Method and composition for preventing or treating ulcerative colitis

By using aerolysin inhibitors and Aeromonas spp. MTB bacteria, combined with specific antibodies and vaccines, the long-term treatment challenges of ulcerative colitis have been solved, achieving more efficient treatment and diagnosis with fewer side effects, and reducing surgical risks.

WO2026066866A1PCT designated stage Publication Date: 2026-04-02NANJING NYSBIO BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-08-22
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Existing treatments for ulcerative colitis are difficult to cure completely, and long-term treatment is not very effective. Furthermore, existing diagnostic and treatment protocols are highly invasive, have varying drug responses, and are prone to side effects.

Method used

Aerosol inhibitors, amino acid sequence peptides or their immunogenic fragments, Aeromonas spp. MTB and their inhibitors, combined with specific antibodies, are used to prepare drugs and vaccines for the prevention and treatment of ulcerative colitis through immunization and in vitro detection.

Benefits of technology

It can significantly relieve symptoms of ulcerative colitis, reduce the need for surgery, improve treatment effectiveness, reduce drug side effects, provide non-invasive diagnostic methods, and improve treatment success rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025116530-FTAPPB-I100001
    Figure PCTCN2025116530-FTAPPB-I100001
  • Figure PCTCN2025116530-FTAPPB-I100002
    Figure PCTCN2025116530-FTAPPB-I100002
  • Figure PCTCN2025116530-FTAPPB-I100003
    Figure PCTCN2025116530-FTAPPB-I100003
Patent Text Reader

Abstract

The present invention provides the use of an aerolysin inhibitor in the preparation of a medicament for preventing or treating ulcerative colitis in a subject. The present invention also provides a method and composition for preventing or treating ulcerative colitis.
Need to check novelty before this filing date? Find Prior Art

Description

Methods and compositions for preventing or treating ulcerative colitis TECHNICAL FIELD

[0001] The present invention relates to the prevention and / or treatment of ulcerative colitis, in particular to the use of aerolysin inhibitors in the prevention or treatment of ulcerative colitis, to aerolysin amino acid sequences and immunogenic fragments thereof, to methods of making anti-aerolysin antibodies, to methods of screening for drug candidates for the prevention or treatment of ulcerative colitis, to antibodies or antigen-binding fragments thereof that bind to aerolysin polypeptides or immunogenic fragments thereof, to Aeromonas bacterial species identified by the present invention, to the use of the bacterial species in the screening of drug candidates for the prevention or treatment of ulcerative colitis, to the use of the bacterial species in the manufacture of a medicament for the prevention or treatment of ulcerative colitis in a subject, to methods of detecting the bacterial species in vitro, to the use of antibodies or antigen-binding fragments thereof that bind to aerolysin in the manufacture of a kit for ulcerative colitis, to vaccine compositions, to the use of aerolysin in the manufacture of a vaccine composition for the prevention of ulcerative colitis, to methods of establishing an animal model of ulcerative colitis and to the established animal model, to methods of preventing or treating ulcerative colitis and to methods of diagnosing ulcerative colitis. BACKGROUND

[0002] Ulcerative colitis (UC) is a chronic intestinal inflammatory disease, and its etiology is currently unknown. The UC lesion area mainly involves the colorectum, showing continuous and diffuse superficial mucosal inflammation, which gradually develops from the rectum to the proximal colon. UC patients can have symptoms such as abdominal pain, diarrhea, tenesmus, mucopurulent bloody stool, fever, and fatigue, and can be accompanied by weight loss and malnutrition and extraintestinal complications in the later stage, and can even develop into intestinal cancer. UC is currently difficult to completely cure, and after treatment, it can relapse repeatedly. 18.2% of UC patients will have a severe disease reaction again within one year after the disease is in remission. Long-term UC inflammatory response requires a large amount of cost to maintain treatment, and patients can also have physical or psychological disability. UC and Crohn's disease (CD) are two main forms of inflammatory bowel disease (IBD), which are caused by over-activated intestinal immune response. Both UC and CD are chronic intestinal inflammation, difficult to completely cure, and have a long-term risk of disability, and thus belong to progressive diseases. Unlike the continuous mucosal inflammation of UC, CD inflammation can occur at any site of the digestive tract, and the inflammation is discontinuously distributed at the site, can penetrate the serosal layer to form inflammation involving the full layer of the intestinal tract, leading to fibrosis, stenosis, and fistula formation. CD patients have symptoms such as abdominal pain, diarrhea, weight loss, malnutrition, and fever, and can be accompanied by perianal disease and abdominal mass. In the past, UC and CD were commonly studied due to their similar disease characteristics. However, it has now been clearly recognized that they represent two different pathological diseases.

[0003] Currently, approximately 50% of patients with UC are treated with corticosteroids, a proportion that is gradually decreasing as research progresses. Correspondingly, the use of immunomodulators (20%) and anti-TNF therapies (5-10%) is increasing. Early remission therapy for UC is prioritized with 5-aminosalicylic acid (5-ASA), with local therapy if necessary, and reduction of inflammatory signaling molecules, with steroids, immunosuppressants, and biologic advanced therapies in order for patients with severe UC and those who do not respond to 5-ASA therapy. Antibiotics are generally used in combination with other treatment regimens, with ciprofloxacin and metronidazole being the main drugs used. FMT can help restore the normal intestinal flora of UC patients as an optional intervention during the course of UC treatment, but there are certain limitations in its clinical application. Despite the development of various biologics, the failure rate of drug therapy is still high. The goal of UC treatment is to relieve symptoms and restore the mucosal epithelium to normal, and the current treatment regimen can only achieve histological remission in 46% of UC patients, with a probability of about 16% for both clinical symptoms and endoscopic and histological remission. 1 / 10 of UC patients require colectomy within 10 years of diagnosis.

[0004] UC is a refractory intestinal inflammatory disease that is prevalent worldwide, and its risk factors involve genetics as well as environmental and risk behaviors. Pathophysiological studies have found that UC is associated with damage to the intestinal barrier function and overactivation of the related intestinal immune response, which suggests that UC is a mucosal barrier disease. Despite the significant progress made in the diagnosis and treatment of UC, there are still many limitations due to the unknown etiology: the necessary colonoscopy and biopsy for the diagnosis of UC increases the physical and psychological burden on patients due to its invasive and traumatic nature; the response to current immunosuppressive and biologic therapies varies greatly, and the likelihood of drug resistance and side effects increases with long-term treatment. Under the current treatment strategy, the proportion of UC patients who can completely recover histologically is still very low, and the proportion of UC patients who require surgical intervention gradually increases as the disease progresses. Therefore, further research is needed on the etiology of UC mucosal barrier damage in order to develop targeted diagnostic and treatment strategies. SUMMARY

[0005] One aspect of the application provides the use of a gasdermin inhibitor in the manufacture of a medicament for preventing or treating ulcerative colitis in a subject. In related aspects, the application provides a method of preventing or treating ulcerative colitis in a subject, the method comprising administering to the subject a prophylactically or therapeutically effective amount of a gasdermin inhibitor. In related aspects, the application provides a gasdermin inhibitor for use in preventing or treating ulcerative colitis in a subject.

[0006] Another aspect of the present application provides a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof, a polynucleotide encoding the polypeptide or the immunogenic fragment thereof, a vector comprising the polynucleotide, and a host cell comprising the vector.

[0007] Still another aspect of the present application provides a method of preparing an antibody for preventing or treating ulcerative colitis, the method comprising: (a) immunizing an animal with a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof provided by the present application; (b) isolating and screening an antibody against the polypeptide or the immunogenic fragment thereof from the animal.

[0008] Still another aspect of the present application provides a method of screening a drug candidate for preventing or treating ulcerative colitis, the method comprising: (a) contacting a test substance with a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 180 to 184; (b) evaluating an inhibitory effect of the test substance on an activity of the polypeptide; and (c) identifying a test substance having an inhibitory effect exceeding a preset threshold as a drug candidate.

[0009] Still another aspect of the present application provides an Aeromonas MTB bacterium, which is deposited with the China General Microbiological Culture Collection Center (CGMCC) and has a deposit number of CGMCC No. 30776 or CGMCC No. 30777. The bacterium is classified as Aeromonas sp. MTB species, and has a Latin name of Aeromonas sp. MTB, a depositing unit of China General Microbiological Culture Collection Center (CGMCC), an address of No. 1, Yikhinaxi Road, Chaoyang District, Beijing, a depositing date of May 27, 2024, and a deposit number of CGMCC No. 30776 (2A5 strain) or CGMCC No. 30777 (10A1 strain).

[0010] Still another aspect of the present application provides a method of screening a drug candidate for preventing or treating ulcerative colitis, the method comprising: (a) contacting a test substance with an Aeromonas MTB bacterium provided by the present application; (b) evaluating an inhibitory effect of the test substance on the bacterium; and (c) identifying a test substance having an inhibitory effect exceeding a preset threshold as a drug candidate.

[0011] Still another aspect of the present application provides use of an inhibitor of Aeromonas MTB bacteria provided by the present application in the manufacture of a medicament for preventing or treating ulcerative colitis in a subject. In a related aspect, the present application provides a method of preventing or treating ulcerative colitis in a subject, the method comprising administering to the subject a prophylactically or therapeutically effective amount of an inhibitor of Aeromonas MTB bacteria provided by the present application. In a related aspect, the present application provides an inhibitor of Aeromonas MTB bacteria provided by the present application for use in preventing or treating ulcerative colitis in a subject.

[0012] Still another aspect of the present application provides an antibody or an antigen binding fragment thereof that can specifically bind to a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof.

[0013] Still another aspect of the present application provides use of an antibody or an antigen binding fragment thereof that can specifically bind to aerolysin in the manufacture of a kit for diagnosing ulcerative colitis in a subject. In a related aspect, the present application provides a method of diagnosing ulcerative colitis in a subject, the method comprising contacting a sample obtained from the subject in vitro with an antibody or an antigen binding fragment thereof that can specifically bind to aerolysin, detecting binding of the antibody or the antigen binding fragment thereof to aerolysin, if any, in the sample, and the presence of the binding indicating that the subject has ulcerative colitis.

[0014] Still another aspect of the present application provides a method of detecting in vitro whether a sample comprises Aeromonas MTB bacteria provided by the present application, comprising (a) contacting an anti-aerolysin antibody or an antigen binding fragment thereof with the sample in vitro, (b) detecting binding of the antibody or the antigen binding fragment thereof to the Aeromonas MTB bacteria, and (c) the presence of the binding indicating that the sample comprises the Aeromonas MTB bacteria.

[0015] Still another aspect of the present application provides a method of detecting in vitro whether a sample comprises Aeromonas MTB bacteria provided by the present application, comprising (a) amplifying a polynucleotide encoding a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof; and / or (b) amplifying gene 1407, wherein a positive amplification result of (a) and / or (b) indicates that the sample comprises the Aeromonas MTB bacteria.

[0016] Still another aspect of the present application provides a method of detecting in vitro whether a sample comprises Aeromonas MTB bacteria provided by the present application, comprising (a) culturing the sample to obtain a culture supernatant, (b) co-culturing the culture supernatant with macrophages, and (c) detecting killing effect of the culture supernatant on the macrophages, wherein the presence of the killing effect indicates that the sample comprises the MTB bacteria.

[0017] In yet another aspect, the present application provides a vaccine composition comprising a polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof, or a polynucleotide encoding the polypeptide or the immunogenic fragment thereof.

[0018] In yet another aspect, the present application provides use of aerolysin in the manufacture of a vaccine composition for preventing ulcerative colitis. In a related aspect, the present application provides a method of immunizing a subject to prevent ulcerative colitis, the method comprising administering to the subject an immunologically effective amount of aerolysin. In a related aspect, the present application provides aerolysin for use in preventing ulcerative colitis.

[0019] In yet another aspect, the present application provides a method of establishing an animal model of ulcerative colitis, the method comprising colonizing the intestines of the animal with an Aeromonas MTB bacterium provided by the present application.

[0020] Further aspects of the present application and advantages thereof will become apparent in the following more detailed description of the application. Bacterial Strain Preservation

[0021] Aeromonas MTB bacterium (2A5), deposited on May 27, 2024, at the China General Microbiological Culture Collection Center (CGMCC), and assigned accession number CGMCC No. 30776.

[0022] Aeromonas MTB bacterium (10A1), deposited on May 27, 2024, at the China General Microbiological Culture Collection Center (CGMCC), and assigned accession number CGMCC No. 30777. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1. The macrophage barrier next to the colonic epithelial cell layer is disrupted in UC. A: Immunohistochemical staining of UC inflammatory colonic tissue (UC, n=10) and cancer adjacent tissue of colorectal cancer patients (CCA-N, n=7) with anti-CD68 antibody. Black dotted line indicates the bottom of the intestinal epithelial cell barrier, and red dotted line indicates the border of the resident macrophage barrier. B: Number of CD68+ macrophages counted within 50 pm range below the epithelial cell layer. The counting range is between the black and red dotted lines in panel A. Each circle represents the counting data from a different field, blue circles represent CCA-N (n=77), and red circles represent UC (n=110). C: Immunofluorescent staining of UC and CCA-N colonic tissue using anti-CD68 antibody (red). DAPI staining of cell nuclei (blue). D: Immunohistochemical staining of UC (n=10) and CCA-N (n=7) intestinal tissue sections with anti-CD169 antibody. Scale bar = 50 pm. E: Number of CD169+ macrophages counted within 50 pm range below the epithelial cell layer. The counting range is between the black and red dotted lines in panel D. Each circle represents the counting data from a different field, blue circles represent CCA-N (n=117), and red circles represent UC (n=153).

[0024] Figure 2. UC fecal bacteria produce toxins that induce macrophage death. A: Schematic diagram of the procedure of treating BMDM with fecal bacteria culture supernatant. B: Cell viability of BMDM treated with fecal bacteria culture supernatant of UC patients (red, n=48), refractory constipation patients (gray, n=32), and normal individuals (blue, n=47). C: Cell viability of BMDM treated with Normal mix (normal fecal bacteria mixture, n=9), UC mix (UC fecal bacteria mixture, n=39) culture supernatant and the samples after heat inactivation at 95°C for 5 min. D: Cell morphology of BMDM treated with Normal mix or UC mix culture supernatant. Scale bar = 20 pm.

[0025] Figure 3. Preliminary identification of the nature of UC fecal bacteria toxins. A: Cell viability of BMDM treated with Normal mix or UC mix culture supernatant after water-saturated n-butanol extraction, polar phase and non-polar phase. B: Cell viability of BMDM or Raw264.7 treated with the retentate and the flow-through of UC mix culture supernatant after separation by 30 kDa ultrafiltration tube. C: Protein retention effect of 30 kDa ultrafiltration tube using ovalbumin (OVA) with a molecular size of 45 kDa. D: Cell viability of BMDM treated with Normal mix and UC mix culture supernatant in DMEM with or without FBS, M9, and LB media. Mock is blank medium. E: SDS-PAGE silver staining results of UC mix culture supernatant after culture in different media.

[0026] Figure 4. UC fecal bacteria produce cell-puncturing toxin Aerolysin. A: Normal mix and UC mix fecal bacteria supernatant were treated with different concentrations of proteinase K, and then co-cultured with BMDM to detect the survival rate of BMDM. B: UC mix culture supernatant was treated with DEAE anion exchange chromatography, and then the elution fractions were used to treat BMDM to detect the cell survival rate. Yellow line, percentage of NaCl concentration in elution buffer; blue line, OD 280nm of elution fractions; green line, cell survival rate of BMDM treated with corresponding elution fractions. C: SDS-PAGE separation of proteins in fractions 15-19 followed by Coomassie blue staining. D: Mass spectrometry analysis results of four candidate bands in fraction 17 for LC-MS / MS, number of specific peptides in the protein in the mass spectrum, and total number of captured peptides. E: Aerolysin protein sequence alignment, all amino acids are compared with the first row, and the same amino acids are represented by point placeholders.

[0027] Figure 5. Aerolysin polyclonal antibody neutralizes the toxin produced by UC mix. A: Schematic diagram of the construction scheme of the GST-Aerolysin NA protein expression plasmid. The Aerolysin NA gene fragment was inserted into the pGEX-5x-1 vector digested with EcoR I and Xho I. B: GST-Aerolysin NA recombinant protein expression and purification were separated by SDS-PAGE and stained with Coomassie blue. C: Western blot analysis of bacterial culture supernatant from Normal mix, UC mix, and MTB using anti-Aerolysin polyclonal antibody. The Aerolysin polyclonal antibody prepared in the experiment can bind to the precursor form, active form, and heptamer form of Aerolysin. D: Different dilutions of Aerolysin polyclonal antibody were mixed with UC mix, Normal mix, and culture supernatant of two Aerolysin-producing MTB strains, and then used to treat BMDM to detect cell survival rate.

[0028] Figure 6. Macrophages are more susceptible to Aerolysin-induced death than epithelial cells, and multiple GPI-modified receptors mediate Aerolysin binding to macrophages. A: Diagram of the GST-Aerolysin protein expression plasmid construction. B: SDS-PAGE separation of the GST-Aerolysin recombinant protein after expression and purification, and Coomassie blue staining. C: Cell survival rates after treatment of human cells with different concentrations of GST-Aerolysin. D: Cell survival rates after treatment of murine cells with different concentrations of GST-Aerolysin. E: Transmission electron microscopy of Raw264.7 cells after treatment with GST-Aerolysin for 3 hours. F: Relative mRNA expression levels in Raw64.7 cells after corresponding siRNA interference. G: Cell survival rates after treatment of Raw264.7 cells with a final concentration of 39 ng / ml GST-Aerolysin after 72 h of siRNA interference.

[0029] Figure 7. Aerolysin-expressing bacteria in UC mix are not susceptible to multiple antibiotics. A: BMDMs treated with culture supernatants obtained from UC mix and Normal mix cultures after addition of different antibiotics. Cell survival rates were determined. B: Effects of combined antibiotics on cytotoxicity of UC mix and Normal mix cultures. KGP (kanamycin + gentamicin + penicillin), AKGP (ampicillin + KGP), AKGPS (AKGP + streptomycin), AKPGSC (AKPGS + ciprofloxacin). C: Cytotoxicity experiments performed on β-hemolytic ring colonies isolated from UC mix, and PCR verification of the aerolysin gene using the ASAl primer.

[0030] Figure 8. Bacterial morphological characteristics and bioinformatics analysis of Aeromonas sp. MTB. A: Colony morphology of MTB grown on LB solid medium. B: Morphology of MTB observed under transmission electron microscope after phosphotungstic acid negative staining. C: Western blot of UC mix, MTB (10A1), MTB (2A5) secreted supernatant using anti-Aerolysin polyclonal antibody. D: Phylogenetic tree of MTBs and reference Aeromonas based on 16S rRNA (1464 bp) constructed using neighbor-joining method and genetic distance calculated using maximum composite likelihood. The tree is drawn to scale. F: Heatmap of ANI analysis of MTB and reference Aeromonas gene whole genome. G: Phylogenetic tree of MTB and reference Aeromonas gene based on Core-Pan based. H: Pan gene Venn diagram of MTB and reference Aeromonas gene. I: Pan gene Venn diagram of MTB. H and I: Each ellipse represents a strain, and the number in the ellipse represents the number of unique gene clusters.

[0031] Figure 9. Aeromonas sp. MTB can long-term colonize in mice pretreated with AVNM antibiotics and DSS. PCR amplification of aerolysin gene (ASA) was performed on mouse feces after two times of LB culture to detect MTB bacterial colonization, E. coli 16S rRNA (RRS) was used as a PCR reaction amplification efficiency control. A: C57BL / 6J mice were orally gavaged with MTB (2A5) bacteria every day for three consecutive days at 1 x 10 9 CFU, and fecal samples were collected on day 17 after the last gavage. B: MTB colonization in AVNM or DSS pretreated mice. C57BL / 6 mice were pretreated with AVNM antibiotics or 2% DSS, then orally gavaged with MTB (2A5) bacteria for three consecutive days at 1 x 10 9 CFU. C: MTB colonized in mouse intestine for at least 30 days after AVNM and 2% DSS treatment. * indicates that the strain bacterial colonization lasted at least 43 days. D: Colonization detection of A. veronii standard strains (TH0426 and ATCC35642) and MTB (2A5) in mice. Solid arrow, bacterial gavage treatment time point; dotted arrow fecal collection time point.

[0032] Figure 10. MTB gavage presents a progressive colitis phenotype and an inflammatory cytokine expression profile characterized by upregulation of Il17. A: Operation scheme of C57BL / 6 gavage with MTB (2A5). Arrow indicates the gavage time point of MTB bacteria. PBS group, n=19; MTB group, n=30. B: Body weight change. C: Disease activity index. D: Dot immunoblotting of mouse fecal bacterial secretions with anti-Aerolysin mAb. E: Colonic morphology. Scale bar = 1 cm. F: Colonic length. G: Colonic Swiss roll H&E staining. Scale bar = 100 pm. H: Colonic tissue section pathological scoring. I and J: Immunohistochemical staining of CX3CR1+ and F4 / 80+ macrophages under the colonic epithelium of mice from PBS and MTB (2A5) groups. Scale bar = 50 pm. K: Histogram of CX3CR1+ macrophage number in colonic lamina propria. Statistical mean is shown on the graph. L: Relative expression level of cytokine mRNA in distal colon. M: Relative expression level of chemokine mRNA in distal colon. *p<0.05, **p<0.01.

[0033] Figure 11. MTB infection can disrupt the resident macrophage barrier. A: Protein immunoblotting of bacterial supernatant of MTB (2A5), ATCC35624, TH0426 using anti-Aerolysin mAb. B and C: Immunohistochemical staining of macrophages in mouse colonic lamina propria with anti-CX3CR1 or anti-F4 / 80 antibody, experimental scheme see Figure 2.8D. PBS group, n=9; MTB (2A5) group, n=15; TH0426 group, n=8; ATCC35624 group, n=13. Scale bar = 50 pm. D: Histogram of CX3CR1+ macrophage number in colonic lamina propria, statistical mean is marked on the graph. Each circle represents a different counting field. PBS, n=254; MTB (2A5), n=450; TH0426, n=217; ATCC35624, n=425. One-way ANOVA analysis was performed between each group and MTB (2A5) group. *p<0.05, **p<0.01.

[0034] Figure 12. Amplification of UC fecal aerolysin gene. Fresh feces were collected and cultured in LB medium, followed by PCR of aerolysin gene using ASAl primers on bacterial suspension. Amplification reaction using E. coli 16S rRNA (RRS) primers was used as internal control of PCR reaction. The percentage of BMDM survival rate shown represents the cytotoxicity of fecal bacterial culture supernatant on BMDM, data from Figure 2B.

[0035] Figure 13. Preparation and specificity of murine anti-Aerolysin monoclonal antibody. A: Flow chart of preparation of murine anti-Aerolysin monoclonal antibody. B: Immunoblotting of 100 ng GST-Aerolysin protein with anti-Aerolysin monoclonal antibody at 1:50,000 dilution. The right lane is DH5a whole protein as negative control. C: Detection of Aerolysin monoclonal antibody in MTB, MTB plus normal fecal bacteria (Normal) and supernatant of normal fecal bacteria culture. D: Immunofluorescence staining of HT-29 and Raw264.7 treated with labeled concentration of GST-Aerolysin for 1 hour using Aerolysin monoclonal antibody. PBS treatment is set as control. Aerolysin (green), nucleus (blue).

[0036] Figure 14. Aerolysin invades colonic mucosa and muscle layer of UC patients. UC colonic resection samples (UC, n=10) and colonic cancer adjacent normal tissue resection samples (CCA-N, n=5) were collected to detect Aerolysin protein distribution. A: Immunohistochemical staining of UC and CCA-N tissue sections with anti-Aerolysin monoclonal antibody. The lower panel is the magnified view of the black box area in the upper panel. B: Western blot analysis of colonic mucosa and muscle layer tissues of UC and CCA-N samples with anti-Aerolysin monoclonal antibody. β-actin was used as internal control protein. MTB bacterial culture supernatant was used as Aerolysin positive control. Ac, ascending colon; Sc, sigmoid colon; Tc, transverse colon.

[0037] Figure 15. Aerolysin is a key pathogenic factor of MTB. A: Schematic diagram of the procedure for constructing MTB Δaerolysin with a deletion of 20-655 bp region of aerolysin gene using Pre112 suicide plasmid. B: PCR verification of the deletion of aerolysin gene fragment. C: Verification of Aerolysin protein expression in MTB Δaerolysin bacteria using anti-Aerolysin monoclonal antibody. Coomassie blue staining of whole bacterial protein was used as internal control. D: Cell survival rate of Raw264.7 treated with supernatant of wild type and Aerolysin protein knockout MTB culture. WT, MTB; KO, MTB Δaerolysin .

[0038] Figure 16. Anti-Aerolysin neutralizing antibodies can effectively treat MTB-induced colitis. A: Anti-Aerolysin neutralizing antibody treatment of MTB-induced colitis model protocol. Grey arrows, intraperitoneal injection of 200 pg of anti-Aerolysin antibody (Ab) or PBS control (ctr) time points; black arrows, MTB gavage time points. MTB+Ab, MTB colitis group receiving antibody treatment (n=12); MTB+Ctr, MTB colitis group receiving control PBS treatment (n=13). B: Body weight change. C: Disease activity index. D: Colonic morphology plot. E: Colonic length histogram. F: Colonic tissue section H&E staining morphology plot. G: Colonic tissue section histopathology score. H and I: Immunohistochemistry staining of CX3CR1+and F4 / 80+macrophages in the subepithelium of the proximal, middle, and distal colon of mice from the MTB+Ab and MTB+Ctr groups. Scale bar = 50 pm. J: Histogram of the number of CX3CR1+macrophages in the colonic lamina propria. Statistical mean values are shown on the plots. K: Relative expression levels of cytokine mRNAs in the distal colon. L: Relative expression levels of chemokine mRNAs in the distal colon. *p<0.05, **p<0.01.

[0039] Figure 17. Active Aerolysin protein 1-148 aa is the key antigenic site for the production of neutralizing antibodies. A: GST-Aerolysin 1-148 aa, GST-Aerolysin 149-296 aa, GST-Aerolysin 297-443 aa protein expression plasmid construction map. B: GST-Aerolysin 1-148 aa, 149-296 aa, 297-443 aa expression and purification. Arrow indicates the position of the corresponding GST-Aerolysin peptide, the lower layer is the broken GST, Aerolysin peptide protein. C: Western blot using the polyclonal antibodies prepared using GST-Aerolysin 1-148 aa, GST-Aerolysin 149-296 aa, GST-Aerolysin 297-443 aa proteins to detect Aerolysin in MTB, MTB plus normal fecal bacteria (Normal), and supernatant after culture of normal fecal bacteria. Primary antibody was used at a dilution of 1:50,000. D: Cytotoxicity neutralization experiment using GST-Aerolysin 1-148 aa, 149-296 aa, 297-443 aa immunized antibodies. E: Swiss-Model prediction of the tertiary structure of the Aerolysin sequence protein used in this experiment. The black label shows the spatial structure of the 1-148 aa sequence. F: Cytotoxicity neutralization experiment using monoclonal antibodies produced by different hybridomas prepared from the spleen cells of mice immunized with GST-Aerolysin 1-148 aa.

