PLASMINOGEN (PLG) iRNA COMPOSITIONS AND METHODS OF USE THEREOF

Abstract

The disclosure relates to double stranded ribonucleic acid (dsRNA) agents and compositions targeting the plasminogen (PLG) gene, as well as methods of inhibiting expression of an PLG gene and methods of treating subjects having an PLG-associated disease or disorder, such as hereditary hemorrhagic telangiectasia (HHT), using such dsRNA agents and compositions.

Description

Atty Dkt No. A1088681820WO (00653) PLASMINOGEN (PLG) iRNA COMPOSITIONS AND METHODS OF USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 782,976, filed on April 3, 2025, and to U.S. Provisional Application No.63 / 696,621, filed on September 19, 2024. The entire contents of the foregoing applications are hereby incorporated herein by reference. SEQUENCE LISTING The instant application contains a Sequence Listing which has been filed electronically in eXtensible Markup Language (XML) format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 3, 2025, is named A108868_1820WO_SL.xml and is 49,172 bytes in size. FIELD OF THE INVENTION The instant disclosure relates generally to PLG-targeting dsRNA agents and methods of use thereof. BACKGROUND OF THE INVENTION Plasminogen (PLG) is the precursor of the enzyme plasmin which is a serine protease that acts to break down fibrin and dissolve blood clots (fibrinolysis). PLG is primarily synthesized by the liver and released into the systemic circulation at a high plasma concentration (1.5-2µM). The two main physiological activators of plasminogen into plasmin are tissue plasminogen activator (tPA) and urokinase plasminogen activator (uPA). Plasminogen activator inhibitor (PAI- 1), is an endogenous negative regulator that inhibits tPA and uPA activity, limiting plasminogen activation into plasmin and subsequent fibrinolysis. Hereditary hemorrhagic telangiectasia (HHT) is a genetic blood vessel disorder which leads to excessive bleeding, affecting males and females of all ages and all ethnic backgrounds. Patients with HHT have abnormal fragile blood vessels that bleed easily and have locally increased fibrinolysis and vascular malformations, such as telangiectasia and arteriovenous malformations. About 90% of people with HHT have recurring nosebleeds and also may experience gastrointestinal bleeding, HMB, anemia, and frequent iron / blood transfusions. There are currently no FDA approved drugs for treating HHT and TXA is used off-label in HHT patients. Page 1 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Heavy menstrual bleeding (HMB) is excessive menstrual blood loss which interferes with a woman’s physical, social, emotional and / or material quality of life. HMB affects ~30% of reproductive age women and is a significant burden for more than 10 million American women each year. HMB is associated with iron deficiency anemia, fatigue, and time lost from school / work / activities. Around 60-90% of women with a bleeding disorder suffer from HMB. Greater than $1 billion is spent every year for the treatment of HMB. Women with HMB have been shown to have higher uterine fibrinolytic activity including higher PLG levels, increased plasminogen activator t-PA levels and delayed PAI-1 levels. Current standard of care for HMB includes use of the anti-fibrinolytic plasminogen activation inhibitor small molecule tranexamic acid (TXA), oral contraceptive pills (OCP), and / or hormone releasing intrauterine devices (IUDs). However, side effects, high pill burden and lack of effectiveness commonly lead to discontinuation of these therapies. Therefore, there is a need for additional therapies for HMB. Given the central role of PLG in mediating fibrinolysis, inhibition of the expression and / or activity of PLG with an agent that can selectively and efficiently inhibit PLG, and thereby block or dampen fibrinolysis and excessive bleeding, would be useful for preventing or treating a variety of PLG-associated diseases and disorders, including HHT and HMB, as well as other types of bleeding associated with bleeding disorders, including nose bleeds and easy bruising. BRIEF SUMMARY OF THE INVENTION The present invention provides iRNA compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a Plasminogen (PLG) gene. The PLG gene may be within a cell, e.g., a cell within a subject, such as a human. The present invention also provides methods of using the iRNA compositions of the invention for inhibiting the expression of a PLG gene and / or for treating a subject who would benefit from inhibiting or reducing the expression of a PLG gene, e.g., a subject suffering or prone to suffering from a PLG- associated disease, for example, a bleeding disorder, such as hereditary hemorrhagic telangiectasia (HHT). In one aspect, the present disclosure provides a method of inhibiting the expression of plasminogen (PLG) gene in a human subject, the method comprising administering to the subject a fixed dose of about 10 mg to about 300 mg of a double-stranded ribonucleic acid (dsRNA) agent or an equivalent amount of a pharmaceutically acceptable salt thereof, wherein the double- stranded ribonucleic acid agent or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide Page 2 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'- usAfsgaaAfcucauagCfgAfuugcascsa-3' of SEQ ID NO: 4 and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usgscaauCfgCfUfAfugaguuucua-3' of SEQ ID NO: 3, wherein a is 2'-O- methyladenosine-3’-phosphate, c is 2'-O-methylcytidine-3’-phosphate, g is 2'-O- methylguanosine-3’-phosphate, u is 2'-O-methyluridine-3’-phosphate, Af is 2’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3’-phosphate, Uf is 2’-fluorouridine-3’-phosphate, Afs is 2’- fluoroadenosine-3’-phosphorothioate, as is 2’-O-methyladenosine-3’-phosphate, cs is 2’-O- methylcytidine-3’- phosphorothioate, gs is 2’-O-methylguanosine-3’- phosphorothioate, us is 2'- O-methyluridine-3’-phosphorothioate , and s is a phosphorothioate linkage thereby inhibiting the expression of PLG in the subject. In another aspect, the present disclosure provides a method of treating a human subject that would benefit from reduction in PLG expression, the method comprising administering to the subject a fixed dose of about 10 mg to about 300 mg of a double-stranded ribonucleic acid (dsRNA) agent or an equivalent amount of a pharmaceutically acceptable salt thereof, wherein the double-stranded ribonucleic acid agent or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usAfsgaaAfcucauagCfgAfuugcascsa-3' of SEQ ID NO: 4 and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usgscaauCfgCfUfAfugaguuucuaL96-3' of SEQ ID NO: 3, wherein a is 2'- O-methyladenosine-3’-phosphate, c is 2'-O-methylcytidine-3’-phosphate, g is 2'-O- methylguanosine-3’-phosphate, u is 2'-O-methyluridine-3’-phosphate, Af is 2’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3’-phosphate, Uf is 2’-fluorouridine-3’-phosphate, Afs is 2’- fluoroadenosine-3’-phosphorothioate, as is 2’-O-methyladenosine-3’-phosphate, cs is 2’-O- methylcytidine-3’- phosphorothioate, gs is 2’-O-methylguanosine-3’- phosphorothioate, us is 2'- O-methyluridine-3’-phosphorothioate , and s is a phosphorothioate linkage, thereby treating the subject that would benefit from reduction in PLG expression. In another aspect, the present disclosure provides a method of treating a human subject having a PLG-associated disease, the method comprising administering to the subject a fixed dose of about 10 mg to about 300 mg of a double-stranded ribonucleic acid agent or an equivalent amount of a pharmaceutically acceptable salt thereof, wherein the double-stranded ribonucleic acid agent or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence Page 3 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'- usAfsgaaAfcucauagCfgAfuugcascsa-3' of SEQ ID NO: 4 and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usgscaauCfgCfUfAfugaguuucua-3' of SEQ ID NO: 3, wherein a is 2'-O- methyladenosine-3’-phosphate, c is 2'-O-methylcytidine-3’-phosphate, g is 2'-O- methylguanosine-3’-phosphate, u is 2'-O-methyluridine-3’-phosphate, Af is 2’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3’-phosphate, Uf is 2’-fluorouridine-3’-phosphate, Afs is 2’- fluoroadenosine-3’-phosphorothioate, as is 2’-O-methyladenosine-3’-phosphate, cs is 2’-O- methylcytidine-3’- phosphorothioate, gs is 2’-O-methylguanosine-3’- phosphorothioate, us is 2'- O-methyluridine-3’-phosphorothioate , and s is a phosphorothioate linkage, thereby treating the subject having a PLG-associated disease. In one embodiment, the human subject has a PLG-associated disease. In some embodiments, the PLG-associated disease is a bleeding disorder. In one embodiment, the bleeding disorder is a mucocutaneous bleeding disorder (MCB). In some embodiments, the PLG- associated disease is selected from the group consisting of hereditary hemorrhagic telangiectasia (HHT), heavy menstrual bleeding (HMB), PAI-1 deficiency, von Willebrand disease, low factor XI levels, platelet defects, hemophilia A, hemophilia B, afibrinogenemia, parahemophilia, low factor VIII levels, low factor IX levels, low factor VII levels, low factor XIII levels, low factor X levels, low factor V levels, low factor II levels, nose bleeds, bleeding gums, easy bruising, postpartum bleeding, and excessive bleeding following surgery. In a specific embodiment, the PLG- associated disease is hereditary hemorrhagic telangiectasia (HHT). In one embodiment, the fixed dose of the dsRNA agent is 5 mg to 20 mg, 20 mg to 50 mg, 25 mg to 75 mg, 30 mg to 75 mg, 35 mg to 75 mg, 40 mg to 75 mg, 45 mg to 75 mg, 50 mg to 75 mg, 25 mg to 60 mg, 30 mg to 60 mg, 35 mg to 60 mg, 40 mg to 60 mg, 45 mg to 60 mg, 50 mg to 60 mg, 25 mg to 50 mg, 30 mg to 50 mg, 35 mg to 50 mg, 40 mg to 50 mg, 45 mg to 50 mg, 25 mg to 100 mg, 50 mg to 100 mg, 75 mg to 100 mg, 25 mg to 150 mg, 30 mg to 150 mg, 35 mg to 150 mg, 40 mg to 150 mg, 45 mg to 150 mg, 50 mg to 150 mg, 75 mg to 150 mg, 100 mg to 150 mg, 50 mg to 75 mg, 75 mg to 100 mg, 100 mg to 150 mg, 150 mg to 225 mg, 225 mg to 300 mg. In one embodiment, the fixed dose of the dsRNA agent is about 5 mg to about 15 mg, about 20 mg to about 50 mg, about 45 mg to about 75 mg, or about 75 mg to about 150 mg. In one embodiment, the fixed dose of the dsRNA agent is about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, Page 4 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, or about 300 mg. In some embodiments, the fixed dose of the dsRNA agent is administered to the subject once every 3 months. In one embodiment, the fixed dose of the dsRNA agent is administered to the subject once every three months for 6 months. In another embodiment, the fixed dose of the dsRNA agent is administered to the subject once every three months for 12 months. In another embodiment, the fixed dose of the dsRNA agent is administered to the subject once every three months for 15 months. In another embodiment, the fixed dose of the dsRNA agent is administered to the subject once every three months for 18 months. In yet another embodiment, the fixed dose of the dsRNA agent is administered to the subject once every three months for 24 months. In one embodiment, the subject shows a decrease in the level of PLG protein and / or activity in the plasma following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the subject shows an at least about 25% decrease in the level of PLG protein and / or activity in the plasma. In one embodiment, the subject shows an about 45% to about 80% decrease in the level of PLG protein and / or activity in the plasma. In one embodiment, the subject shows the decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month. In one embodiment, the subject shows the at least about 25% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month. In another embodiment, the subject shows the at least about 25% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 3 months. In one embodiment, the subject shows the about 45% to about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month. In another embodiment, the subject shows the about 45% to about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 3 months. In one embodiment, the subject shows the about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month. In another embodiment, the Page 5 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) subject shows the about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 3 months. In one embodiment, the subject shows a decrease in fibrinolysis following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the decrease in fibrinolysis is measured in a whole blood sample of the subject using tissue plasminogen activator-rotational thromboelastometry (tPA-ROTEM). In another embodiment, the decrease in fibrinolysis is a decrease in plasma clot fibrinolysis. In one embodiment, the subject is female and shows a decrease in menstrual bleeding following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In another embodiment, the female subject has amenorrhea following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the subject shows a decrease in epistaxis following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the subject shows a decrease in duration, frequency, and / or intensity of epistaxis following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the subject shows a decrease in hematologic support score (HSS), a decrease in the number of iron infusions and / or a decrease in the number of red blood cell (RBC) transfusions following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the subject shows an increase in hemoglobin levels following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the subject shows a decrease in use of epistaxis rescue treatments and / or a decrease in the frequency of emergency room visits following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the subject shows an improvement in quality of life (QoL) and / or patient reported outcome (PRO) scores following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the improvement in quality of life and / or patient reported outcome scores is measured by nasal outcome score for epistaxis in HHT (NOSE-HHT), modified patient global impression of severity (mPGI-S), HHT specific quality of life (HHT-QoL), patient global Page 6 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) impression of change (PGI-C), modified patient global impression of change (mPGI-C), and / or Euro QoL 5 dimensions 5 levels questionnaire (EQ-5D-5L). In one embodiment, the decrease, increase or improvement is relative to a reference level. In one embodiment, the reference level is a level observed in the subject prior to the administration. In another embodiment, the reference level is a level observed in a subject administered a placebo. In another embodiment, the reference level is a predetermined threshold level. In one embodiment, the subject does not develop ligneous lesions, severe injection site reactions, thrombosis, and / or an alanine aminotransferase (ALT) or aspartate aminotransferase (AST) elevation greater than 3 times the upper limit of normal (ULN) following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the subject shows normal liver function tests following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, anti-drug antibodies are not detectable in the subject following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the dsRNA agent or an equivalent amount of a pharmaceutically acceptable salt thereof is administered to the subject as a single dose. In one embodiment, the dsRNA agent or an equivalent amount of a pharmaceutically acceptable salt thereof is administered to the subject subcutaneously. In one embodiment, the pharmaceutically acceptable salt is sodium salt. In one embodiment, the dsRNA agent, or pharmaceutically acceptable salt thereof, further comprises a ligand. In one embodiment, the ligand is conjugated to the 3’ end of the sense strand. In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In another embodiment, the GalNAc derivative comprises one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker. In one embodiment, the ligand is Page 7 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) . strand is conjugated to the ligand as shownBRIEF DESCRIPTION OF THE DRAWINGS The following detailed description, given by way of example, but not intended to limit the disclosure solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings, in which: FIG. 1 depicts the study design for the clinical trial described in Example 1 in healthy volunteers. DB=double blind; PD=pharmacodynamic(s); SRC=Safety Review Committee; TXA=tranexamic acid. FIG.2 depicts the study design for the clinical trial described in Example 2 in patients with HHT. DB=double blind; HHT=hereditary hemorrhagic telangiectasia; OLE=open-label extension; PD=pharmacodynamics; q3M=once every 3 months; SC= Subcutaneous; SRC=Safety Review Committee. DB Treatment Period: Cohort 1 has 18 patients; Cohort 2 has 30 patients. Each cohort is randomized 2:1 to receive 2 doses of study drug (ALN-6400 or placebo) q3M, at Day 1 Page 8 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) and Week 12. OLE Period: Patients receive 4 doses of open-label ALN-6400 q3M. The first dose is at Week 24, after completion of the visit assessments at Week 24; thereafter, patients receive open-label ALN-6400 at Weeks 36, 48, and 60. In the OLE Period, patients receive open-label ALN-6400 at the same dose level as in their DB cohort until the primary analysis for the DB Treatment Period is complete; thereafter, the SRC may recommend a change in the OLE dose based on the primary analysis safety and efficacy results, not to exceed a dose level determined to be safe and tolerable during the study. DETAILED DESCRIPTION OF THE INVENTION The present disclosure provides RNAi compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a plasminogen (PLG) gene. The PLG gene may be within a cell, e.g., a cell within a subject, such as a human. The present disclosure also provides methods of using the RNAi compositions of the disclosure for inhibiting the expression of a PLG gene and / or for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of a PLG gene, e.g., a PLG-associated disease, for example, a bleeding disorder, e.g., hereditary hemorrhagic telangiectasia (HHT). ALN-6400 is a synthetic siRNA covalently linked to a triantennary N-acetylgalactosamine (GalNAc) ligand (L96) for enhanced liver delivery. PLG is predominantly produced in the liver, but there are also extra-hepatic sources such as the cornea. Hereditary Hemorrhagic Telangiectasia (HHT) (also known as Osler-Weber-Rendu disease) is an orphan disease with a high unmet need as there are no approved drugs indicated for the treatment of HHT. HHT is a progressive, multisystem bleeding disorder. It is characterized by disordered angiogenesis, which results in abnormal vascular structures ranging from telangiectasias (small, dilated blood vessels) to arteriovenous malformations (AVMs) in the liver, lungs, and brain (Zarka, et al., Prevalence and risk factors for bleeding in hereditary hemorrhagic telangiectasia: a National Inpatient Sample study. Blood Adv.2023 Oct 10;7(19):5843-50). HHT is inherited in an autosomal dominant manner. It is the second most common inherited bleeding disorder and has an estimated prevalence of 1 in 5000 to 1 in 8000 (Govani, et al., Eur J Hum Genet. 