. Suitable ANAs include, but are not limited to peptide nucleic acid oligomers (PNA, FIG. 14. B), serinol nucleic acid oligomers (SNA, FIG. 14. C), glycol nucleic acid oligomers (GNA), locked nucleic acid oligomers (LNA), morpholino nucleic acid oligomers (MNA), acyclic D-threoninol nucleic acid oligomers (D-aTNA), acyclic L- threoninol nucleic acid oligomers (L-aTNA), tricyclo DNA (tcDNA), and zip nucleic acids (ZNA), and their use in the in vitro and in vivo applications described herein.Bimodal MAC- ANA Conjugates

[0086] In another set of embodiments, the invention provides MAC conjugates comprising a MAC selected from one of the general structures shown in FIGS. 5-17 covalently conjugated to a bimodal ANA derivative as shown in FIG. 15, wherein a pair of nucleobases are conjugated to the same N- (2-aminoethyl)glycine backbone: one nucleobase via the tertiary amide on the repeating aminoethyl glycine units of the bimodal ANA derivative and the other nucleobase connected via an amide spacer to a side chain at Ca (FIG. 15.C) or CY(FIG. 15.D) of the aminoethyl glycine units, and their use in the in vitro and in vivo applications described herein. Suitable bimodal ANA derivatives include but are not limited to bimodal PNA, bimodal SNA, bimodal GNA, bimodal LNA, bimodal MNA, bimodal D-aTNA, bimodal L-aTNA, bimodal tcDNA, and bimodal ZNA.MAC-ANA Dimers

[0087] In another set of embodiments, the invention provides MAC conjugates comprising a MAC selected from one of the general structures shown in FIGS. 5-17 covalently conjugated to an ANA dimer as shown in FIG. 16, wherein the MAC- ANA dimers have (a) >1 nucleobase pair(s) that form multiple H-bonds with the specific BP(s) present within the target DNA, RNA or oligonucleotide, and (b) nucleobases that (i) flank said BP-binding nucleobase pair(s), and (ii) are complementary to the nucleobases flanking the BP within the targeted DNA, RNA or oligonucleotide, and their use inthe in vitro and in vivo applications described herein. Suitable ANA dimers include but are not limited to PNA dimers, GNA dimers, LNA dimers, MNA dimers, SNA dimers, tcDNA dimers, D- c / TNA dimers, L-aTNA dimers, and ZNA dimers.Macrocyclic Mismatch Anchoring Compounds

[0088] In another set of embodiments, the invention provides MACs comprised of macrocyclic (or “circular”) DNA (FIG. 17. A), circular RNA (FIG. 17.B), circular PNA (FIG. 17. C), circular SNA (FIG. 17.D) and combinations thereof (FIG. 17.E), circular GNA, circular LNA, circular MNA, circular tcDNA, circular D-aTNA, circular L-aTNA, circular ZNA and combinations thereof (FIG. 17.E), each containing (i) at least one opposingmmBPs that form multiple H-bonds specifically with non-canonicalmmBP present within DNA, RNA, or oligonucleotides, and (ii) zero or >1 opposing matching base pairs, and their use in the in vitro and in vivo applications described herein.Methods and Kits

[0089] The MACs, methods, and kits of the invention enable the facile, inexpensive, rapid, and accurate (1) detection, identification, and quantification of disease-associated known or unknownmmBP present within single stranded and double stranded DNA / RNA / Oligonucleotides (AABP,CCBP, GGBp TTBp UUBp TUBp UTBp ACgp CAgp AGgp GAgp CTgp TCgp CUgp UCgp GTgp TGgpGUBP, and / orUGBP), (2) discrimination betweenmmDNAPMand DNAWT, (3) discrimination betweenmmRNAPMand RNAWT, (4) capture and enrichment / isolation of anymmDNAPM, said DNA present within (i) DNA samples isolated from bodily fluids, cells, and tissues, (ii) DNA samples that are positive forCDNAPMand DNAWThave been denatured isolated from bodily fluids, cells, and tissues, or (iii) pre- / post-amplified DNA (e.g., PCR), (5) capture and elimination of anymmDNAPMfrom ammDNAPM-DNAWTmixture generated, for example, post amplification, and (6) detection (diagnosis, screening, prognosis, etc.) of precancerous lesions, cancers, and various non-cancerous diseases in DNA Test Samples isolated from tissue biopsies and bodily fluids. These MACs are designed to (1) have exquisite recognition properties to any mismatched nucleic acid pair occurring within single stranded or double stranded DNA, single stranded or double stranded RNA, single stranded oligonucleotides, and double stranded oligonucleotides, (2) form multiple H-bonds simultaneously with anymmBP(s), and (3) enhance the stability of saidmmDNAPMand consequently selectively increase their Tmwithout any alteration in the Tmof DNAWT. The disclosed invention also discloses structural modifications (FIGS. 16 and 17) to the MACs wherein one or more (a) other MAC(s), (b) peptide nucleic acid(s) (PNA), (c) morpholino nucleic acid (MNA) and locked nucleic acids (LNA), (d) glycol nucleic acids (GNA), (e) threose nucleic acid (TNA), (f) serinol nucleic acids (SNA), (g) acyclic D / L-threoninol nucleic acid (D / L-aTNA), (h) nucleoside(s), (i) nucleoside analogs, (j)nucleotide(s), (k) nucleotide analogs, wherein a nucleic acid is typically single-stranded or doublestranded and will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have alternate backbones, including, for example, phosphorothioate, phosphorodithioate, phosphoramide, O-methylphosphoroamidite linkages, and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positively charged backbones, non-ionic backbones (such as those described in U.S. Pat. Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863) and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids, and / or functional groups and propargyl derivatives, wherein the modifications of the ribose-phosphate backbone facilitating the addition of additional moieties such as labels or to alter the stability and half-life of such molecules in physiological environments and / or providing extra H-bonds, hydrophobic interactions, and / or and intermolecular electrostatic ion-ion bonds with said bases, neighboring bases, as well as intermolecular electrostatic ion-ion bonds between molecules / atoms present within the oligo’s backbone and thereby strengthening the hybridization of said MACs with themmBP-containing DNA, RNA, oligonucleotides and leading to further increases in the stability and Tmof saidmmDNA,mmRNA, andmmoligonucleotides.

[0090] In one scenario exemplified forAADNAPM, a fluorescent molecule, e.g., fluorescein isothiocyanate (FITC) or tetramethylrhodamine (TAMRA), is conjugated to MAC (F-MAC) and coincubated with a sample DNA. Since these MACs are tagged with a fluorophore, fluorescence will be specifically emitted fromAADNAPM-positive samples, thereby revealing the presence of theAABP mismatches and identifying theAABP-positive cells / tissue / sample. Alternatively, when theseAABP- binding MACs are conjugated to magnetic beads and incubated with a sample that contains a DNAWT-AADNAPMmixture, the MACs will form multiple H-bonds with any mismatchedAABP(s) present within themmBP-positive DNA and enable the specific isolation, concentration, and enrichment of theAADNAPMthat can then be used in downstream applications including, but not limited to, PCR-mediated amplification, sequencing, or the elimination of theAADNAPMfrom the test sample.

[0091] In another scenario exemplified forAADNAPM, when theseAABP-binding MACs are biotinylated (B-MACs) and co-incubated with a sample that contains a DNAWT-AADNAPMmixture, the B-MAC will form multiple H-bond with the mismatchedAABP(s) and enable the specific isolation and concentration of theAADNAPM(using, for example, magnetic beads- avidin / streptavidin / neutravidin (Av / SAv / Nav) and a magnet) and their subsequent use in various downstream applications. Alternatively, when these B-MACs are incubated with cells, tissues, orpreserved tissue sections and subsequently incubated with Av / SAv / Nav neutravidin previously conjugated to fluorescent molecules, the detection and quantitation of fluorescence in these cells will demonstrate that their DNA isAABP-positive.

[0092] In yet another scenario exemplified forAADNAPM, when suchAABP-binding MACs are conjugated to Av / SAv / Nav ( Av / SAv / N Av-MAC s) and incubated with cells, tissues, or preserved tissue sections, the MACs will form multiple H-bonds with any mismatchedAABP(s) present within themmBP-DNA and will fluoresce upon co-incubation with one or multiple fluorophore-biotin conjugates. The emission of fluorescent signals will reveal the presence ofAABP mismatches within these cells and / or tissues. Such Av / SAv / NAv-MACs can also be used to capture and isolateAADNAPMfrom a DNAWT-AADNAPMmixture when these biological samples are first incubated with Av / SAv / NAv-MACs and subsequently with biotinylated magnetic beads, thereby enabling the specific isolation, concentration, and quantitation of theAADNAPMand their use in downstream applications.

[0093] In another exemplary embodiment, the invention provides methods for the ex vivo incubation of MACs with DNA test samples extracted from bodily fluids and tissues for the isolation and purification ofmmDNAPMpresent in said test samples.

[0094] In another exemplary embodiment, the invention provides methods for the in vitro incubation of MACs with guide RNA (gRNA) for the isolation and purification of gRNA, wherein the gRNA is stem-loop-positive DNA or RNA or aptamers from various contaminants used in CRISPR.

[0095] In another exemplary embodiment, the disclosed MACs are useful for detecting, profiling, and quantifying one or more DNA point mutations or SNPs present in bodily fluids and tissues.

[0096] In another exemplary embodiment, the invention provides kits that are useful for the simultaneous detection, profiling, and quantification of multiple DNA point mutations or multiple DNA SNPs present in bodily fluids and tissues.

[0097] In another exemplary embodiment, the invention provides DNA / PNA-based microarrays that are useful for the simultaneous detection, profiling, and quantification of multiple DNA point mutations or multiple DNA SNOs present in bodily fluids and tissues.

[0098] In another exemplary embodiment, the invention provides MACs are used to detect and quantify aberrant methylation patterns in DNAWT,CDNAPMandmmDNAPMpresent in bodily fluids and tissues.

[0099] In another exemplary embodiment, the invention provides methods for the in vitroincubation of MACs with DNA test samples to enable the elimination ofmmDNAPM, PCR inhibitors, from said test samples.

[0100] In another exemplary embodiment, the invention provides for the in vitro incubation of MACs with DNA test samples isolated from the bodily fluids and / or tissues of patients with cancer to enable the isolation and enrichment of tumor-specific rare minoritymmBP(s) present within said test samples.

[0101] In another exemplary embodiment, the invention provides for methods for the addition of MACs to DNA test samples to enable the elimination ofmmBP errors generated during amplification of the targetedCDNAPM.

[0102] In another exemplary embodiment, the invention provides for methods for the ex vivo incubation of MACs with DNA test samples isolated from the bodily fluids and / or tissues of patients with cancer to enable the quantitation of tumor mutational burdens within said test samples.

[0103] In another set of exemplary embodiments, the invention provides for a lateral flow strip or a vertical flow strip device composed of a test strip that contains a sample dad, a conjugate pad, and an absorbent pad, wherein one or more MACs of the present invention are immobilized onto the test line of said devices, wherein said devices enable the rapid, economical, on-site quantitative and accurate capture and detection of one or multiple disease-associatedmmBP-positive DNA heteroduplexes isolated from a test sample (e.g., blood / saliva / other bodily fluid / tumor biopsy).

[0104] In another exemplary embodiment, the invention provides methods for the in vitro incubation of F-MACs with live cells - for example cloning or gene editing, e.g., CRISPR-Cas - to enable (i) the internalization of said F-MACs into said cells, (ii) the formation of multiple H-bonds between said MACs andmmBP(s) present within the DNA of said cells, and (iii) the accurate in vitro elimination ofmmBP-positive cells using cell sorting methodologies (e.g., FACS).

[0105] In another exemplary embodiment, the invention provides methods for the in vitro incubation of MACs with live cells or tissues and formation of multiple H-bonds between MACs and specificmmBP(s) present within the DNA of all cells that are positive for thesemmBP, resulting in blocking of helicase-mediated H-bond disruption of the two strands of DNA, stalling DNA polymerase, blocking DNA replication, preventing cell division, and leading to cell death.

[0106] In another exemplary embodiment, the invention provides methods for incubating MACs conjugated to one or more DNA-binding molecule(s) (e.g., platinum derivatives (e.g., cisplatin, carboplatin, picoplatin, tetraplatin), nitrogen mustards (melphalan, chlorambucil), ruthenium- containing alkylators that can crosslink to neighboring bases) with live dividing cells or tissues. Inthe method, MACs will form multiple H-bonds with specificmmBP(s) present within cells that are positive for thesemmBP and the DNA-binding agent will then crosslink with adjoining bases, thus blocking helicase-mediated H-bond disruption of the two strands of DNA, stalling DNA polymerase, blocking DNA replication, preventing cell division, and leading to cell death.

[0107] In another exemplary embodiment, the invention provides methods for administering MACs conjugated to one or more DNA-binding chemotoxic molecule(s) (e.g., mitomycin derivatives, chlorambucil) that can crosslink to neighboring bases to an animal. Upon internalization of MACs by cells that are positive for themmBP that the MACs are specific to, multiple H-bonds will form with thesemmBP while the DNA-binding agent will crosslink with adjoining bases, thus blocking the helicase-mediated H-bond disruption of the two strands of DNA, stalling DNA polymerase, blocking DNA replication, preventing cell division, and leading to cell death. In yet another exemplary set of embodiments, the invention provides methods of administering MACs whose administration into an animal will lead to the binding of said MACs to specific intracellularmmBP-positive DNA present in one or more disease-causing genes of cancerous or non-cancerous proliferating diseased cells, said binding blocking DNA Helicase-mediated H-bond disruption, stalling DNA Polymerase, blocking DNA replication, and inhibiting the proliferation of (and / or killing) such dividing cells.

[0108] In another exemplary set of embodiments, the invention provides methods of administering MACs into an animal and binding of said MACs to specific intracellularmmBP-positive DNA present in one or more disease-causing genes of cancerous or non-cancerous proliferating diseased cells, said binding (i) inhibiting the transcription ofmmBP-containing DNA and subsequent mRNA translation that leads to the production, secretion, and accumulation of disease-causing altered proteins (e.g., extracellular amyloid beta (A[3) plaques (between neurons) and intracellular tau neurofibrillary tangles (within neurons), both leading to Alzheimer’s disease), and (ii) alleviating disease symptoms caused by autoimmune diseases, cardiovascular diseases, chronic diseases, genetic diseases, hematological diseases, inflammatory diseases, metabolic disorders, neurodegenerative disease, neurological diseases, proliferative diseases, psychiatric disorders, and / or any combination thereof. It should be noted that since (i) gene transcriptions commonly occur in both alleles (bi- allelic expression), and (ii) somaticmmBP are generated from random processes / errors, it is highly unlikely - even impossible - for any suchmmBP to be simultaneously present on both paternal and maternal alleles of homologous chromosomes. Consequently, when one of the disclosed MACs binds to a specificmmBP present within the double stranded DNA of a mismatch-containing mutated allele of a prokaryotic or eukaryotic cell, it will disable the unwinding of the DNA andselectively (i) block the replication ofmmDNAPMinmmBP positive dividing cells (prior to the cell’s next DNA replication) and inhibit their proliferation, and (ii) disable the transcription of all genes that aremmBP-positive (i.e., block mRNA synthesis), inhibiting the expression and translation of such genes, and leading to the expression and translation of the mutant-free non-disease causing allelic genes only.

[0109] In yet another exemplary set of embodiments, the invention provides methods of administering MACs into an animal and binding of said MACs to intracellularmmBP-positive present within pre-mRNA-DNA duplex molecules, said binding blocking the release of pre-mRNA and therefore downstream translation and the production of abnormal disease-causing proteins.

[0110] In another exemplary set of embodiments, the invention provides methods of administering MACs into an animal and binding of said MACs to intracellularmmBP present within mRNA molecules, said binding blocking their translation and the production of abnormal disease-causing proteins.

[0111] In yet another exemplary set of embodiments, the invention provides methods of administering MACs into an animal to inhibit and / or reverse cellular aging.

[0112] In other exemplary set of embodiments, the invention provides MACs conjugated to radiodiagnostic (SPECT / PET) or radiotherapeutic (a++- / p--particle-emitters) atoms / molecules and their administration into an animal to enable imaging and / or radiotherapy ofmmBP-containing cancerous and precancerous cells and lesions.