[0040] Figure 18. Aerolysin NA vaccine can effectively prevent MTB-induced colitis. A: Aerolysin NA vaccine treatment MTB-induced colitis model protocol. Grey dotted arrow, time point of intraperitoneal injection of Aerolysin NA vaccine (Vaccine, n=10) or PBS control vaccine (Ctr, n=14); black arrow, time point of MTB gavage. B: Body weight change. C: Disease activity index. D: Colonic morphology graph. E: Colonic length histogram. F: Colonic tissue section H&E staining morphology graph. G: Colonic tissue section pathological score. H: Relative expression level of cytokine mRNA in distal colon. *p<0.05, **p<0.01. DETAILED DESCRIPTION

[0041] DEFINITIONS

[0042] The term "and / or" means any single item listed, as well as all possible combinations of those items.

[0043] The term "about" refers to a range of plus or minus 10% of the value, e.g., "about 5" means 4.5 to 5.5.

[0044] The term "subject" can be any animal, such as a mammal. The subject can be a human, a non-human primate (e.g., a monkey, a baboon, or a chimpanzee), a horse, a cow, a pig, a sheep, a goat, a dog, a cat, a rabbit, a guinea pig, a hamster, a rat, or a mouse. The subject includes, for example, a transgenic animal or a genetically modified (e.g., knocked out or knocked in) animal.

[0045] The term "aerolysin" is a pore-forming toxin protein secreted by bacteria of the genus Aeromonas, which is secreted as an inactive dimeric precursor, and activated to an active form by proteolytic cleavage of a C-terminal peptide segment (about 22 amino acids). The active form of Aerolysin can bind to a cell membrane surface glycosylphosphatidylinositol (GPI)-anchored protein, and polymerize into a heptameric complex, which inserts into the cell membrane to form a membrane pore, causing ion imbalance, and disrupting the ion balance and osmotic stability of the cell, thereby mediating cytotoxicity, and further leading to cell swelling, vacuolization, and eventually cell rupture and lysis. In the present invention, the term "aerolysin" includes the inactive precursor form, the active form after cleavage of the C-terminal peptide segment, the monomeric form, and the polymeric form (e.g., dimeric or heptameric form). In the present invention, the term "aerolysin" includes aerolysin secreted by bacteria of any species of the genus Aeromonas. Depending on the specific species or subspecies, bacteria of the genus Aeromonas (e.g., A. veronii) can secrete different aerolysins that differ in amino acid sequence, and the term aerolysin in the present invention is intended to include all such different aerolysins. Aerolysin of the present invention also includes functional fragments that retain its pore-forming function, such as the domain of aerolysin that interacts with the GPI-anchored protein, which is domain 1 located at the N-terminus of aerolysin. Known amino acid sequences of aerolysin can be obtained from the NCBI database, and exemplary amino acid sequences of aerolysin can be found in any one of SEQ ID NOs: 1 to 21 in the Sequence Listing of the present invention. Exemplary sequences of active form of aerolysin can be found in any one of SEQ ID NOs: 180 to 184 in the Sequence Listing of the present invention. In the present invention, the term "aerolysin" includes aerolysin protein, DNA encoding aerolysin protein, and its transcript (mRNA).

[0046] The term "Aeromonas" is also known as Gas-producing Bacillus, belongs to Aeromonadaceae, is a facultative anaerobic gram-negative bacteria commonly found in water environment. At present, there are at least 36 species of Aeromonas with clear classification, including Aeromonas allosaccharophila, Aeromonas aquatica, Aeromonas aquatilis, Aeromonas australiensis, Aeromonas bestiarum, Aeromonas bivalvium, Aeromonas cavernicola, Aeromonas caviae, Aeromonas crassostreae, Aeromonas dhakensis, Aeromonas diversa, Aeromonas encheleia, Aeromonas enterica, Aeromonas eucrenophila, Aeromonas finlandiensis, Aeromonas fluvialis, Aeromonas hydrophila, Aeromonas intestinalis, Aeromonas jandaei, Aeromonas media, Aeromonas molluscorum, Aeromonas lacus, Aeromonas lusitana, Aeromonas piscicola, Aeromonas popoffii, Aeromonas rivipollensis, Aeromonas rivuli, Aeromonas salmonicida, Aeromonas sanarellii, Aeromonas schubertii, Aeromonas simiae, Aeromonas sobria, Aeromonas taiwanensis, Aeromonas tecta, Aeromonas trota and Aeromonas veronii. There are about 3000 unclassified species.A comprehensive list of Aeromonas species and their classification is accessible in the NCBI Taxonomy database (Schoch CL, et al. NCBI Taxonomy: a comprehensive update on curation, resources and tools. Database (Oxford). 2020: baaa062. PubMed: 32761142 PMC: PMC7408187.) Among these Aeromonas, A. caviae, A. veronii, A. dhakensis and A. hydrophila are the most frequently isolated subspecies from human feces. Infections with these species usually result in acute gastroenteritis syndrome, wound infections or bacteremia. While these diseases can be fatal in immunocompromised patients, they are usually self-healing, self-limiting diseases. In the present invention, “Aeromonas” includes all species and subspecies of the genus.

[0047] The term “inhibitor” refers to a substance that inhibits the expression, activity and / or level of another substance, e.g. aerolysin. Functional or physiological antagonism occurs when two substances have opposite effects on the same physiological function. Chemical antagonism or inactivation is a reaction between two substances that neutralizes their effects, e.g. the binding of an antibody to an antigen, which prevents the antigen from acting on its target. The term “inhibit” or “reduce” refers to a decrease or reduction in a particular level or activity of a target, e.g. the level or activity of the target is little or substantially not detectable, including a reduction of about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or about 100% compared to a control that has not been inhibited. Examples of this type of inhibitors are antibodies, small nucleic acid molecules (e.g. ASOs or interfering RNA molecules such as siRNA, miRNA and shRNA), aptamers. Other examples include substances that attenuate or eliminate the transcription or translation of an endogenous gene encoding aerolysin, e.g. small molecule compounds or gene editing complexes.

[0048] As used herein, the term "antibody" generally refers to a polypeptide of the immunoglobulin family that is capable of non-covalently, reversibly, and in a specific manner binding to a corresponding antigen. For example, a naturally occurring IgG antibody is a tetramer that comprises at least two heavy (H) chains and two light (L) chains that are inter-connected by disulfide bonds. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain the binding domain that interacts with an antigen. The constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. The term "antibody" includes, but is not limited to, monoclonal antibodies, human antibodies, humanized antibodies, camelid antibodies, and chimeric antibodies. Antibodies can be of any isotype / class (e.g., IgG, IgE, IgM, IgD, IgA, and IgY) or subclass (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2).

[0049] The term“complementarity determining domain” is used interchangeably herein with the term“complementarity determining region” (“CDR”) and generally refers to the hypervariable regions of VL and VH. CDRs are the target protein binding sites of antibody chains, which are specific for such target proteins. There are three CDRs (CDR1-3, numbered in order starting from the N-terminus) in each human VL or VH, which constitute about 15% to 20% of the variable domain. CDRs can be referred to by their region and order. For example, both“VH CDR1” or“HCDR1” refer to the first CDR of the heavy chain variable region. CDRs are structurally complementary to the epitope of a target protein, and thus are directly responsible for binding specificity. The remaining segments of a VL or VH, the so-called framework regions, exhibit less variation in amino acid sequence (Kuby, Immunology, 4th Ed., Chapter 4, W. H. Freeman & Co., New York, 2000). In the art, CDRs of an antibody can be defined by various methods, such as the Kabat definition rules based on sequence variability (see Kabat et al., protein sequence in immunology, 5th Ed., National Institutes of Health, Bethesda, MD, 1991), the Chothia definition rules based on structural loop region positions (see Al-Lazikani et al., J Mol Biol, vol. 273: p. 927-948, 1997), and the IMGT definition rules based on IMGT-ONTOLOGY concepts and IMGT scientific chart rules. In certain embodiments, the present application uses the IMGT rules to define CDRs of an antibody. The present application also includes the definition rules of Martin, PyIgClassify, and the joint definition rules of Kabat, Chothia, IMGT, Martin, and PyIgClassify. (See Mark L. Chiu et al., Antibodies 8(4), 55, 2019).

[0050] Table A. Numbering system of amino acids for each region (with Chothia numbering)

[0051] wherein Laa-Lbb or Haa-Hbb can refer to the amino acid sequence from No. aa to No. bb of the light chain or the heavy chain, respectively, starting from the N-terminus. For example, L24-L34 refers to the amino acid sequence from the 24th to the 34th amino acid in the light chain.

[0052] The term "antigen binding fragment" generally refers to a polypeptide that includes one or more portions of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilization / de-stabilization, spatial distribution) an epitope of an antigen. Examples of binding fragments include, but are not limited to, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv), Fab fragments, F(ab') fragments, monovalent fragments consisting of the VL, VH, CL, and CH1 domains; F(ab')2 fragments, bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region; Fd fragments consisting of the VH and CH1 domains; Fv fragments consisting of the VL and VH domains of a single arm of an antibody; dAb fragments (Ward et al., Nature, vol. 341 : pp. 544-546, 1989), which consist of a VH domain; and an isolated complementarity determining region (CDR) or other epitope-binding fragment of an antibody. Antigen binding fragments can also include single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology, vol. 23 : pp. 1126-1136, 2005). Antigen binding fragments can also include single chain molecules comprising a pair of tandem Fv segments (VH-CH1-VH-CH1) that, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al., Protein Eng., vol. 8: pp. 1057-1062, 1995). Fragments of a conventional antibody can also be a single domain antibody, such as a heavy chain antibody or VHH.

[0053] In this invention, in the context of two or more nucleic acid or polypeptide sequences, the term "percentage of similarity" or "identity percentage" refers to the degree to which two or more sequences or subsequences are identical. Two sequences are "identical" if they have the same amino acid or nucleotide sequence in the region being compared. When comparing and aligning sequences with maximum correspondence in a comparison window or designated region, or when measured by manual alignment and visual inspection, two sequences are "substantially identical" if they have the same specified percentage of amino acid residues or nucleotides (i.e., 60% identity in the designated region or, when not specified, throughout the entire sequence, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity). Optionally, the identity exists in regions of at least about 30 nucleotides (or 10 amino acids) in length, or more preferably in regions of 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length. Two examples of algorithms suitable for determining the percentage of sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in the following: Altschul et al., Nuc. Acids Res., Vol. 25: pp. 3389-3402, 1977; and Altschul et al., J. Mol. Biol., Vol. 215: pp. 403-410, 1990.

[0054] In this invention, the term "peptide" is used interchangeably with the term "protein" and refers to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of naturally occurring amino acids, as well as to both naturally occurring and non-naturally occurring amino acid polymers. Unless otherwise stated, a particular peptide sequence also implicitly encompasses variants with conserved modifications.

[0055] The term "small molecule" refers to organic molecules with a molecular weight of less than about 2500 amu, less than about 2000 amu, less than about 1500 amu, less than about 1000 amu, or less than about 750 amu. Small molecules may contain one or more heteroatoms.

[0056] As used herein, the term "aptamer" refers to an oligonucleotide (typically an RNA molecule) that is attached to a specific target. "Aptamer" can refer to an oligonucleotide aptamer (e.g., an RNA aptamer). As used herein, the term "aptamer" refers to a DNA or RNA molecule selected from a random pool based on its ability to bind other molecules. Aptamers have been selected to bind nucleic acids, proteins, small organic compounds, and even entire organisms.

[0057] The term "effective amount" refers to the amount of an active agent sufficient to elicit the desired biological response (or equivalently to inhibit an undesired biological response). The absolute amount of a particular agent that is effective can vary according to factors such as the desired biological endpoint, the agent to be delivered, the target tissue, and the like. An "effective amount" can be administered in a single dose or multiple doses. For example, an effective amount of a therapeutic agent can be an amount sufficient to alleviate at least one symptom of a disease. An effective amount can be an amount sufficient to slow the progression of a chronic and progressive disease, e.g., to increase the time before one or more symptoms or signs of the disease appear, or to increase the time before an individual with the disease reaches a certain level of impairment. An effective amount can be an amount sufficient to allow a greater or faster recovery from a disease than in the absence of the agent. For purposes of this application, an effective amount of a drug, compound, or pharmaceutical composition is an amount that is sufficient to achieve a prophylactic or therapeutic treatment, directly or indirectly. As is understood in a clinical setting, an effective amount of an inhibitor or a pharmaceutical composition thereof can be used in conjunction with or without another drug, compound, or pharmaceutical composition. The term "therapeutically effective amount" refers to an amount that is sufficient to achieve a desired therapeutic result. A "prophylactically effective amount" refers to an amount that prevents the development or onset of a disease or its symptoms or reduces the severity of a disease symptom.

[0058] As used herein, "activity" refers to one or more forms of a polypeptide that retains a biological activity of a native or naturally occurring polypeptide, where "biological" activity refers to a biological function elicited by the native or naturally occurring polypeptide (e.g., pore-forming function, cell (e.g., macrophage) toxicity / killing function).

[0059] As used herein, the term "diagnosing" refers to a method by which it can be determined whether a subject is likely to have a given disease or condition (e.g., UC). A person of skill in the art will typically make a diagnosis based on one or more diagnostic indicators, such as a marker, whose presence, absence, amount, or change in amount is indicative of the presence, severity, or absence of a disease or condition. Other diagnostic indicators can include patient history; changes in physical symptoms, such as vital signs or phenotypes, genotypes, or environmental or genetic factors, and the like. A person of skill in the art will appreciate that the term "diagnosing" refers to an increased likelihood that a certain course or outcome will occur; that is, a patient exhibiting a given characteristic (e.g., the presence or level of a diagnostic indicator) is more likely to experience that course or outcome than an individual not exhibiting the given characteristic. The diagnostic methods of the present application can be used independently, or in combination with other diagnostic methods, to determine whether a course or outcome is more likely to occur in a patient exhibiting a given characteristic.

[0060] "Measuring nucleic acid levels" refers to the direct or indirect detection of a nucleic acid (e.g., mRNA) by methods known in the art. Methods of measuring mRNA levels typically include, but are not limited to, Northern blotting, nuclease protection assays (NPA), in situ hybridization (ISH), RT-PCR, and RNA sequencing (RNA-Seq).

[0061] “Determining protein levels” refers to the direct or indirect detection of a protein by methods known in the art. Methods of measuring protein levels generally include, but are not limited to, Western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, surface plasmon resonance, chemiluminescence, fluorescence polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, liquid chromatography (LC)-mass spectrometry, microcytometry, microscopy, fluorescence-activated cell sorting (FACS), and flow cytometry, as well as assays based on the properties of the protein, including but not limited to enzymatic activity or interaction with other protein partners.

[0062] As used herein, the term “specifically binds” refers to an antibody binding to an epitope on a predetermined antigen. Typically, the affinity (KD) of the antibody binding is about less than 10 -7 M, for example, about less than 10 -8 M, 10 -9 M or 10 -10 M, or even lower, which can be performed, for example, using recombinant aerolysin as the analyte and the antibody as the ligand. In some embodiments, the binding of the antibody to the predetermined antigen has an affinity that is at least two-fold greater than its binding affinity to a non-specific antigen other than the predetermined antigen or a closely related antigen (e.g., BSA, casein).

[0063] As used herein, the term “vector” means, including but not limited to, a nucleic acid molecule that expresses a gene or coding sequence of interest, for example, a coding sequence that encodes an antibody. Thus, one type of vector is a viral vector, in which an additional DNA segment (e.g., a transgene, e.g., a transgene that encodes an aerolysin or immunogenic fragment thereof of the application) can be ligated into the viral genome and the viral vector can then be administered to a subject (e.g., by electroporation, e.g., electroporation into muscle tissue) to allow expression of the transgene in a manner analogous to gene therapy. Another type of vector is a “plasmid,” which refers to a circular double stranded DNA loop, into which additional DNA segments can be ligated. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “recombinant expression vectors” (or simply, “expression vectors”). In general, expression vectors of utility in recombinant DNA technologies are generally in the form of plasmids.

[0064] A“gene editing complex” refers to a complex comprising a programmable DNA binding protein and a guide nucleic acid. Gene editing complexes include, but are not limited to, CRISPR-Cas system, zinc finger nuclease (ZFN) or transcription activator-like effector nuclease (TALEN) based technologies, and the subject of gene editing can be DNA or RNA of a gasolysin. A CRISPR-Cas targeting a gasolysin is, for example, a CRIPSR-Cas9 system comprising a guide RNA targeting binding to DNA of a gasolysin to cleave the gasolysin DNA as a whole or in fragments. An example of a gene editing complex can also be a base editor or an epigenetic editor to reduce the expression level of a gasolysin.

[0065] As used herein, the term“programmable DNA binding protein” refers to any protein that can bind (e.g., form a complex) with one or more nucleic acid molecules complementary to one or more nucleic acid molecules (or a portion or region thereof) associated with the protein, and direct or otherwise program the protein to localize to a specific target nucleotide sequence (e.g., a locus of a genome), such that the protein binds to the nucleotide sequence at the specific target site. Exemplary programmable DNA binding proteins include one or more zinc finger protein domains (ZFPs) or transcription factor effector domains (TALEs). The nucleic acid targeting domain can also be a CRISPR effector polypeptide or a CRISPR effector functional variant.

[0066] A“zinc finger nucleotide binding domain” (ZFP) typically contains 3-6 individual zinc finger repeat sequences, each of which can recognize a unique sequence of, for example, 3 bp. By combining different zinc finger repeat sequences, different genomic sequences can be targeted. A“transcription activator-like effector domain” is a DNA binding domain of a transcription activator-like effector (TALE). TALEs can be engineered to bind to almost any desired DNA sequence. A“CRISPR effector protein” generally refers to a nuclease (CRISPR nuclease) or functional variant thereof that is found in a naturally occurring CRISPR system. Any effector protein based on the CRISPR system that is capable of achieving sequence-specific targeting within a cell. Programmable DNA binding proteins include CRISPR-Cas effector proteins. CRISPR-Cas effector proteins can be Type I nuclease inactive Cas protein systems, Type II Cas proteins with single strand cleavage activity, Type II nuclease inactive Cas proteins, Type V nuclease inactive Cas proteins. Specifically, Type I nuclease inactive Cas protein systems can be Type I-A, Type I-B, Type I-C, Type I-U, Type I-D, Type I-E, and Type I-F nuclease inactive Cas proteins.

[0067] “RNA interference” (RNAi) refers to the process by which nucleic acid molecules induce the cleavage and degradation of target RNA molecules, such as mRNA molecules, in a sequence-specific manner, for example, through the RNA-induced silencing complex (RISC) pathway. RNAi agents herein include siRNA, shRNA, miRNA, and DNA / RNA hybrid molecules, sometimes collectively referred to herein as double-stranded RNA (dsRNA), which comprise two antiparallel, contiguous strands of nucleotides that are sufficiently complementary to hybridize to form a double-stranded region. “Hybridization” refers to the pairing of complementary polynucleotides, typically through hydrogen bonding between complementary bases on the two polynucleotides (e.g., Watson-Crick, Wobble, Hoogsteen, or reverse Hoogsteen hydrogen bonding). A “double-stranded region” refers to a region of two complementary or substantially complementary polynucleotides that form base pairs by hybridization, thereby forming a duplex between the two polynucleotide strands. “siRNA” refers to a nucleic acid forming a double-stranded RNA that has the ability to reduce or inhibit expression of a target gene when the siRNA is present in the same cell as the target gene. siRNAs are typically about 15 to about 30 base pairs in length, most typically about 19 to 25 base pairs in length, for example, 19, 20, 21, 22, 23, 24, or 25 nucleotide pairs in length. siRNA inhibition of a target can typically be achieved by introducing an artificially chemically synthesized siRNA molecule into a cell. shRNA refers to a short hairpin RNA that includes two short inverted repeat sequences and a middle stem loop structure connecting the two. The stem loop can comprise at least one unpaired nucleotide, for example, can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23, or more unpaired nucleotides. The stem loop can be 10 or fewer nucleotides. The stem loop can be 8 or fewer unpaired nucleotides. The stem loop can be 4 to 10 unpaired nucleotides. The stem loop can be 4 to 8 nucleotides. shRNA inhibition of a target expression can typically be achieved by cloning it into an expression vector and expressing a processed siRNA duplex molecule specific for the target.

[0068] As used herein, “antisense oligonucleotide” or “ASO” refers to a single-stranded oligonucleotide that is capable of binding specifically to a target RNA (such as an mRNA) sequence and modulating expression of a protein (such as a gasdermin).

[0069] As described herein, an RNAi agent or "antisense oligonucleotide" can comprise a non-oligonucleotide moiety, such as a ligand. The term "ligand" refers to a cell or tissue targeting agent that binds to a specified cell type, such as a hepatocyte, for example a lectin, glycoprotein, lipid, or protein (e.g., an antibody). Exemplary targeting agents include thyroid stimulating hormone, melanocyte stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, multivalent lactose, multivalent galactose, N-acetylgalactosamine (GalNAc), multivalent (e.g., bivalent or trivalent) GalNAc, N-acetylglucosamine, multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonates, polyglutamate, polyaspartate, cholesterol, steroids, bile acids, folate, vitamin B12, biotin, RGD peptides and RGD peptide mimetics. In preferred embodiments, the ligand is a carbohydrate, such as a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, polysaccharide. For example, the ligand can be a derivative comprising GalNAc. In preferred embodiments, the ligand is a derivative comprising one or more N-acetylgalactosamine attached via a bivalent or trivalent branched linker.

[0070] As used herein, the term "immunogenic protein or peptide" includes polypeptides that are immunologically active, which once administered to a host, are capable of eliciting an immune response, either humoral and / or cellular, against the protein. Preferably, the protein fragment has substantially the same immunological activity as the total protein. Thus, the protein fragments according to the present application comprise or consist of, or consist essentially of at least one epitope or antigenic determinant. As used herein, an "immunogenic" protein or polypeptide includes the full-length sequence of the protein, analogs thereof or immunogenic fragments thereof. By "immunogenic fragment" is meant a fragment of a protein that comprises one or more epitopes and thus elicits the immune response described above. Such fragments can be identified using any number of epitope mapping techniques well known in the art. For example, linear epitopes can be determined by, for example, simultaneously synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Similarly, conformational epitopes can be readily identified by, for example, determining the spatial conformation of an amino acid sequence by, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance. The term "immunogenic protein or peptide" further encompasses deletions, additions and substitutions of sequences as long as the polypeptide functions to produce an immune response as defined herein. The term "conservative variation" means the substitution of an amino acid residue with another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue is not changed or is another biologically similar residue. In this regard, particularly preferred substitutions are generally conservative in nature, i.e., those that take place within a family of amino acids, for example. For instance, amino acids can be generally divided into four families: (1) acidic - aspartic acid and glutamic acid; (2) basic - lysine, arginine, histidine; (3) non-polar - alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar - glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as aspartic acid for glutamic acid or vice versa, or the substitution of one acidic residue for another, such as aspartic acid for asparagine or glutamic acid for glutamine and the like; or similar conservative substitutions of amino acids with structurally related amino acids which do not significantly affect the biological activity of the protein. Thus, proteins having substantially the same amino acid sequence as a reference molecule but with minor amino acid substitutions which do not substantially affect the immunogenicity of the protein are within the definition of the reference polypeptide. All polypeptides resulting from these modifications are included herein. The term "conservative variation" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid, provided that the antibody raised against the substituted polypeptide also immunoreacts with the unsubstituted polypeptide.

[0071] An "immune response" to a composition or vaccine is the development of a cell and / or antibody mediated immune response in a host to a composition or vaccine of interest. Generally, an "immune response" includes, but is not limited to, one or more of the following effects: the production of antibodies, B cells, helper T cells, and / or cytotoxic T cells, specific to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will exhibit a therapeutic or protective immune response, thereby increasing resistance to new infection and / or decreasing the clinical severity of disease. Such protection will be evidenced by a lessening or absence of symptoms normally exhibited by infected hosts, faster recovery time, and / or a decrease in viral titers in infected hosts.

[0072] The terms "derived from" and "derived" refer not only to proteins produced by or producible from a strain of the organism in question, but also to proteins encoded by DNA sequences isolated from such strains and produced in host organisms containing such DNA sequences. In addition, the terms refer to proteins encoded by synthetic and / or cDNA-derived DNA sequences and having the identifying characteristics of the protein in question. For example, "proteases derived from Bacillus" refers to those enzymes having proteolytic activity naturally produced by Bacillus, as well as serine proteases such as those produced from Bacillus sources but produced by using genetic engineering techniques from other host cells transformed with nucleic acids encoding serine proteases.

[0073] Use of a gasdermin inhibitor in the prevention or treatment of ulcerative colitis

[0074] A first aspect of the present invention relates to the use of a gasdermin inhibitor in the prevention or treatment of ulcerative colitis.

[0075] In some embodiments, the present invention provides the use of a gasdermin inhibitor in the manufacture of a medicament for preventing or treating ulcerative colitis in a subject. In some embodiments, the present invention provides a method of preventing or treating ulcerative colitis in a subject, the method comprising administering to the subject a prophylactically or therapeutically effective amount of a gasdermin inhibitor. In some embodiments, the present invention provides a gasdermin inhibitor for use in preventing or treating ulcerative colitis in a subject.