2009 Jul;17(7):860-71). HHT affects males and females of all ages and all ethnic backgrounds. The abnormal vascular structures found in patients with HHT are prone to hemorrhage because of their fragile walls and turbulent blood flow. Spontaneous, recurrent epistaxis is the most common symptom of HHT, occurring in more than 90% of patients. These episodes of epistaxis can be severe and life-threatening. Other forms of mucosal bleeding, including gastrointestinal (GI) bleeding, are also common in patients with HHT (Zhang, et al., Hereditary Hemorrhagic Telangiectasia May be the Most Clinically Significant and Morbid Page 9 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Inherited Bleeding Disorder of Women. Blood. 2023 Nov;142(Supplement 1):28). Bleeding episodes frequently result in iron deficiency anemia (which affects approximately 50% of people with HHT). Other manifestations of HHT include symptomatic liver disease (arising as a result of hepatic arteriovenous malformations (AVMs), which may present as heart failure (McDonald, et al., Genet Med. 2011 Jul;13(7):607-16), intracranial hemorrhage (arising from cerebral AVMs) and pulmonary hypertension. The clinical presentation of HHT is heterogeneous, even within families. However, symptoms often first occur in childhood and typically worsen over time. TXA is a globally approved antifibrinolytic drug that inhibits the PLG pathway and is used as a benchmark for assessing ALN-6400 effects on blood clotting. The approved indications for TXA, which are for short courses of treatment, vary across regions for both the intravenous and tablet forms. In Canada, the European Union (EU), and the United Kingdom (UK), TXA is approved for the treatment of increased fibrinolysis, which can include conditions such as epistaxis and menorrhagia. In the United States (US), TXA is indicated for heavy menstrual bleeding. In the ATERO study, a double-blind, placebo-controlled crossover study (3 months per period) that enrolled 118 patients with HHT, treatment with 3000 mg of TXA daily reduced monthly epistaxis duration by 17% (Gaillard, et al., J. Thromb. Haemost.2014 Sep;12(9):1494-502). TXA can be used to help manage symptoms of HHT; however, limitations include potential side effects such as nausea, vomiting, and diarrhea, as well as a high pill burden (~6 tablets / day) due to its short half-life, which can be inconvenient for patients. ALN-6400 contains an siRNA targeting PLG mRNA, conjugated to a GalNAc-containing ligand to facilitate delivery to the liver. Based on the mechanism of RNAi, ALN-6400 is specifically designed to reduce the hepatic synthesis of PLG protein. By reducing the hepatic expression of PLG, it is anticipated that ALN-6400 will limit fibrinolysis (clot breakdown) and thereby ameliorate the bleeding symptoms of HHT. The use of this RNAi agent enables the targeted degradation of mRNAs of a PLG gene in mammals. Very low dosages of PLG dsRNA agents, in particular, can specifically and efficiently mediate RNA interference (RNAi), resulting in significant inhibition of expression of an PLG gene. Using cell-based assays, the present inventors have demonstrated that dsRNA agents targeting PLG can mediate RNAi, resulting in significant inhibition of expression of a PLG gene. See, for example WO2024 / 007148, the entire content of which is incorporated herein by reference. Thus, methods and compositions including these dsRNA agents are useful for treating a subject who would benefit by a reduction in the levels and / or activity of a PLG protein, such as a subject having a PLG-associated disease or disorder, for example, HHT. Page 10 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) The following detailed description discloses how to make and use compositions containing dsRNA agents to inhibit the expression of a PLG gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition and / or reduction of the expression of this gene. Definitions In order that the present disclosure may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this disclosure. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range. The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range. As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range. “ALN-6400” refers to the double-stranded RNA having a sense strand of the nucleotide sequence: 5'-usgscaauCfgCfUfAfugaguuucua-3' (SEQ ID NO: 3), and an antisense strand having the nucleotide sequence: 5'-usAfsgaaAfcucauagCfgAfuugcascsa-3' (SEQ ID NO: 4), Page 11 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) wherein a is 2'-O-methyladenosine-3’-phosphate; as is 2'-O-methyladenosine-3’-phosphorothioate; Af is a 2’-fluoroadenosine-3’-phosphate; Afs is a 2’-fluoroadenosine-3’-phosphorothioate; c is a 2’-O-methylcytidine-3’-phosphate; cs is a 2’-O-methylcytidine-3’- phosphorothioate; Cf is a 2’-fluorocytidine-3’-phosphate g is a 2'-O-methylguanosine-3'-phosphate; gs is a 2’-O-methylguanosine-3’-phosphorothioate; u is a 2'-O-methyluridine-3'-phosphate; Uf is 2’-fluorouridine-3’-phosphate, and us is a 2'-O-methyluridine-3'-phosphorothioate. The sense strand of ALN-6400 conjugated to a GalNAC derivative at the 3’ end has the following nucleotide sequence: 5'-usgscaauCfgCfUfAfugaguuucuaL96-3' (SEQ ID NO: 5), L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol; or (2S,4R)-1-[29-[[2- (acetylamino)-2-deoxy-β-D-galactopyranosyl]oxy]-14,14-bis[[3-[[3-[[5-[[2-(acetylamino)-2-deoxy- β-D-galactopyranosyl]oxy]-1-oxopentyl] amino]propyl]amino]-3-oxopropoxy]methyl]-1,12,19,25- tetraoxo-16-oxa-13,20,24-triazanonacos-1-yl]-4-hydroxy-2-hydroxymethylpyrrolidine. The chemical structure of L96 is as follows: .5'-UGCAAUCGCUAUGAGUUUCUA-3' (SEQ ID NO: 6), and has an antisense strand of the nucleotide sequence: 5'-UAGAAACUCAUAGCGAUUGCACA-3' (SEQ ID NO: 7). ALN-6400 may be used as a free acid or sodium salt. It is intended and understood by one skilled in the art that throughout the disclosure, reference to “ALN-6400” is inclusive of free acid ALN-6400, as well as a pharmaceutically acceptable salt thereof (e.g., ALN-6400 sodium), Page 12 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) unless the free acid or sodium salt is expressly indicated. Likewise, dosage amounts of ALN-6400 are provided throughout the present disclosure on a free-acid basis unless stated otherwise, and are intended to include the equivalent amount of a pharmaceutically acceptable salt (e.g., sodium salt) of ALN-6400 (i.e., ALN-6400 sodium), i.e., the equivalent amount of ALN-6400 salt that contains the specified amount of ALN-6400. The term “PLG,” also known as “Plasminogen,” “Plasmin,” “HAE4,” “EC 3.4.21.7,” and “EC 3.4.21,” refers to the well-known gene encoding a PLG protein from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term also refers to fragments and variants of native PLG that maintain at least one in vivo or in vitro activity of a native PLG. Plasminogen (PLG) is a serine protease and mediates fibrinolysis or dissolving of fibrin blood clots. PLG is highly expressed by the liver and to a lesser extent by the kidney. Plasminogen is released from the liver into systemic circulation. Since plasminogen is the main driver of fibrinolysis, reducing plasminogen levels or activity could be beneficial in patients with bleeding disorders. Non-limiting examples of bleeding disorders include hereditary hemorrhagic telangiectasia (HHT), heavy menstrual bleeding (HMB), PAI-1 deficiency, von Willebrand disease, low factor XI levels, platelet defects, hemophilia A, hemophilia B, afibrinogenemia, parahemophilia, low factor VIII levels, low factor IX levels, low factor VII levels, low factor XIII levels, low factor X levels, low factor V levels, low factor II levels, nose bleeds, bleeding gums, easy bruising, postpartum bleeding, or excessive bleeding following surgery. In one embodiment, the bleeding disorder is a mucocutaneous bleeding disorder (MCB). The biology of MCB is not as well understood as other bleeding disorders, such as hemophilia, and can take a long time to diagnose. MCB symptoms include epistaxis (nosebleeds), heavy menstrual bleeding, post-partum hemorrhage, digestive tract bleeding, easy bruising, prolonged bleeding, and bleeding gums. TXA is used as a treatment to reduce bleeding in MCB patients. Non-limiting examples of mucocutaneous bleeding disorders include inherited platelet disorders (IPD), hereditary hemorrhagic telangiectasia (HHT), hypermobility spectrum disorders (HSD), Ehlers-Danlos syndromes (EDS), and von Willebrand disease (VWD). Exemplary nucleotide and amino acid sequences of PLG can be found, for example, at GenBank Accession No. NM_000301.5 (SEQ ID NO: 1) and GenBank Accession No. NM_001168338.1 (SEQ ID NO: 2) for Homo sapiens PLG. Additional examples of PLG mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM. Page 13 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Further information on PLG is provided, for example in the NCBI Gene database at http: / / www.ncbi.nlm.nih.gov / gene / 5340. The term “PLG” as used herein also refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the PLG gene, such as a single nucleotide polymorphism in the PLG gene. Numerous SNPs within the PLG gene have been identified and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov / snp). In one embodiment, a “RNAi agent” for use in the compositions and methods of the disclosure is a double stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA” refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a PLG gene. The term “antisense strand” or "guide strand" refers to the strand of a RNAi agent, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a PLG mRNA. The term “sense strand” or "passenger strand" as used herein, refers to the strand of a RNAi agent that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein. The phrase “contacting a cell with an RNAi agent,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell. Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and / or be coupled to a ligand, e.g., GalNAc3, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject. Page 14 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) In one embodiment, contacting a cell with a RNAi agent includes “introducing” or “delivering the RNAi agent into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of a RNAi agent can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing a RNAi agent into a cell may be in vitro and / or in vivo. For example, for in vivo introduction, a RNAi agent can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and / or are known in the art. As used herein, a “subject” is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in PLG expression; a human at risk for a disease, disorder or condition that would benefit from reduction in PLG expression; a human having a disease, disorder or condition that would benefit from reduction in PLG expression; and / or human being treated for a disease, disorder or condition that would benefit from reduction in PLG expression as described herein. As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with PLG gene expression and / or PLG protein production, e.g., PLG-associated diseases or disorders such as a bleeding disorder and HHT, among others. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. The term “lower” of “decrease” in the context of the level of PLG in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more. In certain embodiments, a decrease is at least 20%. ”Lower” in the context of the level of PLG in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder. The term “higher” or “increase” in the context of the level of a disease marker or symptom refers to a statistically significant increase in such level. The increase can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more. In certain embodiments, an increase is at least 20%. ”Higher” in the context of the level of a disease marker or symptom in a subject is to a level accepted as outside the range of normal as compared to an individual without such Page 15 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) disorder, or elevated to a level still within the range of normal as compared to an individual without such disorder. As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of an PLG gene and / or production of PLG protein, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of PLG gene expression, such as excessive bleeding. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention. As used herein, the term "PLG-associated disease,” is a disease or disorder that is caused by, or associated with, PLG gene expression or PLG protein production. The term "PLG- associated disease” includes a disease, disorder or condition that would benefit from a decrease in PLG gene expression or protein activity. In one embodiment, an "PLG-associated disease” is a bleeding disorder. A “bleeding disorder” is any disease, disorder, or condition associated with heavy or excessive bleeding. Non- limiting examples of a bleeding disorder include hereditary hemorrhagic telangiectasia (HHT), heavy menstrual bleeding (HMB), PAI-1 deficiency, von Willebrand disease, low factor XI levels, platelet defects, hemophilia A, hemophilia B, afibrinogenemia, parahemophilia, low factor VIII levels, low factor IX levels, low factor VII levels, low factor XIII levels, low factor X levels, low factor V levels, low factor II levels, nose bleeds, bleeding gums, easy bruising, postpartum bleeding, and excessive bleeding following surgery. A “statistically significant” increase or decrease in a parameter refers to an increase or decrease in the parameter that is significant as statistically analyzed. Any known statistical methods can be used for statistical analysis and determination of the presence of a statistically significant increase or decrease, including the chi square test, analysis of variance (ANOVA) test (e.g., paired 2 way ANOVA tests with a Sidak Post-hoc multiple comparison test), Student’s t- test, multivariate analysis or variance (MANOVA), and analysis of covariance (ANCOVA). "Therapeutically effective amount," as used herein, is intended to include the amount of a dsRNA agent that, when administered to a subject having a PLG-associated disorder, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the dsRNA agent, how the agent is administered, the disease and its severity and Page 16 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated. “Prophylactically effective amount,” as used herein, is intended to include the amount of a dsRNA agent that, when administered to a subject having a PLG-associated disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the dsRNA agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated. A "therapeutically-effective amount" or “prophylactically effective amount” also includes an amount of a dsRNA agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. A dsRNA agent employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene Page 17 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non- toxic compatible substances employed in pharmaceutical formulations. The phrase "pharmaceutically acceptable salt" as used herein refers to any pharmaceutically acceptable chemical compound formed by an acid and a base, with all part of the hydrogen of the acid replaced by a metal or other cation. A pharmaceutically acceptable salt of a dsRNA agent (e.g., ALN-6400) as used herein include, but are not limited to, a sodium salt, a calcium salt, a lithium salt, a potassium salt, an ammonium salt, a magnesium salt, or any mixture thereof, of the dsRNA agent (e.g., ALN-6400). One skilled in the art will appreciate that the dsRNA agent, when provided as a polycationic salt having one cation per free acid group of the optionally modified phosphodiester backbone and / or any other acidic modifications (e.g., 5- terminal phosphonate groups). For example, an oligonucleotide of “n” nucleotides in length contains n−1 optionally modified phosphodiesters, so that an oligonucleotide of 21 nt in length may be provided as a salt having up to 20 cations (e.g., 20 sodium cations). Similarly, a dsRNA agent having a sense strand of 21 nt in length and an antisense strand of 23 nt in length may be provided as a salt having up to 42 cations (e.g., 42 sodium cations). In specific embodiments, pharmaceutically acceptable salt is a sodium salt, such as ALN-6400 sodium. The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. RNAi Agents of the Disclosure A dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. For example, the nucleic acids featured in the Page 18 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) disclosure can be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA. A dsRNA agent provided herein, e.g., ALN-6400, may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the disclosure can be prepared using solution-phase or solid-phase organic synthesis or both. A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA. The skilled person is well aware that dsRNAs having a duplex structure of between about 20 and 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of a PLG gene by not more than about 5, 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence, are contemplated to be within the scope of the present invention. In one embodiment, the antisense strand of the dsRNA agent comprises at least 19 contiguous nucleotides derived from one of the antisense sequences provided herein and the sense strand of the dsRNA agent comprises at least 19 contiguous nucleotides derived from one of the sense sequences provided herein. In certain embodiments, the antisense strand of the Page 19 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) dsRNA agent comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usAfsgaaAfcucauagCfgAfuugcascsa-3' of SEQ ID NO: 4 and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usgscaauCfgCfUfAfugaguuucua-3' of SEQ ID NO: 3. An iRNA agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch is not located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5’- or 3’-end of the region of complementarity. For example, for a 23 nucleotide iRNA agent the strand which is complementary to a region of a PLG gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein, or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of a PLG gene. Consideration of the efficacy of iRNAs with mismatches in inhibiting expression of a PLG gene is important, especially if the particular region of complementarity in a PLG gene is known to have polymorphic sequence variation within the population. In one embodiment, the dsRNA agent comprises a ligand. In some embodiments, the ligand is conjugated to the 3’ end of the sense strand. In one embodiment the ligand is a GalNAc derivative. In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to a dsRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to a dsRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to