[0113] The above-described MACs may be delivered in vivo to animals and host cells according to known methods for the delivery of therapeutic and diagnostic agents. The MACs, preferably suspended in a physiologically compatible carrier, may be administered to a human or non-human mammalian subject. Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the MAC is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present invention.

[0114] Optionally, the MAC compositions of the invention may contain, in addition to one or more MACs and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, andparachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0115] MACs are administered in sufficient amounts to contact cells and to provide sufficient levels of contact with cellular DNA, RNA or other oligo- / polynucleotides, to provide a therapeutic or diagnostic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a desired organ (e.g., the liver (optionally via the hepatic artery) or lung), oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.

[0116] Dosages of MACs will depend primarily on factors such as the purpose or condition being treated, the age, weight and health of the patient, and may thus vary among patients. For example, a therapeutically effective human dosage of a MAC of the invention is generally in the range of from about 0.1 mL to about 100 mL of solution containing concentrations of from about 0.1-1000 mg. The dosage will be adjusted to balance the therapeutic benefit against any side effects, and such dosages may vary depending upon the therapeutic application for which the MAC is employed.

[0117] It is to be understood that although particular embodiments, specific configurations as well as materials and / or molecules, have been discussed herein for cells and methods according to the present invention, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention.

[0118] The following examples and figures are provided to aid the understanding of the present invention and better illustrate particular embodiments, the true scope of which is set forth in the appended claims. It is understood that modifications can be made in the procedures set forth without departing from the spirit of the invention and they should not be considered limiting the application.EXAMPLES

[0119] The following are examples of some of the preferred ex vivo, in vitro, and in vivo embodiments. However, it is understood that the invention is not limited to these particular embodiments.Example 1 - Elimination ofmmBP-Positive DNA from DNA Test Samples

[0120] The following examples demonstrate that the MACs, methods, and kits of the invention are useful for the elimination ofmmBP-positive DNA present in a test sample prior to its amplification or post amplification, thereby leading to the production ofmmBP-free DNA.Example 1A.

[0121] A kit is composed of (a) a single tube that contains a MAC selected from one of the structures shown in FIGS. 5-12, said MACs pre-conjugated to magnetic beads, and said mixture of MACs dissolved in 3 mL of 0.1 M Tris-HCl pH 7.5.

[0122] DNA that ismmBP-positive is eliminated by a method in which a DNA Test Sample (e.g., 100 ng) is transferred to said tube, mixed, incubated at room temperature for a few minutes to allow H-bond formation between the MACs and any DNA molecules that contain >1mmBP(s). As shown in Diagram l.A, magnet is then used to trap the magnetic bead-mmBP-binding-MAC::::mmDNA against the wall of the tube and the ""“BP-free DNA molecules are aspirated and used in any downstream applications.Example IB,

[0123] A kit is composed of (a) vial A that contains a MAC selected from one of the general structures shown in FIGS. 5-12, said MACs pre-conjugated to magnetic beads, and said mixture of MACs dissolved in 100 pL of 0.1 M Tris-HCl pH 7.5 buffer, (b) vial B, and (c) one rod having a Magnet at its proximal end.

[0124] As shown in Diagram l.B,mmBP-positive DNA is eliminated from a DNA test sample in a method by which a DNA test sample is added to vial B (step 3 in Diagram l.B). Next, the rodmagnet is inserted into vial A (step 1 in Diagram l.B), withdrawn (step 2 in Diagram l .B) once said magnetic bead-MACs have bound to the magnetic tip of said rod, and the magnetic tip of said rod is inserted into vial B (steps 4 and 5 in Diagram l.B) and said vial is heated to 60°C for 2 min, and cooled to room temperature to facilitate H-bond formation between the MACs and any DNA molecules that contain >1mmBP(s). Finally, the magnetic rod is withdrawn from vial B (step 6 in Diagram 1.B). The DNA that is left within vial B is free of allmmBP-positive DNA.Example 2 - Elimination of PCR Inhibitors from DNA Test Samples

[0125] PCR inhibitors are a heterogeneous class of substances (e.g., heparin, hormones, IgG) that are present in various sample types (e.g., liquid biopsies). Often, these molecules decrease PCR sensitivity and / or lead to false-negative PCR results and as such will affect downstream sequencing (e.g., Sanger sequencing, NGS, targeted NGS) performance. While several strategies and methods have been described to remove PCR inhibitors from DNA during sample preparation, it is difficult to guarantee that the preparations are free of any inhibitors. The MACs, methods, and kits of the invention are useful for eliminating inhibitors or other protein molecules / atoms that could interfere in the PCR reaction, thereby preventing contamination, improving accuracy, and minimizing the riskof biases.Example 2, A.mmDNAPM-Positive Test Samples:

[0126] The kit in this example is used to isolate and purify DNAHDmolecules that are positive for a specificmmBP (e.g.,AABP) from all PCR inhibiting molecules as well as other DNA molecules. The kit is composed of (a) tube A that containsAABP-binding-MAC that is selected from one of the general structures shown in FIG. 5, said MAC pre-conjugated to magnetic beads, and dissolved in 50 pL of 0.1 M Tris-HCl pH 7.5 buffer, (b) one rod having a magnet at its proximal end, (c) tube B and tube C, each containing 5 mL TRIS-HC1 buffer, pH 8, and (d) a vial that contains 100 pL of TRIS- HC1, pH 8 buffer.

[0127] In this example (Diagram l.C.i), anAABP-positive DNA test sample (isolated from blood, plasma, urine, etc. of an Alzheimer’s patient) is added to tube A (step 1). Next, the rod-magnet is (a) inserted into tube A (step 2) to allow the DNA molecules that are positive for the targetedAABP to bind to the magnetic tip of the rod-magnet, (b) removed from tube A and dipped 3 times into tube B (1stwash), (c) removed from tube B and dipped 3 times into tube C (2ndwash), and (d) removed from tube C and dipped into the buffer of said vial (steps 3-5). The vial, which now has the rod- magnet-MB-MAC::::AADNAPMand is void of any PCR / sequencing inhibitors and all other contaminants (including DNAWTandCDNAPM), is heated to 95°C for 2 min to denature theAADNA into single stranded DNA (ssDNA) molecules that are released into the solution. Next, the rodmagnet is withdrawn from said still hot vial and the latter set aside to cool to room temperature. This leads to the hybridization of ssDNA molecules and the re-formation of a highly purifiedAABP- positive DNA that is free from any PCR inhibitors and other DNA molecules.Example 2B. -CDNAPM-Positive Test Samples

[0128] The kit in this example (Diagram l.C.ii) is composed of (a) vial A that contains the DNA test sample (DNAWT(GCDNA),CDNAPM(ATDNA)) and contaminants, isolated from blood, plasma, urine, etc. of a cancer patient, (b) vial B that contains theACBP-binding-MAC shown in FIG. 16, said MAC pre-conjugated to magnetic beads and dissolved in 50 pL of 0.1 M Tris-HCl pH 7.5 buffer, (c) vial C, and (d) a magnet.

[0129] In this example, vial A is heated to 95 °C for 2 min (step 1) and cooled to RT (to enable the formation ofACDNA heteroduplex post denaturation and renaturation of all the DNAWT(GCDNA) andCDNAPM(ATDNA) molecules). Next, the contents of vial B are transferred to vial A (steps 2 and 3) and then a magnet is used (steps 4) to isolate all theACBP-positive DNA molecules (now H-bonded to the magnetic beads-MAC). The magnetic beads-MAC: : : :ACDNA are washed 3 times and the vialvoid of any PCR / sequencing inhibitors and all other contaminants) heated to 95 °C for 2 min to denature themmDNA into single stranded DNA molecules that are released into the solution (step 6). Next, the still hot contents of vial B are transferred to vial C (step 7) that is set aside to cool to RT (step 8). This leads to the hybridization of ssDNA molecules and the re-formation of a highly pureACDNA. The PCR amplification of these highly purifiedACDNA molecules - in the absence of any PCR inhibitors and other contaminants - will lead to the formation of equimolar concentrations ofGCDNA (DNAWT) andATDNA (DNAPM).Example 3 - Purification and Concentration of Guide RNA

[0130] Prior to their use in CRISPR applications, in vitro transcribed and chemically synthesized guide RNA (gRNA) / single guide RNA (sgRNA) require purification for removing excess unwanted material and degradation byproducts. High purity is essential for achieving optimal on-target DNA cleavage efficiency and minimizing off-target binding and cleavage. Current methods, including denaturing polyacrylamide gel electrophoresis (PAGE), anion exchange chromatography, size-exclusion HPLC, and ion pair reverse phase liquid chromatography, are time consuming and rather expensive. Since these sgRNA molecules (i) are always positive for stem-loop structures that are crucial for binding to the Cas9 protein, (ii) enable the system to target and cleave DNA, and (iii) contain multiplemmBP within their loops, the disclosed MACs can form multiple H-bonds and intermolecular electrostatic ion-ion bonds with the disclosed sgRNA and as such, they should be useful for the capture, isolation, purification, and concentration of sgRNA molecules, said methods (a) enabling better on-target cleavage and reduced off-target effects (crucial for accurate gene editing), and (b) leading to more accurate results (less interference with the CRISPR process).

[0131] In this example, the kit is composed of (a) tube A that contains PNA-MAC molecules that bind tommBPs present within the loop (of the stem-loop) of any sgRNA molecules, said MACs preconjugated (Diagram 1.D, top half) to magnetic beads and dissolved in 100 pL of 0.1 M Tris-HCl pH 7.5 buffer, and (b) tube B.

[0132] To purify a gRNA / sgRNA test sample (post synthesis, contaminated with excess unwanted material and degradation byproducts), the sample is added to tube A (Diagram l.D, bottom half) that is mixed, heated to 60 °C for 2 min, and then cooled to RT (to facilitate the formation of specific H- bonds between the magnetic beads-bound PNA-MACs and themmBPs present within the targeted loop of sgRNA molecules). Next, a magnet is used to capture and trap the magnetic beads- MAC::::sgRNA against the wall of said tube (step 1) and washed them 3 times with buffer (Step 2). Tube A, which is now void of contaminants, is then heated to 95 °C for 2 min to denature the sgRNA molecules and release them into the solution (step 3). Next, the hot buffer (contains the denaturedsgRNA molecules) is transferred to tube B (step 4) and the latter set aside to cool to RT, leading to the re-hybridization of the canonical bases present within the stem region of the sgRNA molecules and the formation of ultrapure and functional sgRNA molecules.Example 4 - Aptamer Discovery via SELEX and MAC -Enhanced Enrichment

[0133] Systematic evolution of ligands by exponential enrichment (SELEX) is an iterative method used to isolate nucleic acid aptamers that bind with high specificity and affinity to a target molecule. The process begins with a highly diverse library of random single-stranded DNA or RNA sequences (~ 1014variants). The library is incubated with the target, unbound sequences are rigorously washed away, and bound sequences are isolated / eluted and then amplified (PCR for DNA or RT-PCR for RNA) to enrich those with exquisite abilities to bind to the target molecule. This cycle of selection, elution, and amplification is repeated for 6 to 15 rounds. Finally, the enriched pool is sequenced to identify aptamers with the strongest target affinity.

[0134] A major limitation of SELEX lies in the inefficient recovery of strongly bound sequences since high-affinity aptamers often remain irreversibly associated with the target or the immobilization matrix and are lost during elution. This issue is particularly detrimental in early selection rounds, where rare high-affinity binders are most vulnerable to underrepresentation or complete elimination. While complementary base pairing forms the basis of these structures, non-canonical interactions, including mismatched bases, play a crucial role in shaping the complex folds necessary for specific binding. To overcome this, stem-loop-specific biotinylated MACs may be used to isolate targetbound aptamers (post denaturation and renaturation in the presence of said MACs, per methods described above). This MAC-enhanced SELEX approach not only increases the likelihood of recovering ultra-high-affinity aptamers but also addresses known pitfalls in traditional SELEX workflows, including non-specific enrichment, PCR amplification bias, target instability, and RNA degradation (if applicable). As such, the MAC-enhanced SELEX approach will maximize aptamer quality and reduce the risk of selecting suboptimal binders.Example 5 - Isolation, Purification, Enrichment and Identification of One or More Tumor-Specific Rare MinorityCDNAPM

[0135] DNA isolated from the blood (or other bodily fluids or a tumor) of patients with cancer is composed (1) mostly of DNAWTthat is (i) shed / released from apoptotic / necrotic normal cells and tissues, and (ii) often contaminated with somatic canonical point mutated DNA (CDNAPM) andmmBP- positive DNA heteroduplexes (DNAHD) that are not associated with the initiation / progression of cancer, and (2) very low levels of tumor cell DNA that is shed / released from apoptotic / necrotic tumor cells, said DNA composed of wild type DNAWTand tumor-associated canonical point mutated DNA(CDNAPM). This “biological background” of somatic nontumor specific mutations interferes in the successful identification and quantitation of tumor-specific mutations and represents a major source of potential false-positive mutations. The following examples demonstrate that the MACs, methods, and kits disclosed in this patent can resolve the “biological background” problem occurring in DNA test samples by (a) eliminating DNAWTandmmBP-positive DNA from the test sample, thereby enhancingcDNAPM-to-DNAWTratio, and (b) isolating, quantifying, and identifying specific tumor- associatedCDNAPM(S).Example 5, A,

[0136] Pancreatic ductal adenocarcinoma (PDAC) is the fourth most common cause of cancer death in the U.S. and Western Europe. Because (a) most patients have locally advanced or metastatic pancreatic cancer at diagnosis, (b) less than 20% can be operated on, (c) current chemotherapy has a modest effect, and (d) the 5-year survival is less than 5%, there continues to be an urgent need for novel technologies and strategies that will rapidly confirm the presence of specific tumor-associated canonical point mutated DNA (CDNAPM) and enable the early diagnosis and treatment of patients with PDAC.

[0137] Molecular characterization of PDAC has revealed that the most common single-nucleotide oncogenic driver KRAS mutations (a) occur within codon 12 of exon-2, (b) are present in -90% of pancreatic cancers, and (c) induce the replacement of the DNA codon GGT sequence (encoding for glycine) by (i) the GAT sequence (aspartic acid-KRASG12D-c.35 G>A (40%)), (ii) the CGT (arginine-KRASG12R-c.34 G>C (10%-20%)), and (iii) the GTT (valine-KRASG12V-c.35 G>T (28%- 33%)), and that the tumor depends mostly on these mutations for its development, metastatic progression, and treatment resistance.

[0138] To detect these point mutations, a kit of the invention is composed of a tube that contains a mixture ofACBP-binding-MAC,ccBP-binding-MAC, andTCBP-binding-MAC (structures shown in Diagram l.E.i), said structures (1) having ammBP-binding-MAC (highlighted areas in Diagram) that are each conjugated to (i) four bases that are complementary to the first canonical base pairs flanking both sides of themmBPs, (ii) the DNA stabilizing PAA derivative (2-amino-N-(prop-2-yn-l- yl)propenamide), and (iii) already bound to S Av-coated magnetic beads, and (2) dissolved in 100 pL of 0.1 M Tris-HCl pH 7 buffer. Upon addition of DNA isolated from the blood / plasma / sera / urine / tumor biopsies (Diagram l.E.ii) of patients suspected of having PDAC that has been heated to 95 °C for 2 min and then cooled to RT (to facilitate heteroduplexmmDNA formation), the magnetic bead-(GCBP-ACBP-TABP)-binding-MAC will readily and specifically form 15 H-bonds with DNAHDmolecules that areACBP-positive and are flanked by GC and TA, the MB-(TABP-ccBP-GCBP)-binding-MAC will readily and specifically form 16 H-bonds with DNAHDmolecules that areACBP-positive and are flanked by TA and GC, the MB-(GCBP-TCBP-TABP)- binding-MAC will readily and specifically form 15 H-bonds with DNAHDmolecules that areTCBP- positive and are flanked by GC and TA, while the PPA derivative (FIG. 17), known to increase the Tmof antisense oligonucleotides and the stability of the DNA duplex, will further strengthen the binding of these MACs to their respectivemmDNA. A magnet is then used (Diagram l.E.ii) to facilitate the washing of the MB-(GCBP-ACBP-TABP)-binding-MAC::::ACDNAHD, the MB-(TABP-ccBP-GCBP)-binding-MAC::::ccDNAHD, and the MB-(GCBP-TCBP-ATBP)-binding- MAC: : : :TCDNAHD. Next, the tube is heated to 95 °C (to denature themmDNAPM) and the single stranded DNA molecules aspirated and transferred to another tube that is then cooled down to RT (the MB-MACs are held in place by the magnet). This leads to the re-hybridization of the ssDNA molecules and the reformation of dsDNA. The test sample is now ready for downstream applications (e.g., Sanger sequencing, Nanopore sequencing, NGS, PCR, etc.).Example 5,B,

[0139] In this example (Diagram l.F), a kit of the present invention is composed of vial A, vial B, and tube A, said tube containing anACBP-binding-MAC (Diagram l.F.i) that is conjugated to 4 pseudo-complementary PNA molecules (GDC, CSG, DCC, and SGG, where D (2,6-diaminopurine) and S (2 -thiouracil) are pseudo-complementary nucleobases that (i) suppress self-duplex H-bond formation between pseudo-complementary PNA-PNA, and (ii) promote pseudo-complementary PNA-DNA duplex formation). ThisACBP-binding MAC forms double-duplex invasion with the bases flanking the mismatchedACBP and adds 23 H-bonds to eachACDNAPMmolecule (Diagram 1.F.iv). Since the MAC is also conjugated to a magnetic bead (Diagram 1 F .ii), it enables the isolation and detection ofACDNAPMand therefore the stratification of patients with unresectable pancreatic cancer.