[0076] In the present application, the aerolysin can be any aerolysin from any aerolysin secreting species of Aeromonas. Aerolysin secreting species of Aeromonas include, but are not limited to, Aeromonas allosaccharophila, Aeromonas aquatica, Aeromonas aquatilis, Aeromonas australiensis, Aeromonas bestiarum, Aeromonas bivalvium, Aeromonas cavernicola, Aeromonas caviae, Aeromonas crassostreae, Aeromonas dhakensis, Aeromonas diversa, Aeromonas encheleia, Aeromonas enterica, Aeromonas eucrenophila, Aeromonas finlandiensis, Aeromonas fluvialis, Aeromonas hydrophila, Aeromonas intestinalis, Aeromonas jandaei, Aeromonas media, Aeromonas molluscorum, Aeromonas lacus, Aeromonas lusitana, Aeromonas piscicola, Aeromonas popoffii, Aeromonas rivipollensis, Aeromonas rivuli, Aeromonas salmonicida, Aeromonas sanarellii, Aeromonas schubertii, Aeromonas simiae, Aeromonas sobria, Aeromonas taiwanensis, Aeromonas tecta, Aeromonas trota, and Aeromonas veronii. In preferred embodiments, the aerolysin can be an aerolysin from Aeromonas veronii, sobria, DNP9, FDAARGOS1411, allosaccharophila, HMWF015, Y318-3, JL9, australiensis, 159, jandaei, or hydrophila. In preferred embodiments, the aerolysin can be an aerolysin from Aeromonas veronii.Exemplary amino acid sequences of aerolysin of Aeromonas veronii can be found in GenBank: ABJ52834.1, GenBank: VXA89029.1, and GenBank: OCQ43994.1. In some embodiments, the aerolysin can be any aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-21 and 180-184, or an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to each of them. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-21. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-5 and 180-184. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 1. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 2. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 3. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 4. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 5. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 180. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 181. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 182. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 183. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 184.

[0077] In the present application, an aerolysin inhibitor includes any substance that inhibits the expression and / or activity and / or (DNA / mRNA / protein) level of aerolysin, including but not limited to an antibody or antigen-binding fragment thereof, a small nucleic acid molecule, an aptamer, a small molecule compound, and a gene editing complex.

[0078] In some embodiments, the gasdolin inhibitor is an antibody or antigen-binding fragment thereof against gasdolin. In some embodiments, the anti-gasdolin antibody interferes with the association of gasdolin with GPI-anchored proteins. In some embodiments, the anti-gasdolin antibody is a polyclonal antibody or a monoclonal antibody. In some embodiments, the anti-gasdolin antibody is a monospecific antibody or a multispecific antibody. In some embodiments, the anti-gasdolin antibody is a humanized antibody or a human antibody (i.e., a fully human antibody). In some embodiments, the anti-gasdolin antibody is a chimeric antibody or a non-human antibody (e.g., a mouse antibody, a rat antibody, a rabbit antibody). In some embodiments, the anti-gasdolin antibody binds to a domain of gasdolin comprising an N-terminal 1-148 amino acid fragment of gasdolin, such as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the anti-gasdolin antibody binds to domain 1 (e.g., a 1-108, 1-113, 24-108, or 24-113 amino acid fragment, residues numbered according to SEQ ID NO: 180) of gasdolin. In some embodiments, the anti-gasdolin antibody binds to domain 1 (e.g., a 1-108, 1-113, 24-108, or 24-113 amino acid fragment, residues numbered according to SEQ ID NO: 180) and domain 2 (e.g., a 109-199 or 114-199 amino acid fragment, residues numbered according to SEQ ID NO: 180) of gasdolin. In some embodiments, the anti-gasdolin monoclonal antibody comprises a light chain variable region and a heavy chain variable region, the heavy chain variable region comprising HCDR1, HCDR2, and HCDR3, the light chain variable region comprising LCDR1, LCDR2, LCDR3, wherein the sequences of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3 are selected from the group consisting of:

[0079] (a) SEQ ID NOs: 36, 37, 38, 54, 55, and 56;

[0080] (b) SEQ ID NOs: 39, 40, 41, 57, 58, and 59;

[0081] (c) SEQ ID NOs: 42, 43, 44, 60, 61, and 62;

[0082] (d) SEQ ID NOs: 45, 46, 47, 63, 64, and 65;

[0083] (e) SEQ ID NOs: 48, 49, 50, 66, 67, and 68;

[0084] (f) SEQ ID NOs: 51, 52, FGH, SEQ ID NOs: 69, 70, and 71;

[0085] (g) SEQ ID NO: 51, 52, 73, SEQ ID NO: 72, 73, and 74.

[0086] In some embodiments, the sequences of the light chain variable region and the heavy chain variable region of the anti-aerolysin monoclonal antibody are selected from:

[0087] (a) SEQ ID NO: 23 and 24;

[0088] (b) SEQ ID NO: 25 and 26;

[0089] (c) SEQ ID NO: 27 and 28;

[0090] (d) SEQ ID NO: 29 and 30;

[0091] (e) SEQ ID NO: 31 and 32;

[0092] (f) SEQ ID NO: 33 and 34; and

[0093] (g) SEQ ID NO: 33 and 35.

[0094] Accordingly, in some embodiments, the present application provides the use of an aerolysin antibody or antigen-binding fragment thereof in the manufacture of a medicament for preventing or treating ulcerative colitis in a subject. Accordingly, in some embodiments, the present application provides a method of preventing or treating ulcerative colitis in a subject, the method comprising administering to the subject a prophylactically or therapeutically effective amount of an aerolysin antibody or antigen-binding fragment thereof. In some embodiments, the present application provides an aerolysin antibody or antigen-binding fragment thereof for use in preventing or treating ulcerative colitis in a subject.

[0095] In certain embodiments, phage display technology is used to produce monoclonal antibodies. In certain embodiments, the technology produces fully human monoclonal antibodies. In certain embodiments, polynucleotides encoding individual Fab or Fv antibody fragments are expressed on the surface of phage particles. See, e.g., Hoogenboom et al., J. Mol. Biol., 227:381 (1991); Marks et al., J Mol Biol 222:581 (1991); U.S. Patent No. 5,885,793. In certain embodiments, "pools" of phage are "screened" to determine antibody fragments having affinity for a target. Thus, certain of the processes mimic immune selection by displaying a library of antibody fragments on the surface of filamentous phage and then selecting phage by virtue of their binding to a target. In certain of the procedures, high affinity, functional neutralizing antibody fragments are isolated. In certain of the embodiments, a complete human antibody gene library is generated by cloning naturally rearranged human V genes from peripheral blood lymphocytes. See, e.g., Mullinax et al., Proc Natl Acad Sci (USA), 87:8095-8099 (1990).

[0096] According to certain embodiments, antibodies of the application are produced by utilizing transgenic mice having inserted a substantial portion of the human antibody- producing genome, and which are incapable of producing endogenous murine antibodies. Thus, the mice are capable of producing human immunoglobulin molecules and antibodies, while being deficient in the production of murine immunoglobulin molecules and antibodies. In certain embodiments, one can employ methods disclosed, e.g., in PCT Publication No. WO 98 / 24893 or Mendez et al., Nature Genetics, 15: 146-156 (1997), which are incorporated herein by reference for any purpose.

[0097] A fully human monoclonal antibody specific for aerolysin can generally be produced as follows. A transgenic mouse containing human immunoglobulin genes is immunized with an antigen of interest (e.g., aerolysin), and lymphocytes (e.g., B-cells) from the antibody-expressing mouse are obtained. The recovered cells are fused with a myeloma cell line to produce immortalized hybridoma cell lines, and the hybridoma cell lines are screened and selected to identify a hybridoma cell line that produces an antibody specific for the antigen of interest. In certain embodiments, a hybridoma cell line is provided that produces an antibody specific for aerolysin.

[0098] As is known, antibodies can be expressed in cell lines other than hybridoma cell lines. A suitable mammalian host cell can be transformed with a sequence encoding a particular antibody. The polynucleotide can be introduced into the host cell by any known method of transformation, including, for example, packaging the polynucleotide into a virus (or viral vector) and transducing the host cell with the virus (or vector) or by transfection procedures known in the art. The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polyethylene glycol-mediated transfection, protoplast fusion, electroporation, polynucleotide encapsulation in liposomes, and direct microinjection of the DNA into the cell nucleus. Mammalian cell lines that can be used as expression hosts are well known in the art, including many immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocarcinoma cells (e.g., Hep G2), human epithelial kidney 293 cells, and a variety of other cell lines. A particular cell line is selected by determining which cell line has the highest expression level and produces antibodies with constitutive gasdermin binding properties.

[0099] In certain embodiments, the antibody comprises at least one immunoglobulin molecule of the IgGl, IgG2, IgG3, IgG4, IgE, IgA, IgD, and IgM isotypes. In certain embodiments, the antibody comprises a human K light chain and / or a human heavy chain. In certain embodiments, the heavy chain is of the IgGl, IgG2, IgG3, IgG4, IgE, IgA, IgD, or IgM isotype. In certain embodiments, the antibody has been cloned for expression in a mammalian cell. In certain embodiments, the antibody comprises a constant region that is not of the IgGl, IgG2, IgG3, IgG4, IgE, IgA, IgD, and IgM isotypes. In certain embodiments, the antibody comprises a human lambda light chain and a human IgG2 heavy chain. In certain embodiments, the antibody comprises a human lambda light chain and a human IgG4 heavy chain. In certain embodiments, the antibody comprises a human lambda light chain and a human IgGl, IgG3, IgE, IgA, IgD, or IgM heavy chain. In other embodiments, the antibody comprises a human K light chain and a human IgG2 heavy chain. In certain embodiments, the antibody comprises a human K light chain and a human IgG4 heavy chain. In certain embodiments, the antibody comprises a human K light chain and a human IgGl, IgG3, IgE, IgA, IgD, or IgM heavy chain. In certain embodiments, the antibody comprises an antibody variable region linked to a constant region that is neither of the IgG2 isotype nor of the IgG4 isotype. In certain embodiments, the antibody has been cloned for expression in a mammalian cell.

[0100] In some embodiments, the gasdermin inhibitor is a small nucleic acid molecule. In some embodiments, the small nucleic acid molecule comprises an antisense oligonucleotide (ASO) targeting gasdermin. In other embodiments, the small nucleic acid molecule comprises an RNAi agent targeting gasdermin, including a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or a microRNA (miRNA).

[0101] Exemplary nucleotide sequences (DNA) of gasdermin genes are available from NCBI. Exemplary DNA encoding gasdermin see GenBank: EF034117.1, GenBank: M16495.1, GenBank: MT491733.1, and GenBank: HQ425626.1. In one exemplary embodiment, the cDNA sequence of a gasdermin gene is set forth in SEQ ID NO: 22.

[0102] It is known in the art how to design siRNAs with better silencing efficiency. For target sequence selection, it is necessary to avoid designing siRNAs from introns, 5' UTR, 3' UTR of a gene. The presence of abundant regulatory protein binding sites in UTRs can affect the binding of RISC and target sequences. In general, the best target sequence region for RNAi silencing is 50-100 bp downstream of the transcription start site of the CDS of a gene. For siRNAs, the length, specificity, and base composition need to be considered. The optimal siRNA length is 19-25 bp, too short reduces specificity, too long is easy to trigger an immune response (especially in mammalian hosts). In general, it is considered acceptable for siRNAs to have less than 78% completely matched sequences in addition to the target sequence. That is, for a 19 bp siRNA, if more than 15 base matches are found outside the target sequence, the specificity of the siRNA is questionable, and there is a risk of off-target. The GC content of siRNA is not conclusive, but it basically fluctuates in the range of 30%-50%. Too low GC content affects the efficiency of siRNA binding to mRNA, and too high makes it difficult for the double-stranded structure to unwind in RISC to form a single-stranded structure with recognition ability. Simple double-stranded structure of siRNA is very important in the process of RISC assembly, so palindromic sequences and highly repetitive sequences should be avoided inside siRNA to prevent the formation of secondary structures and affect the efficiency of RISC formation. The base types at specific positions can be further optimized to increase the silencing efficiency of siRNA. A large number of studies have given different optimization methods. Among them, the tenth U base of siRNA is highly related to silencing efficiency, which may be because the base site of mRNA cut by RISC is between 10-11, and it tends to cut the 3' end of U base. Fakhr, E et al. summarized a large number of online siRNA design tools, which can be referred to in Fakhr, E., Zare, F. & Teimoori-Toolabi, L Precise and efficient siRNA design: a key point in competent gene silencing. Cancer Gene Ther 23, 73-82 (2016).

[0103] In some embodiments, the sense strand and the antisense strand of the RNAi agent of the application are each independently about 17 to about 23 nucleotides in length, for example, about 18 to about 23 nucleotides, about 19 to about 23 nucleotides, about 20 to about 23 nucleotides, about 21 to about 23 nucleotides, about 17 to about 22 nucleotides, about 17 to about 21 nucleotides, about 17 to about 20 nucleotides, about 17 to about 19 nucleotides, about 18 to about 22 nucleotides, about 18 to about 21 nucleotides, about 18 to about 20 nucleotides, about 19 to about 22 nucleotides, about 19 to about 21 nucleotides, or about 20 to about 22 nucleotides. In certain embodiments, the sense strand and the antisense strand are each independently about 17, about 18, about 19, about 20, about 21, about 22, about 23 nucleotides in length.

[0104] In some embodiments, the sense strand and the antisense strand are the same length, but form a double-stranded region that is shorter than the strands, such that the RNAi agent for inhibiting expression of a gasdermin gene has two nucleotide overhangs. For example, in one embodiment, the RNAi agent for inhibiting expression of a gasdermin gene comprises (i) a sense strand and an antisense strand that are each 21 nucleotides in length, (ii) a double-stranded region that is 19 base pairs in length, and (iii) a nucleotide overhang of 1 unpaired nucleotide at the 3' end of the sense strand and the 3' end of the antisense strand. In another embodiment, the RNAi agent for inhibiting expression of a gasdermin gene comprises (i) a sense strand and an antisense strand that are each 23 nucleotides in length, (ii) a double-stranded region that is 21 base pairs in length, and (iii) a nucleotide overhang of 1 unpaired nucleotide at the 3' end of the sense strand and the 3' end of the antisense strand.

[0105] In other embodiments, the sense strand and the antisense strand are the same length, and form a double-stranded region over their entire length, such that there are no nucleotide overhangs at either end of the double-stranded molecule. In one such embodiment, the RNAi agent for inhibiting expression of a gasdermin gene is blunt-ended, and comprises (i) a sense strand and an antisense strand that are each 21 nucleotides in length, and (ii) a double-stranded region that is 21 base pairs in length. In another such embodiment, the RNAi agent for inhibiting expression of a gasdermin gene is blunt-ended, and comprises (i) a sense strand and an antisense strand that are each 23 nucleotides in length, and (ii) a double-stranded region that is 23 base pairs in length. In another such embodiment, the RNAi agent for inhibiting expression of a gasdermin gene is blunt-ended, and comprises (i) a sense strand and an antisense strand that are each 19 nucleotides in length, and (ii) a double-stranded region that is 19 base pairs in length.

[0106] In other embodiments, the sense strand or the antisense strand is longer than the other strand, and the two strands form a double-stranded region equal in length to the shorter strand, such that the RNAi agent for inhibiting expression of a gasdermin gene comprises at least one nucleotide overhang. For example, in some embodiments, the sense strand is 1 to 4 nucleotides longer than the antisense strand, and the two strands form a double-stranded region equal in length to the antisense strand, such that the sense strand forms a 1 to 4 unpaired nucleotide overhang. In other embodiments, the antisense strand is 1 to 4 nucleotides longer than the sense strand, and the two strands form a double-stranded region equal in length to the sense strand, such that the antisense strand forms a 1 to 4 unpaired nucleotide overhang. In some embodiments, the nucleotide overhang is 1, 2, 3, or 4 nucleotides in length. In a particular embodiment, the overhang comprises 2 nucleotides. In certain embodiments, the overhang comprises a single nucleotide.

[0107] The overhanging nucleotides can be ribonucleotides or modified nucleotides as described herein. In some embodiments, the overhanging nucleotides are 2’-modified nucleotides (e.g., 2’-fluoro-modified nucleotides, 2’-O-methyl-modified nucleotides), or combinations thereof. For example, in one embodiment, the overhanging nucleotides are deoxyribonucleotides, e.g., deoxythymidine. In another embodiment, the overhanging nucleotides are 2’-O-methyl-modified nucleotides, 2’-fluoro-modified nucleotides, 2’-methoxyethyl-modified nucleotides, abasic nucleotides, inverted abasic nucleotides, inverted nucleotides, or combinations thereof. In other embodiments, the overhang comprises a 5’-uridine-uridine-3’ (5’-UU-3’) dinucleotide. In such embodiments, the UU dinucleotide can comprise ribonucleotides or modified nucleotides, e.g., 2’-modified nucleotides. In other embodiments, the overhang comprises a 5’-deoxythymidine-deoxythymidine-3’ (5’-dTdT-3’) dinucleotide. When a nucleotide overhang is present in the antisense strand, the nucleotides in the overhang can be complementary to the target gene sequence, form a mismatch with the target gene sequence, or comprise some other sequence (e.g., UU, TT, AA, GG, etc.).

[0108] Nucleotide overhangs can be at the 5' end or the 3' end of one or both strands. For example, in one embodiment, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 5' end and the 3' end of the antisense strand. In another embodiment, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 5' end and the 3' end of the sense strand. In some embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 5' end of the sense strand and the 5' end of the antisense strand. In other embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 3' end of the sense strand and the 3' end of the antisense strand. In some embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 5' end of the sense strand only. In some embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 3' end of the sense strand only. In some embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 3' end of the antisense strand only. In some embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 5' end of the antisense strand only. In some embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 5' end of the sense strand only.

[0109] An RNAi agent for inhibiting expression of a gasdermin gene can comprise a nucleotide overhang at one end of the double-stranded RNA molecule and a blunt end at the other end. By "blunt end" is meant that the sense and antisense strands are completely base-paired at the end of the molecule and there is no unpaired nucleotide extending beyond the double-stranded region. In some embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 3' end of the sense strand and a blunt end at the 5' end of the sense strand and the 3' end of the antisense strand. In other embodiments, an RNAi agent for inhibiting expression of a gasdermin gene comprises a nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand and the 3' end of the sense strand.

[0110] In particular, for example, in one embodiment, an RNAi agent for inhibiting expression of a gasdermin gene comprises (i) a sense strand of 19 nucleotides in length, (ii) an antisense strand of 21 nucleotides in length, the two strands forming a double-stranded region equal in length to the length of the sense strand. In another embodiment, an RNAi agent for inhibiting expression of a gasdermin gene comprises (i) a sense strand of 21 nucleotides in length, (ii) an antisense strand of 23 nucleotides in length, the two strands forming a double-stranded region equal in length to the length of the sense strand.

[0111] The likelihood of off-target effects mediated by antisense RNA designed against a particular region on a gasdermin transcript can be measured using any number of publicly available algorithms, for example, obtained from the online tool siSPOTR.

[0112] In some embodiments, the aerolysin inhibitor is an aptamer. Oligonucleotide aptamers range in size from about 20 to about 80 bases (8 to 25 kDa) and their structure is responsible for intramolecular interactions. Aptamers bind to their targets through interactions between aromatic compounds, through hydrogen-bonded base pairing, van der Waals interactions, and electrostatic interactions between charged groups or hydrogen bonds. Thus, aptamers undergo a conformational change upon target recognition and biomolecular interaction. These biological, physical and chemical properties make these oligonucleotides effective recognition tools for diagnosis and therapy. The use of aptamers in the biological field is limited mainly due to their degradation by nucleases. Chemical modifications are required to protect them from nucleases, to improve their thermal stability and their pharmacokinetic properties. Among these modifications, the exchange of the OH at the 2’-position of the ribose for 2’-F or 2’-NH2 can be performed to improve the stability of the aptamer in the cellular environment. Other alterations of aptamers can include end capping with small molecules such as amines, phosphate groups or residues of thymidine and other non-natural bases. Aptamers are selected by the Systematic Evolution of Ligands by Exponential Enrichment technique (SELEX), by an in vitro process. SELEX involves the stepwise selection of aptamers by repeating cycles of binding, elution and amplification of ligands from a random nucleic acid library to select sequences with higher binding affinity to the target. New applications of this technique have been developed, called “cell-SELEX”, which allows the selection of aptamers that bind to specific target cells. Selection parameters can be easily manipulated to obtain aptamers more effective for a wide variety of conditions (pH, temperature or buffer composition). Some modifications have been included in the traditional SELEX method, such as affinity chromatography, capillary electrophoresis and filtration membranes, to maximize affinity and specificity and to improve the selection speed and success rate of the selected aptamers. The characteristics of the selected oligonucleotides are identified using various physical, chemical and biological assays. Once selected, they can be synthesized in large quantities with precision and reproducibility by chemical reactions. These chemical processes are more cost-effective than the production of antibodies. Aptamers have a relatively small size when compared to antibodies, which facilitates their chemical synthesis and possible modifications. They are biocompatible and have a lower immunogenicity in vivo. They have high selectivity and the ability to bind and recognize specific targets, presenting affinity constants (Kd) in the nanomolar range, compared to antibodies (Kd in the millimicromolar range). In addition, due to their significantly lower molecular weight, they penetrate tissues faster and more efficiently, and can distinguish between protein extracellular or intracellular domains that antibodies cannot distinguish.

[0113] In some embodiments, the aerolysin inhibitor is a small molecule compound. Known exemplary aerolysin small molecule compound inhibitors include, but are not limited to, xanthohumol (CN117838676A), anwusin (CN112294796B), glycyrrhizol (CN113679703B), pterostilbene (CN114869871A), genistein (CN113730394A), morin (CN111617069B), luteolin (CN111494363B), palmatine (Dong J et al. Foods. 2022; 11(20):3250), Reynoutrin (Dong, Jing et al. Frontiers in veterinary science vol. 9 937463. 14 Jul. 2022), and resveratrol (Jing Dong et al, Food Control, Volume 126, 2021, 108083, ISSN 0956-7135).

[0114] In some embodiments, the aerolysin inhibitor is a gene editing complex targeting aerolysin. In some embodiments, the gene editing complex is a Crispr-Cas system. In other embodiments, the gene editing complex is a ZFN. In other embodiments, the gene editing complex is a TALEN. In embodiments where the gene editing complex is a Crispr-Cas system, in some embodiments, the gene editing complex can be a complex of a Crispr-Cas effector protein (such as a Cas9 or Cas12 effector protein) with a gRNA targeting the DNA of aerolysin, the complex editing the aerolysin DNA to inactivate it.

[0115] In some embodiments, the gene editing complex can also be a base editor, such as an adenosine editor or a cytosine editor, comprising a fusion protein of a Crispr-Cas effector protein with no cleavage activity or single strand cleavage activity (such as nCas9 or dCas9 effector protein) and a deaminase (such as a cytosine deaminase or an adenosine deaminase) and a gRNA targeting the DNA of the aerolysin. Suitable adenosine deaminases include TadA deaminases, such as TadA, ecTadA, saTadA, ecTadA7.10, TadA-8e, TadA8.17, TadA8.20, TadA9, or combinations thereof, and the like. A suitable adenosine deaminase is any enzyme capable of deaminating adenosine in DNA. In some embodiments, the deaminase is a TadA deaminase. Suitable cytosine deaminases include any enzyme capable of deaminating cytosine in DNA. In some embodiments, the cytosine deaminase is a deaminase from the apolipoprotein B mRNA-editing complex (APOBEC) family. In some embodiments, the APOBEC family deaminase is selected from the group consisting of APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, and APOBEC3H deaminase. In some embodiments, the cytosine deaminase is an activation-induced deaminase (AID).

[0116] In some embodiments, the gene editing complex can also be an epigenetic editor, comprising a fusion protein of a Crispr-Cas effector protein with no cleavage activity or single strand cleavage activity (such as nCas9 or dCas9 effector protein) and a transcription repression domain and a gRNA targeting the DNA of the aerolysin. The number of transcription repression domains is at least 2, which can be 2 identical / different transcription repression domains, 3 identical / different transcription repression domains, 4 identical / different transcription repression domains, 5 identical / different transcription repression domains, 6 identical / different transcription repression domains, 7 identical / different transcription repression domains, 8 identical / different transcription repression domains, 9 identical / different transcription repression domains, 10 identical / different transcription repression domains. Specifically, the number of transcription repression domains can be two, including a first transcription repression domain and a second transcription repression domain; the first transcription repression domain and the second transcription repression domain can be the same transcription repression domain, or the first transcription repression domain and the second transcription repression domain can be different transcription repression domains. Specifically, the number of transcription repression domains can be more than two, which are connected in series by a connecting peptide and connected to the N-terminus and / or C-terminus of the chimeric Cas12 or Cas9 protein.

[0117] The transcription repression domain can comprise a DNA methyltransferase (e.g., DNMT1, DNMT3A, DNMT3B, DNMT3L, or any functional variant or fragment thereof), a RYBP (RING1 and YY1 binding protein) catalytic domain and homologs thereof, a YAF2 catalytic domain and homologs thereof, a KRAB catalytic domain, a MBD2 catalytic domain and homologs thereof, a MeCP2 catalytic domain and homologs thereof, a RBBP4 catalytic domain and homologs thereof, a CDYL2 catalytic domain and homologs thereof, a HP1a catalytic domain and homologs thereof, a HP1=(CBX1) catalytic domain and homologs thereof, a TOX catalytic domain and homologs thereof, a TOX3 catalytic domain and homologs thereof, a TOX4 catalytic domain and homologs thereof, a SCMH1 catalytic domain and homologs thereof, a SCMH2 catalytic domain and homologs thereof, a CBX8 catalytic domain and homologs thereof, a HDAC5 catalytic domain and homologs thereof, a I2BP1 catalytic domain and homologs thereof, a EZH2 catalytic domain and homologs thereof, a SUZ12 catalytic domain and homologs thereof, a SIN3A catalytic domain and homologs thereof, a RING2 catalytic domain and homologs thereof, a SetDB1 catalytic domain and homologs thereof.

[0118] In particular, the KRAB catalytic domain can be selected from ZIM3 KRAB, ZNF554, ZNF264, ZNF324, ZNF354A, ZNF189, ZNF543, ZFP82, ZNF669, ZNF582, KOX1-MeCP2, ZNF30, ZNF680, ZNF331, ZNF33A, ZNF528, ZNF320, ZNF350, ZNF175, ZNF214, ZNF184, ZNF8, ZNF596, KOX1, ZNF37A, ZNF394, ZNF610, ZNF273, ZNF34, ZNF250, ZNF98, ZNF675, ZNF213, NLuc, ZFP28-2, ZNF224, ZNF257, ZIM2 KRAB, ZNF566, ZNF595, ZNF419, ZNF254, ZNF557, ZNF785, ZNF140, ZNF764, ZNF45, ZNF816, ZNF729, ZNF28-1, ZNF547, ZFP1, ZNF677, ZNF41, ZNF14, ZNF490, ZNF436, or ZNF18. Preferably, the KRAB catalytic domain can be ZIM3 KRAB, ZNF554, ZNF264, ZNF324, ZNF354A, ZNF189, ZNF543, ZFP82, ZNF669, ZNF582, KOX1-MeCP2, ZNF30, ZNF680, ZNF331, ZNF33A, ZNF528, ZNF320, ZNF350, ZNF175, ZNF214, ZNF184, ZNF8, ZNF596, KOX1, ZIM2 KRAB, ZNF566, ZNF595, ZNF419, ZNF254, ZNF557, ZNF785, ZNF140, ZNF764, ZNF45, ZNF816, ZNF729, ZNF28-1, ZNF547, ZFP1, ZNF677.