a dsRNA agent of the invention via a trivalent linker. In one embodiment, the ligand is Page 20 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) HOOHO O HN HN O . strand is conjugated to the ligand as shown,PLG Knockdown to Treat a Subject Certain aspects of the instant disclosure are directed to dsRNA agent-mediated knockdown of PLG in a human subject. In some aspects, the human subject is a healthy subject. In some embodiments, the healthy subject is assessed for safety, tolerability, pharmacokinetics (PK), and pharmacodynamics (PD) of a dsRNA agent provided herein after administration of the dsRNA agent. In one embodiment a healthy human subject is administered ALN-6400. Assessing the safety and tolerability of a dsRNA provided herein, e.g., ALN-6400, includes those methods described in the examples provided herein and methods well known in the art, including, for example, evaluating vital signs, clinical laboratory assessments, electrocardiograms (ECGs,) and the occurrence and frequency of adverse events. Non-limiting examples of adverse events include thrombotic events, development of any ligneous lesions, alanine aminotransferase Page 21 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) (ALT) or aspartate aminotransferase (AST) >3× ULN (upper limit of normal), and / or injection site reactions (ISRs). Vital signs that may be monitored include, for example, blood pressure, heart rate, body temperature, and respiratory rate. Clinical laboratory assessments include, for example, hematology: complete blood count with differential; serum chemistry: sodium, potassium, BUN, albumin, total protein, calcium, glucose, bicarbonate, creatinine and eGFR, chloride; liver test functions: AST, ALT, ALP, bilirubin (total and direct); urinalysis: visual inspection for appearance and color, bilirubin, pH (dipstick), nitrite, specific gravity, red blood cells (RBCs), ketones, urobilinogen, glucose, leukocytes, protein, microscopy (if clinically indicated); coagulation: prothrombin time and International Normalized Ratio, activated partial thromboplastin time (aPTT), prothrombin fragment 1.2, fibrinogen, and / or D-dimer; immunogenicity: anti-drug antibodies; and / or pregnancy testing / FSH screening: β-human chorionic gonadotropin (females of child-bearing potential only), FSH (postmenopausal women only). Evaluating the PK of a dsRNA agent provided herein, e.g., ALN-6400, includes, for example, plasma PK measures: area under the concentration-time curve (AUC), maximum plasma concentration (Cmax), and time to maximum plasma concentration (tmax); and urine parameter: fraction excreted in urine (fe) of the dsRNA agent, e.g., ALN-6400, and potential metabolites of the dsRNA agent, e.g., ALN-6400. Characterizing the PD effects of a dsRNA agent provided herein, e.g., ALN-6400, includes, for example, determining the plasma protein levels of PLG and / or the plasma activity levels of PLG. Non-limiting examples of additional measures of PD effects of the dsRNA agent, e.g., ALN-6400, include whole blood clot fibrinolysis by tissue plasminogen activator rotational thromboelastometry (tPA-ROTEM), ROTEM, plasm clot fibrinolysis, plasma plasmin generation, plasma thrombin generation, and / or plasma D-dimer. In some embodiments, the effects of a dsRNA agent provided herein, e.g., ALN-6400, on menstrual blood loss are monitored. In one embodiment a female subject shows a decrease in menstrual bleeding following the administration of the dsRNA agent, e.g., ALN-6400, or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the female subject has amenorrhea following the administration of the dsRNA agent, e.g., ALN-6400, or the equivalent amount of a pharmaceutically acceptable salt thereof. In some embodiments, the subject shows a decrease in fibrinolysis following the administration of the dsRNA agent, e.g., ALN-6400, or the equivalent amount of a pharmaceutically acceptable salt thereof. Fibrinolysis can be measured, for example, in a whole Page 22 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) blood sample of the subject using tissue plasminogen activator-rotational thromboelastometry (tPA-ROTEM), in a plasma clot fibrinolysis assay, or by ROTEM. In one embodiment, the subject shows normal liver function tests following the administration of the dsRNA agent, e.g., ALN-6400, or the equivalent amount of a pharmaceutically acceptable salt thereof. Non-limiting examples of liver function tests are described in the examples herein and include, for example, AST, ALT, alkaline phosphatase ALP), and / or bilirubin (total and direct). In one embodiment, a subject does not develop ligneous lesions, severe injection site reactions, thrombosis, and / or an alanine aminotransferase (ALT) or aspartate aminotransferase (AST) elevation greater than 3 times the upper limit of normal (ULN) following the administration of the dsRNA agent, e.g., ALN-6400, or the equivalent amount of a pharmaceutically acceptable salt thereof. In the methods provided herein include assessing the subject for anti-drug antibodies. In one embodiment, anti-drug antibodies are not detectable following the administration of the dsRNA agent, e.g., ALN-6400, or the equivalent amount of a pharmaceutically acceptable salt thereof. In one embodiment, the various measures of safety, tolerability, PK, and PD of a dsRNA agent provided herein, e.g., ALN-6400, are compared to a reference level. The reference level can be a baseline measure in the subject obtained prior to administration of a dsRNA agent provided herein, e.g., ALN-6400, a level observed in a subject administered a placebo, or to a predetermined threshold level. In other aspects the human subject would benefit from a reduction in PLG expression and / or has a PLG-associated disease or disorder. Non-limiting examples of PLG-associated disorders include bleeding disorders such as a mucocutaneous bleeding disorder (MCB), hereditary hemorrhagic telangiectasia (HHT), heavy menstrual bleeding (HMB), PAI-1 deficiency, von Willebrand disease, low factor XI levels, platelet defects, hemophilia A, hemophilia B, afibrinogenemia, parahemophilia, low factor VIII levels, low factor IX levels, low factor VII levels, low factor XIII levels, low factor X levels, low factor V levels, low factor II levels, nose bleeds, bleeding gums, easy bruising, postpartum bleeding, and excessive bleeding following surgery. Aspects of RNAi agent-mediated knockdown of PLG for treatment of bleeding disorders are further discussed, e.g., in WO2024007148, the entire content of which is incorporated herein by reference. RNAi agent-mediated knockdown in HHT is contemplated by the present invention. HHT is a genetic blood vessel disorder which leads to excessive bleeding, affecting males and females Page 23 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) of all ages and all ethnic backgrounds. There are about 70,000 HHT patients in the United States and 1.4 million with HHT worldwide. There are three known genetic mutations in the TGFβ pathway in HHT, including mutations in the Endoglin, Smad4, and ALK1 genes which are involved in endothelial migration during angiogenesis and vascular remodeling. Patients with HHT have abnormal fragile blood vessels that bleed easily and have locally increased fibrinolysis and vascular malformations, such as telangiectasia and arteriovenous malformations. About 90% of people with HHT have recurring nosebleeds varying in frequency and severity, with nosebleeds greater than 5 times a week and nosebleeds lasting greater than five hours which may require emergency room visits and transfusions. Patients with HHT also may experience gastrointestinal bleeding, heavy menstrual bleeding (HMB), anemia, and frequent iron / blood transfusions. There are currently no FDA approved drugs for treating HHT. Tranexamic acid (TXA) is an oral antifibrinolytic drug that is used off-label in HHT patients but is not an ideal therapy as it has poor bioavailability, a high pill burden (2 large tablets, 3-4 times a day), and off target side effects. Therefore, there is a need for a long-lasting effective therapy for HHT. The dsRNA agents provided herein for inhibiting expression of PLG can be used to treat bleeding disorders, such as HHT. The potential advantages of a PLG lowering siRNA approach versus current standard of care is that siRNA avoids the side-effects of TXA, infrequent administration, and potentially lower thrombotic risk. Patients with genetic disorders resulting in plasminogen deficiency (e.g., type I or type II plasminogen deficiency), do not have an increased risk of thrombosis deficiency (Schuster V. et al., 2007, J Thromb Haemost. 5: 2315–22). However, these patients, having little to no PLG activity, experience ligneous lesions caused by the deposition of fibrin including ligneous conjunctivitis, ligneous gingivitis, ligneous cervicitis, and ligneous endometritis. Treatment for patients with plasminogen deficiency includes i.v. infusion (administered every 2-4 days) of purified, human plasma-donor derived Glu-plasminogen. Studies with TXA indicate that a lower dose of TXA may be equally as effective as the standard dosing, for example, in treating HMB. (The minimal effective dose of tranexamic acid in women with menorrhagia XXIV Congress of the International Society on Thrombosis and Haemostasis (2013)). Therefore, less potent plasminogen suppression of approximately 50% or less may be sufficient. Accordingly, to minimize side effects of PLG deficiency, such as development of lesions, the knockdown of PLG by the dsRNA agents provided herein can be selected or designed to achieve a 50% or less knockdown of PLG. In some embodiments, the dsRNA agents provided herein reduce PLG expression by about 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 45%, 30%, 25%, 20%, 15%, 10%, 5%, or less. Page 24 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) The ALN-6400 dsRNA agent provided herein contains an siRNA targeting PLG mRNA, conjugated to a GalNAc-containing ligand to facilitate delivery to the liver. Based on the mechanism of RNAi, ALN-6400 is specifically designed to reduce the hepatic synthesis of PLG protein. By reducing the hepatic expression of PLG, it is anticipated that ALN-6400 will limit fibrinolysis (clot breakdown) and thereby ameliorate the bleeding symptoms in bleeding disorders, for example, HHT. It is expressly contemplated that all PLG-associated diseases or disorders can ultimately be targeted using the dsRNA agents of the instant disclosure. Delivery of a RNAi Agent of the Disclosure The delivery of a dsRNA agent provided herein, e.g., ALN-6400, to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having an PLG-associated disorder, e.g., bleeding disorder, e.g., HHT) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with a dsRNA agent, e.g., ALN-6400, either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising a RNAi agent, e.g., a dsRNA, to a subject. Certain aspects of the instant disclosure relate to a method of reducing the expression of an PLG target gene in a cell, comprising contacting said cell with a dsRNA agent, e.g., ALN-6400. In one embodiment, the cell is a hepatic cell. Another aspect of the disclosure relates to a method of reducing the expression of an PLG target gene in a subject, comprising administering to the subject a dsRNA agent provided herein, e.g., ALN-6400. Another aspect of the disclosure relates to a method of treating a subject having a PLG- associated disorder, comprising administering to the subject a therapeutically effective amount of a dsRNA agent provided herein, e.g., ALN-6400, thereby treating the subject. Exemplary PLG- associated disorders that can be treated by the method of the disclosure include bleeding disorders such as a mucocutaneous bleeding disorder (MCB), hereditary hemorrhagic telangiectasia (HHT), heavy menstrual bleeding (HMB), PAI-1 deficiency, von Willebrand disease, low factor XI levels, platelet defects, hemophilia A, hemophilia B, afibrinogenemia, parahemophilia, low factor VIII levels, low factor IX levels, low factor VII levels, low factor XIII levels, low factor X levels, low factor V levels, low factor II levels, nose bleeds, bleeding gums, easy bruising, postpartum bleeding, and excessive bleeding following surgery. Page 25 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) In one embodiment, the dsRNA agent, e.g., ALN-6400, is administered subcutaneously. By subcutaneous administration of the dsRNA agent, the method can reduce the expression of a PLG target gene in, for example, the liver. Pharmaceutical Compositions of the Disclosure The present disclosure also includes pharmaceutical compositions and formulations which include a dsRNA agent provided herein, e.g., ALN-6400. In one embodiment, provided herein are pharmaceutical compositions containing a dsRNA agent, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the dsRNA agent are useful for treating a disease or disorder associated with the expression or activity of a PLG gene, e.g., an PLG-associated disease, e.g., a bleeding disorder, e.g., HHT. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, antibacterial and antifungal agents, isotonic, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. The pharmaceutical compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV), intramuscular (IM) or for subcutaneous delivery. Another example is compositions that are formulated for direct delivery into the liver, e.g., by infusion into the liver, such as by continuous pump infusion. Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir. Administration can be provided by the subject or by another person, e.g., a health care provider. The medication can be provided in measured doses or in a dispenser which delivers a metered dose. For subcutaneous administration, the pharmaceutical composition can be administered using, for example, a 29g or 30g needle. The pharmaceutical compositions of the invention may include an dsRNA agent of the invention in an unbuffered solution, such as saline or water, or in a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. Page 26 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) In one embodiment, the dsRNA agent, e.g., ALN-6400, is formulated in water. In other embodiments of the invention, the pharmaceutical compositions of the invention may comprise a dsRNA agent of the invention in a salt form, such as a sodium salt form. In certain embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and / or phosphorothiotate groups present in the agent. Agents in which substantially all of the phosphodiester and / or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and / or phosphorothioate linkages without a sodium counterion. In some embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for all of the phosphodiester and / or phosphorothiotate groups present in the agent. The pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression of a PLG gene. In one embodiment, the dosing frequency of a therapeutic amount of a dsRNA agent provided herein, e.g., ALN-6400, is a single dose. In further embodiments, the single dose of a dsRNA agent provided herein, e.g., ALN- 6400, (free acid) is administered at about 10 mg, about 25 mg, about 50 mg, about 100 mg, or up to a maximum dose of 300 mg), or an equivalent amount of a salt of the dsRNA agent, e.g., ALN-6400 salt (e.g., ALN-6400 sodium). An “equivalent amount” of ALN-6400 salt as used herein with respect to a first amount of free acid ALN-6400 means a second amount of ALN-6400 salt that contains the same number of moles as the first amount of the free acid ALN-6400 and / or has the same activity (e.g., bioactivity) as the first amount of free acid ALN-6400. In specific embodiments, the dsRNA agent provided herein, e.g., ALN-6400, is administered at a single dose of about 5 mg to about 15 mg, about 20 mg to about 50 mg, about 45 mg to about 75 mg, or about 75 mg to about 150 (free acid, e.g., free acid ALN-6400), or an equivalent amount of dsRNA salt (e.g., ALN-6400 sodium). In one embodiment, the single dose of a dsRNA agent, e.g., ALN-6400, is 5 mg to 15 mg, 20 mg to 50 mg, 25 mg to 75 mg, 30 mg to 75 mg, 35 mg to 75 mg, 40 mg to 75 mg, 45 mg to 75 mg, 50 mg to 75 mg, 25 mg to 60 mg, 30 mg to 60 mg, 35 mg to 60 mg, 40 mg to 60 mg, 45 mg to 60 mg, 50 mg to 60 mg, 25 mg to 50 mg, 30 mg to 50 mg, 35 mg to 50 mg, 40 mg to 50 mg, 45 mg to 50 mg, 25 mg to 100 mg, 50 mg to 100 mg, 75 mg to 100 mg, 25 mg to 150 mg, 30 mg to 150 mg, 35 mg to 150 mg, 40 mg to 150 mg, 45 mg to 150 mg, 50 mg to 150 mg, 75 mg to 150 mg, 100 mg to 150 mg, 50 mg to 75 mg, 75 mg to 100 mg, 100 mg to 150 mg, 150 mg to 225 mg, 225 mg to 300 mg. Page 27 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) In another embodiment, the single dose of a dsRNA agent, e.g., ALN-6400, is about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, or about 300 mg. In some embodiments, the dsRNA agent, e.g., ALN-6400, is administered at a single dose of about 10 mg (free acid), or an equivalent amount of ALN-6400 salt (e.g., ALN-6400 sodium). In some embodiments, the dsRNA agent, e.g., ALN-6400, is administered at a single dose of about 25 mg (free acid), or an equivalent amount of ALN-6400 salt (e.g., ALN-6400 sodium). In some embodiments, the dsRNA agent, e.g., ALN-6400, is administered at a single dose of about 50 mg (free acid), or an equivalent amount of ALN-6400 salt (e.g., ALN-6400 sodium). In some embodiments, the dsRNA agent, e.g., ALN-6400, is administered at a single dose of about 100 mg (free acid), or an equivalent amount of ALN-6400 salt (e.g., ALN-6400 sodium). In some embodiments, the dsRNA agent, e.g., ALN-6400, is administered at a single dose of about 300 mg (free acid), or an equivalent amount of ALN-6400 salt (e.g., ALN-6400 sodium). In some embodiments, the dsRNA agent. e.g., ALN-6400, is administered in a multiple- dose regimen or repeat-dose regimen. A repeat-dose regimen may include administration of a therapeutic amount of the dsRNA agent on a regular basis, such as bi-monthly or monthly to once a year. In certain embodiments, the dsRNA agent is administered about once per month to about once per quarter (i.e., about once every three months). In some embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. In some embodiments of the disclosure, a single dose of the dsRNA agent, e.g., ALN- 6400, is administered once per week, bi-monthly, once per month, once every 2 months, once every 3 months (q3M), once every 4 months, once every 5 months, once every 6 months, or once every 7 months, or once every 8 months, or once every 9 months, or once every 10 months, or once every 11 months, or once every 12 months. In specific embodiments, a single dose of the dsRNA agent is administered at least 3 months apart (e.g., every 3 months or less frequently). In further embodiments, a single dose of the dsRNA agent is administered once every 6 months Page 28 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) or less frequently. In further embodiments, a single dose of the dsRNA agent is administered once every 12 months or less frequently. In another embodiment, the dosing frequency of the dsRNA agent, e.g., ALN-6400, is a multi-dose regimen or repeat-dose regimen. In one embodiment, the dsRNA agent, e.g., ALN- 6400 or pharmaceutically acceptable salt thereof, is administered about once every three months (q3M). The dose can be repeated every three months for 6 months. The dose can be repeated every three months for 12 months. The dose can be repeated every three months for 15 months. The dose can be repeated every three months for 18 months. The dose can be repeated every three months for 24 months. In certain embodiments of the multi-dose administration, the dsRNA agent is administered at about 10 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 112 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, or up to a maximum of 300 mg, with no greater than about 450 mg cumulative dose given per annum (e.g., maximum regimens of 225 mg every 6 months) or up to a maximum of 180 mg, with no greater than about 360 mg cumulative dose given per annum (e.g., maximum regimens of 180 mg every 6 months) as free acid, or at an equivalent amount of dsRNA agent salt (e.g., ALN-6400 sodium). In one embodiment, the dsRNA agent of the disclosure is administered no more than once every 3, 4, or 6 months. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual dsRNA agents encompassed by the disclosure can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein. The pharmaceutical compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be parenteral. Parenteral administration includes intravenous (IV), intramuscular (IM) or subcutaneous (SC) administration. The dsRNA agent, e.g., ALN-6400, can be delivered in a manner to target a particular tissue, such as the liver. Page 29 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Carrier Compounds Certain compositions of the present disclosure also incorporate carrier compounds in the formulation. As used herein, a “carrier compound” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with a carrier compound polyinosinic acid, dextran sulfate, polycytidic acid, or 4- acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183. Carriers and Excipients In contrast to a carrier compound, a “carrier,” a “pharmaceutical carrier,” a “pharmaceutically acceptable carrier,” “excipient,” or a “pharmaceutically acceptable excipient” is a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal, or from one organ or portion of the body, to another organ or portion of the body. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents. Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50Page 30 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) (the dose lethal to 50% of the population) and the ED50(the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the disclosure lies generally within a range of circulating concentrations that include the ED50with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the disclosure, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50(i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography. In addition to their administration, as discussed above, the RNAi agents featured in the disclosure can be administered in combination with other known agents effective in treatment of pathological processes mediated by PLG expression. In any event, the administering physician can adjust the amount and timing of RNAi agent administration on the basis of results observed using standard measures of efficacy known in the art or described herein. Kits In certain aspects, the instant disclosure provides kits that include a suitable container containing a pharmaceutical formulation of the dsRNA agent, e.g., ALN-6400. In certain embodiments the individual components of the pharmaceutical formulation may be provided in one container. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, e.g., one container for a siRNA compound preparation, and at least another for a carrier compound. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. The kit can also include a delivery device. Page 31 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Methods for Inhibiting PLG Expression The present disclosure also provides methods of inhibiting expression of a PLG gene in a cell. The methods include contacting a cell with an RNAi agent, e.g., double stranded RNA agent, in an amount effective to inhibit expression of PLG in the cell, thereby inhibiting expression of PLG in the cell. In certain embodiments of the disclosure, PLG is inhibited preferentially in liver cells. Contacting of a cell with a dsRNA agent, e.g., a double stranded RNAi agent, may be done in vitro or in vivo. Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi agent. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAC derivative ligand, or any other ligand that directs the RNAi agent to a site of interest. The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition. In certain embodiments, a level of inhibition, e.g., for ALN-6400 or a pharmaceutically acceptable salt thereof, can be assessed in cell culture conditions, e.g., wherein cells in cell culture are transfected via LipofectamineTM-mediated transfection at a concentration in the vicinity of a cell of 10 nM or less, 1 nM or less, etc. Knockdown of a given dsRNA agent can be determined via comparison of pre-treated levels in cell culture versus post-treated levels in cell culture, optionally also comparing against cells treated in parallel with a scrambled or other form of control RNAi agent. Knockdown in cell culture of, e.g., at least 10% or more, at least 20% or more, etc. can thereby be identified as indicative of “inhibiting” and / or “reducing”, “downregulating” or “suppressing”, etc. having occurred. It is expressly contemplated that assessment of targeted mRNA and / or encoded protein levels (and therefore an extent of “inhibiting”, etc.) can also be assessed in in vivo systems for the dsRNA agent, e.g., ALN-6400, under properly controlled conditions as described in the art. The phrase “inhibiting expression of a PLG,” or “decrease in the level of PLG” as used herein, includes inhibition / decrease of expression of a human PLG gene as well as variants or mutants of a PLG gene that encode a PLG protein. Thus, the PLG gene may be a wild-type PLG gene, a mutant PLG gene, or a transgenic PLG gene in the context of a genetically manipulated cell, group of cells, or organism. Page 32 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) “Inhibiting expression of a PLG gene” includes any level of inhibition of a PLG gene, e.g., at least partial suppression of the expression of a PLG gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. In one embodiment, the level of PLG protein and / or activity is decreased. In certain embodiments, the decrease in the level of PLG protein and / or activity is by at least about 20%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. In other embodiments, the decrease in the level of PLG protein and / or activity is by about 10% to about 20%, about 20% to about 30%, about 30% to about 40%, about 40% to about 50%, about 50% to about 60%, about 60% to about 70%, about 70% to about 80%, or about 80% to about 90%. In a specific embodiment, the decrease in the level of PLG protein and / or activity is by about 25%. In a specific embodiment, the decrease in the level of PLG protein and / or activity is by about 45% to about 80%. In a specific embodiment, the decrease in the level of PLG protein and / or activity is by about 50%. In a specific embodiment, the decrease in the level of PLG protein and / or activity is by about 80%. In a specific embodiment, the decrease in the level of PLG protein and / or activity is by about 27%. In a specific embodiment, the decrease in the level of PLG protein and / or activity is by about 48%. In a specific embodiment, the decrease in the level of PLG protein and / or activity is by about 65%. In a specific embodiment, the decrease in the level of PLG protein and / or activity is by about 79%. The expression of a PLG gene may be assessed based on the level of any variable associated with PLG gene expression, e.g., PLG mRNA level, PLG protein level, or PLG activity level. The expression of PLG may also be assessed indirectly based on the levels of PLG- associated biomarkers. The PLG levels may be measured in a body fluid sample or tissue sample obtained from a subject. In some embodiments, the sample is a whole blood sample, plasma sample, or urine sample. In another embodiment, the PLG levels may be monitored at a timepoint Page 33 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) before administration of the dsRNA agent, e.g., ALN-6400, (pre-dose baseline level) and at various timepoints following administration of the dsRNA agent, e.g., ALN-6400, or the equivalent amount of a pharmaceutically acceptable salt thereof. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control). In certain embodiments, surrogate markers can be used to detect inhibition of PLG. For example, effective prevention or treatment of a PLG-associated disorder, e.g., a bleeding disorder such as HHT or other disorder, as demonstrated by acceptable diagnostic and monitoring criteria with an agent to reduce PLG expression can be understood to demonstrate a clinically relevant reduction in PLG. The expression of a PLG gene may also be assessed indirectly based on, for example, the levels of PLG activity in a sample. In one embodiment, a decrease in PLG protein and / or activity may be assessed by a decrease in fibrinolysis activity in a sample obtained from a subject following the administration of a dsRNA agent provided herein, e.g., ALN-6400, or the equivalent amount of a pharmaceutically acceptable salt thereof. Fibrinolysis can be measured in a body fluid sample, such as whole blood, plasma, or serum. Assays to measure fibrinolysis include, for example, rotational thromboelastometry (ROTEM), tissue plasminogen activator-rotational thromboelastometry (tPA-ROTEM), and plasma clot fibrinolysis. As described in the examples herein, tPA-ROTEM is a modified version of ROTEM in which tPA is used to accelerate clot breakdown (fibrinolysis) to study the inhibitory effects on fibrinolysis. In some embodiments of the methods of the disclosure, fibrinolysis is decreased by at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay, as compared to the pre-dose baseline or a control subject, e.g., without administration of the dsRNA agent provided herein. In some embodiments, the inhibitory effect of a single dose administration of the dsRNA agent on the PLG level and / or activity is long-lasting, e.g., persists for at least 3, 4, 5, or 6 months. For example, following a single-dose administration of the dsRNA agent provided herein, PLG can be reduced by at least about 25-80% and these inhibitory effects can be sustained for at least 4 months after single dose administration. Page 34 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) In certain embodiments, the methods include a clinically relevant inhibition of expression of PLG, e.g., as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of PLG. Methods of Treating or Preventing PLG-Associated Diseases The present disclosure also provides methods of using a dsRNA agent provided herein, e.g., ALN-6400, and / or a composition containing a dsRNA agent provided herein, e.g., ALN-6400, to reduce and / or inhibit PLG expression in a cell. The methods include contacting the cell with the dsRNA agent, e.g., ALN-6400, and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of a PLG gene, thereby inhibiting expression of the PLG gene in the cell. Reduction in gene expression can be assessed by any methods known in the art. For example, a reduction in the expression of PLG may be determined by determining the mRNA expression level of PLG using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT- PCR; by determining the protein level of PLG using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques. A reduction in the expression of PLG may also be assessed indirectly by measuring a decrease in the levels of fibrinolysis, using methods routine to one of ordinary skill in the art and as described in the examples herein e.g., ROTEM, tPA-ROTEM, and plasma clot fibrinolysis in a blood sample of a subject. In the methods of the disclosure the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject. A cell suitable for treatment using the methods of the disclosure may be any cell that expresses a PLG gene. A cell suitable for use in the methods of the disclosure may be a human cell, e.g., a human liver cell. PLG expression is inhibited in the cell relative to a reference level or a control. A “reference level” and a “control level” can be used interchangeably herein. The inhibition of PLG expression can be measured as compared to the PLG expression in a control cell, which can be the cell prior to being contacted by the dsRNA agent, or a reference level of PLG expression in a reference cell or a population of reference cells being contacted with a vehicle or not being contacted with the dsRNA agent. The inhibition can also be measured as compared to the predetermined threshold level as a reference level. One having ordinary skills in the art is able to select an appropriate control or reference. PLG expression levels can be measured by standard methods for measuring mRNA or protein levels, including RT-PCR, PCR, Western blotting, and ELISA of a sample from the subject. For example, PLG expression can be inhibited by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, Page 35 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100% relative to a control. In preferred embodiments, PLG expression is inhibited by at least 20% relative to the control. Inhibition of PLG expression in the cell can be sustained for a duration of time, such as at least 1 week, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, 10 months, 1 year, or more than 1 year following an administration of a single dose of the dsRNA agent provided herein. In some embodiments, PLG expression is inhibited by at least 20%, 25%, 30%, 40%, 50%, 55%, 60%, 70%, 80%, 90%, 95%, or more than 95% in the cell for at least 1 week, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, 10 months, 1 year, or more than 1 year, for example inhibited by at least 40% for at least 3 months, by at least 40% for at least 6 months, by at least 40% for at least 10 months, by at least 55% for at least 3 months, by at least 55% for at least 6 months, or by at least 55% for at least 10 months, after being contacted by a single dose of the dsRNA agent provided herein. In some embodiments, the decrease in the level of PLG protein and / or activity in the plasma of a subject is sustained for at least 1 month and / or for at least 3 months. In one embodiment, the subject shows at least about a 25% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month. In another embodiment, the subject shows at least about a 25% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 3 months. In another embodiment, the subject shows about a 45% to about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month and / or at least 3 months. In another embodiment, the subject shows about an 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month and / or at least 3 months. The in vivo methods of the disclosure may include administering to a subject a composition containing a dsRNA agent, where the dsRNA agent includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the PLG gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to parenteral routes, including subcutaneous. In one aspect, the present disclosure also provides methods for inhibiting the expression of an PLG gene in a subject. The methods include administering to the subject a composition comprising a dsRNA that targets a PLG gene in a cell of the subject and maintaining the subject for a time sufficient to obtain degradation of the mRNA transcript of the PLG gene, thereby Page 36 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) inhibiting expression of the PLG gene in the cell. Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g., qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g., ELISA, described herein. In one embodiment, a blood, plasma, or urine sample serves as the tissue material for monitoring the reduction in PLG gene and / or protein expression (or of a proxy therefore, as described herein or as known in the art). In one embodiment, the subject is human. The present disclosure further provides methods of treatment of a subject in need thereof. The treatment methods of the disclosure include administering a dsRNA agent provided herein, e.g., ALN-6400, or a pharmaceutically acceptable salt thereof to a subject, e.g., a subject that would benefit from a reduction and / or inhibition of PLG expression, e.g., a subject having a PLG- associated disease or disorder, in a therapeutically effective amount of a dsRNA agent targeting a PLG gene or a pharmaceutical composition comprising a dsRNA agent targeting a PLG gene. In one embodiment, the subject is a human. The present disclosure also provides methods of decreasing PLG protein and / or activity levels in a subject. The methods include administering a dsRNA agent provided herein, e.g., ALN- 6400 to a subject, e.g., a subject that would benefit from a reduction and / or inhibition of PLG expression, in a therapeutically effective amount of a dsRNA agent targeting a PLG gene or a pharmaceutical composition comprising a dsRNA agent targeting a PLG gene. A dsRNA agent provided herein, e.g., ALN-6400, may be administered as a “free RNAi agent.” A free RNAi agent is administered in the absence of a pharmaceutical composition. The naked RNAi agent may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject. In another embodiment, the dsRNA agent, e.g., ALN- 6400, is in a sterile water solution. Alternatively, the dsRNA agent, e.g., ALN-6400, may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation. Subjects that would benefit from a reduction and / or inhibition of PLG gene expression are those having an PLG-associated disorder. The term "PLG-associated disease” includes a disease, disorder or condition that would benefit from a decrease in PLG gene expression, replication, or protein activity. The term "PLG-associated disease,” is a disease or disorder that is caused by, or associated with, PLG gene expression or PLG protein production. The term "PLG- associated disease” includes a disease, disorder or condition that would benefit from a decrease in PLG gene expression or protein activity. Non-limiting examples of PLG-associated diseases Page 37 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) include, for example, bleeding disorders, such as hereditary hemorrhagic telangiectasia (HHT), heavy menstrual bleeding (HMB), PAI-1 deficiency, von Willebrand disease, low factor XI levels, platelet defects, hemophilia A, hemophilia B, afibrinogenemia, parahemophilia, low factor VIII levels, low factor IX levels, low factor VII levels, low factor XIII levels, low factor X levels, low factor V levels, low factor II levels, nose bleeds, bleeding gums, easy bruising, postpartum bleeding, and excessive bleeding following surgery. The disclosure further provides methods for the use of a dsRNA agent or a pharmaceutical composition thereof, e.g., for treating a subject that would benefit from reduction and / or inhibition of PLG expression, e.g., a subject having an PLG-associated disease or disorder, in combination with other pharmaceuticals and / or other therapeutic methods, e.g., with known pharmaceuticals and / or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, a RNAi agent targeting PLG is administered in combination with, e.g., an agent useful in treating a PLG-associated disorder as described elsewhere herein or as otherwise known in the art. Non-limiting examples of such agents may include tranexamic acid (TXA), anti-angiogenic drugs, such as drugs that target the VEGF pathway, human plasma-donor derived Glu-plasminogen, inhibitors of the plasminogen pathway, or a combination of any of the foregoing. The RNAi agent and additional therapeutic agents may be administered at the same time and / or in the same combination, e.g., subcutaneously, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and / or by another method known in the art or described herein. Compositions and methods for inhibiting the expression of these genes using RNAi agents can be prepared and performed as described herein. Administration of the dsRNA according to the methods of the disclosure may result in a reduction of the severity, signs, symptoms, and / or markers of such diseases or disorders in a subject with a PLG-associated disorder. By “reduction” in this context is meant a statistically significant decrease in such level relative to a control. The reduction can be measured as compared to the severity, signs, symptoms, and / or markers in a control or reference subject, which can be the subject prior to being administered the dsRNA agent, or a reference subject or a population of reference subjects (e.g., an age- and sex- matched non-diseased population) being administered a placebo agent or not being administered the RNAi agent, such as a reference level for the severity, signs, symptoms, and / or markers in a healthy population. The reduction can also be measured as compared to the predetermined threshold level as a reference level. One having ordinary skills in the art is able to select an appropriate control or reference. Page 38 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Example signs, symptoms, and markers of PLG-associated disorders are disclosed further in the present disclosure. Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of a PLG-associated disorder may be assessed, for example, by periodic monitoring of a subject’s presence or amount of disease biomarkers in a body fluid (e.g., blood, plasma, serum). Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of a RNAi agent targeting PLG or pharmaceutical composition thereof, "effective against" a PLG-associated disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating PLG-associated disorders and the related causes. A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given RNAi agent drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed. Alternatively, the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale. Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using a RNAi agent or RNAi agent formulation as described herein. Page 39 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) In one embodiment, the subject shows an improvement in quality of life (QoL) and / or patient reported outcome (PRO) scores. An improvement in the quality of life (QoL) and / or improvement in patient reported outcome (PRO) scores of a subject having HHT can be measured by clinically accepted disease severity grading scales. Non-limiting examples of clinically accepted disease severity grading scales are provided in the examples herein and include, for example, nasal outcome score for epistaxis in HHT (NOSE-HHT), modified patient global impression of severity (mPGI-S), HHT specific quality of life (HHT-QoL), patient global impression of change (PGI-C), modified patient global impression of change (mPGI-C), and / or Euro QoL 5 dimensions 5 levels questionnaire (EQ-5D-5L). Before administration of a full dose of the RNAi agent, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels or anti-drug antibodies. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the RNAi agents and methods featured in the invention, suitable methods and materials are described below. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. EXAMPLES Table 1. Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 3’->5’-phosphodiester bonds, and it is understood that when the nucleotide contains a 2’-fluoro modification, then the fluoro replaces the hydroxy at that position of the parent nucleotide (i.e., it is a 2’-deoxy-2’-fluoronucleotide). It is understood that the following abbreviations omit the “3-phosphate” when located at the 3’-terminal position of an oligonucleotide (i.e., the 3’-terminal position is a 3’-OH). Abbreviation Nucleotide(s) ’Page 40 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Abbreviation Nucleotide(s) C cytidine-3’-phosphate Cf 2’-fluorocytidine-3’-phosphatePage 41 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Abbreviation Nucleotide(s) (Chd) 2'-O-hexadecyl-cytidine-3'-phosphate 2-SEQ ID SEQ ID Strand Oligonucleotide Sequence NO: Unmodified Sequence NO:Table 3. List of Abbreviations and Definitions of Terms Abbreviation DefinitionPage 42 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Abbreviation Definition AST Aspartate aminotransferase rPage 43 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Abbreviation Definition INR International normalized ratioPage 44 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Abbreviation Definition SRC Safety Review Committee;Example 1. A Phase 1, Randomized, Double-blind, Placebo-controlled Study of the Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of Single Dose ALN-6400 in Adult Healthy Volunteers: Clinical Trial Protocols A. Study Rationale The proposed Study ALN-6400-001 is a first-in-human, randomized, double-blind, placebo-controlled, Phase 1 single ascending dose (SAD) study designed to evaluate the safety, tolerability, pharmacokinetics (PK), and pharmacodynamics (PD) of ALN-6400, administered subcutaneously (SC), in healthy adult male and female volunteers. The primary objective of the study is to evaluate the safety and tolerability of single ascending doses of ALN-6400 in healthy adult volunteers. Secondary objectives of the study include the characterization of plasma and urine PK for ALN-6400 and the evaluation of the PD effects of ALN-6400 on plasma PLG protein and activity levels. Exploratory objectives of the study are to characterize additional PD effects of ALN-6400, including a comparison to tranexamic acid (TXA) where applicable, and to characterize ALN-6400 effects on menstrual blood loss in the female participants. TXA is a globally approved antifibrinolytic drug that inhibits the PLG pathway and is used as a benchmark for assessing ALN-6400 effects on blood clotting. Table 4 is a summary of the study objectives and endpoints. Page 45 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Table 4. Study Objectives and Endpoints: Single-ascending Dose (SAD) in Healthy Volunteers Objectives Endpoints Primary ) 0 y s turine; PD=pharamacodyen namic(s); PK=pharmacokinetic(s); PLG=plasminogen; ROTEM=rotational thromboelastometry; t =time to maximum plasma concentration; tPA=tissue plasminogen activator; TXA=tranexamic acid.maxPage 46 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) B. Summary of Study Design Study Design This is a first-in-human, randomized, double-blind, placebo-controlled, Phase 1 study to evaluate the safety, tolerability, pharmacokinetics (PK), and pharmacodynamics (PD) of single ascending doses of ALN-6400 administered subcutaneously (SC) in healthy adult male and female volunteers. Prior to dosing with study drug (ALN-6400 or placebo), a tranexamic acid (TXA) Benchmark Run-in and Washout Period is included to allow for an intra-volunteer comparison of the antifibrinolytic effect of ALN-6400 relative to TXA. The TXA Benchmark Run-in and Washout Period will be included for Cohorts 1 through 4, but not for the optional cohorts. Four planned single ascending dose (SAD) cohorts, with 8 healthy volunteers per cohort, will evaluate single doses of study drug (Error! Reference source not found.). If needed to further characterize the safety, tolerability, and / or PD of the study drug, a cohort size may increase from 8 volunteers to 12 volunteers. Two optional SAD cohorts, with 8 healthy volunteers per cohort, may be added to better understand the safety, tolerability, PK, and PD of a single dose of ALN-6400; if additional data are needed on a dose that is the same or lower than a dose already evaluated, the 1 or 2 additional cohorts may be enrolled concurrently with the 4 planned cohorts. In addition, 2 optional cohorts of Japanese healthy volunteers may be added, with 8 participants per cohort. Participants in each cohort will be randomized 3:1 to receive a single dose of ALN-6400 or placebo. A decision to increase the size of an existing cohort from 8 healthy volunteers to 12 healthy volunteers may also be made by the SRC to further characterize the safety, tolerability, and / or PD of the study drug; the additional 4 participants will be randomized 3:1 to receive a single dose of ALN-6400 or placebo, respectively. Number of Planned Patients The planned enrollment for this study is up to 48 healthy volunteers for the planned cohorts (Cohorts 1-4) and up to 96 healthy volunteers including both planned and optional cohorts. Diagnosis and Main Eligibility Criteria This study will include healthy adult volunteers. Study Drug, Dose, and Mode of Administration ALN-6400 is an SC administered N-acetylgalactosamine (GalNAc)-conjugated small interfering RNA (siRNA) targeting liver-expressed messenger RNA (mRNA) for plasminogen (PLG). Page 47 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Placebo (sodium chloride 0.9% w / v for SC administration) will be administered at the same dosing interval and volume as ALN-6400. Study drug will be administered as a single subcutaneous (SC) dose. Additional Medication, Dose, and Mode of Administration Prior to the double-blind, placebo-controlled part of the study, all healthy volunteers in Cohorts 1 through 4 will receive open-label TXA in a TXA Benchmark Run-in and Washout Period, to provide a point of reference for the antifibrinolytic effects of ALN-6400 (for individual participants and for the study population as a whole). During the TXA Benchmark Run-in, healthy volunteers will receive oral TXA on Days -6 and -5 at a standard dose used to treat conditions of increased local fibrinolysis when the diagnosis is indicative of hyperfibrinolysis, as with epistaxis and menorrhagia (i.e., 3000 mg daily [1000 mg every 8 hours ). A total of 5 doses of TXA will be administered because steady state is reached after 5 doses. For operational reasons, healthy volunteers may start and complete the TXA Benchmark Run-In and Washout Period before Day -6 so long as the hourly dosing and blood sample schedule is maintained; thus, the TXA Washout will be at least 4 days and will be complete by Day -1. Duration of Treatment and Study Participation A single SC dose of study drug (ALN-6400 or placebo) will be administered. The estimated duration of study participation, inclusive of screening, TXA Benchmark Run-in and Washout Period (as applicable), Treatment Period, and potential safety / PD follow-up, is up to 41 weeks. Statistical Methods The planned enrollment for this study is up to 48 healthy volunteers for the planned cohorts (Cohorts 1-4) and up to 96 healthy volunteers including both planned and optional cohorts. The populations (analysis sets) are defined as follows: Safety Analysis Set: All healthy volunteers who received any amount of study drug. All by-treatment analyses based on the Safety Analysis Set will be grouped according to the treatment actually received. ALN-6400 PK Analysis Set: All healthy volunteers who received at least 1 full dose of ALN-6400 and have at least 1 evaluable post-dose ALN-6400 PK assessment. TXA PK Analysis Set: All healthy volunteers who received at least 1 full dose of TXA and have at least 1 evaluable post-dose TXA PK assessment. PD Analysis Set: All healthy volunteers who received at least 1 full dose of study drug. All by-treatment analyses based on the PD Analysis Set will be grouped according to the treatment actually received. Page 48 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Full Analysis Set (FAS): All randomized healthy volunteers who received any amount of study drug. All by-treatment analyses based on the FAS will be grouped according to the randomized treatment arm. Safety will be analyzed using the Safety Analysis Set. The PK and PD Analysis Sets will be used to conduct PK and PD analyses, respectively. Menstrual blood loss parameters will be analyzed using the FAS. C. Scientific Rationale for Study Design This is a first-in-human, randomized, double-blind, placebo-controlled, Phase 1 study designed to evaluate the safety, tolerability, PK, and PD of ALN-6400 in healthy volunteers. The primary objective is to evaluate the safety and tolerability of single ascending doses of ALN-6400 through evaluating AEs, vital signs, ECGs, and clinical laboratory assessments. The study is being conducted in healthy volunteers, as reduction in PLG with ALN-6400 is assessed to have an acceptable risk profile: 1) nonclinical toxicology data show no ligneous lesion formation or evidence of thrombosis with PLG protein reduction of 66% to 97%; 2) extensive experience with TXA suggests that impacting the PLG pathway in the manner proposed does not confer a significant risk of ligneous lesion development or thrombosis development; 3) internal analyses using a range of other data sources (e.g., UK Biobank, human PLG deficiency phenotype) suggest that reducing PLG will not significantly increase thrombosis risk. Prior to the double-blind, placebo-controlled part of the study, for Cohorts 1 through 4, there will be a TXA Benchmark Run-in and Washout Period, to provide a point of reference for the antifibrinolytic effects of ALN-6400 for individual participants and for the study population as a whole. During the TXA Benchmark Run-in, healthy volunteers will receive oral TXA on Days -6 and -5 at a standard dose used to treat conditions of increased local fibrinolysis when the diagnosis is indicative of hyperfibrinolysis, as with epistaxis and menorrhagia (i.e., 3000 mg daily [1000 mg every 8 hours]). A total of 5 doses of TXA will be administered because steady state is reached after 5 doses. Based on the half-life of oral TXA (~11 hours) and projections of the PK / PD time course of 1000 mg TXA every 8 hours, the antifibrinolytic effects are expected to wear off within 55^hours;(Groene, et al., J Thromb Thrombolysis. 2021 May;51(4):989-96) therefore, the 4-day period between the last TXA dose and ALN-6400 dosing is considered sufficient for TXA washout. Time points for PK and PD sampling during the TXA Benchmark Run- in and Washout Period were selected so that data are collected at maximum and minimum plasma concentrations. Page 49 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) The antifibrinolytic activity of TXA will be assessed at various time points using a number of specialized blood-based assays. Because antifibrinolytic activity will also be assessed after the volunteers receive study drug, an intra-volunteer comparison of the effect of ALN-6400 relative to TXA on antifibrinolytic activity will be possible. In this study, oral TXA treatment is used as a benchmark for assessing the impact of ALN- 6400 on ROTEM. ROTEM devices will be used to allow an in vitro assessment of blood clotting (as viscoelastic changes over time). Specifically, a modified version of ROTEM is used, in which tPA is used to accelerate clot breakdown (fibrinolysis), allowing the study of the inhibitory effects on fibrinolysis. Use of TXA as a benchmark in this study could allow for refining therapeutic dose selection for ALN-6400, as the SRC will be able to use intra-individual ROTEM data to help guide dose escalation decisions between cohorts. For example, if PLG protein / activity reduction with ALN-6400 as observed via ROTEM is similar to, or greater than, the TXA effect at steady state, then ALN-6400 dose escalation may be more conservative, or the SRC may decide not to dose escalate further. Since PLG deficiency can result in ligneous lesions and since there is a theoretical risk of thrombosis with reducing PLG too much, knowing how a given PLG reduction compares to TXA per ROTEM effects is expected to help minimize overexposure of healthy volunteers to ALN-6400. D. Definition of End of Study for an Individual Participant The end of the study for a participant is defined as the participant’s last visit in the study. A participant is considered to have completed the study if: The participant randomized to placebo has completed the Week 12 (end-of-treatment; EOT) visit, or The participant randomized to ALN-6400 has completed the safety / PD follow‑up visit(s). E. Selection and Removal of Participants i. Inclusion Criteria Healthy volunteers are eligible to be included in the study if all the following criteria apply: Age and Sex 1. Age 18 to 65 years, inclusive, at the time of initial informed consent. Japanese Healthy Volunteers in the Optional Japanese Cohort 2. Japanese healthy volunteers must report that their biological parents and grandparents are of Japanese origin. Page 50 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Informed Consent 3. Healthy volunteer is able to understand and is willing and able to comply with the study requirements and to provide written informed consent. ii. Exclusion Criteria Healthy volunteers are excluded from the study if any of the following criteria apply: Laboratory Assessments 1. Has any of the following laboratory parameter assessments at screening: a. Alanine aminotransferase (ALT) or aspartate aminotransferase (AST) > upper limit of normal (ULN). b. Total bilirubin >ULN. Healthy volunteers with elevated total bilirubin that is secondary to documented Gilbert’s syndrome are eligible if the total bilirubin is <2×ULN. c. International normalized ratio (INR) outside the normal reference range. d. Activated partial thromboplastin time (aPTT) outside the normal reference range. e. D-dimer outside the normal reference range. f. Platelet count outside the normal reference range. 2. Has known human immunodeficiency virus infection; or known current or chronic hepatitis C virus or hepatitis B virus infection. 3. Has systolic blood pressure >140 mm Hg and / or diastolic blood pressure >90 mmHg after 10 minutes of rest at screening. 4. Has an estimated glomerular filtration (eGFR) of <90 mL / min / 1.73m2at screening (calculation will be based on the Chronic Kidney Disease Epidemiology Collaboration [CKD-EPI] creatinine equation