[0140] The method for isolating and detecting the KRASG12Dis shown in Diagrams l.F.ii, l.F.iii, l.F.iv, and l.F.v. As shown, cfDNA, isolated from the blood or biopsy of a PD AC-positive patient, is transferred to tube A (Diagram l.F.ii), the contents of the tube are mixed, heated to 95 °C for 2 min, and cooled to RT (to facilitateACDNAHDformation (post melting and reannealing ofGCDNAWTandATDNAPM), as well as H-bond formation between theACBP-binding-MAC andACDNAHD). A magnet is then used to trap the magnetic bead-ACBP-binding-MAC::::ACDNAHDagainst the wall of tube A (Diagram 1.F.iii) and the beads are washed to eliminate DNAWTand DNA harboring any othermmBP (if present in the test sample). Next, the magnetic bead-ACBP-binding-MAC::::ACDNAHDsample is suspended in TRIS-HC1 buffer, transferred to vial A that is then heated to 95 °C (to meltACBP-positive DNAHDinto ssDNA), a magnet used to keep the magnetic bead-MACs in vial A, and the ssDNA-containing buffer (still at 95 °C) aspirated and transferred to said vial B (Diagram l.F.v). Finally, vial B is cooled to RT (to allow ssDNA to convert to double strandedACDNAHD, Diagram l.F.vi) and its contents used in any downstream applications (e.g., NGS, PCR, etc.). Similarly, a KRASG12R-ccBP-binding-MAC that is pre-conjugated to 4 PNA molecules (CGD, CDC, GCS, and GSG that form double-duplex invasion with the bases flanking the mismatchedCCBP and adds 24 Flbonds to eachCCDNAPMmolecule) is used to isolate / detectCCDNAPM. The results will be used to stratify PDAC patients since KRASG12D-positive patients have the worst prognosis (OS of 6 months) while KRASG12R-positive patients have an OS of 14 months.Example 5.C.

[0141] Cell-free DNA (cfDNA) refers to small dsDNA fragments (mostly -150-170 BP long) released from apoptotic and necrotic malignant and nonmalignant cells into bodily fluids (e.g., plasma). The amounts of cfDNA isolated from the peripheral blood of patients with cancer is very small and variable (from a few ng / mL to hundreds of ng / mL) and often elevated compared to those of healthy controls, these excesses originating mainly from leukocytes without any contributions from either the tumor or its normal surrounding tissues. In these patients, cfDNA is composed of DNAWTthat is derived mainly from normal cell DNA and tumor-derived DNA (referred to as circulating tumor DNA (ctDNA), andCDNAPM(canonical point mutated DNA). Despite the facts that (i) the amount of ctDNA released into the blood varies (depends on cancer type, tumor burden, and metastasis), (ii) the quantity of DNAWT- particularly in early stage cancers - often exceeds that ofCDNAPMby 103, 104, 105fold or more (i.e., a variant allele frequency (VAF) of 0.1%, 0.01%, 0.001%, or less) - essentially a needle in a haystack, (iii) PCR (and other amplification techniques) will amplify both the major DNAWTand minorCDNAPMalleles with the same efficiency, (iv) current methods used to detect and identify very low abundance mutations have limited sensitivities, and (v) stochastic sampling of the tumor genome in a blood draw, limits the ability of DNA-based assays to sensitively detect, monitor, and genotype cancer from ctDNA, scientists and clinicians continue to use cfDNA to detect tumor presence, aid in cancer screening, select targeted therapies, and monitor post-treatment tumor resistance, recurrence, and / or residual disease

[0142] As stated earlier, heteroduplexes are formed during PCR when both DNAWTandCDNAPMare present in DNA test samples isolated from patients with cancer. This occurs because the PCR process involves denaturation and re-annealing of DNA strands, allowing formmBP(s) to form between the WT and mutant sequences during the re-annealing step and creating heteroduplex molecules. Since the disclosed MACs form multiple H-bonds and ionic bonds with heteroduplexDNA (DNAHD), they are ideally suited to (i) capture and isolate DNAHDfrom the DNAWT, (ii) alter DNAWT-to-cDNAPMratio from e.g., >1,000,000: 1 to 1: 1, and (iii) substantially enhance the accuracy of downstreamCDNAPMdetection methodologies (e.g., PCR, NGS, etc.).

[0143] In this example, a biotinylated peptide nucleic acid MAC derivative (B-PNA-MAC),ACBP- binding-MAC (structure shown in Diagram l.G.i) is used to confirm the presence of the KRASG12Dpoint mutation (ATDNAPM) and purify and enrich this mutated gene in a DNA test sample isolated from plasma / serum / tumor biopsy. DNA is extracted from the plasma of pancreatic cancer patients (positive for the KRASG12D(ATDNAPM) gene, e.g., oneATDNAPMallele in a background of 106GCDNAWTalleles) and transferred to a vial.

[0144] step 1 : The vial is heated to 95 °C (to denature DNA) and cooled slowly to RT (to renature DNA). This leads to the formation of a mixture that contains approximately 999,999GCDNAWTmolecules, for everyACDNAHDmolecule andGTDNAHDmolecule;

[0145] steps 2 and 3 : MB-PNA-MAC is added to the vial and incubated for 5 min;

[0146] step 4: A magnet is used to immobilize and wash the MB-PNA-MAC: : : :ACDNA (3 times to remove non-boundGCDNA andGTDNAHD(andATDNA - if present) molecules);

[0147] step 5: The vial is heated to 95° C to denature the MB-bound double strandedACDNAHD;

[0148] step 6: The single stranded DNA molecules (ssDNA), released into the buffer from the MB-ACBP-binding-MAC, are transferred to another vial; and

[0149] step 7: The Vial is set aside to cool down to RT. This leads to the rehybridization of the ssDNA molecules and the formation of pureACBP-positive DNA heteroduplex molecules (100%ACDNAHD, 0%GTDNAHD, 0%GCDNAWT, and 0%ATDNAPM).

[0150] In another experiment (Diagram l.G.ii), the same method is used as above with a single exception: two biotinylated peptide nucleic acid MAC derivatives are used (B-ACBP-binding-MAC and B-GTBP-binding-MAC) to confirm the presence of the KRASG12Dpoint mutation (ATDNAPM) and purify and enrich this mutated gene in a DNA test sample isolated from plasma / serum / tumor biopsy.

[0151] step 1 : The vial is heated to 95 °C and cooled to RT. This leads to the formation of a mixture that contains 999,999GCDNAWTmolecules, oneACDNAHDmolecule, and oneGTDNAHDmolecule;

[0152] steps 2 and 3 : MB-PNA-MACACand MB-PNA-MACGTare added to the vial and incubated for 5 min;

[0153] steps 4 and 5: A magnet is used to immobilize and wash the MB-PNA-MACAC: : : :ACDNAand the MB-PNA-MACGT: : : :GTDNA;

[0154] step 6: The vial is heated to 95 °C to denature the MB-bound double strandedACDNAHDandGTDNAHD;

[0155] step 7 : The single stranded DNA molecules (ssDNA), released into the buffer from the MB-ACBP-binding-MAC and the MB-GTBP-binding-MAC, are transferred to another vial; and

[0156] step 8: The vial is set aside to cool down to RT. This leads to the rehybridization of the ssDNA molecules and the formation of (50%) pureATDNAPMmolecules and 50%GCDNAWT.Example 5,D,

[0157] In this example, aGGBP-binding-MAC whose structure is shown in Diagram l.H.i, is used to isolateGGBP-positive DNA (GGDNAPM) from a DNA test sample. In this case, Ria= propargyl derivative = PAI = 2-amino-3 -methyl -N-(prop-2-yn-l-yl)-pentanamide, Rib= 4,5-dimethyl-thiazol, Ric= linker-magnetic bead, and Rid= glycerol. The DNA test sample is added to a tube that contains the magnetic bead-GGBP-binding MAC and a magnet is used to isolate and wash the magnetic bead-GGBP-binding-MAC::::GGDNAPM(Diagram l.H.ii). TheGGBP-binding-MAC forms 14 H-bonds specifically with mismatchedGGBP(s) while the propargyl and thiazole derivatives, known to increase the stability of DNA duplexes Tmof antisense oligonucleotides, further strengthens the binding of the magnetic bead-GGBP-binding-MAC to theGGDNAPM. The tube is then heated to 95 °C to denature theGGDNAPMmolecules, the magnet is used to hold the magnetic bead-GGBP-binding- MAC against the wall of the tube, and the now ssDNA molecules are aspirated and transferred to another tube. The sample is cooled, this leading to the hybridization of the ssDNA molecules and the reformation ofGGDNAPM(ready for downstream applications).Example 5.E.

[0158] In this example, accBP-binding-MAC (general structure shown in FIG. 6.vi and in Diagram 1.1) is used to isolateCCDNAPMfrom a DNAWT-CCDNAPMmixture. In this case, Ria= propargyl derivative = 2-amino-3-(lH-indol-3-yl)-N-(prop-2-yn-l-yl)-propanamide, and Rib= linker-biotin. Upon the addition of this biotin-ccBP-binding MAC derivative to a sample that contains a mixture ofCCDNAPMand DNAWT, theccBP-binding MAC will form 10 H-bonds specifically with any mismatchedccBP(s) (Diagram 1.1) while the 2 propargyl prop-2-yn-l -amine derivatives, known to increase the Tmof antisense oligonucleotides and DNA duplexes, will further stabilize theCCDNAPM. Next, SAv-coated magnetic beads are added to the sample-containing tube and a magnet used to isolate and wash the magnetic bead-SAv-ccBP-binding MAC::::ccDNA. The tube is heated to 95 °C to denature theCCDNA, the magnet is used to hold the magnetic bead-SAv-ccBP-binding MACagainst the wall of the tube, and the now ssDNA molecules aspirated and transferred to another tube where the sample is cooled. This leads to the hybridization of the ssDNA molecules and the reformation of ultrapureCCDNAPM(ready for downstream applications).Example 5.F.

[0159] The p53 gene (TP53) is one of the most frequently mutated tumor-suppressor gene in human tumors (almost 1,000 alleles having been identified) and whose inactivation promotes tumorigenesis. These mutations are distributed in all coding exons of the TP53 gene, with a strong predominance in exons 4-9 (6 hotspot residues R175 (G>A), G245 (G1>T & G2>A), R248 (C>T, G>A or G>T), R249 (G1>T, G2>T or G2>C), R273 (G>T or G>A), and R282 (C>T)), which encode the DNA-binding domain of this protein. The frequency of TP53 mutations varies greatly between different tumor types. For example, 96% of all high-grade serous ovarian cancers express these mutations. The accurate detection of these mmBP in the blood of women is very important (screening, diagnosis, targeted therapy selection, treatment response / resistance monitoring, post-treatment tumor surveillance to detect recurrence and / or residual disease, etc.).

[0160] To detect these 12 DNAPMs, a kit of the invention is composed of vial A, vial B, and tube A (containing a mixture ofACBP-binding-MAC,ccBP-binding-MAC,CTBP-binding-MAC, andGTBP-binding-MAC, selected from one of the general structures shown in FIG. 17), said MACs preconjugated (via PNA backbones) to bases that are complementary to those flanking the mismatched bases (Diagram l.J, top), and magnetic beads, the MACs dissolved in 10 pL of 0.1 M Tris-HCl pH 7.5 buffer. The content of tube A is used to isolate any DNA molecules that are positive for all said 12 P53mmBP mutations, thereby enabling the diagnosis of ovarian cancer in that patient.

[0161] To this end, a DNA test sample (e.g., isolated from plasma, urine, tumor biopsies, etc., of a woman suspected of having ovarian cancer, pre- or post-PCR amplification) is transferred to tube A (Diagram 1.J). The contents of tube A are mixed, heated to 95 °C for 2 min and incubated at RT to facilitate the formation of (i)mmBP-positive DNAHDheteroduplexes (DNAHD), and (ii) H-bonds between the MACs and the DNA molecules that containACDNAHD(if present),CCDNAHD(if present),TCDNAHD(if present), andTGDNAHD(if present). A magnet is then used to trap the magnetic bead-MACs against the wall of tube A (i.e., magnetic bead-ACBP-binding-MAC::::ACDNAPM, magnetic bead-ccBP-binding-MAC::::ccDNAPM, magnetic bead-TCBP-binding-MAC::::TCDNAPM, and magnetic bead-TGBP-binding-MAC::::TGDNAPM) while they are being washed to eliminate DNAWTand DNA harboring any othermmBP-positive DNA molecules. Next, the magnetic bead-mmBP-binding-MAC::::nimDNA are suspended in 50 pL of TRIS-HC1 buffer, and transferred to vial A that is heated to 95 °C for 2 min to melt DNAHDinto ssDNA. A magnet is used to keep the MB-MACs in vial A and the ssDNA-containing buffer aspirated, transferred to vial B that is then cooled to RT to allow conversion of ssDNA into DNAHDbefore its contents are used in in downstream applications (e.g., NGS, PCR, etc.).Example 6 - Purification of DNA Amplicons FrommmBP-Positive Amplicons

[0162] PCR is known to generate various extension errors (e.g., 2E-4 errors / bp / duplication for Taq polymerase; 6E-7 errors / bp / duplication for pfu polymerase) that include template rearrangements,mmBP(s) which can be misinterpreted as mutations (false positives), enrichment of some mutant alleles at the expense of others, etc. The downstream use of such error-containing amplicons could have serious drawbacks. For example, when a post-PCR mixture of DNA fragments is used in cloning, the PCR artifacts are also cloned and thus become indistinguishable from the targeted genuine mutations. In fact, the fractions of PCR errors observed in post-PCR cloning procedures are comparable to the fractions of in vivo mutations and often interfere with mutational analysis. The MACs, methods, and kits of the present invention can be used to (a) remove DNA amplificationgeneratedmmBP that may interfere with and / or complicate further downstream procedures and analyses, e.g., DNA / RNA fragments / oligos / amplicons / genes / vectors used in cloning, gene editing, and / or recombinant genes, etc., and (b) prevent contamination, improve accuracy, and minimize / eliminate the risk of biases. Since the well-known CRISPR-Cas system, used to regulate transcription and edit the genome, also requires nucleic acid amplification and is compromised by the presence of mismatches within DNA, use of MACs to eliminate amplification-mediated base mismatch errors will also improve the performance of this technique.

[0163] In this example, a kit of the invention is composed of (i) vial A that contains aAABP- binding-MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP-binding-MAC,ACBP-binding-MAC,AGBP-binding-MAC,CTBP-binding-MAC, andGTBP-binding-MAC (Diagram 2), each selected from one of the general structures shown in FIGS. 5-12, and pre-conjugated to magnetic beads, and said mixture of MACs dissolved in 100 pL of 0.1 M Tris-HCl pH 7.5 buffer, (ii) vial B, and (iii) one rod having a magnet at its proximal end, for eliminatingmmBP-positive amplicons generated during PCR amplification.