[0119] Gasolin polypeptides and immunogenic fragments thereof

[0120] Another aspect of the present application provides a gasolin polypeptide and immunogenic fragments thereof.

[0121] In some embodiments, the present application provides a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 2. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 3. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 4. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 180. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 181. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 182. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 183. In some embodiments, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 184.

[0122] In some embodiments, the present application provides immunogenic fragments of a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184. In some embodiments, the immunogenic fragment comprises one or more amino acid residues of aerolysin that bind to a cell membrane surface aerolysin receptor. In some embodiments, the immunogenic fragment comprises one or more of residues Trp-45, Ile-47, Met-57, Lys-66, Tyr-162, Trp-324 and His-332 (residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises one or more of residues Trp-45, Ile-47, Met-57 and Lys-66 (residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises residues Trp-45, Ile-47, Met-57 and Lys-66 (residues numbered according to SEQ ID NO: 180).

[0123] The tertiary structure of an active aerolysin protein is L-shaped and can be divided into a small lobe consisting of a small N-terminal domain (domain 1) and a large lobe consisting of three domains (domains 2-4). See PDB: 1PRE for an exemplary protein structure of a monomeric aerolysin precursor. In some embodiments, the immunogenic fragment comprises domain 1 of aerolysin (e.g., an amino acid fragment at positions 1-108, 1-113, 24-108 or 24-113, residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises domain 1 of aerolysin (e.g., an amino acid fragment at positions 1-108, 1-113, 24-108 or 24-113, residues numbered according to SEQ ID NO: 180) and domain 2 of aerolysin (e.g., an amino acid fragment at positions 109-199 or 114-199, residues numbered according to SEQ ID NO: 180).

[0124] In some embodiments, the immunogenic fragment of the polypeptide is a fragment comprising amino acids 1-148 and / or 149-296 and / or 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-148 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 149-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 149-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184.

[0125] In some embodiments, the present application provides an epitope bound by an anti-aerolysin antibody. In some embodiments, the epitope comprises domain 1 of aerolysin. In some embodiments, the epitope comprises domains 1 and 2 of aerolysin. In some embodiments, the epitope is a fragment comprising amino acids 1-148 and / or 149-296 and / or 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the epitope is a fragment comprising amino acids 1-148 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the epitope is a fragment comprising amino acids 149-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the epitope is a fragment comprising amino acids 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the epitope is a fragment comprising amino acids 1-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the epitope is a fragment comprising amino acids 1-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the epitope is a fragment comprising amino acids 149-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184.

[0126] In certain embodiments, an aerolysin epitope can be utilized to isolate an antibody or antigen-binding fragment thereof that binds to aerolysin. In certain embodiments, an aerolysin epitope can be utilized to produce an antibody or antigen-binding fragment thereof that binds to aerolysin. In certain embodiments, an aerolysin epitope or a sequence comprising an aerolysin epitope can be used as an immunogen to produce an antibody or antigen-binding fragment thereof that binds to aerolysin. In certain embodiments, an aerolysin epitope can be administered to an animal, and subsequently an antibody or antigen-binding fragment thereof that binds to aerolysin can be obtained from the animal. In certain embodiments, an aerolysin epitope or a sequence comprising an aerolysin epitope can be utilized to interfere with normal aerolysin-mediated activity, for example, to interfere with the association of aerolysin with a GPI-anchored protein.

[0127] In certain embodiments, one or more domains / regions containing residues contacted by or buried by the antibody can be identified by mutating particular residues in the aerosolysin (e.g., wild-type antigen) and determining whether the antigen binding protein can bind to the mutated or variant aerosolysin protein. By making a number of individual mutations, residues that play a direct role in binding or are in sufficient proximity to the antibody that mutations can affect binding between the antigen binding protein and the antigen can be identified. From knowledge of these amino acids, one or more antigen domains or regions containing residues contacted by the antigen binding protein or buried by the antibody can be elucidated. The domains can include the antibody binding epitope. One particular example of this general approach utilizes the arginine / glutamate scanning procedure. In general, arginines and glutamic acids are used to substitute (usually alone) for each amino acid in the wild-type polypeptide because these amino acids have large, charged side chains which potentially can disrupt the antigen binding protein / antigen interaction. An arginine in the wild-type antigen is replaced with a glutamic acid. A number of such individual mutants are generated and the resulting binding properties are compared with the wild-type binding properties.

[0128] In some embodiments, the present application also provides a polynucleotide encoding the polypeptide or immunogenic fragment thereof. In some embodiments, the present application also provides a vector comprising the polynucleotide. In some embodiments, the present application also provides a host cell comprising the vector.

[0129] A vector can be designed to clone and / or express the polypeptide or immunogenic fragment thereof. A vector can also be designed to transfect the polypeptide or immunogenic fragment thereof of the present application into one or more cells. A vector can be designed for expression of the polypeptide or immunogenic fragment thereof in prokaryotic or eukaryotic cells. For example, the polypeptide or immunogenic fragment thereof can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells, plant cells, or mammalian cells. Alternatively, expression vectors encoding one or more of the polypeptides or immunogenic fragments thereof described herein can be transcribed and translated in vitro. A vector can be introduced into a prokaryotic cell and replicated therein. In some embodiments, a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell, or to produce an intermediate vector (e.g., an amplification plasmid) that is part of a viral vector packaging system to be introduced into a eukaryotic cell. In some embodiments, a prokaryote is used to amplify copies of a vector and to express one or more nucleic acids, e.g., to provide a source of one or more proteins for delivery to a host cell or host organism. Expression of proteins in prokaryotes is typically carried out in E. coli using vectors containing constitutive or inducible promoters.

[0130] In some embodiments, the vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 and pMT2PC. When used in mammalian cells, the control functions of the expression vector are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus, cytomegalovirus, Simian Virus 40, and other viruses known to the art.

[0131] Some embodiments of the application provide a cell comprising the polypeptide or immunogenic fragment thereof provided herein. In some embodiments, the cell comprises a nucleotide construct encoding any of the polypeptides or immunogenic fragments thereof provided herein. In some embodiments, the cell comprises any of the nucleotides or vectors provided herein. In some embodiments, the host cell is transiently or non-transiently transfected with one or more vectors described herein.

[0132] In some embodiments, the application provides a composition comprising any of the aerolysin polypeptides or immunogenic fragments thereof described in this section, and a solvent, excipient, or carrier.

[0133] Aerolysin antibodies or antigen-binding fragments thereof and methods of making

[0134] Another aspect of the application provides an anti-aerolysin antibody or antigen-binding fragment thereof. In some embodiments, the anti-aerolysin antibody interferes with the association of aerolysin with a GPI-anchored protein (e.g., CD52, Thy-1, contactin, CD14, semaphorin K1, N-CAM, etc.).

[0135] In some embodiments, the application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-5 and 180-184, or an immunogenic fragment thereof.

[0136] In some embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 1. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 2. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 3. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 4. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 5. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 180. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 181. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 182. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 183. In other embodiments, the present application provides an antibody or antigen-binding fragment thereof that is capable of specifically binding to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 184.

[0137] In some embodiments, the present application provides an anti-geosinin antibody or antigen-binding fragment thereof that is capable of specifically binding to one or more of Trp-45, Ile-47, Met-57, Lys-66, Tyr-162, Trp-324, and His-332 of a geosinin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-geosinin antibody or antigen-binding fragment thereof that is capable of specifically binding to one or more of Trp-45, Ile-47, Met-57, and Lys-66 of a geosinin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-geosinin antibody or antigen-binding fragment thereof that is capable of specifically binding to domain 1 (e.g., an amino acid fragment at positions 1-108, 1-113, 24-108, or 24-113) of a geosinin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-geosinin antibody or antigen-binding fragment thereof that is capable of specifically binding to domain 1 (e.g., an amino acid fragment at positions 1-108, 1-113, 24-108, or 24-113) and domain 2 (e.g., an amino acid fragment at positions 109-199 or 114-199) of a geosinin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184.

[0138] In some embodiments, the present application provides an anti-aerolysin antibody or antigen-binding fragment thereof that is capable of specifically binding to a fragment of aerolysin comprising amino acids 1-148 and / or amino acids 149-296 and / or amino acids 297-443 of an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-aerolysin antibody or antigen-binding fragment thereof that is capable of specifically binding to a fragment of aerolysin comprising amino acids 1-148 of an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-aerolysin antibody or antigen-binding fragment thereof that is capable of specifically binding to a fragment of aerolysin comprising amino acids 149-296 of an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-aerolysin antibody or antigen-binding fragment thereof that is capable of specifically binding to a fragment of aerolysin comprising amino acids 297-443 of an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-aerolysin antibody or antigen-binding fragment thereof that is capable of specifically binding to a fragment of aerolysin comprising amino acids 1-296 of an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-aerolysin antibody or antigen-binding fragment thereof that is capable of specifically binding to a fragment of aerolysin comprising amino acids 1-443 of an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the present application provides an anti-aerolysin antibody or antigen-binding fragment thereof that is capable of specifically binding to a fragment of aerolysin comprising amino acids 149-443 of an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184.

[0139] In some embodiments, the anti-aerolysin antibody is a polyclonal antibody or a monoclonal antibody. In some embodiments, the anti-aerolysin antibody is a monospecific antibody or a multispecific antibody. In some embodiments, the anti-aerolysin antibody is a humanized antibody or a human antibody (i.e., a fully human antibody). In some embodiments, the anti-aerolysin antibody is a chimeric antibody or a non-human antibody (e.g., a mouse antibody, a rat antibody, a rabbit antibody).

[0140] In some embodiments, the anti-aerolysin monoclonal antibody or antigen-binding fragment thereof comprises a light chain variable region and a heavy chain variable region, the heavy chain variable region comprising a HCDR1, a HCDR2, and a HCDR3, the light chain variable region comprising a LCDR1, a LCDR2, a LCDR3, wherein the sequences of the HCDR1, the HCDR2, the HCDR3, the LCDR1, the LCDR2, the LCDR3 are selected from the group consisting of:

[0141] (a) SEQ ID NOs: 36, 37, 38, 54, 55, and 56;

[0142] (b) SEQ ID NOs: 39, 40, 41, 57, 58, and 59;

[0143] (c) SEQ ID NOs: 42, 43, 44, 60, 61, and 62;

[0144] (d) SEQ ID NOs: 45, 46, 47, 63, 64, and 65;

[0145] (e) SEQ ID NOs: 48, 49, 50, 66, 67, and 68;

[0146] (f) SEQ ID NOs: 51, 52, FGH, SEQ ID NOs: 69, 70, and 71;

[0147] (g) SEQ ID NOs: 51, 52, FGH, SEQ ID NOs: 72, 73, and 74.

[0148] In some embodiments, the sequences of the light chain variable region and the heavy chain variable region of the anti-aerolysin monoclonal antibody are selected from, respectively:

[0149] (a) SEQ ID NOs: 23 and 24;

[0150] (b) SEQ ID NOs: 25 and 26;

[0151] (c) SEQ ID NOs: 27 and 28;

[0152] (d) SEQ ID NOs: 29 and 30;

[0153] (e) SEQ ID NOs: 31 and 32;

[0154] (f) SEQ ID NOs: 33 and 34; and

[0155] (g) SEQ ID NOs: 33 and 35.

[0156] In some embodiments, the anti-geosinin antibody or antigen-binding fragment thereof can be modified or labeled. In some embodiments, the anti-geosinin antibody or antigen-binding fragment thereof can be modified to add a functional moiety, e.g., polyethylene glycol (PEG) or a toxin. The modification can include covalent attachment of any type of molecule to the antibody, such that the covalent attachment does not prevent the antibody from binding to an epitope. For example, but not by way of limitation, by glycosylation, acetylation, pegylation, phosphorylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, and the like. The modification can be made by known techniques, including but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. Additionally, the antibody can comprise one or more non-canonical amino acids.

[0157] In some embodiments, the antibody can be conjugated or fused to a therapeutic agent, prodrug, peptide, protein, enzyme, virus, lipid, biological response modifier, pharmaceutical agent, PEG, oligonucleotide, photoactive therapeutic or diagnostic agent, cytotoxic agent (which can be a drug or toxin), or combinations thereof and other such agents known in the art.

[0158] In some embodiments, the anti-geosinin antibody or antigen-binding fragment thereof can be labeled, e.g., the antibody can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-labeled antigen-binding polypeptide is then determined by detecting the presence of luminescence during the chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, thermostable acridinium ester, imidazole, acridinium salt, and oxalate ester.

[0159] The antibody can also be detectably labeled using a fluorescent emitting metal (e.g., 152Eu or other metals of the lanthanide series). These metals can be attached to the antibody using metal chelating groups such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA). Techniques for conjugating various moieties to antibodies are well known.

[0160] In some embodiments, the present application provides a pharmaceutical composition comprising the anti-geosinin antibody or antigen-binding fragment thereof and a pharmaceutically acceptable excipient. In other embodiments, the present application provides a kit comprising the anti-geosinin antibody or antigen-binding fragment thereof and a solvent (e.g., PBS).

[0161] Another aspect of the present application provides a method of preparing the antibody or antigen-binding fragment thereof described in this section, which can be used for preventing or treating ulcerative colitis.

[0162] In some embodiments, the present application provides a method of preparing an antibody for preventing or treating ulcerative colitis, the method comprising: (a) immunizing an animal with a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof; and (b) isolating and screening antibodies against the polypeptide or the immunogenic fragment thereof from the animal.

[0163] In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 2. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 3. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 3. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 4. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 180. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 181. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 182. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 183. In some embodiments of the above method of preparing an antibody for preventing or treating ulcerative colitis, the polypeptide comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 184.

[0164] In some embodiments of the above methods of making an antibody for preventing or treating ulcerative colitis, the immunogenic fragment comprises one or more amino acid residues of aerolysin having an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184 that bind to a cell membrane surface aerolysin receptor. In some embodiments, the immunogenic fragment comprises one or more of residues Trp-45, Ile-47, Met-57, Lys-66, Tyr-162, Trp-324, and His-332 (residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises one or more of residues Trp-45, Ile-47, Met-57, and Lys-66 (residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises residues Trp-45, Ile-47, Met-57, and Lys-66 (residues numbered according to SEQ ID NO: 180).

[0165] In some embodiments, the immunogenic fragment comprises domain 1 (e.g., amino acid fragments 1-108, 1-113, 24-108, or 24-113) of aerolysin having an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment comprises domain 1 (e.g., amino acid fragments 1-108, 1-113, 24-108, or 24-113) and domain 2 (e.g., amino acid fragments 109-199 or 114-199) of aerolysin having an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184.

[0166] In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-148 and / or 149-296 and / or 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-148 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 149-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 149-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184.

[0167] In some embodiments, the animal is a rodent, such as a mouse or a rat. In some embodiments, the animal is a humanized transgenic mouse or rat. Humanized transgenic mice or rats are available on the market and are described in, for example, WO2013187953A1, WO2013134263A1, WO2011072204A1, WO2011097603A1, or CN106995822B.

[0168] In some embodiments, the animal (e.g., a mouse) is immunized with multiple rounds of immunization using a recombinant aerolysin or an immunogenic fragment thereof and / or a cell line expressing the aerolysin or the immunogenic fragment thereof. This strategy involves a primary immunization and two rounds of booster immunization.

[0169] In some embodiments, the prepared antibody is a polyclonal antibody or a monoclonal antibody. In embodiments of a monoclonal antibody, B cells are removed from an animal and fused with myeloma cells, and hybridomas expressing antibodies are screened. In some embodiments, the monoclonal antibody can be further engineered to form a chimeric antibody. In some embodiments, the monoclonal antibody can be further humanized to form a humanized antibody. In embodiments using a transgenic animal, the monoclonal antibody can be a human antibody without the need for humanization.

[0170] In some embodiments, the antibodies produced are further evaluated to determine their suitability as therapeutic, prophylactic or diagnostic antibodies. Such evaluations include, but are not limited to, binding affinity assays, binding specificity assays, potency assays, cross-reactivity assays, pharmacodynamic assays, in vivo animal assays, sensitivity assays, precision assays, and the like. Methods for evaluating antibodies are well known to those skilled in the art.

[0171] Use of a gasdermin as a vaccine and vaccine compositions

[0172] Another aspect of the present application relates to a vaccine composition.

[0173] In some embodiments, the present application provides a vaccine composition comprising a polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 1, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 1, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 3, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 3, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 4, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 4, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 5, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 5, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 180, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 180, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 181, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 181, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 182, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 182, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 183, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 183, or an immunogenic fragment thereof.In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 184, or an immunogenic fragment thereof. In some embodiments, the vaccine composition comprises a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 184, or an immunogenic fragment thereof.

[0174] In some embodiments, the vaccine composition comprises an immunogenic fragment of a polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184. In some embodiments, the immunogenic fragment comprises one or more amino acid residues of aerolysin that bind to an aerolysin receptor on the surface of a cell membrane having an amino acid sequence as set forth in any one of SEQ ID NOs: 180 to 184. In some embodiments, the immunogenic fragment comprises one or more of residues Trp-45, Ile-47, Met-57, Lys-66, Tyr-162, Trp-324 and His-332 (residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises one or more of residues Trp-45, Ile-47, Met-57 and Lys-66 (residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises residues Trp-45, Ile-47, Met-57 and Lys-66 (residues numbered according to SEQ ID NO: 180).

[0175] In some embodiments, the immunogenic fragment comprises domain 1 (e.g., amino acid fragments 1-108, 1-113, 24-108, or 24-113) of aerolysin having an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment comprises domain 1 (e.g., amino acid fragments 1-108, 1-113, 24-108, or 24-113) and domain 2 (e.g., amino acid fragments 109-199 or 114-199) of aerolysin having an amino acid sequence as set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment of the polypeptide is a fragment comprising amino acids 1-148 and / or amino acids 149-296 and / or amino acids 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-148 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 149-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 149-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184.

[0176] In other embodiments, the present application provides a vaccine composition comprising a polynucleotide encoding a polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 1-5 and 180-184 or an immunogenic fragment thereof. In such embodiments, the vaccine can be an RNA vaccine (e.g., an mRNA vaccine) or a DNA vaccine.

[0177] One advantage of mRNA vaccines over peptide vaccines is that mRNA vaccines bypass HLA matching of the recipient host. In the synthetic approach to mRNA vaccine design, pathogen proteomes can be scanned for antigen signatures with vaccine potential. (Proteome databases can be accessed using the Uniprot Consortium (http: / / www.uniprot.org / )). This can be effective for novel pathogens. This type of reverse vaccinology has been used to identify many novel peptide vaccine candidates. Whether a potential antigen candidate can successfully generate an immune response can be verified by various forms of cell surface display of libraries expressing potential antigens appropriately, as well as opsonization and antibody binding tests. Exemplary useful databases for vaccine antigen development include: the ImMunoGeneTics information system (URL: www.imgt.org); the Epitome database (URL: www.rostlab.org / services / epitome), the Immune Epitope Database and Analysis Resource (www.iedb.org); the Immunet database (immunt.cn / ced / index.php); the HIV database (www.hiv.lanl.gov / content / immunology) (on immunogenetics and immunoinformatics). The present invention can deliver any mRNA encoding an antigen suitable for use as a vaccine as described herein. As used herein, mRNA is a type of RNA that carries information from DNA to the ribosome to translate the encoded protein. mRNA can be synthesized according to any of a variety of known methods. For example, mRNA according to the present invention can be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system which can include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitors. The exact conditions will vary depending on the particular application.

[0178] In some embodiments, in vitro synthesized mRNA can be purified prior to formulation and encapsulation to remove undesirable impurities, including various enzymes and other reagents used in the mRNA synthesis process. The present application can be used to deliver mRNA of various lengths. In some embodiments, the present application can be used to deliver in vitro synthesized mRNA having a length equal to or greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb. In some embodiments, the present application can be used to deliver in vitro synthesized mRNA having a length in the range of about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb.

[0179] The present application can be used to deliver unmodified mRNA or mRNA containing one or more modifications that generally enhance stability. In some embodiments, the modifications are selected from modified nucleotides, modified sugar phosphate backbones, and 5' and / or 3' untranslated regions (UTRs). In some embodiments, the modifications of the mRNA can include modifications of the nucleotides of the RNA. The modified mRNA according to the present application can include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, the mRNA can be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides) including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)) and modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1 -methyl-adenosine, 2-methyl-adenosine, 2-methylthio-N-6-isopentenyl-adenosine, N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-thio-cytidine, 3-methyl-cytidine, 4-acetyl-cytidine, 5-methyl-cytidine, 2,6-diaminopurine, 1 -methyl-guanosine, 2-methyl-guanosine, 2,2-dimethyl-guanosine, 7-methyl-guanosine, inosine, 1 -methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxylmethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxoacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxoacetic acid methyl ester, uracil-5-oxoacetic acid (v), 1 -methyl-pseudouracil, Q nucleoside, beta-D-mannosyl-Q nucleoside, wybutoxoside, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine. In some embodiments, the mRNA can contain RNA backbone modifications. Generally, backbone modifications are modifications in which the phosphates of the nucleotide backbone contained in the RNA are chemically modified. Exemplary backbone modifications generally include, but are not limited to, modifications from methylphosphonate, methylphosphoramidate, phosphoramidate, phosphorothioate (e.g., cytidine 5'-O-(l-thio-phosphoate)), boranophosphonate, positively charged guanidinium groups, and the like, which means replacement of the phosphodiester bond by other anionic, cationic, or neutral groups. In some embodiments, the mRNA can contain sugar modifications.A typical sugar modification is a chemical modification of the sugar of the nucleotides it comprises, including but not limited to a sugar modification selected from 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deaminated-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyl oligoribonucleotides, 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides and their isomers (2'-arabinocytidine 5'-triphosphate, 2'-arabinouridine 5'-triphosphate), or azido triphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate). In some embodiments, the mRNA can contain modifications of the nucleotide bases (base modifications). Modified nucleotides containing base modifications are also referred to as base-modified nucleotides. Examples of such base-modified nucleotides include, but are not limited to, 2-amino-6-chloropurine nucleoside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacytidine 5'-triphosphate, 6-azauridine 5'-triphosphate, 6-chloropurine nucleoside 5'-triphosphate, 7-deazanucleoside 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azanucleoside 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole nucleoside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, or xanthosine 5'-triphosphate.

[0180] Typically, mRNA synthesis includes the addition of a "cap" on the 5' end and a "tail" on the 3' end. The presence of the cap is important to provide resistance to nucleases found in most eukaryotic cells. The presence of the "tail" functions to protect the mRNA from exonuclease degradation. Thus, in some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added in the following manner: first, a terminal phosphate group is removed from the 5' nucleotide by a RNA terminal phosphatase, leaving two terminal phosphates; then a guanosine triphosphate (GTP) is added to the terminal phosphate via a guanylyltransferase, creating a 5'-5' inverted triphosphate linkage; then the 7-nitrogen of the guanine is methylated by a methyltransferase. 2'-O-methylation can also occur at the first and / or second bases after the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA, and m7GpppNmpNmp-RNA (where m denotes a 2'-O-methyl residue). In some embodiments, the mRNA includes a 3' poly(A) tail structure. The poly(A) tail on the 3' end of the mRNA typically comprises about 10 to 300 adenosine nucleotides (e.g., about 10 to 200 adenosine nucleotides, about 10 to 150 adenosine nucleotides, about 10 to 100 adenosine nucleotides, about 20 to 70 adenosine nucleotides, or about 20 to 60 adenosine nucleotides). In some embodiments, the mRNA includes a 3' poly(C) tail structure. A suitable poly-C tail on the 3' end of the mRNA typically comprises about 10 to 200 cytosine nucleotides (e.g., about 10 to 150 cytosine nucleotides, about 10 to 100 cytosine nucleotides, about 20 to 70 cytosine nucleotides, about 20 to 60 cytosine nucleotides, or about 10 to 40 cytosine nucleotides). The poly-C tail can be added to or can replace the poly(A) tail. In some embodiments, the mRNA includes a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region includes one or more elements that affect the stability or translation of the mRNA, such as an iron response element. In some embodiments, the 5' untranslated region can be about 50 to 500 nucleotides in length. In some embodiments, the 3' untranslated region includes one or more of a polyadenylation signal, a binding site for a protein that affects the localization stability of the mRNA in the cell, or one or more binding sites for a miRNA. In some embodiments, the 3' untranslated region can be 50 to 500 nucleotides or longer in length.

[0181] According to the present application, the mRNA can be encapsulated or complexed in nanoparticles. According to various embodiments, suitable nanoparticles include, but are not limited to, polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, exosomes of natural and synthetic origin, natural, synthetic and semi-synthetic lamellar bodies, nanoparticles, calcium phosphosilicate nanoparticles, calcium phosphate nanoparticles, silica nanoparticles, nanocrystal particles, semiconductor nanoparticles, poly(D-arginine), sol-gel, nanodendrimers, starch-based delivery systems, micelles, emulsions, liposomoids, multi-domain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other carrier tags. In some embodiments, the mRNA is encapsulated within one or more liposomes. As used herein, the term “liposome” refers to any lamellar, multi-lamellar, or solid nanoparticle vesicle. Typically, as used herein, the liposomes can be formed by mixing one or more lipids or by mixing one or more lipids and polymers. Thus, as used herein, the term “liposome” encompasses nanoparticles based on both lipids and polymers. In some embodiments, the liposomes suitable for use in the present application contain a cation, one or more non-cationic lipids, one or more cholesterol-based lipids, and / or one or more PEG-modified lipids. Suitable lipids include those described in CN112384205B and CN117377491A, the description of which regarding lipids is incorporated herein by reference.

[0182] The carrier that delivers the vaccine can also be a viral vector. Examples of viral vectors include an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. In alternative embodiments, the recombinant adenovirus used in the vaccines provided herein can be as described in U.S. Patent Application No. US20200399323 Al, which describes, for example, recombinant adenoviruses including a deletion in the El region or a deletion of the El region or any deletion that results in a replication-deficient virus, for example, the replication-deficient virus can include a deletion of one or more of the El, E3, and / or E4 regions.

[0183] In another related aspect, the present application provides the use of a gasdermin as a vaccine. In some embodiments, the present application provides the use of a gasdermin in the manufacture of a vaccine composition for preventing ulcerative colitis. In other embodiments, the present application provides a method of preventing ulcerative colitis in a subject, the method comprising administering to the subject a prophylactically effective amount of a gasdermin or a vaccine composition comprising a gasdermin. In some embodiments, the administration is sufficient to elicit an immune response to the gasdermin in the subject. In some embodiments, the administration results in the production of anti-gasdermin antibodies in the subject in vivo.