[2021] ). Prior / Concomitant Therapy 5. Taking antifibrinolytics (including TXA and ε-aminocaproic acid [EACA]) within 4 days prior to screening or planned use during the study, outside of the study procedures. 6. Taking aspirin within 14 days prior to screening, use during the screening period, and / or planned use within 14 days prior to a study visit. 7. Taking nonsteroidal anti-inflammatory drugs (NSAIDs) within 7 days prior to screening and / or planned use within 7 days prior to a study visit. 8. Taking P2Y12 inhibitors within 14 days prior to screening or planned use during the study. 9. Taking the following medications within 14 days prior to screening or planned use during the study: dipyridamole, treprostinil, vorapaxar, and / or cilostazol. Page 51 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 10. Taking an anticoagulant (e.g., warfarin, apixaban, rivaroxaban) at screening and / or planned use during the study. 11. Taking hormonal contraceptives or hormone replacement therapy within 3 months prior to screening or planned use during the study. 12. Received an investigational agent within the last 30 days or 5 half-lives, whichever is longer, prior to the first dose of study drug, or are in follow-up of another clinical study prior to study enrollment. Any agent that has received health agency authorization (including for emergency use) by local or regional regulatory authorities is not considered investigational. 13. Currently taking, taken within 6 months prior to randomization, or anticipated to receive an RNAi therapeutic or antisense oligonucleotide (approved or investigational) other than ALN-6400. Medical Conditions 14. Has medical conditions or comorbidities which, in the opinion of the Investigator, would interfere with study compliance or data interpretation; or, in the opinion of the Investigator, taking part in the study would jeopardize the safety of the healthy volunteer. 15. Current smoker. 16. Has PLG deficiency (as determined by activity levels lower than the reference range) at screening. 17. Has known thrombophilia. 18. Has known bleeding disorder. 19. History of a chronic inflammatory disease (e.g., systemic lupus erythematosus, inflammatory bowel disease, rheumatoid arthritis). 20. Presence of ligneous lesion(s) on physical examination; or a lesion that, in the opinion of the Investigator, might be confused with a ligneous lesion. 21. History of asthma that has required corticosteroid treatment at or after 18 years of age. 22. Has undergone liver transplantation or is anticipated to be on an active liver transplantation waiting list during the study treatment period. 23. Has any contraindication to the use of oral TXA or has any other reason that TXA should not be administered, in the opinion of the investigator, including any of the following: − History or risk of thrombosis − Acquired disturbances of color vision Page 52 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) − Active thromboembolic disease, such as deep vein thrombosis, pulmonary embolism, and cerebral thrombosis − Subarachnoid hemorrhage − Hematuria − Hypersensitivity to TXA or to any ingredient in the TXA formulation − Inability to swallow oral TXA tablets 24. History of multiple drug allergies or history of allergic reaction to any component of or excipient in the study drug. 25. History of intolerance to SC injection(s). Contraception, Pregnancy, and Breastfeeding 26. Is not willing to comply with the contraceptive requirements during the study period. 27. Female participant is pregnant, planning a pregnancy, or breast-feeding. Alcohol and Substance Use 28. Unwilling or unable to limit alcohol consumption throughout the course of the study. Alcohol intake of >2 units / day is excluded during the study (unit: 1 glass of wine [approximately 125 mL] = 1 measure of spirits [approximately 1 fluid ounce] = ½ pint of beer [approximately 284 mL]). 29. History of alcohol use disorder, within the last 12 months before screening, in the opinion of the Investigator. 30. History of substance use disorder that in the opinion of the Investigator would interfere with compliance with study procedures or follow-up visits. Other 31. Blood or plasma donation more than 500 mL within 56 days and / or more than 50 mL within 30 days prior to the start of screening. 32. Patient is not randomized to a cohort because the cohort is closed and there are no other options for the patient to be randomized in the study. F. Treatments and Other Requirements i. Study Drug ALN-6400 is a synthetic small interfering RNA (siRNA) (drug substance ALN-6400 sodium) covalently linked to a triantennary N-acetylgalactosamine (GalNAc) ligand. The sequences of ALN-6400 are shown in Table 2. ALN-6400 will be supplied as a sterile solution in water for SC injection. Page 53 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) The control drug for this study will be a placebo (sodium chloride 0.9% w / v). ii. Dose and Administration Healthy volunteers will be administered a single dose of ALN-6400 or placebo, at the same volume. Healthy volunteers will be administered study drug by SC injection. Study drug injection will be administered by qualified clinical study center staff under the supervision of the Investigator or designee. The injection site may be marked and mapped for later observation. Injections may be administered in the abdomen, thigh, or the side or back of the upper arms. Detailed instructions for study drug administration are found in the Pharmacy Manual. iii. Criteria for Study Drug Dosing and Progression / Escalation The starting dose of ALN-6400 for healthy volunteers in Cohort 1 will be 10 mg. Based on nonclinical pharmacology studies, this starting dose is expected to be safe, well tolerated, and to have a modest effect on plasma PLG protein and activity levels (Table ). The planned dose levels and predicted % median maximum reduction of PLG protein and activity are provided in Table . Table 5: Planned Dose Levels and Predicted % Median Maximum Reduction in PLG Protein and Activity Cohort Planned Dose Predicted % Median Maximum R d ti i PLG (P t i d A ti it )aTwo optional cohorts may be added to better understand the safety, tolerability, PK, and PD of single-dose administration of ALN-6400; if additional data are needed on a dose that is the same or lower than a dose already evaluated, the 1 or 2 optional cohorts may be enrolled concurrently with the 4 planned cohorts. For all cohorts, the exact doses to be administered may be modified (higher or lower) from planned doses based on emerging safety, PK, and PD data from preceding cohorts. Dose progression / escalation will proceed accordingly such that optional dose levels may be explored and can be adjusted in line with evolving safety, tolerability, and available PD data. However, dose progressions will not exceed 3-fold increments from the previous dose, will not exceed the Page 54 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) planned maximum dose of 300 mg, and will adhere to the progression / escalation criteria and suspension / stopping rules, including AE-based stopping rules and stopping rules based on plasma PLG activity levels. The dose to be administered to Japanese healthy volunteers (optional Japanese Cohorts 1 and 2) will be at or below a dose that was evaluated in a SAD cohort and determined to be safe and tolerable by the SRC. G. Study Assessments All assessments, except for post-dose PK sample collection, are to be performed prior to study drug dosing on Day 1. i. Pharmacodynamic Assessments Blood samples will be collected for the assessment of plasma PLG protein and activity levels; whole blood clot fibrinolysis by tPA-ROTEM; plasma clot fibrinolysis; plasma plasmin and thrombin generation; plasma D-dimer; and additional ROTEM parameters from the tPA-ROTEM whole blood analysis. For the TXA Benchmark Run-in and Washout Period, blood samples will be collected. On Day 1, blood samples will be collected before study drug administration. These measurements will be analyzed centrally. ii. Pharmacokinetic Assessments a. TXA Pharmacokinetic Assessments The concentration of TXA in blood samples will be determined using a validated assay. b. Study Drug Blood and urine samples will be collected for the assessment of ALN-6400 PK parameters and potential metabolite analysis. The concentration of ALN-6400 in plasma and urine will be determined using a validated assay. Example 2. A Phase 2, Randomized, Double-blind, Placebo-controlled Study of the Safety, Tolerability, Efficacy, Pharmacokinetics, and Pharmacodynamics of Multiple Dose ALN- 6400 in Adult Patients with Hereditary Hemorrhagic Telangiectasia (HHT) A. Study Rationale The proposed Study is a first-in-human, randomized, double-blind, placebo-controlled, Phase 2 multiple-ascending dose (MAD) study in adult patients with HHT designed to evaluate Page 55 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) the safety, tolerability, efficacy, pharmacokinetics (PK), and pharmacodynamics (PD) of ALN-6400, administered subcutaneously (SC), in adult male and female patients with HHT. The primary objective is to evaluate the safety and tolerability of multiple-ascending doses of ALN-6400 in adult patients with HHT. Secondary objectives of are to characterize the PD effects of multiple doses of ALN-6400 on plasma PLG protein and activity levels and to evaluate the efficacy of ALN-6400, including effects on epistaxis, hematologic parameters, menstrual bleeding, and quality of life. Exploratory objectives include characterization of multiple-dose plasma PK of ALN‑6400 and characterization of additional PD effects of multiple doses of ALN- 6400 on plasma fibrinolysis. Table 6. Study Objectives and Endpoints: Multiple-ascending Dose (MAD) in Patients with HHT Objectives Endpoints PrimarPage 56 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Objectives Endpoints o RBC transfusions5D- 5L=EuroQoL 5 Dimensions 5 Levels questionnaire; ESS=epistaxis severity score; HHT- QoL=hereditary hemorrhagic telangiectasia-specific quality-of-life; HSS=hematologic support score; MAD=multiple-ascending dose; MBQ=Menstrual Bleeding Questionnaire; mPGI- C=modified Patient Global Impression of Change; mPGI-S=modified Patient Global Impression of Severity; NOSE HHT=Nasal Outcome Score for Epistaxis in Hereditary Hemorrhagic Telangiectasia; PD=pharmacodynamic(s); PGI-C=Patient Global Impression of Change; PK=pharmacokinetic(s); PLG=plasminogen; PRO=patient-reported outcomes; QoL=quality of laife; RBC=red blood cell.bWith a 1-month reference interval. Epistaxis duration (including intensity-adjusted duration), frequency, intensity, and epistaxis-free days will be assessed via the daily patient epistaxis diary. Page 57 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) B. Summary of Study Design Study Design This is a first-in-human, randomized, double-blind, placebo-controlled, Phase 2 study to evaluate the safety, tolerability, efficacy, PK, and PD of multiple-ascending doses (2 doses) of ALN- 6400 administered SC in male and female patients with HHT. Patients in 2 MAD cohorts (18 patients in Cohort 1; 30 patients in Cohort 2) will be randomized 2:1 to receive 2 doses of study drug (ALN-64SEQ 00 or placebo) once every 3 months (q3M) during the Double-blind (DB) Treatment Period and will receive 4 doses of open-label ALN-6400 q3M during the Open-label Extension (OLE) Period (Error! Reference source not found.). The total planned enrollment of the study is approximately 48 patients with HHT. The following periods are included, as shown in FIG.2: Up to 4-week Screening Period 4-week Observation Period 24-week DB Treatment Period 48-week OLE Period Safety / PD follow-up visits at Week 84; and at Week 96 for those with PLG activity ≤50% at the Week 84 visit. Eligibility will be determined during the up to 4-week Screening Period (Days -57 and -30). Prior to dosing with study drug (ALN-6400 or placebo), eligible patients will begin the 4-week Observation Period, which is included for establishment of baseline data (e.g., epistaxis for the month prior to Day 1 using the epistaxis severity score (ESS) and the daily patient epistaxis diary; menstrual bleeding via the MBQ). Patients will receive no elective treatments for HHT bleeding during this period; treatments for other aspects of HHT (e.g., embolization for a pulmonary AVM) will not be prohibited. The Observation Period will begin when all assessments required for screening are complete and the patient’s eligibility is established and lasts for 29 days (up to 5 additional days, if needed for flexibility in scheduling the Day 1 visit). During the 24-week DB Treatment Period, 2 planned cohorts (18 patients in Cohort 1; 30 patients in Cohort 2), will receive 2 doses of SC study drug (ALN-6400 or placebo) q3M. On Day 1, eligible patients will be randomized (2:1) to treatment with ALN-6400 or placebo; the second dose of randomized study drug will be at Week 12. The ALN-6400 dose levels to be evaluated will be safe and tolerable, as determined by the SRC. The doses selected for each cohort will not be higher than any dose level determined to be safe and tolerable during the phase 1 study in Example 1 at the time when the given MAD dose cohort starts to enroll the eligible HHT patients. Page 58 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) During the DB Treatment Period, patients will return to the clinical study site for assessments (safety, tolerability, PD, efficacy, and PK) at Weeks 2 and 4, and then every 4 weeks through Week 24. Patients who do not discontinue from study drug dosing in the DB Treatment Period and complete the Week 24 visit will enter the OLE Period. At the Week 24 visit, after completion of the DB end-of-treatment (EOT) visit assessments, patients will enter the OLE Period and receive their first dose of open-label ALN-6400; thereafter, patients will receive open-label ALN-6400 q3M, at Weeks 36, 48, and 60. Patients will receive open- label ALN-6400 at the same dose level used in their DB cohort until the primary analysis for the DB Treatment Period is complete; thereafter, the SRC may recommend a change in the OLE dose based on the primary analysis safety and efficacy results, not to exceed a dose level determined to be safe and tolerable during the study. During the OLE Period, assessments (safety, tolerability, PD, and efficacy) will be completed every 4 weeks from Week 24 through Week 36, and then every 6 weeks through the final visit in the OLE Period at Week 72; assessments may be conducted locally at Weeks 2, 42, 54, and 66. All patients will have a safety / PD follow-up visit at Week 84; patients with PLG activity ≤50% at the Week 84 visit will have an additional safety / PD follow-up visit at Week 96. Each cohort will be unblinded when all patients in an individual cohort have completed the Week 48 visit or have stopped participation in the study. The estimated duration of participation in Part B, inclusive of screening, Observation Period, DB Treatment Period, OLE Period, and safety / PD follow-up, is up to 104 weeks. Number of Planned Patients The planned enrollment for this study is approximately 48 patients with HHT. Diagnosis and Main Eligibility Criteria This study will include adult patients with a clinical diagnosis of HHT. Study Drug, Dose, and Mode of Administration ALN-6400 is an SC administered N-acetylgalactosamine (GalNAc)-conjugated small interfering RNA (siRNA) targeting liver-expressed messenger RNA (mRNA) for plasminogen (PLG). Placebo (phosphate-buffered saline) for SC administration will be administered at the same dosing interval and volume as ALN-6400. Concomitant Medications and Procedures If a patient experiences an episode or episodes of epistaxis requiring rescue treatment during the study, alternatives to prohibited medications are shown below (Al-Samkari, Blood. 2024 Aug 29;144(9):940-54; Faughnan, et al., Ann Intern Med.2020 Dec 15;173(12):989-1001; and Sautter, et Page 59 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) al., Otolaryngol Clin North Am. 2016 Jun;49(3):639-54). All epistaxis rescue treatments will be captured as concomitant medications and procedures. The Investigator will remain ultimately responsible for selecting the most appropriate treatment based on the severity and frequency of epistaxis, as well as individual patient factors. First-line treatments: Firm, sustained compression to the nose for ≥5 minutes Moisturizing topical therapies to humidify the nasal mucosa (e.g., saline spray, petroleum jelly) Avoidance of epistaxis triggers Second-line treatments: Nasal packing (self-packing or by a medical professional) Topical estriol therapy Topical TXA Other topical medications, eg, timolol, oxymetazoline Oral TXA or EACA (≤1500 mg, strictly limited to a single dose of either medication within any given 5-day period) Third-line treatments: Ablative therapies for nasal telangiectasias Laser treatment Radiofrequency Electrotherapy Sclerotherapy Embolization Duration of Treatment and Study Participation Two doses of study drug (ALN-6400 or placebo) will be administered during the DB Treatment Period and 4 doses of open-label ALN-6400 q3M will be administered during the OLE Period. The estimated duration of participation, inclusive of screening, Observation Period, DB Treatment Period, OLE Period, and safety / PD follow-up, is up to 104 weeks. Statistical Methods The planned sample size is 18 patients in Cohort 1 and 30 patients in Cohort 2, for a total of approximately 48 patients. The populations (analysis sets) are defined as follows: Page 60 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Safety Analysis Set: All participants who received any amount of study drug. All by-treatment analyses based on the Safety Analysis Set will be grouped according to the treatment actually received. ALN-6400 PK Analysis Set: All participants who received at least 1 full dose of ALN-6400 and have at least 1 evaluable post-dose ALN-6400 PK assessment. PD Analysis Set: All participants who received at least 1 full dose of study drug. All by- treatment analyses based on the PD Analysis Set will be grouped according to the treatment actually received. Full Analysis Set (FAS): All randomized participants who received any amount of study drug. All by-treatment analyses based on the FAS will be grouped according to the randomized treatment arm. Safety will be analyzed using the Safety Analysis Set. The PK and PD Analysis Sets will be used to conduct PK and PD analyses, respectively. Menstrual blood loss parameters and all efficacy parameters will be analyzed using the FAS. C. Scientific Rationale for Study Design This study is being conducted in patients with HHT. The primary objective for the study is to evaluate the safety and tolerability of multiple-ascending doses of ALN-6400 in patients with HHT through evaluating AEs, vital signs, ECGs, and clinical laboratory assessments. Additionally, inclusion of patients with HHT, administered 2 doses q3M, allows for establishment of the dose-PD response relationship for ALN-6400. A 24-week DB Treatment Period is used to provide adequate time to potentially demonstrate efficacy and a positive benefit-risk, while minimizing time on placebo. Following the DB part of the study, all patients will receive open-label ALN-6400 to provide additional data on safety, tolerability, efficacy, and PD; and to allow placebo-treated patients to have possible benefit from active treatment. D. Definition of End of Study for an Individual Participant The end of the study for a participant is defined as the participant’s last visit in the study. A participant is considered to have completed the study if: The participant has completed the DB Treatment Period if the participant has completed at least the DB EOT visit at Week 24. The participant has completed the OLE Period if the participant has completed at least the OLE EOT visit at Week 72 and the safety / PD follow‑up visit(s). Page 61 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) E. Selection and Removal of Participants i. Inclusion Criteria Participants are eligible to be included in the study if all the following criteria apply: Age and Sex 1. Age ≥18 years, at the time of initial informed consent. Patient and Disease Characteristics 2. Clinical diagnosis of HHT, either per criterion 2a or 2b: a. Definite diagnosis of HHT as per Curaçao criteria (Shovlin, et al., Am J Med Genet.2000 Mar 6;91(1):66-7), i.e., at least 3 of the 4 criteria: • Recurrent and spontaneous epistaxis. • Multiple telangiectasias on the skin of the hands, lips, face, or inside of the nose or mouth. • Arteriovenous malformations (AVMs) or telangiectasias in 1 or more internal organs, including the lungs, brain, liver, intestines, stomach, and spinal cord. • Family history of HHT (i.e., first-degree relative [brother, sister, parent, or child] meeting these same criteria for “definite HHT”). b. Genetic confirmation of HHT (with recurrent and spontaneous epistaxis) 3. Epistaxis severity score (ESS) ≥4 (i.e., moderate or severe) measured at screening to assess symptoms and bleeding over the prior 4 weeks. 4. Iron deficiency anemia (i.e., hemoglobin <12.0 g / dL in women and <13.0 g / dL in men) at screening; and / or treatment with ≥250 mg of intravenous iron and / or ≥1 red blood cell (RBC) transfusion within 24 weeks of screening. 5. Patient agrees not to undergo procedural or surgical management of nasal telangiectasias / epistaxis (except for emergent situations in which it is required) and agrees not to start new therapies for bleeding in HHT during the DB Treatment Period; during the OLE Period, such treatments and therapies are discouraged but not prohibited. Routine nasal packing is not considered procedural management of epistaxis. Informed Consent 6. Patient is able to understand and is willing and able to comply with the study requirements, including completing the daily patient epistaxis diary (including ≥1 week during screening) and to provide written informed consent. ii. Exclusion Criteria Patients are excluded from the study if any of the following criteria apply: Page 62 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) Laboratory Assessments 1. Has any of the following laboratory parameter assessments at screening: a. ALT or AST >2×ULN. b. Total bilirubin >1.5×ULN. Patients with elevated total bilirubin that is secondary to documented Gilbert’s syndrome are eligible if the total bilirubin is <2×ULN. c. INR >2.0. 2. Has eGFR of <30 mL / min / 1.73m2at screening (calculation based on the CKD-EPI creatinine equation