[0164] Towards this end, a DNA test sample pre-isolated from blood, plasma, serum, urine, etc. is transferred to vial B and PCR amplified (step 3 in Diagram 2). The rod-magnet is inserted into vial A (step 1 in Diagram 2), withdrawn (step 2 in Diagram 2) once said magnetic bead-MACs have bound to the magnetic tip of the rod, and the magnetic tip of the rod is inserted into vial B (step 4 and step 5 in Diagram 2). Following a 5 min incubation at RT during which multiple H-bonds are formed between anyAABP- / ccBP- / GGBP- / TTBP- / ACBP- / AGBP- / CTBP- / GTBP-positive amplicons andAABP- / ccBP- / GGBP- / TTBP- / ACBP- / AGBP- / CTBP- / GTBP-binding-MACs (bound to the magnetic tip of the rod), the magnetic rod is withdrawn from vial B (step 6 in Diagram 2). The DNA that is left within vial B is now free of allmmBP-positive DNA.Example 7 - Quantification of Tumor Mutational Burdens (TMB) in DNA Isolated from Tumor Biopsies

[0165] Somatic mutations (CDNAPM) are responsible for the development and progression of cancer and various other diseases. To fully appreciate the impact of these unknown mutations (for example in tumor biopsies) on disease progression and the variable response rates to cancer therapeutics (a-priori and / or a-posteriori), investigators have been using whole exome sequencing (WES) and next generation sequencing (NGS) targeted panels to detect and measure their total numbers in tumor specimens (termed the mutation load or tumor mutational burden (TMB), defined as the number of somatic mutations per megabase of interrogated genomic sequence). These studies have demonstrated that WES is effective in discriminating responders from non-responders across several tumor entities. However, the approach (which is considered to be the gold standard) is time consuming and expensive due to the sequencing of a large genomic space. Consequently, it continues to be confined to research settings and is of limited utility in daily clinical routine use. While NGS targeted panels provide TMB estimates in a more time-effective and cost-effective manner, the technology leads to high variability in TMB estimates across laboratories, mainly due to differences in panel size and gene coverage and the underlying bioinformatics pipelines used. Thus, there is a need for rapid and highly accurate methods and technologies that can measure TMB and enable, for example, the identification of patients who are most likely to derive benefit from these therapies and patients who have already undergone therapeutic intervention. The MACs, methods, and kits of the invention can rapidly quantify TMB in DNA isolated from tissue biopsies.

[0166] Towards this end, a kit of the invention is composed of (a) vial A that containsAABP- binding-MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP-binding-MAC,ACBP-binding- MAC,AGBP-binding-MAC,CTBP-binding-MAC, andGTBP-binding-MAC (step 1, Diagram 3), each selected from one of the general structures shown in FIGS. 5-12, said MACs pre-conjugated to magnetic beads, said magnetic bead-MAC dissolved in 10 pL of 0.1 M Tris-HCl pH 7.5 buffer, (b) vial Bl and vial B2, (c) vial Cl and vial C2 that contain 20 pL of 0.1 M Tris-HCl pH 7.5 buffer and the DNA intercalator SYBR Green (or other DNA binding / intercalating fluorescent molecules, e.g., SYTO®9, SYTO®22, SYBR Gold®, LC Green® Plus, EvaGreen™, Chromofy™, and the like), and (d) 2 rod-magnets, wherein the kit used to quantify TMB in DNA isolated from tumor tissue biopsies. Specifically, 10 pm thick sections are cut from formalin-fixed, paraffin-embedded (FFPE) tissueblocks, deparaffinized, and the tumor areas are macro-dissected from unstained slides using a marked hematoxylin-eosin (H&E) stained slide as reference. Normal tissues are also macro-dissected from surrounding areas. The tumor tissue and normal tissue are each digested overnight using proteinase K, their DNA isolated and quantified, and 100 ng of DNA (in 10 pL of TRIS buffer) from each test sample transferred to vials Bl and B2 (per Diagram 3). Each vial is then flicked, spun, heated to 95 °C for 2 min and incubated at RT to facilitate the formation of DNA heteroduplexes, i.e.,AADNAHD,CCDNAHD,GGDNAHD,GGDNAHD,ACDNAHD,AGDNAHD,CTDNAHD, andGTDNAHD. Next, each of the two rod-magnets are (a) inserted into the magnetic bead-MAC containing vial A (step 2, Diagram 3), (b) removed once the magnetic bead-MACs have magnetically attached to the magnetic tip of these rods (step 3, Diagram 3), and (c) inserted into vials Bl and B2 (step 4, Diagram 3). The vials are then heated to 60 °C for 2 min and incubated at RT for 5 min to facilitate the formation of specific H-bonds between the MACs and DNAHD(magnetic bead-MAC: : : :DNAHD). Each rod is then withdrawn from its respective vial (step 5, Diagram 3) and inserted into the SYBR Green-containing vials (Cl and C2). Next, the vials are heated to 95 °C for 2 min to denature the DNAHDinto ssDNA molecules, and release the now ssDNA molecules into the solution. The rods are withdrawn from the hot vials (step 6, Diagram 3) and the latter set aside to cool to RT, this leading to the hybridization of the ssDNA molecules and the formation of SYBR Green: : : :DNAHD. The fluorescence intensity of vials Cl and C2 (due to SYBR Green intercalation with DNAHD) is quantified (relative fluorescence units / 100 ng DNA) and the net TMB calculated (= TMBTT- TMBNT).Example 8 - Isolation, Enrichment Purification, Quantification, and Identification ofmmDNAPMin Tissue Biopsies and Bodily Fluids

[0167] The MACs, methods, and kits of the invention are useful for the detection, identification, and quantification ofmmDNAPMisolated from tissue biopsies and bodily fluids.Example 8. A.

[0168] In this example (see Diagram 4. A), a kit of the invention is composed of (a) vial A containingAABP-binding-MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP-binding-MAC,ACBP-binding-MAC,AGBP-binding-MAC,CTBP-binding-MAC, andGTBP-binding-MAC, each selected from one of the general structures shown in FIGS. 5-12, and pre-conjugated to magnetic beads and dissolved in 10 pL of 0.1 M Tris-HCl pH 7.5 buffer, and used to capture anymmBP- containing DNA present in a bodily fluid, (b) one rod having a magnet at its proximal end, (c) vial B and vial C, each containing 0.5 mL TRIS-HC1 buffer, 150 mM NaCl, pH 8, and (d) vial D that contains 20 pL of TRIS-HC1, pH 8 buffer. The contents of vial A are added to 1 mL of blood (or plasma, serum, and the like). After 5 min, the rod-magnet is (a) inserted into the vial to allow theDNA molecules that contain any of the 8mmBPs, now H-bonded to the MB-MACs to bind to the magnetic tip of the rod, (b) removed from vial A and dipped 3 times into vial B (containing saline) to wash themmDNAPMmolecules and dissociate them from proteins, lipids, and other contaminants, (c) removed from vial B and dipped 3 times into vial C, and (d) removed from vial C and dipped into vial D. The rod-magnet-magnetic bead-MAC: : : :mmDNAPM-containing vial D is then heated to 95 °C to denature themmDNAPMinto ssDNA molecules and to release them into the solution. The rodmagnet is then withdrawn from the hot vial D and the latter set aside to cool to RT. This leads to the re-hybridization of the ssDNA molecules and the formation of the highly purifiedmmDNAPMmolecules. ThemmDNAPMmolecules are quantified and then identified using downstream applications (e.g., Sanger DNA sequencing, targeted NGS).Example 8,B,

[0169] In this example (see Diagram 4.B), a kit of the invention is composed of (a) vial A containing a MAC that is selected from one of the general structures shown in FIGS. 13-17 and preconjugated to magnetic beads and dissolved in 10 pL of 0.1 M Tris-HCl pH 7.5 buffer and used to selectively bind to a knownmmBP-containing DNA present in a DNA test sample, (b) one rod having a magnet at its proximal end, (c) vial B and vial C, each containing 0.5 mL TRIS-HC1 buffer, 150 mM NaCl, pH 8, and (d) vial D that contains 20 pL of TRIS-HC1, pH 8 buffer. The contents of vial A are added to 1 mL of blood (or plasma, serum, and the like). After 5 min, the rod-magnet is (a) inserted into the vial to allow the DNA molecules that contain any of said 8mmBPs, now H-bonded to the magnetic beads-MACs, to bind to the magnetic tip of the rod, (b) removed from vial A and dipped 3 times into vial B (containing saline) to wash themmDNAPMmolecules and dissociate them from proteins, lipids, and other contaminants, (c) removed from vial B and dipped 3 times into vial C, and (d) removed from vial C and dipped into vial D. The rod-magnet-magnetic bead- MAC: :::mmDNAPM-containing vial D is then heated to 95 °C to denature themmDNAPMinto ssDNA molecules and to release them into the solution. The rod-magnet is then withdrawn from the hot vial D and the latter set aside to cool to RT. This leads to the re-hybridization of the ssDNA molecules and the formation of the highly purifiedmmDNAPMmolecules. The isolated specificmmDNAPMis quantified and used in downstream applications (e.g., Sanger DNA sequencing, targeted NGS, etc.).Example 9 - Detection, Identification, and Quantification of MultipleCDNAPM

[0170] The KRAS gene encodes the protein GTPase that plays a role in cell growth signaling and division, differentiation, and apoptosis. This gene is considered a proto-oncogene because when somatic point mutations occur, it can lead to uncontrolled cell proliferation and tumor formation. The accurate detection of these disease-associated mutants is the prerequisite for guiding clinicaldecision-making. Current commercial kits, such as the FDA approved TheraScreen KRAS kit (Qiagen), which detects 7 mutations in codons 12 and 13 of the KRAS gene using DNA derived from human colorectal cancer (CRC) tumor tissue, is used to help identify CRC patients who may benefit from treatment with Erbitux® (cetuximab) or with Vectibix® (panitumumab). The MACs, methods, and kits of the invention are useful for the on-site detection of 7 KRAS point mutations in DNA extracted from tumor tissues and from plasma.

[0171] To detect these mutations, a kit of the invention (Diagram 5) is composed of: (1) vial A (containing DNA that has been denatured and renatured post its isolation from the plasma of CRC patients, (2) vial B (containing DNA that has been denatured and renatured post its isolation from the plasma of healthy men and women), (3) vials 1-7 that contain the following fluorophore-labeled MACs (F-MACs): F-(GCBP-ccBP-TABP)-binding-MAC (vial 1), F-(TABP-TCBP-GCBP)-binding- MAC (vial 2), F-(GCBP-ACBP-TABP)-binding-MAC (vial 3), F-(TABP-ccBP-GCBP)-binding-MAC (vial 4), F-(TABP-ACBP-GCBP)-binding-MAC (vial 5), F-(GCBP-TCBP-TABP)-binding-MAC (vial 6), and F-(GCBP-ACBP-CGBP)-binding-MAC (vial 7), each of the MACs selected from the general structures shown in FIGS. 5-17 and designed to form multiple (i) H-bonds specifically with these specificmmBP and with the BPs flanking saidmmBP that is present within the heteroduplexes formed between the bead-attached KRASWT-specific synthetic 20-mer oligoprobes and DNA fragments that are positive for each of the seven KRAS mutations (i.e., KRASG12A(TTGGAGCTGCGTGGCGTAGG), KRASG12C(GTTGGAGCTTGTGGCGTAGG), KRASG12D(TTGGAGCTGATGGCGTAGGC), KRASG12R(GTTGGAGCTCGTGGCGTAGG), KRASG12S(GTTGGAGCTAGTGGCGTAGG), KRASG12V(TTGGAGCTGTTGGCGTAGGC), and KRASG13D(GAGCTGGTGACGTAGGCAAG)), and (ii) nonspecific intermolecular electrostatic ion-ion bonds between the positively charged groups of the MACs and the negatively charged PO4- groups present within the backbone of the hybridized ssDNA-oligoprobes, (4) vial 8 that contains F-(GCBP-CCBP-TABP)-binding-MAC, F-(TABP-TCBP-GCBP)-binding-MAC, F-(GCBP-ACBP-TABP)-binding-MAC, F-(TABP-ccBP-GCBP)-binding-MAC, F-(TABP-ACBP-GCBP)-binding-MAC, F-(GCBP-TCBP-TABP)- binding-MAC, and F-(GCBP-ACBP-CGBP)-binding-MAC), and (5) a plate containing a set of microliter wells that contain beads pre-spotted with theWTKRAS-specific synthetic 20-mer oligonucleotide (5’-TTGGAGCTGGTGGCGTAGGC-3’). DNA from vial A (post denaturation and renaturation) is transferred to vials 1-7 (100 ng / vial) and 100 ng of DNA (post denaturation and renaturation) from vial B is transferred to vial 8. The vials are flicked, spun for a few seconds, and their contents transferred into wells. The plate is heated to 95 °C for 5 min and cooled to RT. This leads to the hybridization of the ssDNA molecules (formed post heating) with said oligoprobes and the formation of (i) homoduplexes (perfect matching sequences between the oligoprobes andKRASWT-SSDNA, well 8), (ii) heteroduplexes between the oligoprobes and ssDNA fragments that are positive for the 7 KRAS mutation, i.e., KRASG12A(well 1), KRASG12C(well 2), KRASG12D(well 3), KRASG12R(well 4), KRASG12S(well 5), KRASG12V(well 6), and KRASG13D(well 7), (iii) multiple H-bonds between each F-MAC and the specificmmBP that is present within each of the heteroduplexes, (iv) multiple H-bonds between each said F-MAC and the 2 BPs flanking the specificmmBP, and (v) intermolecular electrostatic ion-ion bonds between the positively charged groups present within the MACs and the negatively charged PO4- groups present within the backbones of the heteroduplexes. The wells are then washed to remove any unbound DNA and F-MACs and scanned by a laser to detect and quantify the fluorescent signals in well 1-8, thus enabling the identification of all 7 KRAS mutations (wells 1-7) and confirming the specificity of these MACs consequent to the absence of fluorescent signals, i.e., binding to homoduplexes formed in well 8.Example 10 - MAC Microarrays to Detect, Identify, and QuantifymmDNAPMBurdens

[0172] Oligonucleotide microarray (DNA chip)-based hybridization analysis is a high throughput technology that enables rapid and cost-effective gene expression profiling and the screening / detection of sequence variations (SNPs, point mutations, etc.) in genomic DNA. The MACs of the invention lend themselves to microarray technologies, as they will reduce their cost and simplify the overall process, essentially by negating the need to (a) biotinylate each DNA test sample or label it with fluorophores, and (b) include multiple probes for each possible base substitution. In addition, MACs are inexpensive to synthesize and will easily bind to and detect / identify known / unknown SNPs and disease-causing base substitutions.

[0173] In one example, the MACs (selected from one of the general structures shown in FIGS. 5- 12) are pre-conjugated to uniquely colored fluorophores (i.e., F'- BP-binding-MAC, F2-CCBP- binding-MAC, F3-GGBP-binding-MAC, F4-TTBP-binding-MAC, F5-ACBP-binding-MAC, F6-AGBP- binding-MAC, F7-CTBP-binding-MAC, and F8-GTBP-binding-MAC - see for example the structures shown in Diagrams 9 and 10), and added to a microarray slide / chip post introduction of a heat- denatured ssDNA Test sample (not labeled with fluorescent molecules, biotin, etc.) into the slide / chip and the hybridization of these ssDNA(s) to the array’s oligonucleotides (Diagram 6), the F-MAC introduction leads to the formation of multiple H-bonds between each F-MAC and the specificmmBP of the ssDNA-oligonucleotide heteroduplex, and the binding enables the detection (per color of fluorophore) of each non-canonical base pair mismatch (i.e.,AABP,CCBP,GGBP,TTBP,ACBP / CABP,AGBP / GABP,CTBP / TCBP, and / orGTBP / TGBP) that each MAC is specific to.