[0184] In embodiments where the aerolysin is used as a vaccine, the aerolysin can be any aerolysin derived from any aerolysin secreting species of Aeromonas. In preferred embodiments, the aerolysin can be an aerolysin derived from Aeromonas veronii, sobria, DNP9, FDAARGOS 1411, allosaccharophila, HMWF015, Y318-3, JL9, australiensis, 159, jandaei, or hydrophila. In preferred embodiments, the aerolysin can be an aerolysin derived from Aeromonas veronii. Exemplary amino acid sequences of Aeromonas veronii aerolysins can be found at GenBank: ABJ52834.1, GenBank: VXA89029.1, and GenBank: OCQ43994.1. In some embodiments, the aerolysin can be any one of an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-21 and 180-184, or an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to each of them. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-21. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 1. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 1. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 2. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 2. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 3. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 3. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 4. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 4. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 5. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 5. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 180. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 181.In preferred embodiments, the aerolysin can be an aerolysin comprising the amino acid sequence set forth in SEQ ID NO: 182. In preferred embodiments, the aerolysin can be an aerolysin comprising the amino acid sequence set forth in SEQ ID NO: 183. In preferred embodiments, the aerolysin can be an aerolysin comprising the amino acid sequence set forth in SEQ ID NO: 184.

[0185] In embodiments where the aerolysin is used as a vaccine, the aerolysin can be an immunogenic fragment of aerolysin. In some embodiments, the immunogenic fragment comprises one or more amino acid residues of aerolysin that bind to a cell membrane surface aerolysin receptor. In some embodiments, the immunogenic fragment comprises one or more of residues Trp-45, Ile-47, Met-57, Lys-66, Tyr-162, Trp-324, and His-332 (residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises one or more of residues Trp-45, Ile-47, Met-57, and Lys-66 (residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises residues Trp-45, Ile-47, Met-57, and Lys-66 (residues numbered according to SEQ ID NO: 180).

[0186] In some embodiments, the immunogenic fragment comprises domain 1 of aerolysin (e.g., an amino acid fragment at positions 1-108, 1-113, 24-108, or 24-113, residues numbered according to SEQ ID NO: 180). In some embodiments, the immunogenic fragment comprises domain 1 of aerolysin (e.g., an amino acid fragment at positions 1-108, 1-113, 24-108, or 24-113, residues numbered according to SEQ ID NO: 180) and domain 2 (e.g., an amino acid fragment at positions 109-199 or 114-199, residues numbered according to SEQ ID NO: 180).

[0187] In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-148 and / or 149-296 and / or 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-148 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 149-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 297-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-296 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 1-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184. In some embodiments, the immunogenic fragment is a fragment comprising amino acids 149-443 of the amino acid sequence set forth in any one of SEQ ID NOs: 180-184.

[0188] The vaccine compositions provided herein also comprise a pharmaceutically acceptable excipient. In some embodiments, the vaccine compositions provided herein further comprise an adjuvant. Suitable adjuvants include aluminium salts such as aluminium hydroxide gel (alum) or aluminium phosphate, but can also be calcium salts (particularly calcium carbonate), iron salts or zinc salts, or can be insoluble suspensions of acylated tyrosine or acylated sugars, insoluble suspensions of cationic or anionic derivative polysaccharides or polyphosphazenes. Suitable Th1 adjuvant systems which can be used include monophosphoryl lipid A, particularly 3-de-O-acylated monophosphoryl lipid A and combinations of monophosphoryl lipid A, preferably 3-de-O-acylated monophosphoryl lipid A (3D-MPL) with aluminium salts (preferably aluminium phosphate). Enhanced systems include combinations of monophosphoryl lipid A and saponin derivatives, particularly the combination of QS21 with 3D-MPL disclosed in WO 94 / 00153, or less reactogenic compositions as disclosed in WO 96 / 33739 in which QS21 is quenched with cholesterol. Particularly effective adjuvants comprising oil-in-water emulsions of QS21 3D-MPL and tocopherol are described in WO 95 / 17210 and are preferred formulations. The vaccine can include a saponin, more preferably QS21. It can also include an oil-in-water emulsion and tocopherol. Unmethylated CpG containing oligonucleotides (WO 96 / 02555) are a preferred inducer of TH1 responses and are suitable for use in the present application. The vaccine preparations of the present application can be used to protect or treat a susceptible mammal, wherein the vaccine is administered via a systemic or mucosal route. These administrations can include injection via intramuscular, intraperitoneal, intradermal or subcutaneous routes; or via mucosal administration to the oral / digestive, respiratory, urogenital tracts.

[0189] Diagnostic uses of aerolysin antibodies and antigen-binding fragments thereof

[0190] Another aspect of the application provides the use of an aerolysin antibody or antigen-binding fragment thereof in the diagnosis of ulcerative colitis.

[0191] In some embodiments, the application provides the use of an antibody or antigen-binding fragment thereof that specifically binds to aerolysin in the manufacture of a kit for the diagnosis of ulcerative colitis in a subject. In some embodiments, the application provides a kit for the diagnosis of ulcerative colitis in a subject, the kit comprising an antibody or antigen-binding fragment thereof that specifically binds to aerolysin.

[0192] In some embodiments, the present application provides a method of diagnosing ulcerative colitis in a subject, comprising obtaining a sample from the subject, contacting the sample with an antibody or antigen-binding fragment thereof that specifically binds to aerolysin in vitro, detecting the binding of aerolysin, if any, in the sample to the antibody or antigen-binding fragment thereof, the presence of the binding indicating that the sample contains aerolysin, and diagnosing the subject corresponding to the sample containing aerolysin as having or likely to have ulcerative colitis. In some embodiments, the sample is a fecal sample of the subject.

[0193] In some embodiments, the aerolysin antibody or antigen-binding fragment thereof can be labeled, for example, the antibody can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-labeled antigen-binding polypeptide is then determined by detecting the presence of luminescence that occurs during the chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, thermostable acridinium ester, imidazole, oxalate ester. The antibody can also be detectably labeled with a fluorescent emitting metal (e.g., 152Eu or other metals of the lanthanide series). These metals can be attached to the antibody using metal chelating groups such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA). Techniques for conjugating various moieties to antibodies are well known.

[0194] In any of the embodiments described in this section, the aerolysin can be any aerolysin from any secretable aerolysin-producing species of Aeromonas. In preferred embodiments, the aerolysin can be an aerolysin from Aeromonas veronii, sobria, DNP9, FDAARGOS 1411, allosaccharophila, HMWF015, Y318-3, JL9, australiensis, 159, jandaei, or hydrophila. In preferred embodiments, the aerolysin can be an aerolysin from Aeromonas veronii. Exemplary amino acid sequences of Aeromonas veronii aerolysins can be found at GenBank: ABJ52834.1, GenBank: VXA89029.1, and GenBank: OCQ43994.1. In some embodiments, the aerolysin can be any one of an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-21 and 180-184, or an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to each of them. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-21 and 180-184. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 1. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 1. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 2. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 2. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 3. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 3. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 4. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 4. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 5. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 5. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 180. In preferred embodiments, the aerolysin is an aerolysin having an amino acid sequence as set forth in SEQ ID NO: 180.In preferred embodiments, the gasolin can be a gasolin comprising an amino acid sequence set forth in SEQ ID NO: 181. In preferred embodiments, the gasolin is a gasolin having an amino acid sequence set forth in SEQ ID NO: 181. In preferred embodiments, the gasolin can be a gasolin comprising an amino acid sequence set forth in SEQ ID NO: 182. In preferred embodiments, the gasolin is a gasolin having an amino acid sequence set forth in SEQ ID NO: 182. In preferred embodiments, the gasolin can be a gasolin comprising an amino acid sequence set forth in SEQ ID NO: 183. In preferred embodiments, the gasolin is a gasolin having an amino acid sequence set forth in SEQ ID NO: 183. In preferred embodiments, the gasolin can be a gasolin comprising an amino acid sequence set forth in SEQ ID NO: 184. In preferred embodiments, the gasolin is a gasolin having an amino acid sequence set forth in SEQ ID NO: 184.

[0195] In some embodiments, the gasolin antibody is a polyclonal antibody or a monoclonal antibody. In some embodiments, the gasolin antibody is a monospecific antibody or a multispecific antibody. In some embodiments, the gasolin antibody is a humanized antibody or a human antibody (i.e., a fully human antibody). In some embodiments, the gasolin antibody is a chimeric antibody or a non-human antibody (e.g., a mouse antibody, a rat antibody, a rabbit antibody).

[0196] In some embodiments, the gasolin monoclonal antibody or antigen-binding fragment thereof comprises a light chain variable region and a heavy chain variable region, the heavy chain variable region comprising HCDR1, HCDR2, and HCDR3, the light chain variable region comprising LCDR1, LCDR2, LCDR3, wherein the sequences of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3 are

[0197] are selected from the group consisting of:

[0198] (a) SEQ ID NOs: 36, 37, 38, 54, 55, and 56;

[0199] (b) SEQ ID NOs: 39, 40, 41, 57, 58, and 59;

[0200] (c) SEQ ID NOs: 42, 43, 44, 60, 61, and 62;

[0201] (d) SEQ ID NOs: 45, 46, 47, 63, 64, and 65;

[0202] (e) SEQ ID NOs: 48, 49, 50, 66, 67, and 68;

[0203] (f) SEQ ID NO: 51, 52, FGH, SEQ ID NO: 69, 70, and 71;

[0204] (g) SEQ ID NO: 51, 52, FGH, SEQ ID NO: 72, 73, and 74.

[0205] In some embodiments, the sequences of the light chain variable region and the heavy chain variable region of the aerolysin monoclonal antibody are selected from, respectively:

[0206] (a) SEQ ID NO: 23 and 24;

[0207] (b) SEQ ID NO: 25 and 26;

[0208] (c) SEQ ID NO: 27 and 28;

[0209] (d) SEQ ID NO: 29 and 30;

[0210] (e) SEQ ID NO: 31 and 32;

[0211] (f) SEQ ID NO: 33 and 34; and

[0212] (g) SEQ ID NO: 33 and 35.

[0213] Aeromonas sp. MTB bacteria

[0214] Another aspect of the present application provides a new bacterial species of Aeromonas, which is named as Aeromonas sp. MTB species in taxonomy, Latin name Aeromonas sp. MTB (macrophage-toxic bacteria, MTB), deposited in China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Yikhina, Beichen West Road, Chaoyang District, Beijing, China, on May 27, 2024, and has the accession number of CGMCC No. 30776 (2A5 strain) or CGMCC No. 30777 (10A1 strain).

[0215] MTB bacteria morphological characteristics: the colonies on LB agar appear as white, intermediate convex round colonies. After negative staining with phosphotungstic acid, single polar flagella and peritrichous pili can be observed under transmission electron microscope. After 24 hours of culture on Rimler-Shotts plates, green colonies are formed. The bacteria are negative for citrate (CIT) utilization and positive for arginine dehydrogenase (ADH) reaction.

[0216] The present application performs whole genome sequencing and bioinformatics analysis on five isolated MTB strains MTB2A5, MTB10A1, MTB10B4, MTB10A3 and MTB10A10. The standard whole genomes of A.hydrophila, A.caviae, A.jandaei, A.sobria and A.veronii are used as reference genomes. The results show that the genome size, GC%, tRNA number and gene number of different MTB strains are the same or basically the same among the isolated MTB, but different from the reference Aeromonas genome. The ANI (average nucleotide identity) analysis results of the whole genome of MTB and the reference genome of Aeromonas show that the ANI value of MTB and three A.veronii reference genomes is more than 96.4%, but the ANI value of MTB and A.hydrophila, A.caviae, A.jandaei and A.sobria is less than 92%. The phylogenetic tree analysis based on the core genes shows that the five MTB strains are most similar to the whole genome of A.veronii. The number of common core genes of the five MTB strains is 3506, while the number of common core genes of the three A.veronii strains is 3280. Based on the bacterial API-20NE detection, the difference in RS culture characteristics, and the bioinformatics analysis results of the whole genome sequence, the present application identifies MTB as a new species of Aeromonas. The unique colonization ability of A.MTB in the mouse intestine further proves that MTB is different from A.veronii.

[0217] Method for screening drug candidates for preventing or treating ulcerative colitis

[0218] Another aspect of the present application provides a method for screening drug candidates for preventing or treating ulcerative colitis.

[0219] In some embodiments, the present application provides a method for screening drug candidates for preventing or treating ulcerative colitis, the method comprising: (a) contacting a test substance with any of the Aeromonas MTB bacteria provided by the present application, (b) evaluating the inhibitory effect of the test substance on the bacteria; and (c) identifying the test substance with an inhibitory effect exceeding a preset threshold as a drug candidate.

[0220] The present application is not limited to the kind of the test substance, which includes but is not limited to small molecule compounds, polypeptides, polysaccharides, small nucleic acid molecules, aptamers, antibodies, viruses, gene editing complexes, and their possible conjugates, such as antibody drug conjugates (ADCs), targeted protein degradation chimeras (PROTACs). The test substance can also be a single traditional Chinese medicine, a traditional Chinese medicine compound, a traditional Chinese medicine extract, an effective fraction, and a mixture thereof. In some embodiments, the test substance is a small molecule compound. In other embodiments, the test substance is a small nucleic acid molecule, such as an RNAi molecule targeting aerolysin. In other embodiments, the test substance is a bacteriophage.

[0221] In some embodiments, the inhibitory effect is characterized by at least one of the minimum inhibitory concentration (MIC), the minimum bactericidal concentration (MBC), the half maximal effective concentration (EC50), and the half maximal inhibitory concentration (IC50).

[0222] In some embodiments, the inhibitory effect can be evaluated by culturing the test substance with any of the Aeromonas MTB bacteria provided by the present application and macrophages, and evaluating the killing effect of the MTB bacteria on the macrophages in the presence of the test substance. In some embodiments, the killing effect can be characterized by the survival rate of the macrophages. In some embodiments, the macrophages are human gut-resident macrophages. In some embodiments, the macrophages are CX3CR1+ gut-resident macrophages in the colonic lamina propria of a human.

[0223] For the characterization of various inhibitory effects, the corresponding threshold values can be predetermined by those skilled in the art to identify the test substance with an inhibitory effect exceeding the threshold value as a drug candidate. For example, the threshold value of IC50 can be set to be in the nM level (e.g., 0.1 nM to 100 nM) or the mM level (e.g., 0.1 mM to 100 mM).

[0224] In some embodiments, the screening is performed in vitro. In other embodiments, the screening is performed in an ex vivo sample, such as a sample isolated from a subject.

[0225] In other embodiments, the present application provides a method of screening a drug candidate for preventing or treating ulcerative colitis, the method comprising: (a) contacting a test substance with a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 180 to 184, (b) evaluating the inhibitory effect of the test substance on the activity of the polypeptide; and (c) identifying the test substance with an inhibitory effect exceeding a preset threshold value as a drug candidate.

[0226] In some embodiments, the test substance is a small molecule compound. In other embodiments, the test substance is a small nucleic acid molecule, such as an RNAi molecule targeting aerolysin.

[0227] In some embodiments, the inhibitory effect can be determined by culturing a test substance with a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 180 to 184 and macrophages and evaluating the killing effect of the polypeptide on macrophages in the presence of the test substance. In some embodiments, the activity of the polypeptide is characterized by the killing effect of the polypeptide on macrophages. In some embodiments, the killing effect can be characterized by the survival rate of macrophages. In some embodiments, the macrophages are human gut-resident macrophages. In some embodiments, the macrophages are CX3CR1+ gut-resident macrophages in the colonic lamina propria of a human.

[0228] In some embodiments, the screening is performed in vitro. In other embodiments, the screening is performed in an ex vivo sample, such as a sample isolated from a subject.

[0229] Methods for detecting Aeromonas MTB bacteria

[0230] Another aspect of the present application provides methods for detecting the Aeromonas MTB bacteria provided by the present application.

[0231] In some embodiments, the present application provides a method for detecting in vitro whether a sample comprises any of the Aeromonas MTB bacteria provided by the present application, comprising (a) contacting an anti-aerolysin antibody or antigen-binding fragment thereof with the sample in vitro, (b) detecting the binding of the antibody or antigen-binding fragment thereof to the Aeromonas MTB bacteria, and (c) the presence of the binding indicates that the sample comprises the Aeromonas MTB bacteria.

[0232] In the detection method, the aerolysin can be any aerolysin from any aerolysin-secreting species of Aeromonas. In preferred embodiments, the aerolysin can be an aerolysin from Aeromonas veronii, sobria, DNP9, FDAARGOS 1411, allosaccharophila, HMWF015, Y318-3, JL9, australiensis, 159, jandaei, or hydrophila. In preferred embodiments, the aerolysin can be an aerolysin from Aeromonas veronii. Exemplary amino acid sequences of Aeromonas veronii aerolysins can be found at GenBank: ABJ52834.1, GenBank: VXA89029.1, and GenBank: OCQ43994.1. In some embodiments, the aerolysin can be any one of an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-21 and 180-184, or an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to each of them. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1-21 and 180-184. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 180. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 181. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 182. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 183. In preferred embodiments, the aerolysin can be an aerolysin comprising an amino acid sequence as set forth in SEQ ID NO: 184.

[0233] In some embodiments, the anti-aerolysin antibody is a polyclonal antibody or a monoclonal antibody. In some embodiments, the anti-aerolysin antibody is a monospecific antibody or a multispecific antibody. In some embodiments, the anti-aerolysin antibody is a humanized antibody or a human antibody (i.e., a fully human antibody). In some embodiments, the anti-aerolysin antibody is a chimeric antibody or a non-human antibody (e.g., a mouse antibody, a rat antibody, a rabbit antibody). In some embodiments, the anti-aerolysin antibody binds to a domain of aerolysin comprising an N-terminal 1-148 amino acid fragment. In some embodiments, the anti-aerolysin monoclonal antibody comprises a light chain variable region and a heavy chain variable region, the heavy chain variable region comprising HCDR1, HCDR2, and HCDR3, the light chain variable region comprising LCDR1, LCDR2, LCDR3, wherein the sequences of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3 are selected from the group consisting of:

[0234] (a) SEQ ID NOs: 36, 37, 38, 54, 55, and 56;

[0235] (b) SEQ ID NOs: 39, 40, 41, 57, 58, and 59;

[0236] (c) SEQ ID NOs: 42, 43, 44, 60, 61, and 62;

[0237] (d) SEQ ID NOs: 45, 46, 47, 63, 64, and 65;

[0238] (e) SEQ ID NOs: 48, 49, 50, 66, 67, and 68;

[0239] (f) SEQ ID NOs: 51, 52, FGH, SEQ ID NOs: 69, 70, and 71;

[0240] (g) SEQ ID NOs: 51, 52, FGH, SEQ ID NOs: 72, 73, and 74.

[0241] In some embodiments, the anti-aerolysin monoclonal antibody comprises a light chain variable region and a heavy chain variable region, the sequences of which are selected from the group consisting of:

[0242] (a) SEQ ID NOs: 23 and 24;

[0243] (b) SEQ ID NOs: 25 and 26;

[0244] (c) SEQ ID NOs: 27 and 28;

[0245] (d) SEQ ID NOs: 29 and 30;

[0246] (e) SEQ ID NOs: 31 and 32;

[0247] (f) SEQ ID NOs: 33 and 34; and

[0248] (g) SEQ ID NOs: 33 and 35.

[0249] In preferred embodiments, the sample is a fecal sample, such as a fecal sample obtained from a subject suspected of having ulcerative colitis.

[0250] In other embodiments, the present application provides a method of detecting in vitro whether a sample comprises the Aeromonas MTB bacteria provided by the present application, comprising (a) amplifying a polynucleotide encoding a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof; and / or (b) amplifying gene 1407, wherein a positive amplification result of (a) and / or (b) indicates that the sample comprises the Aeromonas MTB bacteria.

[0251] In some embodiments, the present application provides a method of detecting in vitro whether a sample comprises the Aeromonas MTB bacteria provided by the present application, comprising amplifying a polynucleotide encoding a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof, wherein a positive amplification result indicates that the sample comprises the Aeromonas MTB bacteria. In these embodiments, the primer and probe sequences can be designed according to the gene sequence encoding an aerolysin comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, and / or sequences upstream and downstream thereof. In some embodiments, the primer sequences are, for example, a primer pair as set forth in SEQ ID NOs: 143 and 144. In some embodiments, the probe sequence is, for example, a sequence as set forth in SEQ ID NO: 147. In these embodiments, the amplification can be performed by, for example, polymerase chain reaction (PCR). The reaction conditions for PCR can be determined by one skilled in the art according to experience or routine experimental operation. In an exemplary embodiment, the PCR amplification program is set as: 1) preheating at 37 °C for 2 min; 2) 40 cycles of denaturation at 95 °C for 30 s and annealing at 60 °C for 30 s.

[0252] In some embodiments, the present application provides a method of detecting in vitro whether a sample comprises the Aeromonas MTB bacteria provided by the present application, comprising amplifying gene 1407, wherein a positive amplification result indicates that the sample comprises the Aeromonas MTB bacteria. In these embodiments, the primer and probe sequences can be designed according to the sequence of gene 1407 and / or its upstream and downstream sequences. In some embodiments, the primer sequences are, for example, the primer pair set forth in SEQ ID NOs: 141 and 142. In some embodiments, the probe sequence is, for example, the sequence set forth in SEQ ID NO: 148. In these embodiments, the amplification can be performed by, for example, polymerase chain reaction (PCR). The reaction conditions for PCR can be determined by one skilled in the art according to experience or routine experimental operation. In an exemplary embodiment, the PCR amplification program is set as follows: 1) preheating at 37°C for 2 min; 2) 40 cycles of denaturation at 95°C for 30 s and annealing at 60°C for 30 s.

[0253] In other embodiments, the present application provides a method of detecting in vitro whether a sample comprises the Aeromonas MTB bacteria provided by the present application, comprising (a) amplifying a polynucleotide encoding a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 1 or 2, or an immunogenic fragment thereof; and (b) amplifying gene 1407, wherein a positive amplification result of both (a) and (b) indicates that the sample comprises the Aeromonas MTB bacteria.

[0254] In preferred embodiments, the sample is a fecal sample, for example, a fecal sample obtained from a subject suspected of having ulcerative colitis.

[0255] In other embodiments, the present application provides a method of detecting in vitro whether a sample comprises the Aeromonas MTB bacteria provided by the present application, comprising (a) culturing the sample to obtain a culture supernatant, (b) co-culturing the culture supernatant with macrophages, and (c) detecting the killing effect of the culture supernatant on the macrophages, wherein the presence of the killing effect indicates that the sample comprises the MTB bacteria. In some embodiments, the killing effect can be characterized by the survival rate of the macrophages. In some embodiments, the macrophages are human intestinal resident macrophages derived from the colon lamina propria. In some embodiments, the macrophages are CX3CR1+ intestinal resident macrophages derived from the colon lamina propria of a human. In some embodiments, the sample is cultured for 4-72 hours, preferably 12 hours, in step (a). In some embodiments, the culture supernatant is co-cultured with the macrophages for 1-8 hours, preferably 4 hours, in step (b). In some embodiments, the killing effect is determined by CCK8 or MTT method in step (c).

[0256] In a preferred embodiment, the sample is a fecal sample, such as a fecal sample obtained from a subject suspected of having ulcerative colitis.

[0257] Uses of Aeromonas spp. MTB inhibitors

[0258] Another aspect of the invention provides the use of any of the Aeromonas spp. MTB inhibitors provided by the invention for the prevention or treatment of ulcerative colitis in subjects.

[0259] In some embodiments, the present invention provides the use of any Aeromonas spp. MTB bacterium provided by the present invention as an inhibitor in the preparation of a medicament for the prevention or treatment of ulcerative colitis in a subject. In some embodiments, the present invention provides any Aeromonas spp. MTB bacterium provided by the present invention as an inhibitor for the prevention or treatment of ulcerative colitis in a subject. In some embodiments, the present invention provides a method for the prevention or treatment of ulcerative colitis in a subject, the method comprising administering to the subject any Aeromonas spp. MTB bacterium provided by the present invention as an inhibitor. In some embodiments, the present invention provides a method for the prevention or treatment of ulcerative colitis in a subject, the method comprising administering to the subject a medicament that inhibits or kills any Aeromonas spp. MTB bacterium provided by the present invention.

[0260] Inhibitors of Aeromonas spp. MTB can be obtained using the drug candidate screening method described above. In some embodiments, the inhibitors of Aeromonas spp. MTB are small molecule compounds that inhibit or kill Aeromonas spp. MTB.

[0261] In some embodiments, the Aeromonas spp. MTB inhibitor has the structure of Formula I:

[0262] in

[0263] At least two of R1, R2, and R3 are hydroxyl groups, and if not all of R1, R2, and R3 are hydroxyl groups, one of R1, R2, and R3 is selected from H, C1-C. 20 Alkyl groups, halogen-substituted C1-C groups 20 Alkyl, C3-C8 cycloalkyl, C1-C 20 Alkyl or C3-C8 cycloalkyl-substituted hydroxyl groups, and amino groups; preferably, R1, R2 and R3 are all hydroxyl groups;

[0264] R4 is selected from hydroxyl group, C1-C 20 Alkyl groups, halogen-substituted C1-C groups 20 Alkyl, C1-C 20 Alkoxy groups, halogenated C1-C 20alkyl, C3-C8cycloalkyl, C3-C8cycloalkyl substituted with halogen, and nothing; preferably, R4is selected from the group consisting of hydroxyl and C1to C8alkoxy; preferably, R4is hydroxyl, methoxy, ethoxy, propoxy, isopropoxy, butoxy, t-butoxy, isobutoxy, pentoxy, or iso-pentoxy.

[0265] In some embodiments, the Aeromonas MTB bacteria inhibitor is selected from the group consisting of phenolic carboxylic acids, 3,5-dihydroxy-4-methylbenzoic acid, 3-O-methylgallic acid, 1-(3,4,5-trihydroxyphenyl)ethanone, 3,4,5-trihydroxybenzaldehyde monohydrate, gallic acid, pyrogallic acid, propyl gallate, octyl gallate, 2-hydroxythiophenol, cyclohexane-1,3-diol, isoamyl gallate, isobutyl 3,4,5-trihydroxybenzoate, ethyl 3,4-dihydroxybenzoate, hexahydroxybenzene, dodecyl 3,4,5-trihydroxybenzoate, propyl p-hydroxybenzoate, 2-aminoresorcinol, 3-methylcatechol, butyl gallate, 1-O-galloylglycerol, and 3,4,5-trihydroxybenzamide.