[2021] ; refer to Section Error! Reference source not found.). 3. Hemoglobin <6 g / dL at screening. Prior / Concomitant Therapy 4. Received an investigational agent within the last 30 days or 5 half-lives, whichever is longer, prior to the first day of the Observation Period, or are in follow-up of another clinical study prior to study enrollment. Any agent that has received health agency authorization (including for emergency use) by local or regional regulatory authorities is not considered investigational. 5. Currently taking, taken within 24 weeks prior to screening, or anticipated to receive an RNAi therapeutic or antisense oligonucleotide (approved or investigational) other than ALN-6400. 6. Taking combined oral contraceptives or systemic estrogen-containing hormone replacement therapy within 4 weeks of screening or planned use during the study. 7. Systemic use of an antiangiogenic agent (eg, bevacizumab, pazopanib, thalidomide, pomalidomide, lenalidomide, AKT inhibitor drugs, or receptor tyrosine kinase inhibitor drugs) within 6 weeks of screening or during screening. 8. Use of a somatostatin analog (eg, octreotide, lanreotide) within 4 weeks of screening or during screening. 9. Taking an anticoagulant (eg, warfarin, apixaban, rivaroxaban, dabigatran) during screening and / or planned use during the study. 10. Unable or unwilling to abstain from systemic HHT medications (eg, antiangiogenic agents or antifibrinolytic agents, including TXA and aminocaproic acid) during the Observation and DB Treatment Periods, except where allowed as an epistaxis rescue treatment. Medical Conditions 11. Has medical conditions or comorbidities which, in the opinion of the Investigator, would interfere with study compliance or data interpretation; or, in the opinion of the Investigator, taking part in the study would jeopardize the safety of the patient. 12. Has undergone liver transplantation or is anticipated to be on an active liver transplantation waiting list during the study treatment period. 13. Has uncontrolled hypertension in the opinion of the Investigator at screening. 14. Has known hereditary thrombophilia or antiphospholipid antibody syndrome. Page 63 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 15. History of prior unprovoked thromboembolism confirmed by venous ultrasound or other imaging modalities; or acute thrombosis within 3 months of screening. 16. Presence of ligneous lesion(s) on physical examination; or a lesion that, in the opinion of the Investigator, might be confused with a ligneous lesion. 17. Planned major surgery during the study (Observation and DB Treatment Periods). 18. History of multiple drug allergies or history of allergic reaction to any component of or excipient in the study drug. 19. History of intolerance to SC injection(s). Contraception, Pregnancy, and Breastfeeding 20. Is not willing to comply with the contraceptive requirements during the study period. 21. Female participant is pregnant, planning a pregnancy, or breast-feeding. Alcohol and Substance Use 22. Unwilling or unable to limit alcohol consumption throughout the course of the study. Alcohol intake of >2 units / day is excluded during the study (unit: 1 glass of wine [approximately 125 mL] = 1 measure of spirits [approximately 1 fluid ounce] = ½ pint of beer [approximately 284 mL]). 23. History of alcohol use disorder, within the last 12 months before screening, in the opinion of the Investigator. 24. History of substance use disorder that in the opinion of the Investigator would interfere with compliance with study procedures or follow-up visits. F. Treatments and Other Requirements i. Study Drug ALN-6400 is a synthetic small interfering RNA (siRNA) (drug substance ALN-6400 sodium) covalently linked to a triantennary N-acetylgalactosamine (GalNAc) ligand. The sequences of ALN- 6400 are shown in Table 2. ALN-6400 will be supplied as a sterile solution in water for SC injection. The control drug for this study will be a placebo (phosphate-buffered saline) for SC administration. ii. Dose and Administration Patients with HHT will be administered 2 doses q3M of study drug (ALN-6400 or placebo, at the same volume) during the DB Treatment Period at Day 1 and at Week 12. In the OLE Period, patients will be administered 4 doses q3M of open-label ALN-6400 at Week 24 (after completion of the DB EOT assessments), and Weeks 36, 48, 60. In the OLE Period, patients will receive open-label ALN-6400 at the same dose level used in their DB cohort until the primary analysis for the DB Treatment Period is complete; thereafter, the SRC may recommend a change in the OLE dose based Page 64 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) on the primary analysis safety and efficacy results, not to exceed a dose level determined to be safe and tolerable during the study. Participants will be administered study drug by SC injection. Study drug injection will be administered by qualified clinical study center staff under the supervision of the Investigator or designee. The injection site may be marked and mapped for later observation. Injections may be administered in the abdomen, thigh, or the side or back of the upper arms. Detailed instructions for study drug administration are found in the Pharmacy Manual. iii. Criteria for Study Drug Dosing and Progression / Escalation Two dose levels will be evaluated in the 2 cohorts of patients with HHT. For each patient, 2 doses are planned to be administered q3M (at Day 1 and at Week 12) during the 24-week DB Treatment Period. The dose levels will be determined by the SRC upon review of safety, tolerability, and available PK and PD data from the phase 1 study in Example 1, and no dose selected for either cohort will exceed any dose level determined to be safe and tolerable during the phase 1 study in Example 1 at the time when the phase 2 dose cohort starts to enroll eligible HHT patients. Phase 2 may begin while Phase 1 is ongoing. Doses for the 2 cohorts will be based on preclinical data, emerging phase 1 PD (PLG activity and ROTEM data) and safety data, and PK-PD modeling. Results from phase 1 Cohort 1 (10-mg dose) and Cohort 2 (25-mg dose), will be included in the PK / PD modeling, which will be used for dose selection of the 2 MAD cohorts in phase 2. Phase 2 doses will not exceed the highest dose evaluated in Phase 1 for which safety and tolerability data are available and supportive, as determined by the SRC. Phase 2 doses will also be guided by clinical evidence with TXA. The phase 2 doses are intended to target median maximum reduction in PLG activity levels in the range of 60% to 80%, based on evidence with TXA. The 60 to 80% target PLG reduction was extrapolated from the plasmin generation reducing effects of therapeutically relevant TXA doses, which were then correlated with PLG reduction using human plasma diluted with PLG deficient plasma as follows (Miszta, et al., J Thromb Haemost.2021 Jan;19(1):221-32): • 40% PLG reduction (60% PLG remaining) has equivalent plasmin generation reducing effect to a TXA plasma level of ~1.5 μg / mL (expected from oral dose of 500 mg / day TXA at maximum concentration); • 60% PLG reduction (40% PLG remaining) has equivalent plasmin generation reducing effect to a TXA plasma level of ~16 μg / mL (expected of an oral dose of 3900 mg / day TXA at maximum concentration); Page 65 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) • 80% PLG reduction (20% PLG remaining) has equivalent plasmin generation reducing effect to a TXA plasma level of ~35 μg / mL (expected from IV doses up to 1000 mg). The use of TXA in healthy volunteers in phase 1 as a benchmark, at a dose used clinically in patients with HHT (3000 mg daily), is anticipated to allow refinement of ALN-6400 dose selection for phase 2, as it will enable intra-participant comparison of the antifibrinolytic effects (via ROTEM and Lysis Timer data) of ALN-6400 versus TXA; thus, the benchmarking in phase 1 provides an additional means for assessing the PD effects of ALN-6400 beyond the effects directly on PLG activity and protein. Thus, the use of ROTEM in the SAD part of the study (phase 1) to compare the effects of TXA and ALN-6400 on fibrinolysis will help to estimate when the ALN-6400 dose reaches similar or superior antifibrinolytic effects to the clinically relevant TXA dose (3000 mg daily), to guide further dose escalation, and to determine the phase 2 dose predicted to achieve the target 60% to 80% PLG reduction. In the OLE Period, patients will receive open-label ALN-6400 at the same dose level used in their DB cohort until the primary analysis for the DB Treatment Period is complete; thereafter, the SRC may recommend a change in the OLE dose based the primary analysis safety and efficacy results. G. Study Assessments All assessments, except for post-dose PK sample collection, are to be performed prior to study drug dosing on dosing visits. i. Pharmacodynamic Assessments Blood samples will be collected for the assessment of plasma PLG protein and activity levels and plasma fibrinolysis (Global Fibrinolytic Capacity – Lysis Time). Blood samples will be collected before study drug administration. These measurements will be analyzed centrally. ii. Efficacy Assessments a. Epistaxis Severity Score (ESS) The ESS, with a 1-month reference interval, will be assessed in patients with HHT. The 6-item, clinically validated, patient-reported ESS was established for use in HHT and assesses the frequency, duration, and intensity of epistaxis; the presence of anemia; whether the patient has sought medical attention and / or has received a RBC transfusion for epistaxis (curehht.org / resource / epistaxis-severity-score / ) (Hoag, et al., Laryngoscope. 2010 Apr;120(4):838- 43). The ESS was found to be a significant predictor of invasiveness of treatment, with patients with higher ESS having a much greater risk of needing surgical procedures for epistaxis (Hoag 2010). Page 66 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) In this study, the ESS questions refer to the prior month (1-month reference interval). Guidance on properly completing the ESS will be provided in a study manual. The responses to each of the 6 questions are assigned a score, which is multiplied by the question’s coefficient and used to determine the final ESS (Hoag, 2010). Scores range from 0 (no epistaxis) to 10 (most severe epistaxis); the thresholds for moderate and severe epistaxis are considered to be 4 and 7, respectively. b. Daily Patient Epistaxis Diary Patients will complete a daily patient epistaxis diary as described in Clark, et al. (Laryngoscope Investig Otolaryngol.2018 Dec;3(6):439-45). Patients will be provided with a diary to record details for epistaxis episodes during the day and night. For each nosebleed, patients will complete the diary, recording, for example, the epistaxis duration, worst level of intensity (e.g., from spotting to gushing), and whether medical care was sought (yes or no). c. Hematologic Parameters Hematologic parameters will be assessed in patients with HHT. The hematologic support score (HSS) is a quantitative tool designed to longitudinally assess the RBC and iron supplementation needs of patients with HHT and other chronic bleeding disorders (Al-Samkari, et al., Res Pract Thromb Haemost. 2020a Nov;4(8):1340-2). The tool converts RBC units transfused and iron infusions into a single value and creates a standardized comparator of hematologic support needs in a single patient or between patients, who may require a variable combination of RBC transfusion and iron infusions. Hemoglobin is assessed as a standard clinical laboratory assessment. Additionally, measures of iron stores will be assessed, i.e., iron, total iron binding capacity, iron saturation, ferritin, and C-reactive protein. d. MBQ For women having menstrual periods, information regarding participants’ menstrual bleeding will be collected via the validated Menstrual Bleeding Questionnaire (MBQ) (Matteson, et al., BJOG. 2015 Apr;122(5):681-9). The questionnaire includes questions about menstrual bleeding over the past month, including the heaviness of flow and length of time of bleeding. Decreased menstrual bleeding, including potential amenorrhea, is an expected and potentially beneficial PD effect based on the mechanism of action of ALN-6400 and will thus be recorded as an exploratory assessment in phase 1 and an efficacy assessment in phase 2, and will not be treated as AEs or SAEs. e. QoL and PRO Assessments Page 67 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) General and HHT-specific quality of life (QoL) and patient-reported outcomes (PRO) questionnaires will be used to evaluate quality of life in patients with HHT. f. NOSE HHT The Nasal Outcome Score for Epistaxis in HHT (NOSE HHT) is a 29-item patient-reported, clinically validated outcome measure, with total scores ranging continuously from 0 to 4 (Peterson, et al., JAMA Otolaryngol Head Neck Surg.2020 Nov 1;146(11):999-1005). The NOSE HHT provides a measure of physical, functional, and emotional consequences of HHT-associated epistaxis and was designed for evaluation of epistaxis in clinical trials. The 29 items are divided into 3 sections: physical problems (6 items), functional limitations (14 items), and emotional consequences (9 items). Each item is rated on a 5-point Likert scale, with higher scores indicating worse scores, with a reference interval of the prior 2 weeks. g. PGI The patient’s overall status and epistaxis experience will be assessed using the Patient Global Impression of Change (PGI-C) and modified versions of the PGI-C and the Patient Global Impression of Severity (PGI-S). For each scale, the patient will respond to a single question, providing their global impression of change in their overall status and epistaxis experience. h. HHT-QoL The HHT-specific quality-of-life (HHT-QoL) instrument is a 4-item questionnaire to evaluate the impact of HHT on productivity and social and personal interactions (Kasthuri, et al., Blood Adv. 2022 Jul 26;6(14):4301-9). The patient responds to questions on how frequently over the past 4 weeks: nose bleeds interrupted activities for work, school, or regularly scheduled commitments; nose bleeds interrupted activities with a partner, family or friends; nose bleeds led to the patient avoiding social activities due to worry about the nose bleeds; the patient had to miss work, school, or regularly scheduled commitments because of HHT-related problems other than nosebleeds. The scores range from 0 (never) to 4 (always). i. EQ-5D-5L The EuroQol 5 Dimensions 5 Levels questionnaire (EQ-5D-5L) index score is based on the response to questions evaluating 5 dimensions (mobility, self-care, usual activities, pain / discomfort, and anxiety / depression) (The EuroQol Group. EuroQol - a new facility for the measurement of health- related quality of life. Health Policy.1990;16:10). Each dimension scored is based on 5 possible levels, where level 1 reflects the best possible score for that dimension. As an example, the 5 levels for the dimension of self-care are: 1 = no Page 68 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) problems with washing or dressing self; 2 = slight problems; 3 = moderate problems; 4 = severe problems; 5 = unable. The EQ-5D index score is derived based on scores from all 5 dimensions; scores range from 0 (worst QoL) to 1 (best QoL). The EuroQol-Visual Analog Scale is a single question evaluating the patient’s own global impression of their overall health and is evaluated on a scale of 0 (worst possible health) to 100 (best possible health). iii. Pharmacokinetic Assessments a. Study Drug Blood samples will be collected for the assessment of ALN-6400 PK parameters and potential metabolite analysis. The concentration of ALN-6400 in plasma and urine will be determined using a validated assay. PLG Sequences SEQ ID NO:1 >NM_000301.5 Homo sapiens plasminogen (PLG), transcript variant 1, mRNA GTAAGTCAACAACATCCTGGGATTGGGACCCACTTTCTGGGCACTGCTGGCCAGTCCCAAAATGGAACATAAGGAAGTGGT TCTTCTACTTCTTTTATTTCTGAAATCAGGTCAAGGAGAGCCTCTGGATGACTATGTGAATACCCAGGGGGCTTCACTGTT CAGTGTCACTAAGAAGCAGCTGGGAGCAGGAAGTATAGAAGAATGTGCAGCAAAATGTGAGGAGGACGAAGAATTCACCTG CAGGGCATTCCAATATCACAGTAAAGAGCAACAATGTGTGATAATGGCTGAAAACAGGAAGTCCTCCATAATCATTAGGAT GAGAGATGTAGTTTTATTTGAAAAGAAAGTGTATCTCTCAGAGTGCAAGACTGGGAATGGAAAGAACTACAGAGGGACGAT GTCCAAAACAAAAAATGGCATCACCTGTCAAAAATGGAGTTCCACTTCTCCCCACAGACCTAGATTCTCACCTGCTACACA CCCCTCAGAGGGACTGGAGGAGAACTACTGCAGGAATCCAGACAACGATCCGCAGGGGCCCTGGTGCTATACTACTGATCC AGAAAAGAGATATGACTACTGCGACATTCTTGAGTGTGAAGAGGAATGTATGCATTGCAGTGGAGAAAACTATGACGGCAA AATTTCCAAGACCATGTCTGGACTGGAATGCCAGGCCTGGGACTCTCAGAGCCCACACGCTCATGGATACATTCCTTCCAA ATTTCCAAACAAGAACCTGAAGAAGAATTACTGTCGTAACCCCGATAGGGAGCTGCGGCCTTGGTGTTTCACCACCGACCC CAACAAGCGCTGGGAACTTTGTGACATCCCCCGCTGCACAACACCTCCACCATCTTCTGGTCCCACCTACCAGTGTCTGAA GGGAACAGGTGAAAACTATCGCGGGAATGTGGCTGTTACCGTGTCCGGGCACACCTGTCAGCACTGGAGTGCACAGACCCC TCACACACATAACAGGACACCAGAAAACTTCCCCTGCAAAAATTTGGATGAAAACTACTGCCGCAATCCTGACGGAAAAAG GGCCCCATGGTGCCATACAACCAACAGCCAAGTGCGGTGGGAGTACTGTAAGATACCGTCCTGTGACTCCTCCCCAGTATC CACGGAACAATTGGCTCCCACAGCACCACCTGAGCTAACCCCTGTGGTCCAGGACTGCTACCATGGTGATGGACAGAGCTA CCGAGGCACATCCTCCACCACCACCACAGGAAAGAAGTGTCAGTCTTGGTCATCTATGACACCACACCGGCACCAGAAGAC CCCAGAAAACTACCCAAATGCTGGCCTGACAATGAACTACTGCAGGAATCCAGATGCCGATAAAGGCCCCTGGTGTTTTAC CACAGACCCCAGCGTCAGGTGGGAGTACTGCAACCTGAAAAAATGCTCAGGAACAGAAGCGAGTGTTGTAGCACCTCCGCC TGTTGTCCTGCTTCCAGATGTAGAGACTCCTTCCGAAGAAGACTGTATGTTTGGGAATGGGAAAGGATACCGAGGCAAGAG GGCGACCACTGTTACTGGGACGCCATGCCAGGACTGGGCTGCCCAGGAGCCCCATAGACACAGCATTTTCACTCCAGAGAC AAATCCACGGGCGGGTCTGGAAAAAAATTACTGCCGTAACCCTGATGGTGATGTAGGTGGTCCCTGGTGCTACACGACAAA TCCAAGAAAACTTTACGACTACTGTGATGTCCCTCAGTGTGCGGCCCCTTCATTTGATTGTGGGAAGCCTCAAGTGGAGCC GAAGAAATGTCCTGGAAGGGTTGTAGGGGGGTGTGTGGCCCACCCACATTCCTGGCCCTGGCAAGTCAGTCTTAGAACAAG GTTTGGAATGCACTTCTGTGGAGGCACCTTGATATCCCCAGAGTGGGTGTTGACTGCTGCCCACTGCTTGGAGAAGTCCCC AAGGCCTTCATCCTACAAGGTCATCCTGGGTGCACACCAAGAAGTGAATCTCGAACCGCATGTTCAGGAAATAGAAGTGTC TAGGCTGTTCTTGGAGCCCACACGAAAAGATATTGCCTTGCTAAAGCTAAGCAGTCCTGCCGTCATCACTGACAAAGTAAT CCCAGCTTGTCTGCCATCCCCAAATTATGTGGTCGCTGACCGGACCGAATGTTTCATCACTGGCTGGGGAGAAACCCAAGG TACTTTTGGAGCTGGCCTTCTCAAGGAAGCCCAGCTCCCTGTGATTGAGAATAAAGTGTGCAATCGCTATGAGTTTCTGAA TGGAAGAGTCCAATCCACCGAACTCTGTGCTGGGCATTTGGCCGGAGGCACTGACAGTTGCCAGGGTGACAGTGGAGGTCC TCTGGTTTGCTTCGAGAAGGACAAATACATTTTACAAGGAGTCACTTCTTGGGGTCTTGGCTGTGCACGCCCCAATAAGCC Page 69 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) TGGTGTCTATGTTCGTGTTTCAAGGTTTGTTACTTGGATTGAGGGAGTGATGAGAAATAATTAATTGGACGGGAGACAGAG TGACGCACTGACTCACCTAGAGGCTGGAACGTGGGTAGGGATTTAGCATGCTGGAAATAACTGGCAGTAATCAAACGAAGA CACTGTCCCCAGCTACCAGCTACGCCAAACCTCGGCATTTTTTGTGTTATTTTCTGACTGCTGGATTCTGTAGTAAGGTGA CATAGCTATGACATTTGTTAAAAATAAACTCTGTACTTAACTTTGATTTGAGTAAATTTTGGTTTTGGTCTTCAACATTTT CATGCTCTTTGTTCACCCCACCAATTTTTAAATGGGCAGATGGGGGGATTTAGCTGCTTTTGATAAGGAACAGCTGCACAA AGGACTGAGCAGGCTGCAAGGTCACAGAGGGGAGAGCCAAGAAGTTGTCCACGCATTTACCTCATCAGCTAACGAGGGCTT GACATGCATTTTTACTGTCTTTATTCCTGACACTGAGATGAATGTTTTCAAAGCTGCAACATGTATGGGGAGTCATGCAAA CCGATTCTGTTATTGGGAATGAAATCTGTCACCGACTGCTTGACTTGAGCCCAGGGGACACGGAGCAGAGAGCTGTATATG ATGGAGTGAACCGGTCCATGGATGTGTAACACAAGACCAACTGAGAGTCTGAATGTTATTCTGGGGCACACGTGAGTCTAG GATTGGTGCCAAGAGCATGTAAATGAACAACAAGCAAATATTGAAGGTGGACCACTTATTTCCCATTGCTAATTGCCTGCC CGGTTTTGAAACAGTCTGCAGTACACACGGTCACAGGAGAATGACCTGTGGGAGAGATACATGTTTAGAAGGAAGAGAAAG GACAAAGGCACACGTTTTACCATTTAAAATATTGTTACCAAACAAAAATATCCATTCAAAATACAATTTAACAATGCAACA GTCATCTTACAGCAGAGAAATGCAGAGAAAAGCAAAACTGCAAGTGACTGTGAATAAAGGGTGAATGTAGTCTCAAATCCT CAAAGAGCTGTGTTTATTTCATTGACAAATAGATTATTTGTATTCAA SEQ ID NO: 2 >NM_001168338.1 Homo sapiens plasminogen (PLG), transcript variant 2, mRNA GAATCATTAACTTAATTTGACTATCTGGTTTGTGGATGCGTTTACTCTCATGTAAGTCAACAACATCCTGGGATTGGGACC CACTTTCTGGGCACTGCTGGCCAGTCCCAAAATGGAACATAAGGAAGTGGTTCTTCTACTTCTTTTATTTCTGAAATCAGG TCAAGGAGAGCCTCTGGATGACTATGTGAATACCCAGGGGGCTTCACTGTTCAGTGTCACTAAGAAGCAGCTGGGAGCAGG AAGTATAGAAGAATGTGCAGCAAAATGTGAGGAGGACGAAGAATTCACCTGCAGGGCATTCCAATATCACAGTAAAGAGCA ACAATGTGTGATAATGGCTGAAAACAGGAAGTCCTCCATAATCATTAGGATGAGAGATGTAGTTTTATTTGAAAAGAAAGT GTATCTCTCAGAGTGCAAGACTGGGAATGGAAAGAACTACAGAGGGACGATGTCCAAAACAAAAAATGGCATCACCTGTCA AAAATGGAGTTCCACTTCTCCCCACAGACCTAGGTAAGACATTCCCTTTCATCTTTGTGTTCATCTACTGTAAAGTTGTCC CTCTGTGTCTGTGAGGGATTGGTTCCAGGACCCCTGTGGCTACCAAAATCCATGCTTCTCAAGTCCCTTATATAAAATGGT GCAGTATTTGCATATAACCTACATACCTTCTCTTGTATAATCCCTAATATAATGTAAATGCTATTTAATCGTTGTTATACT GTATTGTTTTTATTTGTATTATGTTTTATTGTCATATTGTTATTTTCTGTCATCTTTTTCAAGTCTTTTCCATCCACAGTT GGTTGAATTTGTGGATCTGGAACCCATGGATACAGAGGGCCAACTGTATTTAGGATAATTTCATCACTTTTAATTCAAACC ACAATATGTGAATAAGCAGATAGAAAGAATCTTTTTGATGTCGATGTTCAACTATTTTTGGCACCATAGTAGAACATGGTT GCTTTCTATTTTTTCTTGGATATGGAGGTTTCTTGAAGACCTAGAACATAGAAGAATGCCTAGTTTAAAAAAAATCAATGA AACTATGAGTTTTAGGCCAAATCTGAGAAAAGATCAAAGATGACTATGTTTGGGACTGAAGTAAGCATATCAGGTTAGAAC TCTCATCACATGTTCGACTCAAATTGTGGAGCAAAAGAGTAAATAAGATATAAAAATGAAAATGAA Page 70 of 79 WBD (US) 4909-1752-9902v2