[0174] In another example, the MACs selected from one of the general structures shown in FIGS. 13-17) are pre-conjugated to uniquely colored fluorophores (i.e., F'-AABP-binding-MAC, F2-CCBP-binding-MAC, F3-GGBP-binding-MAC, F4-TTBP-binding-MAC, F5-ACBP-binding-MAC, F6-AGBP- binding-MAC, F7-CTBP-binding-MAC, and F8-GTBP-binding-MAC), and added to a microarray slide / chip post introduction of ssDNA test sample (not labeled with fluorescent molecules, biotin, etc.) into the slide / chip and the hybridization of these ssDNA(s) to the array’s oligonucleotides, the F-MAC introductions leads to the formation of multiple (a) H-bonds between the F-MACs and (i) the specificmmBP found within the ssDNA-oligonucleotide heteroduplexes, and (ii) the canonical BPs flanking saidmmBPs, and (b) intermolecular electrostatic non-specific ion-ion bonds between positively charged groups present within said MACs and the negatively charged PO4- groups present within the backbones of these heteroduplexes, said binding enabling the detection and identification (per color of fluorophore) of the specificmmBPPMthat (i) the MACs are specific to, and (ii) are directly interrelated to pre-knownm'"DN APMpresent within the DNA / cDNA test sample.Example 11 - Identification of SpecificmmBP-Positive DNA

[0175] High-resolution melting (HRM) curve analysis is a PCR-based assay that is used to identify / confirm subtle variations in the melting temperature (Zm) of DNA and as such, is often used to discriminate between DNAWTandCDNAPM, i.e., those in which a complementary BP (e.g., GC) has been replaced by another canonical BP (e.g., AT, CG, etc.). However, the method is not always suitable for all amplicons, particularly some GC-rich amplicons, especially since the T m ofcDNAPMmolecules is slightly lower or higher (<0.5°C) than that of the DNAWT. For example, a A 7 / 7? of 0.27 °C is reported for the KRASG>Apoint mutation (ATDNA) and the KRASWT(GCDNA). Additionally, while HRM can determine the presence of mutation(s) in a sample, it is unable to identify the specific mismatch within themmBP that is causing the variant melt curve. This is a particularly important issue when mutations or variants are not known a-priori and / or a-posteriori and are likely to occur at any position within the amplicon sequence. Consequently, sequencing of the amplicons must be used to determine the genetic sequence of DNA fragments (e.g., Sanger DNA sequencing, NGS, targeted NGS) and thereby identify the mutation. These sequencing methods continue to require a significant investment in time and materials, are labor-intensive, and require complex protocols for data analysis. Additionally, since NGS platforms generate sequence data from ssDNA fragments, any artifactual mutations introduced during the initial round of PCR amplification continue to be undetectable as errors - even with tagging techniques - if the base change is propagated to all subsequent PCR duplicates. Since these drawbacks necessitate (i) the use of HRM curve apparatus with a SD of <0.1 °C, and (ii) downstream time consuming (several days), complex, and expensive error-prone methodologies (e.g., NGS) to confirm the results, it is desirable to develop improved methods that enable the differentiation between DNAWTand disease-associatedCDNAPMmolecules that have very similar Tms. As shown in the example below, the MACs, methods, and kits of the invention enable the differentiation between the targeted heteroduplex DNA and all other DNA molecules (i.e., canonical DNAWTandCDNAPMmolecules as well as DNA molecules that have othermmBPs), this being a consequence of the formation of (i) multiple H-bonds specifically with themmBPs present withinmmDNA heteroduplexes, and (ii) the substantial selective increase in their Tm(several °C) without altering the Tmof canonical DNAWTandCDNAPMmolecules as well as DNA molecules that have othermmBPs, and (b) confirm the presence of the mutated gene and its identity.Example 11. A,

[0176] In this example, aGGBP-binding-MAC has the general structure shown in FIG. 7.ii, where Ri = propargyl derivative = PAA = 2-amino-N-(prop-2-yn-l-yl)-propanamide, a molecule known to confer additional duplex stability and increase the Tmof antisense oligonucleotides. ThisGGBP- binding-MAC (2,2’-((7,8-bis(6-amino-5-oxohept-l-yn-l-yl)-2,3-dioxo-2,3,5,10-tetrahydro- pyrazino(2,3-b)quino-xaline-6,9-diyl)-bis-(oxy))bis-(ethan-l-aminium) - structure shown in Diagram 7. A), is then added to a vial containing a mixture of DNAWT(GCDNA) and mutant DNA (CGDNAPM) and the DNA intercalator SYBR Green, and the vial’s contents are mixed, heated to 95 °C for 2 min and cooled to RT (to facilitate (i) heteroduplex formation (i.e., between the WTGCDNA molecules and the mutantCGDNAPMmolecules), and (ii) the formation of 8 H-bonds between theGGBP-binding-MAC molecules specifically with eachGGBP withinGGBP-positive DNA molecules (Diagram 7. A). Since these 8 H-bonds, together with the duplex stabilization conferred by the presence of the 2 propargyl derivatives, will increase the TmofGGBP-positive DNA without any change in the Tmof the DNAWT(per FIG. 4) and enable the rapid detection (per substantial increase of TminGGDNAPMmelt profile post melting curve analysis) and the identification ofGGBP mismatch-containing DNA within the test sample.Example l l.B,

[0177] In this example, anACBP binding peptide nucleic acid (PNA) MAC (PNA-ACBP-binding- MAC, structure shown in Diagram 7.B) is used. This MAC forms (a) multiple specific H-bonds with (i) mismatchedACBPs present in DNA (ACDNAPM) heteroduplexes, and (ii) canonical BPs flanking theACBPs, and (b) nonspecific intermolecular electrostatic ionic bonds between MAC- bound positively charged ammonium ions (— NHF) and the negatively charged — PO4- groups present within the targeted DNA’s backbone. Specifically, the PNA-ACBP-binding-MAC is added to a vial containing a mixture of PCR-amplified DNA test sample that contains equimolar concentrations of KRASWTamplicons (GCDNAWT), KRASG12Damplicons (ATDNAPM), and the DNAintercalator SYBR Green, the vial is flicked to mix its contents, heated to 95 °C for 2 min and cooled to RT to facilitateACDNAHDandGTDNAHDformation and the selective binding of the PNA-ACBP- binding-MAC to theACDNAHD(51 H-bonds and 16 ionic bonds, see Diagram 7.B). When HRM (0.2 °C step increments, 5 second hold before each acquisition, from 65 °C to 98 °C) is performed under these conditions, the Tmof theACDNAPMmolecules will substantially increase (Diagram 7.C) without any change in the Tmof the canonicalGCDNAWTmolecules,ATDNAPMmolecules (if present), andGTDNAHDmolecules, thereby enabling the facile detection and identification ofACBP-positive DNA within the test sample.Example 12 - Profiling and QuantifyingmmBP-Positive DNA

[0178] The MACs, methods and kits of the invention can be used (a) to detect / identify / confirm the presence of one or more specific variant(s) in a particular population of DNA molecules, and (b) to quantify the fraction of variant DNA molecules in that population.

[0179] In this example, a kit of the invention is composed of (a) vials 1-9, each containing a mixture of MACs (per Diagram 8) that are chosen from those shown in FIGS. 5-12 and preconjugated to magnetic beads and to the DNA stabilizing molecules PAI (2-amino-3-methyl-N- (prop-2-yn-l-yl)-pentanamide), PAA (2-amino-N-(prop-2-yn-l-yl)propenamide), and 4,5-DT (4,5- dimethylthiazol), and dissolved in 10 pL of 0.1 M Tris-HCl pH 7.5 buffer, (b) vials 11-18 each containing the DNA intercalator SYBR Green (or other DNA binding fluorescent molecules, e.g., SYTO®9, SYTO®22, SYBR Gold®, LC Green® Plus, EvaGreen™, Chromofy™), and onemmBP- binding-MAC (i.e., vial 11 :AABP-binding-MAC, vial 12:ccBP-binding-MAC, vial 13:GGBP- binding-MAC, vial 14:TTBP-binding-MAC, vial 15:ACBP-binding-MAC, vial 16:AGBP-binding- MAC, vial 17:CTBP-binding-MAC, and vial 18:GTBP-binding-MAC) that are dissolved in 10 pL of 0.1 M Tris-HCl pH 7.5 buffer, and (c) vial 19 containing 10 pL of buffer.

[0180] Step 1 : 10 pL of a DNA Test Sample are added to vials 1-9. The vials are flicked again, spun, heated to 95 °C for 2 min and cooled to RT to formmmBP-containing heteroduplexes and facilitate the formation of H-bonds between the MB-MACs and themmBP, if they are present within the DNA Test Sample. A magnet is then used to remove and discard the magnetic bead-mmBP- binding-MAC::::mmDNAPM. For example, vial 1 contains DNAWTand MB-ccBP-binding- MAC: : : :CCDNAPM, MB-GGBP-binding-MAC: : : :GGDNAPM, MB-TTBP-binding-MAC: : : :TTDNAPM, MB-ACBP-binding-MAC::::ACDNAPM, MB-AGBP-binding-MAC::::AGDNAPM, MB-CTBP-binding- MAC: : : :CTDNAPM, and MB-GTBP-binding-MAC::::GTDNAPM, where MB=magnetic beads. The procedure will removeCCDNAPM,GGDNAPM,TTDNAPM,ACDNAPM,AGDNAPM,CTDNAPM, andGTDNAPMif they are present within the DNA sample while leaving behindAADNAPM(if present) aswell as the DNAWT(unless they contain any SNP other than AA). Similarly, vials 2, 3, 4, 5, 6, 7, and 8 will each respectively containCCDNAPM(if present) and DNAWT,GGDNAPM(if present) and DNAWT,TTDNAPM(if present) and DNAWT,ACDNAPM(if present) and DNAWT,CTDNAPM(if present) and DNAWT,GADNAPM(if present) and DNAWT, andGTDNAPM(if present) and DNAWT. vial 9, wherein all eight MB-MACs had been added (Diagram 8) to the test sample, will havemmDNAPM-free DNA only. Finally, the contents of vials 1-9 are transferred respectively to vials 11- 19 that are flicked and spun for a few seconds.

[0181] Step 2: The presence ofmmBP in vials 11-18 is then detected and quantified:(a) Melting curve analysis is used for detecting the Tmof eachmmBP (in the presence of a specific MAC), if present, in vials 11-18 while vial 19 is used to determine the Tmof the zerommBP negative Wild Type “true” control. The generation of a melt curve whose Tmis substantially higher than the Tmmeasured in vial 19 and that in the absence of any MAC indicates the presence of a specific mismatch (e.g.,AABP in vial 11,CCBP in vial 12, etc.); or(b) A fluorometer is used to quantify SYBR Green: :::mmDNAPMconcentrations in vials 1- 19.Example 13 - Phenotyping, Detecting, and QuantifyingmmBP-Positive DNA Heteroduplex Point Mutations in Tumor Biopsies (FISHMACKits)

[0182] Fluorescence in situ hybridization (FISH) is the most convincing technique for locating specific DNA sequences, diagnosing genetic diseases, gene mapping, and identification of novel oncogenes or genetic aberrations contributing to various types of cancers. FISH involves annealing fluorescent DNA probes to specific target sequences within the DNA of cells / tissue sections (test sample) and using fluorescence microscopy to detect and identify fluorescent cells. The technique has recently been expanded to enable simultaneous whole genome screening via multicolor whole chromosome probe techniques (e.g., multiplex FISH, spectral karyotyping, or through array-based methods using comparative genomic hybridization). However, even though these methodologies have revolutionized the field of cytogenetics and are now recognized as being reliable diagnostic and discovery tool in the fight against genetic diseases, they nevertheless cannot detect point mutations underlying various diseases, in dividing and non-dividing cells. The MACs, methods and kits of the invention can be used to (a) detect and identifymmBP-containing DNA in tumor / normal / diseased tissue sections, and (b) isolatemmBP-positive cells.Example 13, A,

[0183] In one example, tissue sections from tumor biopsies are fixed, processed as described in Molec Cytogen, 12:27 (2019), and incubated with anACBP-binding-MAC (structure shown in Diagram 9) that is covalently bound to a fluorophore (F-ACBP-binding-MAC). The approach, which is similar to the well-known FISH assay, allows the spatial analysis of the tumor (and surrounding) microenvironment by (1) enabling mismatch-phenotyping (AC in this example) solely from the analysis of H&E slides post incubation with the F-ACBP-binding-MACs, and (2) quantifying fluorescence intensity within the tumor and its surrounding tissues, especially (for example) when using biopsies before and after treatment for assessing therapy response predictions. In this case, Ria= an iodine atom, Rib= the propargyl derivative PAA = 2-amino-N-(prop-2-yn-l-yl)propanamide, and Rs = 2 linker-TAMRA molecules (2-(6-(dimethylamino)-3-(di-methyliminio)-3H-xanthen-9- yl)-5-(((2,5-dioxopyrroli-din-l-yl)oxy)-carbonyl)benzoate). Upon the addition of this F-ACBP- binding-MAC derivative to anACDNAPM-positive tissue sample, theACBP-binding-MAC will form 8 H-bonds specifically with allACBP molecules (Diagram 9) while the propargyl derivatives, known to increase the Tmof antisense oligonucleotides, will further stabilize theACDNAPM. The formation of multiple H-bonds withmmBP(s) that the MAC is specific to will lead to the emission of fluorescence signals from theACDNAPM-positive cells / tissues (using a fluorescence microscope), thereby enabling the rapid, and accurate (i) detection ofACDNAHDpresent within the probed cells / tissues, (ii) identification ofACDNAHD-positive cells, and (iii) quantitation of theACDNAHDconcentration in the tissue under observation or on a per cell basis.Example 13.B,

[0184] In this example, tissue sections from tumor biopsies are fixed and processed (Molec Cytogen, 12:27 (2019)) and incubated with the following 4 MACs (Diagram 10):ACBP-binding- MAC (general structure shown in FIG. 9. iii),ccBP-binding-MAC (general structure shown in FIG. 6. iii),CTBP-binding-MAC (general structure shown in FIG. 1 l.iii), andGTBP-binding-MAC (general structure shown in FIG. 12. iii), each pre-conjugated to differently colored fluorophores (i.e., F1-ACBP-binding-MAC, F2-ccBP-binding-MAC, F3-CTBP-binding-MAC, and F4-GTBP-binding-MAC, see list of fluorophores at Front Microbiol, 10: 1383 (2019), incorporated by reference herein). Here again, the approach is quite similar to that used in the well-known FISH assay and it allows the spatial analysis of the tumor (and surrounding) microenvironment by (1) enablingmmBP-positive DNAHDphenotyping (in this caseACDNAPM,CCDNAPM,CTDNAPM, andGTDNAPM) solely from the analysis of H&E slides post incubation with FJ-MACAC, F2-MACCC, F3-MACCT, and F4-MACGT, and (2) quantifying fluorescence intensity within the tumor and its surrounding tissues, especially (for example) when using biopsies before and after treatment for assessing response predictions.Specifically, the 4 F-MAC derivatives (F'-tBP-binding-MAC, F2-ccBP-binding-MAC, F3-CTBP- binding-MAC, and F4-GTBP-binding-MAC) are mixed and added to tumor biopsy tissue sections that are then heated to partially denature their DNA. This leads to the formation of H-bonds and intermolecular electrostatic ion-ion bonds between each F-MAC derivative and themmBP it is designed to specifically bind to (Diagram 10). Here again, the propargyl derivatives will confer stability to theF2-MACCC::::CCDNAPM, F3-MACCT::::CTDNAPM, and F4- MACGT:::: GTDNAPM. The samples are then washed to remove unbound MACs and observed under a fluorescence microscope, thereby enabling the rapid, and accurate (i) detection, identification, and quantitation ofACDNAHD,CCDNAHD,CTDNAHD, andGTDNAHDthat are present within the probed cells / tissues (also on a per cell basis).Example 13.C.