[0266] In some embodiments, the Aeromonas MTB bacteria inhibitor is selected from the group consisting of phenolic carboxylic acids, 3,5-dihydroxy-4-methylbenzoic acid, 1-(3,4,5-trihydroxyphenyl)ethanone, 3,4,5-trihydroxybenzaldehyde monohydrate, 2-hydroxythiophenol, cyclohexane-1,3-diol, isobutyl 3,4,5-trihydroxybenzoate, ethyl 3,4-dihydroxybenzoate, hexahydroxybenzene, dodecyl 3,4,5-trihydroxybenzoate, propyl p-hydroxybenzoate, 2-aminoresorcinol, 3-methylcatechol, and 3,4,5-trihydroxybenzamide.

[0267] In some embodiments, the small molecule compound does not include gallic acid, ethyl gallate, ethyl digallic acid, or galloyl glucose.

[0268] In some embodiments, the small molecule compound is isoamyl gallate.

[0269] Methods of establishing an animal model of ulcerative colitis and animal models

[0270] Another aspect of the present application relates to methods of establishing an animal model of ulcerative colitis.

[0271] In some embodiments, the present application provides methods of establishing an animal model of ulcerative colitis, the method comprising colonizing the intestines of the animal with any of the Aeromonas MTB bacteria provided by the present application.

[0272] In some embodiments, the method comprises subjecting the colon epithelium of the animal to injury prior to administering the bacteria to the animal. In some embodiments, the method comprises administering an aqueous solution of dextran sulfate sodium to the animal prior to administering the bacteria to the animal. In some embodiments, the aqueous solution of dextran sulfate sodium has a concentration of 1-5 wt%, e.g., 2%, 3%, or 4%. In some embodiments, the aqueous solution of dextran sulfate sodium has a molecular weight of 36,000-50,000. In some embodiments, the method comprises administering an aqueous solution of dextran sulfate sodium having a molecular weight of 36,000-50,000 and a concentration of 1-5 wt% to the animal prior to administering the bacteria to the animal.

[0273] In some embodiments, the method further comprises clearing the normal gut flora of the animal prior to administering the bacteria to the animal. In some embodiments, the method further comprises administering an antibiotic or a mixture of antibiotics to the animal prior to administering the bacteria to the animal. In some embodiments, the antibiotic is one selected from the group consisting of ampicillin, vancomycin, neomycin, and metronidazole. In some embodiments, the mixture of antibiotics comprises multiple or all of ampicillin, vancomycin, neomycin, and metronidazole. In some embodiments, the mixture of antibiotics comprises 0.2 g / L ampicillin, 0.1 g / L vancomycin, 0.2 g / L neomycin, and 0.2 g / L metronidazole.

[0274] In some embodiments, the method comprises orally gavaging the animal with the MTB bacteria. In some embodiments, the animal is orally gavaged with 1 x 10 9 CFU of the MTB bacteria. In some embodiments, the method comprises (a) subjecting the colon epithelium of the animal to injury and / or clearing the normal gut flora of the animal; and (b) orally gavaging the animal with the MTB bacteria, such that the MTB bacteria colonize the gut of the animal.

[0275] In some embodiments, the method comprises (a) administering an aqueous solution of dextran sulfate sodium to the animal; and / or administering a mixture of antibiotics to the animal; and (b) orally gavaging the animal with the MTB bacteria, such that the MTB bacteria colonize the gut of the animal.

[0276] In some embodiments, the method comprises (a) administering an aqueous solution of dextran sulfate sodium having a molecular weight of 36,000-50,000 and a concentration of 1-5 wt% to the animal; and / or administering a mixture of antibiotics comprising ampicillin, vancomycin, neomycin, and metronidazole to the animal; and (b) orally gavaging the animal with the MTB bacteria, such that the MTB bacteria colonize the gut of the animal.

[0277] In any of the above embodiments, the method comprises administering an antibiotic or a mixture of antibiotics once and the aqueous solution of dextran sulfate sodium three times, and gavage administration of the MTB bacteria at each period of administration of the aqueous solution of dextran sulfate sodium.

[0278] In some embodiments, the establishment of the model is evaluated by the disease activity index (DAI).

[0279] In some embodiments, the animal is a mammal. In preferred embodiments, the animal is a rodent or a non-human primate. In preferred embodiments, the animal is a mouse, a rat or a monkey. In preferred embodiments, the animal is a mouse.

[0280] In some embodiments, the present application provides an animal model prepared by the method of establishing an animal model of ulcerative colitis. In some embodiments, the animal model is a rodent model. In preferred embodiments, the animal model is a mouse model.

[0281] Pharmaceutical compositions

[0282] The present application also includes pharmaceutical compositions and formulations comprising: (a) any of the aerolysin inhibitors provided by the present application, (b) any of the anti-aerolysin antibodies or antigen-binding fragments thereof provided by the present application, (c) any of the polypeptides or antigen-binding fragments thereof provided by the present application, (d) any of the inhibitors of MTB bacteria provided by the present application, or (e) any of the MTB bacteria or inactivated forms thereof provided by the present application; and a pharmaceutically acceptable carrier, excipient or diluent. In contemplation of clinical applications, the pharmaceutical compositions and formulations will be prepared in a form appropriate for the intended application. Generally, this will require the preparation of a composition that is substantially free of pyrogens as well as other impurities that can be harmful to humans or animals.

[0283] An effective amount of a pharmaceutical composition of the present application can be from about 0.01 mg / kg body weight to about 100 mg / kg body weight, and can be administered daily, weekly, monthly, or at longer intervals. The precise determination of the amount and frequency of administration of a particular inhibitor can be based on several factors, including the size, age and general condition of the patient, the type of disease to be treated (e.g., myocardial infarction, coronary artery disease, peripheral artery disease, stroke), the particular inhibitor used, and the route of administration.

[0284] Administration of the pharmaceutical compositions of the present application can be by any common route, so long as the target tissue is accessible by that route. These routes include, but are not limited to, parenteral (e.g., subcutaneous, intramuscular, intraperitoneal, or intravenous), oral, nasal, buccal, intradermal, transdermal, and sublingual routes, or by direct injection into liver tissue or delivery through the hepatic portal vein. In some embodiments, the pharmaceutical composition is administered parenterally. For example, in certain embodiments, the pharmaceutical composition is administered intravenously.

[0285] SEQUENCE LISTING EXAMPLES

[0286] 1. Experimental materials and methods

[0287] 1.1.1 Experimental animals

[0288] C57BL / 6J male mice used in this experiment were purchased from Nanjing Jisui Pharmaceutical Co., Ltd. and BALB / c female mice were purchased from Beijing Sibeifeng. Experimental animals were bred in the SPF environment of the Model Animal Institute of Nanjing University, Nanjing Normal University, and the School of Medicine of Nanjing University. Mice were bred under 12-hour light / 12-hour dark conditions and had free access to food and water. All animal operations in this study were in accordance with the requirements of animal experiments and were strictly in accordance with the standards of the Animal Care and Use Committee (IACUC) of the School of Medicine of Nanjing University and Nanjing Normal University.

[0289] 1.1.2 Clinical tissue and fecal sample collection criteria

[0290] Participants with UC were included in the experimental analysis after being diagnosed according to the criteria described in the reference. Intestinal tissue samples were collected from 13 UC patients and 7 colorectal cancer patients who underwent surgery in the Department of Surgery of Jinling Hospital Affiliated to the School of Medicine of Nanjing University. Indicators for colon resection surgery of UC patients: (a) absolute indicators: massive hemorrhage, intestinal perforation, toxic megacolon, or sepsis; (b) relative indicators: severe ulcerative colitis that does not respond to medical treatment, or that significantly affects the quality of life due to UC disease; (c) selective indicators: symptoms persist despite maximum medical treatment, long-term chronic disease state leading to dysplasia, or concurrent malignancy. Patients from whom UC tissue samples were collected were excluded from having diseases such as Crohn's disease and altered colitis, and patients who underwent colon resection had complete records of disease, medication, and allergy history. Fresh colon segments from UC and colorectal cancer (CCA) patients who underwent colon resection were collected, the colon tissue was washed with sterile PBS, and the tissue block was cut into 1 cm3 The mucosa and muscle layers were peeled off and snap-frozen in liquid nitrogen for Western blotting. Another 4% PFA (PBS) (16005, Sigma) fixed tissue was embedded in paraffin and sectioned for immunohistochemistry. Fresh stool samples were collected from UC patients (79), refractory constipation patients (66), and CD patients (38) who were admitted to the Department of Gastroenterology, Jinling Hospital. Normal stool samples were collected from Jiangsu Center for Disease Control and Prevention and Nanjing Center for Disease Control and Prevention (430). Fresh stool samples from UC patients and other control groups were collected using a stool collection tube containing a cryopreservation solution (LB medium: glycerol = 1:1) (Chu Tianshu Biotechnology Co., Ltd., Xi'an, China). After uniform shaking, the samples were stored at -80°C for later use.

[0291] 1.1.3 Bacterial culture

[0292] To collect bacterial culture metabolites, 100 μΐ of the stool suspension was inoculated into 900 μΐ of LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride) and incubated at 37°C for 12-16 hours. After centrifugation of the supernatant at 12000 rpm for 10 min at 4°C, the supernatant was filtered using a 0.22 μιη syringe filter. The obtained supernatant was used for cytotoxicity assays. To isolate and identify bacteria in the stool sample, 100 μΐ of the stool suspension was diluted ten-fold and spread on Columbia blood agar plates (LA3540, Solarbio) containing 10% sterile defibrillated sheep blood. After 12-16 hours, single colonies were picked from the culture plates for PCR detection and cytotoxicity assays. The final concentrations of antibiotics used in bacterial culture were as follows: ampicillin (100 μg / mL), kanamycin (30 μg / mL), gentamicin (55 μg / mL), penicillin (100 U / mL), streptomycin (100 μg / mL), and ciprofloxacin (25 μg / mL).

[0293] 1.1.4 Strain preservation and API-20NE

[0294] Aeromonas veronii strains TH0426 and ATCC35624 were purchased from Ningbo Mingzhou Bioengineering. Aeromonas bacteria were characterized using RIMLER-SHOTTS (RS) agar medium. MTB (2A5), MTB (10A1), MTB (10B4), MTB (10A3), and MTB (10A10) strains isolated from UC fecal bacteria in this experiment were deposited in the applicant’s laboratory, and MTB (2A5) and MTB (10A1) were deposited in the China General Microbiological Culture Collection Center on May 27, 2024, with the accession numbers CGMCC No. 30776 (2A5) and 30777 (10A1). API 20NE identification was completed by the China Industrial Microbial Culture Collection Center.

[0295] 1.1.5 Cell lines and primary isolated macrophages and their culture

[0296] BMDM, Raw264.7, MC-38, HT29, Caco-2 cells were cultured in DMEM (#12100046, Life Technologies) containing 10% fetal bovine serum (FBS, Gibco), 100 U / mL penicillin and 100 μg / mL streptomycin (1% PS). NCM460 cells were cultured in RPMI 1640 (#31800-022, Life Technologies) medium containing 10% FBS and 1% PS. THP-1 was induced into human macrophages with 200 ng / ml PMA (HY-18739, MedChemExpress) pretreatment 24 hours before the experiment in RPMI 1640 (10% FBS, 1% PS) medium containing 50 μM β-mercaptoethanol. The isolation of mouse bone marrow-derived macrophages (BMDM) was performed according to the method described in the reference. The hind limbs of sacrificed C57BL / 6J (6-8 weeks) mice were washed with PBS (pH 7.4) to remove bone marrow. The cells were centrifuged at 500 g x 10 min at room temperature and inoculated into 10 ml of macrophage complete medium (DMEM, 30% L929 medium, 10% FBS, 1% PS), and the BMDM induction stage was cultured on Nunclon Sphera 90 mm culture dishes (174945, Thermo). The medium was replaced on the third day of induction, and BMDM was collected by 0.25% EDTA (PBS) digestion on the seventh day, followed by plating into 96-well plates and culturing in DMEM containing 10% FBS and 1% PS. All cells were cultured at 37°C, 5% CO2.

[0297] 1.1.6 Cytotoxicity detection, toxin antibody neutralization survival rate detection

[0298] To test the cytotoxic effect of fecal bacteria culture supernatant from healthy person, constipation patient, UC patient on BMDM, 20 μΐ of filtered bacteria culture supernatant was added into 100 μΐ DMEM (10% FBS, 1% PS) and mixed with 2 x 10 4 BMDM were co-cultured in 96-well plate, 6 hours later, 10 μΐ CCK8 was added to test cell survival rate. To test the neutralization effect of anti-Aerolysin neutralizing antibody on UC fecal bacteria toxin, 20 μΐ of bacteria culture supernatant from healthy person mixed bacteria, UC mixed bacteria and MTB were mixed with 10 μΐ of ten-fold gradient dilution of mouse anti-Aerolysin polyclonal antibody, respectively, and the bacteria supernatant-antibody mixture was mixed with 2 x 10 4 BMDM were co-cultured, 6 hours later, CCK8 was added to test cell survival rate. To test the sensitivity of human and mouse epithelial cell lines and macrophages to Aerolysin-induced death, MC-38, Raw264.7, 5E6L, Caco-2, NCM460, HT-29 and THP-1 cells were plated in 96-well plate, cultured for about 20 hours to grow to 50% cell confluence, then 1 μΐ of two-fold gradient dilution of 1 mg / ml GST-Aerolysin was added in each well, 3 hours later, CCK8 was added to test cell survival rate.

[0299] CCK-8 kit (#20118, SUDGEN) was used to test cell survival rate. The calculation method was as follows: OD 450 nm and OD 600 nm (blank control) values. Cell survival rate = [(experimental (OD 450 nm-OD 600 nm)-blank (OD 450 nm-OD 600 nm)) / (control (OD 450 nm-OD 600 nm)-blank (OD 450 nm-OD 600 nm))] x 100%.

[0300] 1.1.7 Isolation and identification of macrophage toxin in UC fecal bacteria culture supernatant

[0301] UC mixed faecal bacteria were cultured in DMEM medium for 16 hours, the culture supernatant was filtered through a 0.22 pm filter to remove bacteria, and the culture supernatant was concentrated 30-fold using an Amicon Ultra-15 10K ultrafiltration tube (Millipore). The concentrated solution was loaded into a 10 kDa dialysis bag and dialysed against 20 mM Tris-HCl (pH 6.5) at 4°C overnight. The purification was performed using a IexCap DEAE 6FF column (SI005C15, Smart-Lifesciences) on a AKTA Avant Protein Purification System (Cytiva Lifesciences). The equilibration buffer A (20 mM Bis-tris, pH 6.5) and the buffer B (1 M NaCl, 20 mM Bis-tris, pH 6.5) were used in the purification experiment. The concentrated and dialysed sample was loaded onto the IexCap DEAE 6FF column and equilibrated with 10 CV (column volume) of buffer A. The gradient elution program was: 2 CV (85% buffer A + 15% buffer B), 2 CV (70% buffer A + 30% buffer B), 2 CV (40% buffer A + 60% buffer B), 4 CV (100% B) at a flow rate of 1 ml / min. Each elution fraction was dialysed against 10 mM PBS (pH 7.4), filtered to remove bacteria and used for BMDM cytotoxicity assay. The cytotoxic fractions were separated by SDS-PAGE and the candidate bands were subjected to LC-MS / MS analysis after Coomassie blue staining. The protein purification system (Cytiva Lifesciences). The equilibration buffer A (20 mM Bis-tris, pH 6.5) and the buffer B (1 M NaCl, 20 mM Bis-tris, pH 6.5) were used in the purification experiment. The concentrated and dialysed sample was loaded onto the IexCap DEAE 6FF column and equilibrated with 10 CV (column volume) of buffer A. The gradient elution program was: 2 CV (85% buffer A + 15% buffer B), 2 CV (70% buffer A + 30% buffer B), 2 CV (40% buffer A + 60% buffer B), 4 CV (100% B) at a flow rate of 1 ml / min. Each elution fraction was dialysed against 10 mM PBS (pH 7.4), filtered to remove bacteria and used for BMDM cytotoxicity assay. The cytotoxic fractions were separated by SDS-PAGE and the candidate bands were subjected to LC-MS / MS analysis after Coomassie blue staining.

[0302] 1.1.8 LC-MS / MS analysis

[0303] The active fractions after protein purification were separated by SDS-PAGE, and the candidate bands were excised, trypsin-digested and subjected to LC-MS / MS analysis. The detailed procedure included: the protein gel of candidate bands was cut into 1 mm 3 cubes, and washed three times with 50 mM ammonium bicarbonate:acetonitrile (1 : 1) solution. Then, the gel cubes were dried in vacuum and digested with trypsin overnight at 37°C with a trypsin:protein mass ratio of 1 :50. Subsequently, 10% formic acid:acetonitrile (1 : 1) solution was mixed and the peptides were extracted after 15 minutes and dried in a SpeedVac. The protein samples were resuspended with 15 pL of 3% acetonitrile and 2% formic acid before LC-MS / MS analysis. The LC-MS / MS analysis was performed using a nanoAcquity UPLC system (Waters) coupled to a Q Exactive Plus mass spectrometer (Thermo Scientific). 5600+ system (AB SCIEX) for LC-MS / MS analysis. Raw MS / MS file data of the label-free proteomics experiment were submitted to the ProteinPilot software (version 4.5, AB SCIEX) for data analysis. Raw data file number PXD050471. MS / MS data were searched against the UniProt database (January 2021, containing 251,702,059 results, https: / / www.uniprot.org / proteomes / UP000439123).

[0304] 1.1.916S rRNA phylogenetic tree analysis

[0305] MTB 16S rRNA sequences were amplified by PCR method using Bacteria-27-F (5’-3’: AGAGTTTGATCCTGGCTCAG, SEQ ID NO: 185) and Bacteria-1492-R (5’-3’: GGTTACCTTGTTACGACTT, SEQ ID NO: 186) primers. Sequence alignment and clustering analysis were performed using ClustalW. The genetic evolutionary history was calculated using the Neighbor-Joining method. The genetic evolutionary distance was calculated using the Maximum Composite Likelihood method. The 16S rRNA phylogenetic tree analysis included 39 nucleotide sequences from different Aeromonas species, and all sites containing gap and missing data were excluded. There were a total of 1263 sites in the final data set. Phylogenetic tree construction and analysis were performed using the molecular evolution genetic analysis software MEGA7 (version 7.0.14).

[0306] 1.1.10 Bacterial whole genome sequencing and assembly

[0307] Genomic DNA of MTB was sequenced on DNBSEQ and Oxford nanopore platforms at Beijing Genomics Institute (BGI, Shenzhen, China). DNBSEQ data were filtered for data quality control using SOAPnuke software (version 1.5.6, parameters: -l 20 -q 40% -n 0.1% -d) to further improve the accuracy of the genomic sequence. Nanopore data were adapter contamination removed using porechop (version: 0.2.4, parameters: default parameters %Methods) and filtered for sequences less than 2000 bp in length. These subreads were self-corrected by the Canu program to assemble a draft genome unit of high-quality, corrected, circular consensus sequence subread sets. Single base correction was performed by GATK (https: / / www.broadinstitute.org / gatk / ) to further improve the accuracy of the genomic sequence. Sequenced assembled genomic sequences were uploaded to GenBank with the BioProject Accession Number PRJNA1083721. Genome component prediction and annotation were performed according to the methods described in the references.

[0308] 1.1.11 Plasmid construction

[0309] To express recombinant Aerolysin protein of different lengths in E. coli, Aerolysin sequences were amplified from Aeromonas sp. MTB (10A1) genomic DNA. The sequence containing N-terminal signal peptide resulted in no protein activity of GST-Aerolysin NA amplified using pGEX-Aerolysin NAF / R primers. The full-length Aerolysin (1-464 aa) sequence without N-terminal signal peptide was amplified using pGEX-Aerolysin F / R primers. Aerolysin truncated fragments (1-148 aa, 149-296 aa and 297-443 aa) sequences were amplified using pGEX-Aerolysin (1-148 aa)-F / R, pGEX-Aerolysin (149-296 aa)-F / R and pGEX-Aerolysin (297-443 aa)-F / R primers, respectively. The amplified Aerolysin and its truncated sequences were integrated into pGEX-5X-1 plasmid linearized with EcoR I & Xho I restriction enzymes using ClonExpress II One Step Cloning Kit (C112, Valzyme). To construct a homologous recombination suicide plasmid for Aerolysin N-terminal gene deletion of 636 bp, MTB (2A5) genomic DNA 500 bp left arm (LA) and 500 bp right arm (RA) sequences were amplified using PRE112-Δaerolysin-LAF / R and PRE112-Δaerolysin-RAF / R primer sets. The resulting LA and RA fragments were integrated into PRE112 plasmid linearized with Kpn I & Sac I restriction enzymes using ClonExpress MultiS One Step Cloning Kit (C113, Valzyme), and the recombinant plasmid was transformed into E. coli λpir competent cells (Mingzhou Biological) and the successful construction of the plasmid was confirmed by sequencing. Primer sequences are shown in Table 1.

[0310] 1.1.12 Expression and purification of recombinant proteins

[0311] pGEX-Aerolysin NA, pGEX-Aerolysin, pGEX-Aerolysin 1-148aa, pGEX-Aerolysin 149-296aa and pGEX-Aerolysin 297-443aa were transformed into DH5α competent cells, respectively. The transformed bacteria were induced with 50 nM IPTG for 4 hours. The induced bacteria were collected by centrifugation at 12000 rpm for 5 min and were sonicated. The obtained bacterial supernatant was filtered through a 0.22 μm filter and was purified using glutathione Sepharose 4B resin (#17-0756-01, GE Healthcare) to obtain GST-Aerolysin NA, GST-Aerolysin, GST-Aerolysin 1-148aa, GST-Aerolysin 149-296aa, GST-Aerolysin 297-443aa recombinant proteins.

[0312] 1.1.13 Preparation of mouse polyclonal antibody against Aerolysin

[0313] The purified recombinant GST-Aerolysin NA (100 μg dissolved in 100 μl PBS) was mixed with 100 μl complete Freund's adjuvant (sigma, F5881, CFA) to form a suspension, which was intraperitoneally injected into BALB / c female mice (6 weeks old) for the first immunization. The mice were intraperitoneally injected with 50 μg GST-Aerolysin NA protein and 50 μl incomplete Freund's adjuvant (sigma, F5506, IFA) for two times of booster immunization, with an interval of 2 weeks. Three days after the last injection, the mice were intraperitoneally injected with 2 x 10 6 SP2 / 0 myeloma cells were used to induce the production of antibody-containing ascites. The polyclonal antibodies in ascites and serum were purified by rProtein G gel (Smart-Lifesciences, SA016005) according to the instructions.

[0314] 1.1.14 Preparation of mouse monoclonal antibody against Aerolysin

[0315] To prepare monoclonal antibodies, BALB / c female mice (6 weeks old) were initially immunized by intraperitoneal injection of 100 μg GST-Aerolysin 1-148aa:CFA (1:1) suspension. Two booster immunizations were performed every two weeks by intraperitoneal injection of 50 μg GST-Aerolysin 1-148aa:IFA (1:1) suspension. Three days after the final immunization, the spleen of the immunized mice was harvested, spleen cells were isolated by grinding, and fused with SP2 / 0 cells using polyethylene glycol. The fused cells were cultured in RPMI 1640-HAT medium (Sigma, HO262) containing 10% FBS, 1% PS, and gentamicin. Two weeks later, the culture medium of hybridoma cells was used for ELISA detection on Aerolysin-coated plates to screen hybridoma clones that produced anti-Aerolysin IgG antibodies. The culture medium of antibody-positive hybridomas was used to perform Western blotting with the supernatant of Aeromonas sp. MTB and DH5α to verify antibody specificity. Anti-Aerolysin antibody-positive hybridomas were further subcloned and amplified in 10% FBS, 1% PS RPMI 1640-HT medium (Sigma, HO137) to obtain single-cell hybridoma lines. The procedure for obtaining high-titer monoclonal antibodies from anti-Aerolysin antibody-positive hybridomas via intraperitoneal culture was as follows: 8-week-old BALB / c female mice were intraperitoneally injected with 0.25 ml of IFA, and one week later, they were intraperitoneally injected with 1×10⁻⁶ IFA. 6 Hybridoma cells. Ascites fluid was further purified using rProtein G, and after antibody dialysis, it was finally stored in 10 mM PBS.

[0316] 1.1.15MTB Δaerolysin strain construction

[0317] To mutate the aerolysin gene in MTB(2A5) bacteria, we used the homologous recombinant plasmid PRE112-Δaerolysin, which deletes the 20-655 bp region of the aerolysin gene. The specific procedures included: transforming the correctly sequenced PRE112-Δaerolysin into E. coli WM3064 competent cells (Ningbo Mingzhou Biotechnology); supplementing the E. coli WM3064 culture medium with 25 μg / ml pimecrolic acid (DAP) (D836611, Macklin). E. coli WM3064 strains containing the PRE112-Δaerolysin plasmid and MTB(2A5) colonies were inoculated into antibiotic-free LB broth and incubated at 37°C until OD500. 600The value reached 0.5. The bacteria were mixed at a ratio of 1 :3 = recipient bacteria : donor bacteria, 1 ml of MTB (2A5) bacterial culture was centrifuged (5000 rpm x 8 min) and suspended with 300 μl of LB, 100 μl of the MTB (2A5) suspension was added to 1 ml of PRE112-Δaerolysin E. coli WM3064 centrifuged bacterial pellet, and the mixed bacteria were resuspended, the mixed bacteria were plated on LB solid medium containing 25 μg / ml DAP. After 24 hours of culture at 37°C, the clones on the culture plate were washed with 2 ml of LB medium and collected, then inoculated on LB solid medium containing 100 μg / ml ampicillin and 25 μg / ml chloramphenicol (B541015, BBI). After overnight culture at 37°C, the colonies were picked and the first cross-recombination positive colonies were screened by PCR using the PRE112-Δaerolysin LA-F / RA-R primer pair, and the positive clone PCR product should have two bands of 1042 bp and 1677 bp. To screen the second cross-recombination bacteria, the first cross-positive strain was inoculated into liquid LB containing 10% sucrose, cultured at 37°C, and subcultured every 12 hours for a total of 4 times. Subsequently, the screened strain was spread on LB agar (100 μg / ml ampicillin, 10% sucrose) and cultured overnight at 37°C. MTB (2A5) mutant strains that could grow on LB plates containing ampicillin and 10% sucrose but could not grow on LB medium containing chloramphenicol were selected, the mutant strains were detected by PCR using the PRE112-Δaerolysin LA-F / RA-R primer pair, which should only have a 1042 bp band, and the amplification product was sequenced to verify the gene deletion. The positive clone with correct sequencing was subjected to Western blotting to detect the expression of Aerolysin protein. The MTB recombinant mutant strain with Aerolysin protein expression deletion verified by sequencing and Western blotting is referred to as MTB Δaerolysin .