Claims

Atty Dkt No. A1088681820WO (00653) CLAIMS We claim:

1. A method of inhibiting the expression of plasminogen (PLG) gene in a human subject, the method comprising administering to the subject a fixed dose of about 10 mg to about 300 mg of a double-stranded ribonucleic acid (dsRNA) agent or an equivalent amount of a pharmaceutically acceptable salt thereof, wherein the double-stranded ribonucleic acid agent or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usAfsgaaAfcucauagCfgAfuugcascsa-3' of SEQ ID NO: 4 and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usgscaauCfgCfUfAfugaguuucua-3' of SEQ ID NO: 3, wherein a is 2'-O-methyladenosine-3’-phosphate, c is 2'-O-methylcytidine-3’- phosphate, g is 2'-O-methylguanosine-3’-phosphate, u is 2'-O-methyluridine-3’-phosphate, Af is 2’-fluoroadenosine-3’-phosphate, Cf is 2’-fluorocytidine-3’-phosphate, Uf is 2’-fluorouridine-3’- phosphate, Afs is 2’-fluoroadenosine-3’-phosphorothioate, as is 2’-O-methyladenosine-3’- phosphate, cs is 2’-O-methylcytidine-3’- phosphorothioate, gs is 2’-O-methylguanosine-3’- phosphorothioate, us is 2'-O-methyluridine-3’-phosphorothioate , and s is a phosphorothioate linkage thereby inhibiting the expression of PLG in the subject.

2. A method of treating a human subject that would benefit from reduction in PLG expression, the method comprising administering to the subject a fixed dose of about 10 mg to about 300 mg of a double-stranded ribonucleic acid (dsRNA) agent or an equivalent amount of a pharmaceutically acceptable salt thereof, wherein the double-stranded ribonucleic acid agent or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usAfsgaaAfcucauagCfgAfuugcascsa-3' of SEQ ID NO: 4 and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usgscaauCfgCfUfAfugaguuucua- 3' of SEQ ID NO: 3, wherein a is 2'-O-methyladenosine-3’-phosphate, c is 2'-O-methylcytidine- 3’-phosphate, g is 2'-O-methylguanosine-3’-phosphate, u is 2'-O-methyluridine-3’-phosphate, Af is 2’-fluoroadenosine-3’-phosphate, Cf is 2’-fluorocytidine-3’-phosphate, Uf is 2’-fluorouridine-3’- phosphate, Afs is 2’-fluoroadenosine-3’-phosphorothioate, as is 2’-O-methyladenosine-3’- phosphate, cs is 2’-O-methylcytidine-3’- phosphorothioate, gs is 2’-O-methylguanosine-3’- Page 71 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) phosphorothioate, us is 2'-O-methyluridine-3’-phosphorothioate , and s is a phosphorothioate linkage, thereby treating the subject that would benefit from reduction in PLG expression.

3. A method of treating a human subject having a PLG-associated disease, the method comprising administering to the subject a fixed dose of about 10 mg to about 300 mg of a double- stranded ribonucleic acid agent or an equivalent amount of a pharmaceutically acceptable salt thereof, wherein the double-stranded ribonucleic acid agent or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usAfsgaaAfcucauagCfgAfuugcascsa-3' of SEQ ID NO: 4 and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence 5'-usgscaauCfgCfUfAfugaguuucua-3' of SEQ ID NO: 3, wherein a is 2'-O-methyladenosine-3’-phosphate, c is 2'-O-methylcytidine-3’-phosphate, g is 2'-O- methylguanosine-3’-phosphate, u is 2'-O-methyluridine-3’-phosphate, Af is 2’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3’-phosphate, Uf is 2’-fluorouridine-3’-phosphate, Afs is 2’- fluoroadenosine-3’-phosphorothioate, as is 2’-O-methyladenosine-3’-phosphate, cs is 2’-O- methylcytidine-3’- phosphorothioate, gs is 2’-O-methylguanosine-3’- phosphorothioate, us is 2'- O-methyluridine-3’-phosphorothioate , and s is a phosphorothioate linkage, thereby treating the subject having a PLG-associated disease.

4. The method of claim 1 or 2, wherein the human subject has a PLG-associated disease.

5. The method of claim 3 or 4, wherein the PLG-associated disease is a bleeding disorder.

6. The method of claim 5, wherein the bleeding disorder is a mucocutaneous bleeding disorder (MCB).

7. The method of claim 3 or 4, wherein the PLG-associated disease is selected from the group consisting of hereditary hemorrhagic telangiectasia (HHT), heavy menstrual bleeding (HMB), PAI-1 deficiency, von Willebrand disease, low factor XI levels, platelet defects, hemophilia A, hemophilia B, afibrinogenemia, parahemophilia, low factor VIII levels, low factor IX levels, low factor VII levels, low factor XIII levels, low factor X levels, low factor V levels, low factor II levels, nose bleeds, bleeding gums, easy bruising, postpartum bleeding, and excessive bleeding following surgery. Page 72 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 8. The method of claim 7, wherein the PLG-associated disease is hereditary hemorrhagic telangiectasia (HHT).

9. The method of any one of claims 1-8, wherein the fixed dose is 5 mg to 20 mg, 20 mg to 50 mg, 25 mg to 75 mg, 30 mg to 75 mg, 35 mg to 75 mg, 40 mg to 75 mg, 45 mg to 75 mg, 50 mg to 75 mg, 25 mg to 60 mg, 30 mg to 60 mg, 35 mg to 60 mg, 40 mg to 60 mg, 45 mg to 60 mg, 50 mg to 60 mg, 25 mg to 50 mg, 30 mg to 50 mg, 35 mg to 50 mg, 40 mg to 50 mg, 45 mg to 50 mg, 25 mg to 100 mg, 50 mg to 100 mg, 75 mg to 100 mg, 25 mg to 150 mg, 30 mg to 150 mg, 35 mg to 150 mg, 40 mg to 150 mg, 45 mg to 150 mg, 50 mg to 150 mg, 75 mg to 150 mg, 100 mg to 150 mg, 50 mg to 75 mg, 75 mg to 100 mg, 100 mg to 150 mg, 150 mg to 225 mg, 225 mg to 300 mg.

10. The method of claim 9, wherein the fixed dose is about 5 mg to about 15 mg, about 20 mg to about 50 mg, about 45 mg to about 75 mg, or about 75 mg to about 150 mg.

11. The method of any one of claims 1-10, wherein the fixed dose is about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, or about 300 mg.

12. The method of any one of claims 1-11, wherein the fixed dose is administered to the subject once every 3 months.

13. The method of any one of claims 1-12, wherein the fixed dose is administered to the subject once every 3 months for 6 months.

14. The method of any one of claims 1-12, wherein the fixed dose is administered to the subject once every 3 months for 12 months. Page 73 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 15. The method of any one of claims 1-12, wherein the fixed dose is administered to the subject once every 3 months for 15 months.

16. The method of any one of claims 1-12, wherein the fixed dose is administered to the subject once every 3 months for 18 months.

17. The method of any one of claims 1-12, wherein the fixed dose is administered to the subject once every 3 months for 24 months.

18. The method of any one of claims 1-17, wherein the subject shows a decrease in the level of PLG protein and / or activity in the plasma following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

19. The method of claim 18, wherein the subject shows an at least about 25% decrease in the level of PLG protein and / or activity in the plasma.

20. The method of claim 18, wherein the subject shows an about 45% to about 80% decrease in the level of PLG protein and / or activity in the plasma.

21. The method of claim 18, wherein the subject shows the decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month.

22. The method of claim 19, wherein the subject shows the at least about 25% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month.

23. The method of claim 19, wherein the subject shows the at least about 25% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 3 months.

24. The method of claim 20, wherein the subject shows the about 45% to about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month.

25. The method of claim 20, wherein the subject shows the about 45% to about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 3 months. Page 74 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 26. The method of claim 20, wherein the subject shows the about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 1 month.

27. The method of claim 20, wherein the subject shows the about 80% decrease in the level of PLG protein and / or activity in the plasma that is sustained for at least 3 months.

28. The method of any one of claims 1-27, wherein the subject shows a decrease in fibrinolysis following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

29. The method of claim 28, wherein the decrease in fibrinolysis is measured in a whole blood sample of the subject using tissue plasminogen activator-rotational thromboelastometry (tPA- ROTEM).

30. The method of claim 28, wherein the decrease in fibrinolysis is a decrease in plasma clot fibrinolysis.

31. The method of any one of claims 1-30, wherein the subject is female and shows a decrease in menstrual bleeding following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

32. The method of claim 31, wherein the female subject has amenorrhea following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

33. The method of any one of claims 1-32, wherein the subject shows a decrease in epistaxis following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

34. The method of claim 33, wherein the subject shows a decrease in duration, frequency, and / or intensity of epistaxis following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof. Page 75 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 35. The method of any one of claims 1-34, wherein the subject shows a decrease in hematologic support score (HSS), a decrease in the number of iron infusions and / or a decrease in the number of red blood cell (RBC) transfusions following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

36. The method of any one of claims 1-35, wherein the subject shows an increase in hemoglobin levels following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

37. The method of any one of claims 1-36, wherein the subject shows a decrease in use of epistaxis rescue treatments and / or a decrease in the frequency of emergency room visits following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

38. The method of any one of claims 1-37, wherein the subject shows an improvement in quality of life (QoL) and / or patient reported outcome (PRO) scores following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

39. The method of claim 38, wherein the improvement in quality of life and / or patient reported outcome scores is measured by nasal outcome score for epistaxis in HHT (NOSE-HHT), modified patient global impression of severity (mPGI-S), HHT specific quality of life (HHT-QoL), patient global impression of change (PGI-C), modified patient global impression of change (mPGI-C), and / or Euro QoL 5 dimensions 5 levels questionnaire (EQ-5D-5L).

40. The method of any one of claims 18-39, wherein the decrease, increase or improvement is relative to a reference level.

41. The method of claim 40, wherein the reference level is a level observed in the subject prior to the administration.

42. The method of claim 40, wherein the reference level is a level observed in a subject administered a placebo.

43. The method of claim 40, wherein the reference level is a predetermined threshold level. Page 76 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 44. The method of any one of claims 1-43, wherein the subject does not develop ligneous lesions, severe injection site reactions, thrombosis, and / or an alanine aminotransferase (ALT) or aspartate aminotransferase (AST) elevation greater than 3 times the upper limit of normal (ULN) following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

45. The method of any one of claims 1-44, wherein the subject shows normal liver function tests following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

46. The method of any one of claims 1-45, wherein anti-drug antibodies are not detectable in the subject following the administration of the dsRNA agent or the equivalent amount of a pharmaceutically acceptable salt thereof.

47. The method of any one of claims 1-46, wherein the dsRNA agent or an equivalent amount of a pharmaceutically acceptable salt thereof is administered to the subject as a single dose. 48 The method of any one of claims 1-47, wherein the dsRNA agent or an equivalent amount of a pharmaceutically acceptable salt thereof is administered to the subject subcutaneously.

49. The method of any one of claims 1-48, wherein the pharmaceutically acceptable salt is sodium salt.

50. The method of any one of claims 1-49, wherein the dsRNA agent, or pharmaceutically acceptable salt thereof, further comprises a ligand.

51. The method of claim 50, wherein the ligand is conjugated to the 3’ end of the sense strand.

52. The method of claim 50 or 51, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

53. The method of claim 52, wherein the GalNAc derivative comprises one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker. Page 77 of 79 WBD (US) 4909-1752-9902v2Atty Dkt No. A1088681820WO (00653) 54. The use of claim 53, wherein the ligand is55. The use of claim 54, wherein the 3’ end of the sense strand is conjugated to the ligand as shown in the following schematicPage 78 of 79 WBD (US) 4909-1752-9902v2

Images