[0185] In this example, a kit of the invention is composed of (a) 50 glass slides, 50 filter cards, and cytofunnels; (b) 8 vials, each containing one of the 8 MACs that have been pre-conjugated with the fluorescent dye TAMRA, i.e., TAMRA-AABP-binding-MAC, TAMRA-ccBP-binding-MAC, TAMRA-GGBP-binding-MAC, TAMRA-TTBP-binding-MAC, TAMRA-ACBP-binding-MAC, TAMRA-AGBP-binding-MAC, TAMRA-CTBP-binding-MAC, and TAMRA-GTBP-binding-MAC; (c) Formaldehyde Bottle (4%, 100 mL); (d) HC1 Bottle (0.2 N, 50 mL); (e) 500 mL 0.1 M PBS, pH 7.4; (f) proteinase K (10 mg / mL digestion buffer, pH 7.0, Sigma); (g) 1 mL colcemid (10 pg / ml PBS); (h) 1 mL 0.075 M KC1 hypotonic buffer; and (i) DAPI (4Z,6-diamidino-2-phenylindole), wherein the kit used to detect and identify anymmBP in mammalian cells in one of these two approaches.

[0186] Approach A. In these experiments, 1E5 tumor cells are suspended in 200 pL of colcemid solution and incubated at 37 °C for 2 h. The cells are pelleted and re-suspended in 200 pL of KC1 hypotonic buffer, incubated at 37 °C for 5 min, and dispensed into cytofunnels pre-loaded each with a glass slide and a filter card. The slides (a total of 48, 12 at a time) are then spun in a Shandon Cytospin centrifuge (or equivalent) and the cells fixed (4% formaldehyde to permeabilize the cells), treated with 0.2 N HC1 (to solubilize basic nuclear proteins and improve accessibility of the MACs to DNA), and rinsed several times with PBS. Next, each MAC-containing vial is heated to 78 °C and added to 6 slides (100 pL / slide) that are then incubated for 30 min in a humidified atmosphere before being briefly rinsed in PBS, counterstained with DAPI hardset mounting medium, covered with cover slips, and stored at -20 °C (unless analyzed immediately). Images are then captured (63x magnification and used for analysis on a Leica automatic DM6000 Scanner). Multiple fields (e.g., >6 per sample) are captured and visualized (containing minimally 100 interpretable nuclei). Theresults of these studies enable the accurate detection, identification, and quantification of allmmBPs present in the DNA of these cells (i.e.,AABP,CCBP,GGBP,TTBP,ACBP / CABP,AGBP / GABP,CTBP / TCBP, and / orGTBP / TGBP) .

[0187] Approach B. In these experiments, a tumor cell suspension is hypotonically swollen in 0.075 M KC1 at 37 °C for 5-7 min, permeabilized, and incubated with MACs that have each been pre-conjugated to differently colored fluorophores (i.e., F'-ABP-binding-MAC, F2-ccBP-binding- MAC, F3-GGBP-binding-MAC, F4-TTBP-binding-MAC, F5-ACBP-binding-MAC, F6-AGBP-binding- MAC, F7-CTBP-binding-MAC, and F8-GTBP-binding-MAC, see list of fluorophores Front Microbiol, 10: 1383 (2019), incorporated by reference herein). This will (1) trigger the formation of multiple flbonds with themmBP(s) that each MAC is specific to, and (2) lead to the emission of fluorescence signals from themmDNAPM-positive cells, thereby enabling the facile, rapid, and accurate (i) detection and identification of all themmDNAPMpresent within the probed cells, (ii) isolation of the tumor cells that are positive for the 8mmBPs, e.g., using fluorescence-activated cell sorting (FACS), and (iii) quantitation of the concentration(s) of the base mismatch(es) in the cells a per cell basis using FACS.Example 14 - MAC-Lateral Flow Assay (MAC-LFA) Platforms for Detection and Identification of Canonical Point Mutations (CDNAPM)

[0188] Lateral flow assays (LFAs) are very simple and highly successful rapid analytical platforms that were first reported in the 1980s. Since then, hundreds of LFAs have been commercialized for the detection of infectious diseases, cancer, cardiac diseases, etc. These devices are typically composed of a test strip that contains a sample pad, a conjugate pad, a hydrophobic nitrocellulose membrane, and an absorbent pad. The MACs of the invention are useful for the quantitative detection of knownCDNAPM(post denaturation and reannealing of DNAWTandCDNAPMand the consequent formation of specificmmBP-positive DNA). In these LFA strips, highly positively charged biomolecules (e.g., histones, cationic peptides (polylysine, etc.), chitosan, branched and linear poly(ethylene imine), gelatin, and polyamines (spermine, spermidine, etc.)) are used to capturemmBP-negative DNA / RNA molecules onto the control line of the LFA strip.Example 14, A, - MAC-LFA-Mediated Detection of KRASG12D

[0189] The following example demonstrates a MAC-LFA kit of the invention that is useful for the detection of the KRASG12D-c.35 G>A point mutation (KRASWT(GCDNAWT) KRASG12D(ATDNAPM)), the MAC selected from the structures shown in FIG. 16. This LFA kit has (1) a sample vial that contains (a) the fluorogenic SYBR Gold (SG) stain, and (b) a biotinylated peptide nucleic acid MAC (B-PNA-ACBP-binding-MAC - Diagram 11.1), and (2) an LFA-MAC strip (6 cm x 5mm) that is composed of (a) a sample pad (receives the test sample), (b) a nitrocellulose membrane having (i) a test line (Trine) that is coated with streptavidin (SAv) (to capture B-PNA-ACBP-binding- MAC: : : :ACDNA: : : : SG complexes), and (ii) a control line (Crine) that is coated with SAv-biotinylated poly-L-lysine (SAv-B-(PL)25o), a cationic homopolypeptide that contains 250 positively-charged hydrophilic -NHs+molecules (pKa = ~9.0) that substantially increase the local positive charge density of the Crine (to capture DNA:: ::SG complexes), and (c) an absorbent pad that absorbs excess liquids, preventing backflow and ensuring proper flow.

[0190] To use the kit, DNA is extracted from a test sample (e.g., blood / saliva / other bodily fluid / tumor biopsy of KRASG12D-point mutation positive patient), amplified (e.g., LAMP), and the amplicons (KRASG12D(ATDNAPM) and KRASWT(GCDNAWT)) heated to 95 °C for 2 min (to denature the double stranded DNA molecules), cooled slowly to RT (to renature the DNA molecules and lead to DNA heteroduplex formation), and added to the sample vial (steps 1 & 2 in Diagram 11.1). Since the test sample isATDNAPMpositive, the vial will containGCDNAWT: : : : SG,ATDNAPM: : : : SG,GTDNAHD: : : : SG, and B-PNA-ACBP-binding-MAC:: ::ACDNAHD: : : : SG (Diagram 11.1. A), wherein the binding of the B-PNA-ACBP-binding-MAC toACDNAHDis due to the 51 specific H-bonds and 15 nonspecific ionic bonds formed between theACBP-binding-MAC and theACDNAHDmolecules. The vial’s contents are dispensed onto the LFS’s sample pad (steps 3 & 4 in Diagram 11.1), thereby initiating the flow - capillary action - of these molecular complexes along the nitrocellulose membrane. Upon reaching the Trine zone, the B-PNA-ACBP-binding-MAC::::ACDNA::::SG complex will be selectively captured by the nitrocellulose membrane (NM)-bound SAv (NM- SAv::::B-PNA-ACBP-binding-MAC:: ::ACDNA: : : : SG, Diagram 11. LB) and detected by the SG- generated bright fluorescent signal (using a handheld LFS Fluorescence Reader), confirming that the assayed DNA test sample is positive for theKRASG12Dmutant allele (ATDNAPM). On the other hand, theACDNAPM-negative DNA molecules (i.e.,GCDNA: : : : SG,ATDNA: : : : SG, andGTDNA: : : : SG) will continue their migration and, upon reaching the Crine zone, will bind to and be retained by the highly catanionic PL250 (Diagram ll. l.C: NM-SAV: : : :B-(PL)25O: : : :GCDNA: : : : SG, NM-SAV: : : :B- (PL)25O: : : :ATDNA: : : : SG, and NM-SAv: : : :B-(PL)25o: : : :GTDNA: : : : SG) and be detected and quantified by the SG-generate fluorescent signal (using a handheld LFS fluorescence reader that is configured to match SG’s excitation maxima of 495 nm and emission maxima of 537 nm, respectively).Example 14.B, - Detection of >1CDNAPMUsing Multi-Test Line MAC-LFA Strip

[0191] In this example, a MAC-LFA strip is used for the simultaneous detection of five clinically actionable somatic hotspot missense KRAS DNA™ (KRASG12C, KRASG12D, KRASG12R, KRASG12V, and KRASG13D) that are associated with pancreatic ductal adenocarcinoma and other cancers, theMAC-LFA strip (Diagram 11.2) is composed of (a) a sample pad that receives the DNA test sample, (b) a conjugate pad that is preloaded with the DNA-intercalating fluorophore SG that is released by, and intercalates with, all the DNA molecules flowing through, (c) a nitrocellulose membrane with (i) 5 test lines (Trine), and (ii) a Crine, and (d) an absorbent pad that absorbs excess liquids, preventing backflow and ensuring proper flow. The Trines are first coated with 300 ng of streptavidin (SAv), washed, and then recoated each with 100 ng of the five biotinylatedmmBP-binding MACs (selected from one of the general structures shown in FIGS. 13-17), specifically Trine-iTABP-TCBP-GCBP- binding-MAC (role: selective and quantitative capture of KRASG12C-TCDNAHD: : : : SG complexes migrating through), Trine-2GCBP-ACBP-TABP-binding-MAC (role: selective and quantitative capture of KRASG12D-specificACDNAHD: : : : SG complexes migrating through), Trine-3TABP-CCBP-GCBP- binding-MAC (role: selective and quantitative capture of KRASG12R-specificCCDNAHD: : : : SG complexes migrating through), Trine-4GCBP-TCBP-TABP-binding-MAC (role: selective and quantitative capture of KRASG12V-TCDNAHD: : : :SG complexes migrating through), and Trine-sGCBP-ACBP-CGBP-binding-MAC (role: selective and quantitative capture of KRASG13D-ACDNAHD: : : : SG complexes migrating through), and the Crine are coated with SAv-Biotinylated Poly-L-Lysine (SAv- B-(PL)25O) (role: capture all DNA: :: :SG complexes as they traverse it).

[0192] To use the LFS-MAC device, 200 ng of the DNA test sample (post LAMP amplification), is heated to 95 °C for 2 min, cooled slowly to RT, and dispensed onto the LFS’ s sample pad (Diagram 11.2), thereby initiating the flow - capillary action - of DNA molecules. If the test sample is positive for all the 5 KRAS missense point mutations, the dispensed solution will contain a mixture of DNAWTand DNA™ as well as the heteroduplexes formed after the denaturation and renaturation of DNAWTand DNA™, i.e.,TCDNAHD(KRASG12C),ACDNAHD(KRASG12D),CCDNAHD(KRASG12C), etc. Once these DNA molecules reach the conjugate pad, they will trigger the release of the SG molecules and the subsequent formation of DNA::::SG complexes. As these molecules continue to migrate along the nanocellulose membrane strip, they will reach the Trine zones where each DNAHDwill be selectively captured and immobilized by its respective nanocellulose membrane-bound B-MACs. All the DNA molecules not captured by the B-MACs (e.g.,CDNAWT,CDNA™, and other DNAHDthat contain othermmBP) will be captured and immobilized by the nanocellulose membrane-Sav- bound B-(PL)25O. The DNA captured at the Trines and the Crine will be detected and quantified by the SG-generated bright fluorescent signal (using a handheld LFS fluorescence reader that is configured to match SG’s excitation maxima of 495 nm and emission maxima of 537 nm, respectively).Example 15 - MAC-Lateral Flow Assay (MAC-LFA) Platform for Detection and Identification of Multiple SARS-CoV-2 Point Mutations

[0193] The constant mutation of SARS-CoV-2 (single strandedCoVRNA) continues to trigger new rounds of public health crises and continues to impact existing vaccines and diagnostic tools. The MAC technology of the present invention lends itself to the detection and identification of these mutants. Towards this end, LFA-MAC devices of the invention are used to differentiate and identify SARS-CoV-2 RNA point mutations (CoVRNAPM).

[0194] In these experiments, an RNA test sample is added to a vial that contains single stranded DNA / PNA molecules whose sequence is complementary to that of the WT single strandedCoVRNA (COVRNAWT). The mixture is heated to 95 °C, cooled slowly to RT, and dispensed onto the LFS’s sample pad (Diagram 11.2), thereby initiating the flow - capillary action - along the LFS. If the test sample is positive for ACE2 point mutations, the dispensed solution will contain a mixture ofCOVRNAPM-DNA heteroduplex hybrids that are positive for one or more of themmBP that are specific to aCOVRNAPM. Consequently, the mutant-specific biotinylated MACs (selected from the general structures shown in FIGS. 13-17, see for example Diagrams l.E.i, l.F, l.G.i, 7.B, and 11.1) that bind to a total of nine base pairs within the RNA-DNA heteroduplex: themmBP at the center and the four base pairs flanking each side. Once theseCoVRNAPM-DNA andCoVRNAWT-DNA molecules reach the conjugate pad (Diagram 11.2), they will trigger the release of the SG molecules and the subsequent formation ofCoVRNAPM-DNA: : : : SG andCoVRNAWT-DNA: : : : SG complexes. As these molecules continue to migrate along the nanocellulose membrane strip, they will reach the Trine zones where eachCoVRNAPM-DNA::::SG will be selectively captured and immobilized by its respective NM-bound. All theCoVRNAWT-DNA: : : : SG molecules not captured by the B-MACs will be captured and immobilized by the nanocellulose membrane-Sav-bound B-(PL)25o. TheCoVRNAPM1- DNA::::SG,CoVRNAPM2-DNA::::SG,CoVRNAPM3-DNA::::SG,CoVRNAPM4-DNA::::SG, andCOVRNAPM5-DNA: : : : SG, complexes (captured at the Trine-i, Trine-2, Trine-3, Trine-4, and Trine-5) and the Crine (COVRNAWT-DNA: : : : SG) can be detected and quantified by the SG-generated bright fluorescent signal (using a handheld LFS fluorescence reader that is configured to match SG’ s excitation maxima of 495 nm and emission maxima of 537 nm, respectively).Example 16 - Detection and Quantification of Aberrant Methylation Patterns in DNA

[0195] Cytosine methylation, the addition of a methyl group to cytosine residues in CpG dinucleotides to form 5-methylcytosine (5-mC), is a key epigenetic modification regulating gene expression, genomic stability, and cellular differentiation. It is stably propagated during cell division and plays an important role in both normal physiology and disease. In cancer cells, aberrant DNAmethylation patterns, specifically global hypomethylation and hypermethylation, play a crucial role in driving tumorigenesis and progression by affecting the expression of tumor suppressor genes (silencing) and oncogenes (activation). In neurodegenerative diseases, such as Alzheimer’s and Parkinson’s, abnormal methylation of genes (e.g., those involved in amyloid precursor protein processing and serotonin receptor regulation) in these nonproliferating cells have also been reported to contribute to their pathologies. Quantifying the methylation status of CpG dinucleotides is critical for understanding their diverse biological roles and their involvement in various diseases, especially cancer. For example, the CpG island promoter region of the GSTP1 gene is typically unmethylated in normal prostate tissue DNA but hypermethylated (>90%) in prostate tumour tissue DNA. Similarly, the APC gene is methylated in >90% of esophageal cancers. As such, both markers provide excellent test specificity in plasma DNA analysis. The following examples demonstrate that the MACs, methods, and kits of the present invention can enable the detection and quantitation of aberrant methylation patterns in DNA,mmDNAPM, andCDNAPM.Example 16, A, - Global CpG-Positive DNA Test SamplesExample 16.A.1,

[0196] In this example (Diagram 12. A.1),GUBP-binding MACs (GUMACs) selected from one of the general structures shown in FIG. 12, are used to isolate and purify DNAHDmolecules formed post bisulfite treatment of DNA test samples. The method comprises (1) incubating the DNA test sample with sodium bisulfite (leading to sulfonation of methyl-cytosine-negative cytosines and the production of cytosine sulfonate), (2) deaminating the sulfonated cytosines (to produce uracil sulfonate), (3) de-sulfonating the sulfonated uracils (producing uracils and leading to the denaturation of the double stranded DNA), (4) contacting the single stranded DNA with magnetic beads-GUBP- binding-MACs (leads to the formation of double stranded DNA consequent to the binding of said MACs toGUBPS), (5) using a magnet to capture, wash, and isolateGUBP-positive DNA (GUDNAHD), (6) denaturing the capturedGUDNAHD, (7) separating the denatured single stranded DNA from said MB-GUMACS, and (8) sequencing the isolated DNA (e.g., Sanger, NGS) to confirm the presence of the methylated CpG dinucleotides and determine the base sequences flanking said CpG dinucleotides.Example 16.A.2,