[0318] 1.1.16 siRNA interference

[0319] siRNA was designed and synthesized by Shanghai Jimabio, and the sequence information is shown in Table 2. siRNA was introduced into Raw264.7 using the siRNA-mate plus transfection kit (G04002, Genepharma). The specific operation steps include: Raw264.7 cells were plated in 96-well plates at 2 x 10 4Cells were plated at 1 x 10 cells per well in 24-well plates in 500 μl DMEM (10% FBS, 1% PS) and the siRNA transfection was performed as described above. After 72 hours, the cells were assayed for Aerolysin cytotoxicity. Raw264.7 cells were plated at 1 x 10 5 Cells were plated at 1 x 10 cells per well in 24-well plates in 500 μl DMEM (10% FBS, 1% PS) and the siRNA transfection was performed as described above. After 72 hours, the cells were assayed for Aerolysin cytotoxicity. Raw264.7 cells were plated at 1 x 10

[0320] 1.1.17 Western blotting and dot blotting

[0321] Fresh or frozen biopsy samples were homogenised in RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.25% deoxycholate sodium, 1 x Protease Inhibitor Cocktail) and lysed on ice for 30 minutes. The lysate was centrifuged at 12,000 rpm for 5 minutes at 4°C and the supernatant was removed. The supernatant was denatured by the addition of 1 x Laemmli buffer and heating at 95°C for 5 minutes. The proteins were separated by SDS-PAGE and transferred to a PVDF membrane (Bio-Rad). For dot blotting, the denatured sample was added directly to the PVDF membrane. The PVDF membrane was blocked in 5% skimmed milk for 30 minutes and incubated with the primary antibody overnight at 4°C. The secondary antibody was incubated for 2 hours at room temperature. The PVDF membrane was reacted with high-sensitivity ECL reagent (180-5001, Tanon) and developed on an immunoblotting detection system (Tanon 4160). The primary antibodies are listed in Table 3. The secondary antibodies are listed in Table 4. Table 4. Secondary antibody list

[0322] 1.1.18 Microscopy

[0323] Bacteria were observed under transmission electron microscope (TEM) after negative staining with phosphotungstic acid. The detailed operation included: MTB bacteria were adsorbed on Formvar-coated copper grid (WFHM-150, Servicebio), then fixed in 0.5% glutaraldehyde (P1126, Solarbio) for 10 s, and finally negatively stained with 2% phosphotungstic acid (G1870, Solarbio) for 10 s. TEM imaging of bacteria was taken on a transmission electron microscope (H-7650, HITACHI).

[0324] To observe the death morphology of Raw264.7 cells after Aerolysin treatment, 1 x 10 6 Raw264.7 cells were plated in 10 cm dishes, and 20 hours later, recombinant GST-Aerolysin was added for 3 hours. TEM imaging of cells was completed by Shandong Weiya Company. The detailed operation included: cells were collected and fixed with 3% glutaraldehyde for more than 24 hours, and then sequentially washed, fixed with 1% osmium acid, followed by washing, dehydration, penetration, Epon812 embedding, and LKB-V ultra-thin sectioning according to the conventional TEM sample preparation method. Then, lead citrate and acetic acid electronic staining were performed. TEM images were observed by JEOL-1200Ex transmission electron microscope, and Morada-G2 software was used for imaging.

[0325] Cell morphology under bright field was observed using an inverted microscope, and cell morphology images were taken using Motic Image Plus 3.0. H&E and IHC images were taken using an upright microscope (DP74, OLYMPUS) equipped with a CCD camera.

[0326] 1.1.19 Histology and immunohistochemical staining

[0327] Intestinal tissue samples fixed with 4% PFA were paraffin-embedded (39601095, Leica) and sectioned, and hematoxylin-eosin (H&E) staining was performed according to the conventional procedure. Immunohistochemical staining was performed using immunohistochemical reagents (KIT-9706 for mouse tissue sections; KIT-5920 for human tissue sections, Maygen Biotechnology Co., Ltd.). The specific operation steps included: tissue antigen repair was performed on 5 μm paraffin sections using citric acid buffer (E673001, BBI). Endogenous peroxide was removed, serum was blocked, primary antibody was incubated at 4°C overnight, and horseradish peroxidase-conjugated secondary antibody was incubated at room temperature. Color development was performed using a DAB peroxidase (HRP) substrate kit (DAB-0031, Maygen Biotechnology), followed by hematoxylin counterstaining. The primary antibody information and the concentration used are shown in Table 3.

[0328] 1.1.20 Immunofluorescence detection

[0329] Inflammatory colonic tissues from UC patients or cancer adjacent colonic tissues from CRC patients were collected 5mm 3 and immediately fixed with 4% PFA (PBS, pH 7.4) at 4°C for 24 hours, dehydrated with 10%, 20% sucrose gradient for 1 hour at each concentration, and finally 30% sucrose at 4°C overnight. The colonic tissues were embedded in OCT and snap-frozen in liquid nitrogen. Cryosections (8 pm) were performed using a Leica CM1950 cryostat. Raw264.7 and HT29 cells were seeded on 1% gelatin pre-treated coverslips. After treatment with GST-Aerolysin, the coverslips were fixed with 4% PFA (PBS) for 10 minutes. For immunofluorescence staining, the colonic sections or coverslips were washed with PBS for 5 minutes for three times, permeabilized with 0.1% Triton X-100 (PBS) for 10 minutes, and then blocked with 1% bovine serum albumin (BSA) for 1 hour at room temperature. The primary antibodies were incubated overnight at 4°C. The sections were washed with PBS for 5 minutes for three times, and then incubated with secondary antibodies and DAPI (1:500, BioSharp) for 1 hour at room temperature. After washing, the sections were mounted with 50% glycerol (PBS, pH 7.4). Images were taken at 1024 x 1024 pixels on a FV3000 confocal microscope (Olympus, Japan). The information of antibodies is shown in Tables 3-4.

[0330] 1.1.21 Bacterial intestinal colonization experiment

[0331] MTBs strains and A. veronii strains (TH0426, ATCC35625) were collected from feces of mice after gavage to detect the colonization of bacteria in the intestinal tract of mice. The specific operation includes: C57BL / 6 male mice (6-8 weeks old) were pretreated with water, antibiotic mixture (AVNM, 0.2 g / L ampicillin, 0.1 g / L vancomycin, 0.2 g / L neomycin and 0.2 g / L metronidazole) and / or DSS (36,000-50,000 dextran sulfate sodium salt, 160110, MPBiomedicals) for 1 x 10 9CFU bacteria. Feces were collected several days after bacterial gavage, and 1 ml LB was added for 16 hours incubation at 37°C (P1). For DSS-treated mice, 10 μl P1 fecal bacteria were transferred to a new 1 ml LB for 16 hours incubation at 37°C (P2). Then P1 or P2 fecal bacterial suspension was used directly for PCR detection of bacterial colonization. ASA F / R primers amplified Aerolysin gene fragment for identification of MTBs strain and A. veronii strain, with a product size of 327 bp. RRS F / R primers amplified E. coli 16s rRNA to show the degree of PCR inhibition, and only when there was a positive band in RRS, the result of ASA reaction of this sample was used to judge bacterial colonization. Reaction system: 10 μl Taq Master Mix (P112, Vazyme), 0.5 μl / 0.5 μl forward / reverse primer, 1 μl bacterial solution, 8 μl ddH2O. Amplification program was set as: 1) 95°C for 3 minutes; 2) 35 cycles of 95°C for 30 s denaturation, 62°C (ASA) / 58°C (RRS) for 30 s annealing, 72°C for 30 s extension; 3) 72°C for 5 minutes. PCR primers are shown in Table 5.

[0332] 1.1.22 MTB colitis induction and phenotype evaluation

[0333] C57BL / 6J male mice were given free access to AVNM-containing water for 5 days, then changed to 2% DSS-containing drinking water for 5 days, and then normal drinking water for 2 days. During the DSS treatment, mice were orally gavaged with 1 x 10 9CFU MTB or 100 μΐ PBS, two cycles of DSS treatment and bacterial gavage. The body weight, diarrhea and hematochezia of mice were recorded every day. The final disease activity index (DAI) included the following: weight loss percentage (none = 0, <5% = 1, 5%-10% = 2, 10%-20% = 3, >20% = 4), stool consistency (normal = 0, loose = 2, diarrhea = 4), and hematochezia (none = 0, occult = 2, obvious bleeding = 4). After the colon tissue of mice was rolled into a Swiss roll and paraffin sectioned, H&E staining was performed, and then the stained tissue was scored for histopathology. The pathological score was calculated according to the method of the reference, and the specific evaluation criteria included: inflammation severity score (0 = none, 1 = mild, 2 = moderate, 3 = severe); inflammation involving the range of mucosal layer (0 = none, 1 = mucosa, 2 = mucosa and submucosa, 3 = full layer); epithelium / pit injury degree (0 = none, 1 = 1 / 3 of the base, 2 = 2 / 3 of the base, 3 = crypt loss, 4 = crypt and surface epithelium destruction). Each variable score was multiplied by the coefficient of the percentage of involved colon (0.25 = 0-25%, 0.5 = 26-50%, 0.75 = 51-75%, 1.0 = 76-100%), and the sum of the scores was the histopathology score.

[0334] 1.1.23 Fluorescent quantitative PCR and relative quantification of mRNA

[0335] To analyze the gene expression in the colon, total RNA of the colon was extracted using Trizol (9109, Takara Bio), and reverse transcription was performed using HiScript III RT SuperMix, followed by 5-fold dilution with ddH2O. The cDNA sample was subjected to fluorescent quantitative PCR (qPCR) analysis, and the reaction system was as follows: 5 μΐ Taq Pro Universal SYBR qPCR Master Mix (Q712-02, Vazyme), 4.6 μΐ reverse transcription cDNA sample, and 0.2 μΐ / 0.2 μΐ forward / reverse primer. The amplification program was set as follows: 1) 95 °C for 30 s; 2) 40 cycles of 95 °C for 10 s denaturation and 60 °C for 20 s annealing. The qPCR reaction was performed on an ABI ViiA TM 7Real-Time PCR instrument. The relative expression of mRNA was analyzed using the ΔCt method, with Gapdh abundance as the standardization control. The relative expression level was calculated using the 2^-ΔCt formula, and then standardized with the control group value set as 1. The final result was presented as the gene fold change relative to the control group. The primer sequence information is shown in Table 6. Table 6 qPCR primer list

[0336] 1.1.24 Epidemiological detection of MTB in the feces of UC patients and control population

[0337] The fecal samples of UC patients and control group were mixed with frozen liquid and stored at -80°C. 100 μl of fecal bacteria suspension was taken and added into 900 μl LB medium before detection. The mixture was incubated at 37°C for 16 hours. Aerolysin in the fecal bacteria of UC patients was detected by PCR according to the method in the reference. The reaction system included 10 μl Taq Master Mix, 0.5 μl / 0.5 μl PCR-ASA1 F / R primer, 1 μl bacteria liquid, and 8 μl ddH2O. The amplification procedure was set as follows: 1) 95°C for 5 minutes; 2) 50 cycles of 95°C for 30 seconds, 59°C for 30 seconds, and 72°C for 30 seconds; 3) 72°C for 7 minutes. The information of PCR-ASA1 primer is shown in Table 5. The positive product band of PCR amplification was 249 bp. The amplification of RRS F / R primer was carried out according to the amplification method in 1.1.21, which was used as the reaction efficiency internal reference.

[0338] To improve the sensitivity of detection, 100 μl UC patient and control fecal bacteria suspension was added to 900 μl LB medium, and after 37°C culture for 16 hours, the bacterial genomic DNA of gram-negative bacteria in the fecal bacteria was extracted using Bacterium(G-) Genomic DNA extracting Kit (K2303, Karroten) according to the manufacturer's instructions, and used for MTB-specific Taqman probe detection. In this experiment, specific amplification primers and corresponding Taqman probes were designed for MTB Aerolysin gene and MTB special gene 1407. The Taqman probe qPCR reaction system included: 10 μl Taq Pro HS Universal U+Probe Master Mix (QN114, Vazyme), 1 μl genomic DNA, 0.4 μl / 0.4 μl ASAtaq F / R, 0.4 μl / 0.4 μl 1407taq F / R, 0.2 μl / 0.2 μl RRStaq F / R, 0.2 μl ASAtaq probe, 0.2 μl 1407taq probe, 0.1 μl RRStaq probe, 1 μl ddH2O. The primers are shown in Table 6. ASAtaq probe: 5'-CGTGGACAAGCCGCCATTGCACA-3'(SEQ ID NO: 147); 1407taq probe: 5'-AACAAAGGCACCATTGACTACATCGGTCAG-3'(SEQ ID NO: 148); RRStaq probe: 5'-AACTGAGACACGGTCCAGACTCCTACGGGA-3'(SEQ ID NO: 149). The amplification program was set as: 1) 37°C preheating for 2 min; 2) 40 cycles of 95°C 30 s denaturation and 60°C 30 s annealing. Taqman probe qPCR was performed on ABI QuantStudio 5 Real-Time PCR instrument.

[0339] 1.1.25 Small molecule compounds and antibiotics on the inhibitory effect of MTB bacteria

[0340] Preparation of LB liquid medium and LB solid medium: add proteose peptone 10 g, yeast powder 5 g, NaCl 10 g, ddH2O to 1 L in turn and dissolve; add 15 g agar to the solid medium, and autoclave for 20 min.

[0341] Preparation of drug stock solution and working solution: take appropriate amount of drug (about 10 mg), prepare stock solution with concentration of 51.2 mg / ml by DMSO, and dilute with sterilized liquid medium to working solution with concentration of 1024 μg / ml or 2048 μg / ml.

[0342] Negative control DMSO: take appropriate amount of DMSO and dilute by the same ratio; positive control: take 100X double-antibiotic (penicillin / streptomycin, 10 ml, 0.1 g of streptomycin and 0.0625 g of penicillin in 1x PBS, to prepare 100x stock solution) and dilute by the same ratio.

[0343] Activation of bacterial strains: light alcohol lamp, pour appropriate amount of solid medium into the culture dish, take a small amount of bacterial solution with a gun head and streak on the medium, and place in a 37°C shaking bed (180 rpm / min) for overnight culture. The next day, pick single colonies into centrifuge tubes with 3-4 ml of medium, and incubate for 12-18 h. Measure the OD600 of the bacterial solution, and the absorbance value should be within 0.6-0.8.

[0344] Plating: take appropriate amount of bacterial solution and dilute with liquid medium at a ratio of 1:2000. Add 100 μl of sterilized water or medium to each well. Add 100 μl of working solution to each well, blow evenly, and then take 100 μl to the next well, with the concentration decreasing in turn. The concentrations from top to bottom are 1024, 512, 256, 128, 64, and 32 (μg / mL). The double-antibiotic concentrations are 25X, 12.5X, 3.25X, 3.125X, and 1.56X. Add 100 μl of bacterial solution to each well, and place in a 37°C incubator for 16-20 h.

[0345] Result determination: positive indication: similar to the positive control well, the growth of microorganisms in the well is effectively inhibited, and the liquid is clear; negative indication: similar to the negative control well, the growth of microorganisms in the well is not effectively inhibited, and the liquid is turbid. After the culture is completed, take out the 96-well plate, observe and record the minimum bacteriostatic concentration of the compound; use the enzyme marker to measure the OD600, and compare it with the OD value of the double-antibiotic MIC well. If it is smaller, it has bacteriostatic effect. Some drugs have high color absorbance after dissolution, so the final MIC determination needs to combine the OD600 with the observation results.

[0346] 1.1.26 Aerolysin NA vaccine can effectively prevent MTB-induced colitis

[0347] Plasmid construction: Aerolysin sequence was amplified from Aeromonas sp. MTB (10A1) genomic DNA. PGEX-Aerolysin NAF / R primers were used to amplify Aerolysin NA sequence containing N segment signal peptide which resulted in no protein activity. The amplified full length Aerolysin was integrated into EcoRI & Xho I restriction enzyme linearized pGEX-5X-1 plasmid.

[0348] Protein expression and purification: PGEX-Aerolysin NA plasmid was transformed into DH5a competent cells, and the transformed bacteria were induced by 50 nM IPTG for 4 hours. The induced bacteria were collected by centrifugation at 12000 rpm for 5 min, and then were subjected to ultrasonic disruption. The obtained bacterial supernatant was filtered through a 0.22 μm filter, and then was purified using glutathione agarose 4B resin (#17-0756-01, GE Healthcare) to obtain GST-Aerolysin NA.

[0349] Vaccine induction phase: The vaccine treatment group was immunized with GST-Aerolysin NA antigen, and the PBS and immunoadjuvant suspension immunized mice were used as the control group. The purified recombinant 100 μg GST-Aerolysin NA / 100 μl PBS was mixed with 100 μl complete Freund's adjuvant to form a suspension, and then was intraperitoneally injected into C57BL / 6J male mice (7 weeks old) for the first immunization. The intraperitoneal injection of 50 μg GST-Aerolysin NA / 100 μl PBS and 50 μl incomplete Freund's adjuvant suspension was used for three times of booster immunization, and the interval was 2 weeks.

[0350] Construction of intestinal inflammation model and disease scoring after vaccine immunization: The subsequent intestinal inflammation model was constructed in the GST-Aerolysin NA immunized mice (Vaccine) and the control group immunized mice (Ctr). The immunized mice were allowed to freely drink AVNM water (AVNM, 0.2 g / L ampicillin, 0.1 g / L vancomycin, 0.2 g / L neomycin and 0.2 g / L metronidazole) for 5 days, and then were replaced with 2% DSS drinking water for 5 days, and then were allowed to drink normal water for 2 days. During the DSS treatment, the mice were orally gavaged with 1 x 10 9CFU MTB, DSS treatment and bacterial gavage were repeated for one cycle. Body weight, diarrhea, and hematochezia of mice were recorded daily. The final disease activity index (DAI) included the following: weight loss percentage (none = 0, <5% = 1, 5-10% = 2, 10-20% = 3, >20% = 4), stool consistency (normal = 0, loose = 2, diarrhea = 4), and hematochezia (none = 0, occult = 2, obvious bleeding = 4). After paraffin embedding of the mouse colon tissue into a Swiss roll, H&E staining was performed, and the stained tissue was scored for histopathology, with the following assessment criteria: inflammation severity score (0 = none, 1 = mild, 2 = moderate, 3 = severe); extent of inflammation involving the mucosal layer (0 = none, 1 = mucosa, 2 = mucosa and submucosa, 3 = full thickness); degree of epithelial / crypt damage (0 = none, 1 = basal 1 / 3, 2 = basal 2 / 3, 3 = crypt loss, 4 = crypt and surface epithelium destruction). Each variable score was multiplied by a coefficient for the percentage of colon involved (0.25 = 0-25%, 0.5 = 26-50%, 0.75 = 51-75%, 1.0 = 76-100%), and the sum of the scores was the histopathology score.

[0351] 1.1.27 Data Statistics

[0352] All animal model graph data are presented as mean ± standard error. Statistical significance (p value) between two groups was analyzed by unpaired Student’s t test. Statistical significance of body weight change was analyzed by One-way ANOVA. Other data statistics are indicated in the graph. All statistical analyses and plotting in the paper were performed using GraphPad Prism 8. Statistical significance is shown in the figure legend as n.s.: P > 0.05, *P < 0.05, **P < 0.01.

[0353] 1.2 Experimental Results

[0354] 1.2.1 UC colonic resident macrophage barrier disruption precedes epithelial barrier injury

[0355] Colonic resident macrophages, as the first line of defense in the gut, monitor the intestinal contents, clear invading microbes, and play a key role in maintaining colonic epithelial homeostasis. Since the common pathological changes in UC are the disruption of the colonic mucosal barrier and the alteration of intestinal macrophage immunity, we hypothesized that the impairment of intestinal resident macrophages might be the cause of UC. We collected colonic tissue samples from 10 UC patients and 7 colorectal cancer patients (CCA). The diagnosis of UC was based on the combination of clinical symptoms, colonoscopy, histological examination, and the exclusion of other diseases. The 10 UC patients who underwent colectomy all had surgical indications (such as massive intestinal bleeding, perforation, dysplasia, refractory acute severe UC, or drug treatment failure). The 7 CCA patients used their normal tissues adjacent to cancer (CCA-N) as controls. The clinical data of the patients are summarized in Tables 7-8.

[0356] We first detected the resident macrophage layer adjacent to the colonic epithelial cell (IEC) layer in UC and CCA-N using anti-CD68 antibody. The control group CCA-N colon had a large number of CD68+ cells distributed below the intestinal epithelial cell layer, forming a clear and complete macrophage barrier, and other CD68+ macrophages were scattered in the intestinal lamina propria (LP) (Figure 1A, a-f). Notably, these CD68+ macrophages near the epithelial cell layer formed an immune cell barrier by resident macrophages (Figure 1A, d-f). The main functions of resident macrophages include phagocytosis of apoptotic IECs, clearance of invading bacteria, support of IEC proliferation, and promotion of FoxP3+ Treg T cell survival, making them important members of the intestinal anti-inflammatory network. In UC colonic tissue, significant inflammatory cell infiltration was observed in the multi-layered LP, accompanied by crypt abscesses and distortion (Figure 1A, g-l). Interestingly, even when the UC colonic mucosa was covered with a complete IEC layer, the adjacent macrophage layer was absent or the number of macrophages was significantly reduced (Figure 1A, J-1). Quantitative statistical results showed that the number of CD68+ cells in the 50 μm region adjacent to the IEC layer in UC tissue was significantly lower than that in the control group (UC: 1.460 ± 0.0592 / 50 μm x 50 μm vs control: 4.335 ± 0.2072 / 50 μm x 50 μm, **p < 0.01) (Figure 1B). Immunofluorescence staining of UC and CCA-N tissues with CD68 antibody also showed a decrease in the number of macrophages under the IEC layer in UC colon (Figure 1C). We further verified the damage to the resident macrophage barrier in UC mucosa by immunohistochemical staining of macrophages under the IEC layer with anti-CD169 antibody (Figure 1D-E). These results clearly indicate that the resident macrophage barrier is damaged before the epithelial cell layer is damaged in the pathogenesis of UC. Table 7. Description of UC and CCA patient characteristics Table 8 Disease characteristics of UC patients undergoing colectomy

[0357] 1.2.2 Damage of resident macrophage barrier can be caused by toxins produced by UC fecal bacteria

[0358] Since there are reports suggesting that intestinal flora imbalance can be somehow related to IBD, we hypothesized that the decrease of intestinal resident macrophages can be caused by intestinal bacterial toxins. To test this hypothesis, we cultured fecal bacteria from 48 UC patients, 32 patients with intractable chronic constipation, and 47 healthy adults under aerobic conditions and performed toxicity analysis. After 12-16 hours of culture in LB medium, BMDM (mouse primary macrophages) were treated with the culture supernatant for 6 hours (Figure 2A). The results showed that 47.9% (23 / 48) of UC patients' fecal bacteria could induce BMDM cell death (only 3.1% (1 / 32) of constipation patients and 0% (0 / 47) of healthy people' fecal bacteria could induce cell death (Figure 2B). This indicates that UC fecal bacteria can produce macrophage toxic substances. To facilitate the study of the characteristics of toxic substances, we classified and mixed the fecal bacteria, and prepared 39 UC fecal bacteria mixtures (UC Mix) and 9 normal fecal bacteria mixtures (Normal Mix). The results showed that UC mix had significant cytotoxicity to BMDM, while Normal mix could not cause BMDM cell death (Figure 2C). This result further confirmed that UC fecal bacteria can produce toxins that induce macrophage death. BMDM treated with UC mix showed cell swelling and cell membrane rupture under the microscope, followed by cell death. BMDM treated with Normal mix supernatant had a normal morphology similar to M1 polarized macrophages (Figure 2D). When the UC mix culture supernatant was inactivated at 95°C for 5 minutes, its cytotoxicity to BMDM disappeared, indicating that the UC fecal bacteria produced heat-sensitive toxins.

[0359] 1.2.3 UC fecal bacteria produce Aerolysin to induce macrophage death

[0360] To identify the nature of the UC fecal-bacteria toxin, we extracted the culture supernatant of UC mix with water-saturated butanol, and the extract was separated into polar and non-polar phases. The polar and non-polar phases were extracted and treated BMDMs, respectively, and subjected to cytotoxicity test. The results showed that the polar phase retained almost complete toxin activity, while the non-polar phase had no toxin activity (Fig. 3A), suggesting that the toxin might be a protein or polysaccharide. To verify the molecular size of the toxin, we performed a protein interception experiment using a 30 kDa ultrafiltration tube, and found that the toxin was basically present in the retentate (Fig. 3B), suggesting that the molecular weight of the toxin was greater than 30 KDa. We used 45 kDa ovalbumin (OVA) to determine the efficiency of the ultrafiltration tube, and the results confirmed that the ultrafiltration tube was working properly (Fig. 3C). To reduce the interference of impurities in subsequent purification, we screened different culture media for culturing UC mix and Normal mix (Fig. 3D). The results showed that DMEM culture medium could efficiently produce toxin compared to M9 culture medium, and had less protein impurities (Fig. 3E). Therefore, we used DMEM medium for subsequent purification and identification of the toxin.

[0361] Further study on the characteristics of the toxin found that after proteinase K treatment, the cytotoxicity of UC Mix completely disappeared (Fig. 4A), indicating that the toxin produced by UC fecal bacteria is a protein with a molecular weight greater than 30 kDa. We purified the toxin in the culture supernatant of UC mix using DEAE-anion exchange chromatography, and performed gradient elution, and each elution fraction was treated with BMDM to test the position of the toxin-containing fraction. The results showed that the cytotoxicity peak of BMDM existed in the 16-19 elution fraction, and the main peak value appeared in the 17th fraction (Fig. 4B). SDS-PAGE electrophoresis separated the proteins in the 15-19 fractions, and found that four proteins with a molecular weight greater than 30 kDa were distributed in the 17th fraction (Fig. 4C). LC-MS / MS was performed on the four candidate protein bands, and it was found that the four candidate proteins were: lysine-sensitive asparagine kinase 3 (band 1), aerolysin (band 2), maltose / maltodextrin binding periplasmic protein (band 3), and glycerol-3-phosphate dehydrogenase (band 4). In the mass spectrometry experiment of band 2, 53 peptide fragments were captured, which matched the Aerolysin (Uniport: sp|Q06304|AERA_AERSO) protein in the search library, covering a total of 38.32% (95% CI) of the sequence of Aerolysin protein. Aerolysin is a classic cell-penetrating toxin, so we guessed that Aerolysin might be the key toxin of UC fecal bacteria to cause macrophage death.