[0197] In this example (Diagram 12.A.2),GTBP-binding MACs (GTMACs) selected from one of the general structures shown in FIG. 12, are used to isolate and purify DNAHDmolecules formed post (i) bisulfite treatment of DNA test samples, and (ii) PCR amplification. The method comprises (1) incubating the DNA test sample with sodium bisulfite (leading to sulfonation of methyl-cytosine-negative cytosines and the production of cytosine sulfonate), (2) deaminating the sulfonated cytosines (to produce uracil sulfonate), (3) de-sulfonating the sulfonated uracils (producing uracils and leading to the denaturation of the double stranded DNA), (4) PCR amplification of DNA, (5) contacting the single stranded DNA with MB-GTBP-binding-MACs (leads to the formation of double stranded DNA consequent to the binding of said MACs toGTBPs), (6) using a magnet to capture, wash, and isolateGTBP-positive DNA (GTDNAHD), (7) denaturing the capturedGTDNAHD, (8) separating the denatured single stranded DNA from said MB-GTMACs, DNA, and (9) sequencing the isolated DNA (e.g., Sanger, NGS) to confirm the presence of the methylated CpG dinucleotides and determine the base sequences flanking said CpG dinucleotides.Example 16.B, - CpG-PositivemmDNAPMTest SamplesExample 16.B.1

[0198] In this example (Diagram 12. B.1), MACs selected from one of the general structures shown in FIG. 5-12 are used to isolate and purify (i)mmBP-positive DNAHDmolecules already present in a DNA test sample isolated from tissue biopsies or bodily fluids, and (ii)GUBP-positive DNAHDmolecules (GUDNAHD) formed post bisulfite treatment of the DNA test sample. The method comprises (1) contacting said DNA Samples withAABP-binding-MAC,ccBP-binding-MAC,GGBP- binding-MAC,TTBP-binding-MAC,ACBP-binding-MAC,AGBP-binding-MAC,CTBP-binding-MAC, orGTBP-binding-MAC, (2) using a magnet to capture, wash, and isolatemmBP-containingmmDNAPM, (3) denaturing the captured DNAHD, (4) separating the DNA (single stranded) from said magnetic bead-MACs using a magnet, (5) incubating the said DNA sample with sodium bisulfite (leading to sulfonation of methyl-cytosine-negative cytosines and producing cytosine sulfonate), (6) deaminating the sulfonated cytosines (to produce uracil sulfonate), (7) de-sulfonating the sulfonated uracil (producing uracil, this leading to the denaturation of the double stranded DNA), (8) contacting the single stranded DNA with magnetic beads-GUBP-binding-MACs (leading to the formation of double stranded DNA consequent to the binding of said MACs toGUBPs), (9) using a magnet to capture, wash, and isolateGUBP-positive DNA (GUDNAHD), (10) denaturing the capturedGUDNAHD, (11) separating the denatured single stranded DNA from said magnetic beads-GUMACs, and (12) sequencing the isolated DNA (e.g., Sanger, NGS) to confirm the presence of the methylated CpG dinucleotides and determine the base sequences flanking said CpG dinucleotides.Example 16.B.2,

[0199] In this example (Diagram 12. B.2), MACs selected from one of the general structures shown in FIG. 5-12 are used to isolate and purify (i)mmBP-positive DNAHDmolecules already present in a DNA test sample isolated from tissue biopsies or bodily fluids, and (ii)GTBP-positive DNAHDmolecules (GTDNAHD) formed post (a) bisulfite treatment of DNA test samples, and (b) PCR amplification, said method comprising of (1) contacting said DNA Samples withAABP-binding- MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP-binding-MAC,ACBP-binding-MAC,AGBP- binding-MAC,CTBP-binding-MAC, orGTBP-binding-MAC, (2) using a magnet to capture, wash, and isolatemmBP-containingmmDNAPM, (3) denaturing the captured DNAHD, (4) separating the DNA (single stranded) from the magnetic beads-MACs using a magnet, (5) incubating said DNA Sample with sodium bisulfite (leading to sulfonation of methyl-cytosine-negative cytosines and producing cytosine sulfonate), (6) deaminating the sulfonated cytosines (to produce uracil sulfonate), (7) desulfonating the sulfonated uracils (producing uracils, this leading to the denaturation of the double stranded DNA), (8) PCR amplification of DNA, (9) contacting the single stranded DNA with magnetic beads-GTBP-binding-MACs (leads to the formation of double stranded DNA consequent to the binding of said MACs toGTBPs), (10) using a magnet to capture, wash, and isolateGTBP- positive DNA (GTDNAHD), (11) denaturing the capturedGTDNAHD, (12) separating the denatured single stranded DNA from the magnetic beads-GTMACs, DNA, and (13) sequencing the isolated DNA (e.g., Sanger, NGS) to confirm the presence of the methylated CpG dinucleotides and determine the base sequences flanking said CpG dinucleotides.Example 16, C. - CpG-PositiveCDNAPMTest SamplesExample 16.C.1.

[0200] In this example (Diagram 12. C.1), MACs selected from one of the general structures shown in FIG. 5-12 are used to isolate and purify (i) BP-positive DNAHDmolecules that are formed post heating (95 °C) and cooling (RT) of acDNAPM-positive DNA test sample isolated from tissue biopsies or bodily fluids, and (ii)GUBP-positive DNAHDmolecules (GUDNAHD) formed post bisulfite treatment of a DNA test sample. The method comprises (1) contacting a DNA test sample (post denaturation and renaturation, which leads to the formation of the"1"1BP-positive DNAHD) withAABP- binding-MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP-binding-MAC,ACBP-binding-MAC,AGBP-binding-MAC,CTBP-binding-MAC, orGTBP-binding-MAC, (2) using a magnet to capture, wash, and isolatemmBP-containingmmDNAPM, (3) denaturing the captured DNAHD, (4) separating the DNA (single stranded) from said magnetic beads-MACs using a magnet, (5) incubating said DNA Sample with sodium bisulfite (leading to sulfonation of methyl-cytosine-negative cytosines and producing cytosine sulfonate), (6) deaminating the sulfonated cytosines (producing uracil sulfonate), (7) de-sulfonating the sulfonated uracils (to produce uracils, this leading to the denaturation of the double stranded DNA), (8) contacting the single stranded DNA with magnetic beads-GUBP-binding-MACs (leads to the formation of double stranded DNA consequent to thebinding of said MACs toGUBPs), (9) using a magnet to capture, wash, and isolateGUBP-positive DNA (GUDNAHD), (10) denaturing the capturedGUDNAHD, (11) separating the denatured single stranded DNA from the magnetic beads-GUMACs, and (12) sequencing the isolated DNA (e.g., Sanger, NGS) to confirm the presence of the methylated CpG dinucleotides and determine the base sequences flanking said CpG dinucleotides.Example 16, C.2,

[0201] In this example (Diagram 12. C.2), MACs selected from one of the general structures shown in FIG. 5-12 are used to isolate and purify (i)mmBP-positive DNAHDmolecules that are formed post heating (95 °C) and cooling (RT) of acDNAPM-positive DNA test sample isolated from tissue biopsies or bodily fluids, and (ii)GTBP-positive DNAHDmolecules (GTDNAHD) formed post (a) bisulfite treatment of DNA test samples, and (b) PCR amplification. The method comprises (1) contacting DNA samples (post denaturation and renaturation, which leads to the formation of themmBP-positive DNAHD) withAABP-binding-MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP- binding-MAC,ACBP-binding-MAC,AGBP-binding-MAC,CTBP-binding-MAC, orGTBP-binding- MAC, (2) using a magnet to capture, wash, and isolatemmBP-containingmmDNAPM, (3) denaturing the captured DNAHD, (4) separating the DNA (single stranded) from said magnetic beads-MACs using a magnet, (5) incubating said DNA Sample with sodium bisulfite (leading to sulfonation of methyl-cytosine-negative cytosines and producing cytosine sulfonate), (6) deaminating the sulfonated cytosines (producing uracil sulfonate), (7) de-sulfonating the sulfonated Uracils (producing uracils, this leading to the denaturation of the double stranded DNA), (8) PCR amplification of DNA, (9) contacting the single stranded DNA with magnetic beads-GTBP-binding- MACs (leads to the formation of double stranded DNA consequent to the binding of said MACs toGTBPS), (10) using a magnet to capture, wash, and isolateGTBP-positive DNA (GTDNAHD), (11) denaturing the capturedGTDNAHD, (12) separating the denatured single stranded DNA from the magnetic beads-GTMACs, DNA, and (13) sequencing the isolated DNA (e.g., Sanger, NGS) to confirm the presence of the methylated CpG dinucleotides and determine the base sequences flanking said CpG dinucleotides.Example 17 - Blocking the Amplification ofnimBP Error-Positive Amplicons Generated During Target Template DNA Amplification

[0202] It is well established that DNA or RNA amplification methods (e.g., PCR, ddPCR, emulsion PCR, qPCR, PCR endpoint, circle-to-circle amplification (C2CA), exponential amplification reaction (EXPAR), helicase-dependent amplification (HDA), isothermal bridge amplification, isothermal DNA amplification, isothermal RNA amplification, loop-mediated isothermal amplification(LAMP), multiple displacement amplification (MDA), nucleic acid sequence-based amplification (NASBA), primer-generation rolling cycle amplification (PG-RCA), recombinase polymerase amplification (RPA), rolling cycle amplification (RCA), single primer isothermal amplification (SPIA), strand displacement amplification (SDA), transcription-mediated amplification (TMA), whole genome amplification (WGA), and the like) generate various errors that decrease, for example, PCR sensitivity and / or lead to false-negative PCR results. Such errors will often interfere and / or complicate further downstream procedures and analyses (e.g., NGS accuracies). For example, since NGS platforms (considered the gold standard for detecting point mutations) generate sequence data from ssDNA fragments, any base mismatch introduced, especially during the initial round of PCR amplification, will continue to be amplified and will be undetectable as an error - even with tagging techniques. In such a scenario, if the DNA polymerase errs during the 2ndamplification round of a PCR reaction, i.e., when a total of 16 DNA strands are present, and incorporates a mismatching base in one of the 16 DNA strands, this error - which unlike DNA replication in cells, is not repaired - will be propagated in all subsequent PCR rounds and as such 6.25% of all the amplicons will have the wrong base. The MACs, methods, and kits of the present invention are useful for blocking the amplification ofmmBP(s)-containing amplicons generated during target amplification (beginning with cycle 1 and throughout), thereby preventing contamination of the final amplicon sample, improving accuracy, and minimizing / eliminating the risk of biases.

[0203] In this example, the kit is composed of a vial that contains (a) PCR reagents, and (b)AABP- binding-MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP-binding-MAC,ACBP-binding- MAC,AGBP-binding-MAC,CTBP-binding-MAC, andGTBP-binding-MAC, each selected from one of the general structures shown in FIGS. 5-12 and dissolved in 5 pL of 0.1 M Tris-HCl pH 7.5 buffer and used to clamp, and thereby block, the amplification of DNA molecules that contain anymmBP (AABP,CCBp GGBp TTBp \CB PC \B p\GB pG \B pCTgp TCgp GTgpand / orTGgp)that are eitheralready present within the DNA Test Sample (Diagram 13. A) or those generated erroneously during the amplification process (Diagram 13.B), wherein the kit is used to inhibit the amplification of anymmBP error-containing amplicons and allow the amplification of error-free amplicons only.

[0204] Towards this end, a DNA test sample (e.g., 100 ng / 5 pL) is added to a vial, the vial is capped, tapped gently to mix its contents, spun briefly, inserted into a thermocycler, heated to 95 °C for 2 min, slowly cooled to RT (5 min), and the nucleic acids amplified (e.g., 35 cycles). Since anymmBP error-containing amplicons present in the test sample, as well as those generated during PCR cycling, will not be amplified further (consequent to the specific H-bonding / clamping ofmmBP errors by said MACs and the inhibition of primer elongation in subsequent cycles), only amplicons that aremmBP-negative will be repeatedly amplified (i.e., zero error PCR (zePCR).

[0205] In this case, the MACs form multiple H-bonds (along with intermolecular electrostatic ionion bonds) withmmBP present within the DNA (pre / during amplification). However, as shown in FIG. 18, the MACs may also be conjugated to DNA-crosslinking compounds that form H-bonds as well as covalent bonds - between M AC-conjugated DNA crosslinking molecules and nucleosides that are in close proximity to saidmmBP - when exposed to UVA irradiation, said H-bonds and covalent bonds clamping the 2 strands of said DNA molecules together and blocking their amplification. In this example, a kit of the invention is composed of a vial that contains (a) PCR reagents, and (b)AABP-binding-MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP-binding- MAC,ACBP-binding-MAC,AGBP-binding-MAC,CTBP-binding-MAC, andGTBP-binding-MAC, each selected from one of the general structures shown in FIGS. 5-12, said MACs also conjugated to (E)-3-(p-tolyl)acrylonitrile (Diagram 14). A DNA test sample (e.g., 100 ng / 5 pL) is added to the vial, the vial is capped, tapped gently to mix its contents, spun briefly, inserted into a thermocycler, and the nucleic acids amplified (35 cycles, each cycle ending with a 5 sec. 366 nm irradiation (Diagram 14). Since anymmBP error-containing DNA that are present in the test sample, as well as those generated within the amplicons during PCR cycling, will not be amplified further (consequent to the (i) multiple specific H-bonds formed between the MACs withmmBP errors, and (ii) covalent bonds formed between the acrylonitrile and any two thymine molecules nearby (Diagram 14), only amplicons that aremmBP-negative will be amplified.Example 18 - Blocking DNA Polymerase-Mediated DNA Replication and / or RNA Polymerase- Mediated DNA Transcription ofmmBP-Positive Genes and Prevention of the Proliferation of Tumor Cells

[0206] As stated above,mmBPs appear in proliferating cells (FIG. 3A) consequent to random or stochastic DNA copying errors that occur each time a cell replicates its DNA. Unless repaired, these alterations can lead to PM and epigenetic changes that may affect the quantity, structure, and / or activity of themmBP-positive gene or the expression of mutant proteins that could drive oncogenesis.

[0207] The binding of MACs tommBP-positive genes, particularly those within potentially cancercausing genes, will block helicase-mediated H-bond disruption and the unzipping of DNA and inhibit (a) DNA polymerase-mediated DNA replication (Diagram 15. A), thereby preventing cell proliferation and triggering apoptosis, and (b) RNA polymerase-mediated gene transcription (Diagram 15.B), this leading to the synthesis of truncated mRNA molecules whose translation results in nonfunctional disease-causing proteins.

[0208] In this example,AABP-binding-MAC,ccBP-binding-MAC,GGBP-binding-MAC,TTBP- binding-MAC,ACBP-binding-MAC,AGBP-binding-MAC,CTBP-binding-MAC, andGTBP-binding- MAC (see general structures in FIGS. 5-12) are each conjugated to 2 or more cisplatin molecules and administered to patients with cancer. Optionally, these MACs are also conjugated to antibodies (e.g., antitumor) or other tumor cell-specific molecules (e.g., folate) or cell penetrating peptides that are known to enhance the targeting of these conjugates to specific cells and their subsequent internalization by these cells. Once inside the tumor cells, the MACs will form H-bonds with their respectivemmBP(s) (within themmBP-positive gene) while the cisplatin molecules will form intra- and inter-strand crosslinks with the purine-N(7) of guanine and adenine residues nearby (seeACBP- binding-MAC, for example, in Diagram 15. C). Consequently, the two strands of thesemmDNAPMmolecules will be permanently clamped together. As stated above, this will block helicase-mediated unzipping of DNA, inhibit DNA polymerase-mediated DNA replication, and therefore prevent the proliferation ofmmBP-positive tumor cells (Diagram 15. A).Example 19 - Blocking RNA Polymerase-Mediated DNA Transcription of Neurodegenerative Disease-CausingmmBP-Positive Genes

[0209] It is well known that most neurons do not divide and live for very long periods of time (e.g., years). Consequently, these cells gradually accumulatemmBPs within various genes, mainly as a result of (a) exposure to (i) exogenous mutagenic chemicals and physical agents (e.g., tobacco, exposure to X-rays, viruses), or (ii) endogenous reactive metabolites that cause changes in DNA bases (e.g., spontaneous deamination of cytosine and its conversion to uracil, estimated to occur >100 times per mammalian cell per day, and the creation of aUGBP mismatch (instead of the canonicalCGBP)), and / or (b) misrepair or unrepair ofmmBPs errors due to (i) absence of one or more of the DNA MMR proteins (e.g, MLH1, MLH3, MSH2, MSH3, MSH6, PMS1, and / or PMS2), and / or (ii) deficiencies in MMR processes consequent to the occurrence of mutations in MMR-associated genes. For example, several common neurodegenerative diseases frequently exhibit an increased burden of somatic point mutations with associated mitochondrial dysfunction (e.g, studies have noted elevated levels of point mutations in several brain regions in Alzheimer’s disease brains and in Parkinson’s disease patients). When the aberrant base within themmBP is in the noncoding template strand of the DNA (FIG. 3B), the changed codon may lead to the expression of (i) the same amino acid and therefore the production of the same protein (i.e, silent mutations), or (ii) a different amino acid that leads to the production of a defective pathogenic protein (e.g, extracellular amyloid beta (A[3) plaques (between neurons) and intracellular tau neurofibrillary tangles (within neurons)) that misfolds, aggregates, impairs synaptic function,and / or disrupts cellular processes, all of which contributing to the onset and progression of e.g., neurodegenerative disease, e.g., Alzheimer’s, Huntington, Parkinson, etc. Consequently, the administration of the MACs of the invention - which will bind and clampmmBP-positive diseasecausing genes - will (a) block the transcription of such neurodegenerative disease-causingmmDNAPM-positive genes, i.e., silence these genes, and (b) be highly effective in alleviating disease symptoms and treating such disease.

[0210] In this example, MAC(s) selected from one of the general structures shown in FIGS. 5-17 that can form multiple H-bonds with Alzheimer-specificmmDNAPM-causing genes (and intermolecular electrostatic ion-ion bond formation between positively charged groups present within said MACs and the negatively charged PO4- groups present within DNA’s backbone) are administered to patients expected / known to have the disease. Once the MACs have been internalized by neurons and have formed bonds with their respectivemmBP within the targeted gene(s), the two strands of thesemmDNA-positive molecules will be clamped (Diagram 15.B); this blocks the helicase- mediated unzipping of DNA, inhibits RNA polymerase-mediated transcription, and the synthesis of said disease-causing proteins, thereby alleviating disease-related symptoms.Example 20 - Blocking Transcription of One or More Containing Genes Within Animalsand / or Inhibiting and Reversing Cellular Aging

[0211] The acquisition of somatic pathogenic and nonpathogenic mitochondrial DNA point mutations that interrupt the function of the electron transport chain have long been associated with aging and common diseases of the elderly. For example, increased DNA mutation loads have also been reported in diabetes, sarcopenia, macular degeneration, heart disease, and ulcerative colitis. Collectively, these studies have provided evidence that the accumulation of somatic point mutations is a phenotype of aging and a potential causative process in several age-related diseases. Since (i) most cells in the human body do not divide / are quiescent (e.g., neurons, lymphocytes, stem cells, kidney, lung, cardiac muscle, pancreas, etc.) and live for very long periods of time (e.g., years), (ii) zombie-like entities known as senescent cells are also non-dividing death-resisting cells that (a) lurk throughout various tissues / organs (e.g., liver, brain) for very long times, (b) increase in numbers as we age, (c) spew potent inflammatory signals that weaken the immune system, stir up excessive inflammation, and slow down cognition, and (d) correlate with many disease (e.g., Alzheimer’s, diabetes, heart disease, kidney disease, osteoporosis, etc.), and (iii) as mentioned above, DNA repair MMR enzymes within the cells of older people are often dysfunctional,mmBPs will accumulate within the DNA of these cells over time and lead to the expression of mutant proteins that drive aging in cells. Consequently, the administration of the MACs of the invention will block the transcription ofsuchmmDNAPM-positive genes, thereby inhibiting and or reversing aging and age-related diseases.

[0212] Towards this end, the contents of a vial (containingAABP-binding-MAC,ccBP-binding- MAC,GGBP-binding-MAC,TTBP-binding-MAC,ACBP-binding-MAC,AGBP-binding-MAC,CTBP- binding-MAC, andGTBP-binding-MAC, each selected from one of the general structures shown in FIGS. 5-17) are administered to older patients. The binding of said MACs (post internalization by aging cells) tommBP-containing DNA will block the transcription of allmmBP-containing genes and thereby stop / reverse cellular aging.Example 21 - Target Imaging and Therapeutic MACs tommBP-Containing Cells Post Administration into an Animals

[0213] As stated above, the invention also discloses MACs that (a) have been radiolabeled with (i) y-emitting radiodiagnostic (SPECT (e.g., "mTc,n iIn,1231,131I) or PET (e.g.,18F or124I)), or (ii) a++- / p--particle-emitting (e.g.,33P,67Cu,77Br,90Y,U 1ln,123I,125I,131I,211At,213Bi,223Ra,225Ac) radiotherapeutic atoms / molecules, and (b) are useful in radioimaging and radiotherapy ofmmBP- positive cancerous or precancerous cells and lesions or other non-cancerous conditions / disease upon their administration into an animal. In all these conditions, the patient / animal may have no known disease (e.g., an individual suspected of having a disease) or may already have been diagnosed with a disease).

[0214] In this example, the contents of a vial containing a MAC selected from one of the general structures shown in FIGS. 5-17, and specific tommBP known to be present in pancreatic cancers, is conjugated to the radiometal chelator DOTA (l,4,7,10-Tetraazacyclododecane-l,4,7,10-tetraacetic acid), and radiolabeled with the y-emitting radiodiagnosticU 1ln. The conjugate (n iIn-DOTA- MAC) is then administered i.v. to a patient suspected of having pancreatic cancer and SPECT imaging is performed to demonstrate tumor targeting and high tumor-to-normal ratios. Next, the contents of another DOTA-MAC-containing vial are radiolabeled with the energetic [^-particle- emitting radiotherapeutic isotope90Y and a therapeutic dose of90Y-DOTA-MAC is administered to the same patient.Example 22 - Synthesis of MACs

[0215] The MACs and MAC conjugates of the invention can be made by conventional chemical synthetic methods known to those of skill in the art. By way of example only, multi-modal MAC architectures can be prepared by linking chemistry known to those of skill in the art, including copper- catalyzed azide-alkyne cycloaddition to form 1,2,3-triazole, as shown in Schemes 1-3.Example 22, A, - Synthesis of B-PNA-MACAC(Scheme 1 A) and B-PNA-MACAC(Scheme IB)Derivatives

[0216] PNAs are synthetic pseudopeptide backbone DNA mimics in which (i) the sugar-phosphate DNA backbone is replaced with repeating units of nucleobase-linked N-(2-aminoethyl)glycine. Since the polyamide backbone of these molecules is flexible and does not carry a negative charge, PNAs are not repelled by the negatively charged — PO4- groups of natural DNA and will pair with complementary DNA molecules with higher affinity and specificity than that seen with DNA-DNA hybrids.

[0217] PNA dimer molecules (Scheme 1A and IB) (i) are readily synthesized using PNA monomers, (ii) specifically bind toA CDNAHD(39 hydrogen and 11 ion-ion bonds) andA CDNAHD(41 hydrogen and 11 ion-ion bonds) molecules, and (iii) are biotinylated, enabling facile biding to Streptavidin (SAv)-coated magnetic beads. Specifically, each alkyne-appended PNA heptamer (PNA-alkyne) and azide-appended biotinylated PNA heptamer (B-PNA-azide) - each functionalized with multiple lysine molecules that will enhance their water solubility and increase DNA-binding affinities (via electrostatic interaction of each lysine’s positively charged — Nfh to DNA’s negatively charged — PO4- groups). Each heptamer pair (PNA-alkyne-to-B-PNA-azide ratio of 3 -to- 1 in the presence of Cu(I)-water) will then be dimerized using the 1,3 dipolar Hiiisgen cycloaddition reaction, known as “click-reaction.” Under these conditions, and irrespective of the sequence and functional groups of such substrates, the reaction is driven to completion in ~2 h with high purity and yield and no side products. RP-HPLC (Cs) is used to isolate the B-PNA-MACGS(MW = 5,300) and B-PNA-MACGS(MW = 5,269) from any unreacted PNA-alkyne / B-PNA-azide and the MACs characterized (JH NMR,13C NMR, and HRMS).Example 22.B,

[0218] The same “click” cycloaddition approach can be employed for creating a variety of MAC structures such as those shown in Schemes 2 and 3.Scheme 2

Claims

What is claimed:

1. A compound selected from selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18.

2. A compound of claim 1, or a precursor thereof, having a structure which includes one or more functional groups shown in FIG. 19.

3. A method of identifying a base pair mismatch (""“BP) within a single stranded or double stranded oligonucleotide or polynucleotide, comprising(a) contacting said oligonucleotide or polynucleotide with one or more mismatch anchoring compounds (MAC) selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18;(b) differentiating between canonicalmmBP-negative sequences andmmBP-positive sequences within said oligonucleotide or polynucleotide; and(c) identifying one or moremmBPs present within said oligonucleotide or polynucleotide.

4. The method of claim 3, further comprising quantifying said one or moremmBP-positive sequences.

5. The method of claim 3, further comprising eliminating said one or moremmBP-positive sequences.

6. The method of any of claims 3-5, wherein said one or moremmBPs areAABP,CCBP,GGBP,TTBP,UUBP,TOBP,UTBP,ACBP,CABP,AGBP,GABP,CTBP,TCBP,CUBP,UCBP,GTBP,TGBP,GUBP, orUGBP, or combinations thereof.

7. The method of any of claims 3-6, wherein said oligonucleotide or polynucleotide is DNA or RNA isolated from a cell or tissue or bodily fluids of a subject suspected of having or having a disease or condition associated with one or more known or unknown point mutations.

8. The method of any of claims 3-7, wherein said oligonucleotide or polynucleotide is DNA or RNA obtained from a pregnant woman undergoing non-invasive prenatal testing.

9. The method of claim 7, wherein said disease is cancer.

10. The method of claim 7, wherein said disease is Alzheimer’s disease, bone disease, cardiovascular disease, diabetes, neurological disease, Parkinson disease, Autism, prenatal disease,rheumatoid arthritis, B-thalassemia, sickle cell disease, hereditary spherocytosis, Fanconi anemia, cystic fibrosis, Huntington disease, Duchenne muscular dystrophy, or Hemophilia A and B.

11. The method of claim 7 wherein said disease is communicable.

12. The method of any of claims 3-11, wherein said MAC is conjugated to one or more propargyl derivatives having a structure shown in FIG. 19.

13. The method of any of claims 3-11, wherein said MAC is conjugated to a fluorophore, a magnetic bead, a phosphodiester DNA or RNA nucleotide, PNA (peptide nucleic acid oligomer, SNA (serinol nucleic acid oligomer, MNA (morpholino nucleic acid oligomer), LNA (locked nucleic acid oligomer), GNA (glycol nucleic acid oligomer), TNA (threose nucleic acid oligomer), D / L-aTNA (acyclic D / L-threoninol nucleic acid oligomer), a DNA or RNA crosslinking agent, avidin, streptavidin, neutravidin, biotin, an antibody, a protein, a cell penetrating peptide, a radioactive atom, or a radiolabeled molecule.

14. The method of any of claims 3-13, wherein said MACs have structures represented by the formulae in FIGS. 5.i, 5.ii, 5.iii, 5.iv, 5.v, and 5.vi that form 4-10 H-bonds specifically withAABP mismatches, FIGS. 6.i, 6.ii, 6. iii, 6.iv, 6.v, 6.vi that form 6-10 H-bonds specifically withCCBP mismatches, FIGS. 7.i, 7.ii, 7. iii, 7.iv, 7.v, 7.vi that form 6-14 H-bonds specifically withGGBP mismatches, FIGS. 8.i, 8.ii, 8. iii, 8.iv, 8.v, 8.vi that form 4-10 H-bonds specifically with ^BP / ^BP / ^BP / ^BP mismatches, FIGS. 9.i, 9.ii, 9. iii, 9.iv, 9.v, 9.vi that form 5-10 H-bonds specifically withACBP / CABP mismatches, FIGS.

10. i, 10. ii, 10. iii, 10. iv, lO.v, lO.vi that form 6-12 H-bonds specifically withAGBP / GABP mismatches, FIGS, l l.i, 11. ii, 11. iii, 11. iv, l l.v, 11. vi that form 5-10 H-bonds specifically withCTBP / CUBP / TCBP / UCBP mismatches, and FIGS.

12. i, 12. ii, 12. iii, 12. iv, 12.v, 12. vi that form 5-12 H-bonds specifically withGTBP / GUBP / TGBP / UGBP mismatches.

15. The method of any of claims 3-13, wherein said MACs have structures represented by the formulae in FIGS. 13, 14, 15, 16, and 17.

16. The method of any of claims 3-15, wherein said differentiating is by melting curve analysis.

17. The method of any of claims 3-15, wherein said contacting comprises adding said one or more MACs to said oligonucleotide or polynucleotide prior to their amplification blocksmmBP- positive oligonucleotide or polynucleotide amplification.

18. The method of claim 17, wherein said amplification is carried out by PCR, ddPCR, emulsion PCR, qPCR, PCR endpoint, circle-to-circle amplification (C2CA), exponential amplification reaction (EXPAR), helicase-dependent amplification (HAD), isothermal bridge amplification, isothermal DNA amplification, isothermal RNA amplification, loop-mediated isothermal amplification (LAMP),multiple displacement amplification (MDA), nucleic acid sequence-based amplification (NASBA), primer-generation rolling cycle amplification (PG-RCA), recombinase polymerase amplification (RPA), rolling cycle amplification (RCA), single primer isothermal amplification (SPIA), strand displacement amplification (SDA), transcription-mediated amplification (TMA), or whole genome amplification (WGA).

19. A method of detecting aberrant methylation patterns within DNA comprising a) treating DNA samples with bisulfite; b) contacting a magnetic bead-MAC conjugate, wherein said MAC is selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18, with said bisulfite- treated DNA; and c) using a magnet to detect said aberrant methylated DNA.

20. A method of isolatingmmBP-positive-DNA cells, comprising a) contacting said cells with one or more MACs pre-conjugated to a fluorescent atom or compound (F-MAC), said MAC selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18; and b) using cell sorting methodologies to isolate saidmmBP-positive DNA cells.

21. The method of claim 20, further comprising eliminating saidmmBP-positive-DNA cells.

22. A method of eliminatingmmBP-positive-DNA cells within topical lesions comprising a) applying onto said lesions one or more MACs pre-conjugated to a fluorescent atom or compound (F-MAC), said MAC selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18; and b) using a laser to irradiate saidmmBP-positive-DNA cells and eliminate said lesions.

23. A method of eliminatingmmBP-positive-DNA cells within topical lesions comprising a) conjugating a- / p-particle emitting radionuclides to a MAC selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18; and b) applying said MACs onto said lesion.

24. A method of eliminatingmmBP-positive-DNA cells in an animal comprising a) conjugating a- / p-particle emitting radionuclides to a MAC selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18; and b) administering said MACs into said animal.

25. A method of imagingmmBP-positive-DNA cells or lesions in an animal comprising a) conjugating gamma-emitting radionuclides to a MAC selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18; b) administering said MACs into an animal; and c) imaging saidmmBP-positive-DNA cells or lesions.

26. A method of inhibiting H-bond disruption in cellularmmBP-positive-oligonucleotides comprising, contacting ammBP-positive-oligonucleotide-containing cell with a MAC selected from the group of compounds having a structure shown in FIGS. 1 and 5-17 and having substituents R1'28selected from the atoms and groups listed in FIG. 18.

Images