[0362] To verify whether Aerolysin is the key toxin of UC fecal bacteria to kill macrophages, we prepared anti-Aerolysin polyclonal antibody. First, we amplified aerolysin gene from UC mix fecal bacteria by PCR, and obtained 5 different aerolysin gene sequences (No. 4-1, 3-3, 3-1, 3-7 and 3-6, gene ID: PP460999-PP461003), which had some differences in protein sequence compared with the sequence reported in Uniport (gene ID: Q06304) (see Figure 4E for sequence). One of the full-length aerolysin genes (No. 4-1, gene ID: PP460999, which was confirmed to be derived from the MTB 10A1 strain of the present application) was cloned into the pGEX-5X-1 vector and expressed as GST-inactive aerolysin (GST-Aerolysin NA) protein in E. coli (Figure 5A, amino acid sequence shown as SEQ ID NO: 1), and high-purity GST-Aerolysin NA protein was obtained by purification with GST affinity resin (Figure 5B). Aerolysin proteins with amino acid sequences shown as SEQ ID NO: 2 (gene sequence No. 3-1, which was confirmed to be derived from the MTB 2A5 strain of the present application), SEQ ID NO: 3 (gene sequence No. 3-7), SEQ ID NO: 4 (gene sequence No. 3-3) and SEQ ID NO: 5 (gene sequence No. 3-6) were obtained in the same way. By immunizing BALB / c mice with purified GST-Aerolysin NA protein, we obtained mouse anti-Aerolysin polyclonal antibody. This antibody can recognize pro-Aerolysin (pro-form), active-Aerolysin (active form) and heptamer-Aerolysin (heptamer form) (Figure 5C). When anti-Aerolysin polyclonal antibody was mixed with UC mix culture supernatant and used to treat BMDM, the results showed that anti-Aerolysin antibody can neutralize the toxin produced by UC mix, inhibit its cell-killing effect, and the neutralizing effect is dose-dependent (Figure 5D). Therefore, we believe that the toxin produced by UC mix fecal bacteria to induce macrophage death is Aerolysin.

[0363] 1.2.4 Macrophages are more sensitive than epithelial cells to Aerolysin-induced death, and various GPI-modified receptors mediate the binding of Aerolysin to macrophages

[0364] In the intestinal tissue sections of UC patients we found that the number of resident macrophages under the intact IEC barrier has been reduced, suggesting that Aerolysin can have a higher killing efficiency on macrophages. We prepared GST-Aerolysin protein with toxin activity (Fig. 6A-B, amino acid sequence shown as SEQ ID NO: 180) to detect the killing difference of Aerolysin on epithelial cells and macrophages. We determined the killing effect of Aerolysin on epithelial cell lines (including human-derived NCM460, HT-29, 5E6L, Caco-2 and mouse-derived MC-38) and macrophages (human-derived THP-1 and mouse-derived BMDM, Raw264.7), and calculated the IC50(concentration of GST-Aerolysin inducing 50% cell death). The results found that Aerolysin has a very high killing efficiency on macrophages, with IC50values of 0.0287±0.0075 nM, 0.0376±0.0054 nM and 0.0790±0.0100 nM for BMDM, Raw264.7 and THP-1, respectively, which are far lower than the IC50values of Aerolysin on epithelial cell lines, such as MC-38 (0.7312±0.2228 nM), 5E6L (6.4003±2.1360 nM), Caco-2 (3.2910±1.9228 nM), NCM460 (1.7371±0.4434 nM), HT29 (2.0052±0.6963 nM) (Fig. 6C-D and Table 9), which are 30-80 times of the IC50values of macrophages. Morphological studies found that after 3 hours of GST-Aerolysin treatment, the macrophage cell line Raw264.7 showed classic cell necrosis characteristics under electron microscopy, including cell swelling, vacuole formation and plasma membrane rupture (Fig. 6E).

[0365] As a pore-forming toxin, active form of Aerolysin can bind to specific glycosylphosphatidylinositol (GPI)-anchored proteins on the target cell surface and form a heptamer, insert into the cell membrane to form a pore, and finally lead to cell rupture. To determine the key GPI-anchored proteins on the surface of macrophage membranes that mediate Aerolysin binding, we screened the GPI-modified receptor proteins on the surface of mouse macrophage membranes (Cd14, Vnnl, Bstl, Bst2, Smpdl3b, Pakap, and Ly6e), silenced the expression of these membrane proteins in Raw264.7 cells using siRNA interference (Figure 6F), and detected the toxicity of GST-Aerolysin to macrophages after knocking down different receptors. The results showed that knocking down Cd14 (leukocyte antigen 14), Bstl (bone marrow stromal cell antigen 1), and Smpdl3b (sphingomyelin phosphodiesterase acid-like 3B) can significantly reduce the toxicity of Aerolysin (Figure 6G). Therefore, it is possible that multiple GPI-modified receptors are involved in the toxic effect of Aerolysin on macrophages. IC50values were calculated from at least three independent experiments

[0366] 1.2.5 Isolation and identification of Aerolysin-expressing bacteria from UC fecal flora

[0367] To facilitate the isolation of UC fecal flora that can express Aerolysin, we added antibiotics to the UC mix culture to reduce the abundance of other bacteria. The results showed that when ampicillin, kanamycin, gentamicin, penicillin, streptomycin, and ciprofloxacin were added to the culture medium, respectively (Figure 7A), or multiple antibiotics were used in combination (Figure 7B), the UC mix still produced BMDM cytotoxic substances. Only after ciprofloxacin treatment, the toxin level decreased, suggesting that there were Aerolysin-producing strains with different resistances in the UC mix. We plated the UC mix treated with ciprofloxacin on Columbia blood agar plates for culture, and picked colonies that produced β-hemolytic rings. Subsequently, bacteria carrying the Aerolysin gene were verified by PCR using the ASA1 primers used in the reference, and the culture supernatant of the isolated Aerolysin-positive bacteria could significantly cause BMDM cell death (Figure 7C). The same method was used to isolate the 2A5 strain after culturing the UC mix without antibiotics. The 10A1, 10A3, 10A8, 10A10, 10A12, 10B1, 10B2, 10B4, and 2A5 strains were used for 16S rRNA phylogenetic tree analysis.

[0368] 1.2.6 Biochemical and bioinformatic analysis of Aeromonas sp. MTB

[0369] Morphologically, the Aerolysin-positive colonies isolated were white, round and convex on LB agar (Fig. 8A). The bacteria possessed a single polar flagellum and peritrichous flagella after negative staining with phosphotungstic acid under transmission electron microscopy (Fig. 8B). Western blotting results showed that these bacteria could stably express and secrete Aerolysin protein even after multiple passages (Fig. 8C). After 16S rRNA sequencing and phylogenetic tree construction, the results showed that these bacteria belonged to the genus Aeromonas and were closest to A. veronii, with colony 2A5 and 10A1 having 99.93% and 99.73% sequence similarity with A. veronii standard strain ATCC35624 and colony 10A1 with ATCC35624, respectively (Fig. 8D). Therefore, we named the Aerolysin-expressing bacteria isolated from the UC mix fecal bacteria as Aeromonas sp. MTB (macrophage-toxic bacteria, MTB). After 24 hours of incubation on Rimler-Shotts plates, the standard A. veronii strain (TH0426, ATCC35624) presented yellow colonies, while the MTB colonies formed green colonies (Fig. 8E), suggesting that MTB might produce some basic metabolites causing the colonies to become green, which is different from A. veronii. API-20NE identification of MTB and TH0426, ATCC35624 showed that the biochemical reactions between MTB and A. veronii strains were similar, such as consistent results for oxidase (OX), potassium nitrate (NO3), L-tryptophan (TRP) and D-glucose fermentation (GLU) reactions, suggesting that MTB is similar to A. veronii. MTB had a negative result for citric acid (CIT) utilization and a positive result for arginine dehydrogenase (ADH) reaction, which is different from A. veronii strains (see Table 10). Aeromonas strains positive for lysine or ornithine produce basic metabolites after amino acid decarboxylation, which causes them to not present typical yellow colonies on RS medium. The positive ADH result can explain why MTB presents green colonies on RS plates, and this characteristic can be used to distinguish MTB from other A. veronii strains.

[0370] We further sequenced the whole genomes of the MTB strains MTB2A5, MTB10A1, MTB10B4, MTB10A3, and MTB10A10 isolated from the UC mix and performed bioinformatics analysis. The standard whole genomes of A. hydrophila, A. caviae, A. jandaei, A. sobria, and A. veronii were used as reference genomes. The results showed that the genome sizes, GC%, tRNA numbers, and gene numbers of the different MTB strains were the same or substantially the same among the isolated MTB strains, but were different from the reference Aeromonas genomes (Table 11). ANI (average nucleotide identity) analysis of the whole genomes of the MTB strains and the reference Aeromonas genomes showed that the ANI values of the MTB strains and the three A. veronii reference genomes were over 96.4%, but the ANI values of the MTB strains and A. hydrophila, A. caviae, A. jandaei, and A. sobria were lower than 92% (Fig. 8F). Phylogenetic tree analysis based on core genes showed that the five MTB strains were most similar to the A. veronii whole genomes (Fig. 8G). The number of common core genes of the five MTB strains was 3506, while the number of common core genes of the three A. veronii strains was 3280 (Fig. 8H-I). Based on the bacterial API-20NE detection, the differences in RS culture characteristics, and the results of whole genome sequence bioinformatics analysis, we proposed that MTB is a new strain of Aeromonas. The unique colonization ability of MTB in the mouse intestine (see Figs. 9C-D and 11B-D) further confirmed that MTB is different from the A. veronii strains. Table 11 Whole genome information of MTB and Aeromonas reference genomes

[0371] 1.2.7 MTB is able to colonize the mouse intestine for a long time

[0372] Bacteria that induce long-term chronic enteritis need to have certain intestinal colonization ability. To evaluate the colonization ability of MTB in animals, we gavaged wild-type C57BL / 6J mice without any treatment with 1x10 9CFU MTB, fecal samples were collected after three consecutive days of gavage, and the presence of MTB in fecal samples was detected by PCR amplification of the aerolysin gene (ASA). On the fourth day after bacterial gavage, no MTB was detected in the fecal samples of mice (n=5) (Figure 9A), suggesting that MTB could not colonize in wild-type mice. When we added an antibiotic cocktail (AVNM) to the drinking water, mice received five days of AVNM water treatment, followed by gavage of MTB bacteria, 1 x 10 9 CFU, it was found that 75% (3 / 4) of mice could still detect MTB colonization on day 17 after MTB gavage (Figure 9B), indicating that the depletion of normal gut flora in mice could help MTB colonize in the mouse intestine, but the colonization efficiency was not high. When treated with 2% DSS for five days, during which MTB was gavaged for three consecutive days, 33% of animals (1 / 3) could detect MTB colonization on day 17 (Figure 9B), indicating that colon epithelial damage is another factor affecting MTB colonization. When we treated mice with AVNM and DSS in combination, 1 x 10 9 CFU MTB, it was found that: MTB can persistently colonize for at least 30 days (Figure 9C), among which MTB (2A5), MTB (10A10), and MTB (10B4) can colonize for at least 43 days. In contrast, other strains of A. veronii, TH0426 and ATCC35624 strains, even after AVNM and DSS treatment, no A. veronii bacterial colonization was detected in the feces of mice (Figure 9D). This result indicates that antibiotics and epithelial damage are key prerequisites for MTB colonization, and MTB can colonize in the mouse intestine for a long time.

[0373] 1.2.8 MTB can induce chronic intestinal inflammation in mice

[0374] To verify whether MTB can induce chronic colitis, a mouse intestinal inflammation model was constructed according to the experimental scheme shown in Figure 10A. Mice were treated with AVNM and three times of 2% DSS, 1 x 10 9MTB (2A5) or 100 μΐ PBS were administered intragastrically for three consecutive days per DSS cycle. During the first cycle of 2% DSS treatment, there was no significant difference in body weight change and disease activity index (DAI) between the MTB group and the PBS group. However, starting from the second cycle of 2% DSS treatment, the mice in the MTB group developed a gradually worsening colitis phenotype, including weight loss, bloody stool and diarrhea (Fig. 10B-C). Pathological scoring was performed on H&E stained sections of colonic tissue, and the pathological changes were evident after MTB treatment (Fig. 10G-H), with a significant increase in the pathological score (Fig. 10H). However, there was no significant statistical difference in colon length between the MTB and PBS groups (p>0.05) (Fig. 10E-F), which could be due to experimental variation. In addition, dot immunoblotting was performed on fecal secretions from the MTB and PBS mice using an anti-Aerolysin mAb, and the results showed that Aerolysin protein was produced in the fecal cultures of all the MTB-treated mice (Fig. 10D), indicating that MTB can effectively express Aerolysin protein in the gut after colonization in mice. Significant inflammatory cell infiltration, crypt distortion and abscess formation were observed in the colonic pathological sections of the MTB group mice, similar to the pathological changes observed in UC patients (Fig. 10G), while the control group had no significant histopathological changes. The mice in the MTB-treated group had mild symptoms of initially induced enteritis, but the enteritis phenotype worsened with repeated induction of MTB, showing the gradual aggravation of clinical UC performance. In addition, there was no difference in the spleen weight of the mice after MTB treatment compared with the PBS group (MTB: 76.64 ± 4.855 mg vs control: 76.77 ± 3.428 mg, P>0.05), which is consistent with the normal spleen size characteristic of clinical UC patients, while CD patients have a significantly larger spleen compared to healthy people. The above results show that MTB intragastric administration can induce a colitis phenotype similar to UC symptoms.

[0375] 1.2.9 MTB colonization disrupts the intestinal macrophage barrier and is accompanied by increased expression of Il17 inflammatory factors

[0376] To investigate whether MTB treatment leads to the barrier impairment of colon-resident macrophages as observed in UC patients, we labeled CX3CR1+ intestinal-resident macrophages (Fig. 101) and F4 / 80+ total macrophages (Fig. 10J) in the colonic lamina propria by immunohistochemical staining. In the PBS control group, the colonic lamina propria was filled with F4 / 80+ macrophages (Fig. 10J, upper panel), and a large number of ordered CX3CR1+ macrophages were distributed in the lamina propria of the proximal, middle, and distal colon (Fig. 101, upper panel), presenting an intact resident macrophage barrier. In the MTB group, although a large number of F4 / 80+ macrophages were still distributed in the intestinal lamina propria (Fig. 10J, lower panel), the distribution of CX3CR1+ macrophages in the lamina propria of the proximal, middle, and distal colon was reduced (Fig. 101, lower panel). The number of CX3CR1+ macrophages in the lamina propria was counted, and the results also showed that the number of CX3CR1+ macrophages in the intestinal lamina propria was significantly reduced after MTB treatment compared with the PBS group (Fig. 10K). The reduction in the number of CX3CR1+ cells in the lamina propria indicated that MTB colonization can destroy the resident macrophage barrier. Since the distribution of F4 / 80+ macrophages in the lamina propria of the MTB and PBS control groups was similar, the mechanism of macrophage replenishment from bone marrow-derived monocytes did not seem to be affected by MTB bacteria. This also means that the damaged resident macrophage barrier cannot be completely repaired by circulating monocytes. We also detected the effects of A. veronii standard strains ATCC35624 and TH0426 (Fig. 11D) on the resident macrophage barrier by the same chronic enteritis mouse modeling method. Both A. veronii strains can express and secrete Aerolysin protein, and the expression level of TH0426 is similar to that of MTB (2A5), while the expression abundance of ATCC35246 is relatively low (Fig. 11A). The results show that mice receiving ATCC35624 and TH0426 gavage cannot induce the reduction of CX3CR1+ macrophages in the colonic lamina propria as MTB does (Fig. 11B-D). Since A. veronii strains ATCC35624 and TH0426 cannot colonize in mice (Fig. 9D), we believe that the colonization ability of MTB is a key factor for its cytotoxicity.

[0377] In UC inflammatory tissues, there are significant changes in cytokines such as IFNy, IL-2 (Thl cytokines), IL-5, IL-13, TGF (Th2 cytokines), IL-17a, IL-21 and IL-22 (Thl 7 cytokines), TNFa, IL-6, IL-1b, IL-12, IL-23, IL-33 (inflammatory cytokines), etc., which are important events in the pathogenesis of UC. Therefore, we detected the mRNA expression levels of these cytokines after MTB infection. The results showed that the expression levels of Il 17a and Tgfb were significantly increased in MTB-treated mice, while the levels of other cytokines including Tnfa, Iilb, Ill2b, Il10, Ifng, Il2, Il13, Il21 were similar to the PBS control group, except for a slight decrease in Il6, Il23 and Il22 (Figure 10L). In addition, given the high expression of chemokines such as CCL2 (MCP-1), CCL3 (MIP-1a), CCL4 (MIP-1=), CCL5 (RANTES), CCL23 (murine CCL6) in humans, IL-8 (murine CXCL1, CXCL2) and CXCL10 (IP-10) in the mucosa of IBD patients, we detected the levels of chemokines in the distal colon after MTB treatment. The results showed that Ccl5 and Ccl6 were significantly upregulated after MTB infection, while Ccl2, Ccl3, Ccl4, Cxcll, Cxc12, Cxcl9 and CxcllO had no significant difference (Figure 10M). Therefore, the above results we found that MTB-induced chronic colitis formation is characterized by an immune factor expression pattern with increased mRNA levels of Il 17a, Tgfb and some chemokines, similar to the typical IL-17 and TGF= expression up-regulated inflammatory factor expression pattern in the intestinal mucosa of UC patients.

[0378] 1.2.10 Epidemiological distribution of MTB in human populations

[0379] Considering the role of MTB colonization in the induction of UC-like progressive chronic colitis, MTB should be identifiable in fecal samples of UC patients. Since MTB carries the aerolysin gene, we first performed PCR using the aerolysin-specific PCR primers (PCR-ASA1) from the reference, and then determined the distribution of aerolysin-carrying bacteria in the feces of UC patients and control population (case information is shown in Tables 12-13). 62.5% (25 / 40) of UC fecal samples showed positive for the aerolysin gene (Figure 12), while no aerolysin gene was detected in the Normal mix (n=9). The fecal bacteria samples from UC patients that induced BMDM cell death (Figure 2B) were mostly positive for the aerolysin gene. However, we noticed that some UC fecal bacteria that were negative for ASA1 detection (e.g., patients UC24 and UC30) also had significant cytotoxicity, while some fecal bacteria that were positive for ASA1 detection (e.g., patients UC32, UC33, and UC34) could not induce BMDM cell death. This phenomenon suggests that the BMDM cytotoxic toxin can also be secreted by non-MTB bacteria such as Enterococcus faecalis, or other Aeromonas strains carrying the aerolysin gene (due to differences in promoters leading to low levels of Aerolysin protein expression). Therefore, cytotoxicity alone or ASA1 amplification cannot accurately detect MTB.

[0380] To design an effective PCR detection method to identify MTB, we performed a bacterial genome-wide alignment analysis of the whole genome of MTB. We found a relatively specific gene (gene 1407, Gene ID: PP486328) in MTB and A. veronii. We designed specific amplification primers and Taqman probes for gene 1407 and MTB aerolysin sequences, respectively, and the qPCR detection methods are named PCR-p1407 and PCR-pASA, respectively. We collected 79 UC patients, 430 healthy adults (ND), 38 CD patients, and 66 constipation patients' fecal samples (information in Tables 12-13). PCR-p1407 results showed that the MTB positive rate in UC patients was 31.65% (25 / 79), 3.49% (15 / 430) in healthy people, 10.53% (4 / 38) in CD patients, and 7.58% (5 / 66) in constipation patients. PCR-pASA results showed that the MTB positive rate in UC patients was 72.15% (57 / 79), 11.86% (51 / 430) in healthy people, 2.63% (1 / 38) in CD patients, and 13.64% (9 / 66) in constipation patients. Statistical analysis of samples that were double positive in both PCR-p1407 and PCR-pASA detection found that the double positive rate in UC patients was 22.78% (18 / 79), 1.16% (5 / 430) in healthy adults, 0% (0 / 38) in CD patients, and 4.55% (3 / 66) in constipation patients (see Table 12). We speculate that the MTB positive rate in UC patients' feces ranges from 22.78% to 72.15%. Although the current PCR detection method is not accurate enough, the above results are sufficient to show that the incidence of MTB in UC patients' fecal samples is significantly higher than that in non-UC samples. Since PCR-p1407 only detects live MTB bacteria, the actual incidence of MTB in UC patients is expected to be higher than the detection rate. It is worth noting that p1407-positive patients' fecal bacteria sometimes show aerolysin-negative, indicating that future research needs to develop a more specific qPCR detection method. In addition, based on the above data, we calculated the sensitivity and specificity of p1407 for UC diagnosis as 59.4% (79 / 79+54) and 96.6% (430 / 430+15), respectively, while the sensitivity and specificity of pASA were 78.2% (79 / 79+22) and 89.4% (430 / 430+51), respectively, suggesting that both methods have clinical diagnostic value. Table 12 p1407 and pASA qPCR detection of MTB distribution in UC and control population feces Values are mean ± SD. # Health population information is missing for 22 individuals. Statistical significance was determined using the Chi-square test to compare the PCR results of the ND, CD, Constipation, and UC groups. **P < 0.01. Table 13. Disease characteristics of UC patients from which stool samples were obtained Data are presented as mean ± SD.

[0381] 1.2.11 Aerolysin protein distribution in the colonic mucosa and muscle layers of UC patients

[0382] To establish a specific method for detecting Aerolysin protein, we prepared a mouse anti-Aerolysin monoclonal antibody (Figure 13A). The monoclonal antibody had a titer greater than 1 :50000 (determined by Western blot) and specifically recognized both the recombinantly expressed GST-Aerolysin NA and the Aerolysin protein expressed by MTB bacteria (Figures 13B-C). The antibody also allowed for immunofluorescence experiments, specifically recognizing the membrane-embedded GST-Aerolysin protein bound to the surface of HT-29 and Raw264.7 cells. This result indicated that we successfully prepared a mouse anti-Aerolysin monoclonal antibody (hybridoma clone McAb 12) with high sensitivity and specificity, which can be used for subsequent experimental studies.

[0383] We used the mouse anti-Aerolysin monoclonal antibody prepared in this experiment to detect the Aerolysin protein levels and expression distribution in the colonic mucosa and muscle layers of UC and CCA-N patients by immunohistochemistry and Western blot. In the experiment, we collected ascending colon and sigmoid colon tissue samples from 10 UC patients and 5 colorectal cancer patients' normal tissue adjacent to cancer (CCA-N) (as a control). The clinical data of the patients are shown in Table 2.7. The immunohistochemistry results using the anti-Aerolysin monoclonal antibody showed that there was no Aerolysin protein in either the mucosa or muscle layers of the CCA-N samples, while there was obvious Aerolysin protein distribution around the inflammatory cells in some UC mucosa and muscle layers (Figure 14A). After the colon samples were stripped into mucosa and muscle layer parts, Western blot analysis using the anti-Aerolysin monoclonal antibody showed that Aerolysin protein was detected in at least 40% (4 / 10) of the UC colonic mucosa and / or muscle layers, while no Aerolysin protein expression was detected in the CCA-N samples (Figure 14B). These findings indicated that Aerolysin can penetrate the intestinal epithelial barrier and penetrate into the deep colonic tissue.

[0384] 1.2.12 Anti-Aerolysin neutralizing antibodies can effectively treat MTB-induced colitis

[0385] After knocking out the Aerolysin protein in MTB (2A5) (Fig. 15A-C), the cytotoxicity of MTB culture supernatant to induce BMDM death was completely abolished (Fig. 15D), indicating that Aerolysin might be the key toxin for MTB to induce macrophage death.

[0386] To explore the treatment of UC, we tested the therapeutic effect of anti-Aerolysin neutralizing antibodies in alleviating MTB-induced colitis. The neutralizing antibodies were polyclonal antibodies prepared from BALB / c mice immunized with GST-Aerolysin NA (Fig. 5D), and the antibodies were stored in PBS solution after protein G purification. The animal model of MTB chronic enteritis was constructed as previously described, and the mice were injected intraperitoneally with 200 μg of anti-Aerolysin polyclonal antibodies (Ab treatment group) or 100 μl of PBS (Ctr control group) before each MTB gavage cycle (Fig. 13A). The antibody treatment and MTB induction were repeated every week for four weeks. The mice injected with PBS showed a typical colitis phenotype, consistent with the phenotype we observed previously (Fig. 10), including weight loss, increased blood in stool and diarrhea, and increased histopathology scores (Fig. 13B-G). However, the mice treated with Aerolysin antibodies did not show a significant colitis phenotype during the observation period (Fig. 13B-G). Notably, the colonic mucosa of the mice treated with Aerolysin antibodies was normal in morphology, and the number of CX3CR1+ resident macrophages in the lamina propria was significantly increased in distribution and quantity after treatment (Fig. 16H-J). In addition, the expression level of Il17 was significantly reduced after Aerolysin antibody treatment (Fig. 16K). The expression levels of inflammatory and chemotactic factors such as Tnfa, Il6, Il1b, Il33, Ccl3, Ccl4, and Cxcl2 were also significantly reduced (Fig. 16K-L). Our research results show that anti-Aerolysin neutralizing antibodies can effectively treat colitis induced by MTB.

[0387] 1.2.13 Antigenic site analysis for generating Aerolysin neutralizing antibodies

[0388] In previous antibody therapy, we used polyclonal antibody prepared from inactivated full-length Aerolysin NA protein, and the results showed that it could effectively alleviate MTB-induced enteritis. However, in actual clinical application, in order to improve the specificity and safety of treatment, monoclonal antibodies with neutralizing activity will be prepared. In order to analyze the antigenic sites of the neutralizing antibody, we predicted and analyzed the structure of the Aerolysin protein produced by MTB. The tertiary structure of active Aerolysin protein presents an L type, which can be divided into a small lobe composed of a small N-terminal domain (domain 1) and a large lobe composed of three domains (domain 2-4). Among them, Aerolysin binds to the N-sugar and anchored core glycan of the cell membrane surface Aerolysin receptor through the Trp-45, Ile-47, Met-57 and Lys-66 sites of domain 1 (1-82 aa) and the Tyr-162, Trp-324, His-332 sites of domain 2 (83-178 aa, 311-398 aa), and participates in the dimerization and oligomerization of Aerolysin. Therefore, we speculate that the domains of these binding sites may produce Aerolysin neutralizing protective antibodies after immunization.

[0389] We first divided the 443 amino acid sequence of active Aerolysin into three segments, 1-148aa, 149-296aa, 297-443aa, and inserted these sequences into PGEX-5X-1 vector to obtain expression plasmids (Figure 17A). GST-Aerolysin 1-148aa, GST-Aerolysin 149-296aa, GST-Aerolysin 297-443aa proteins were expressed by induction and purified using GST affinity column (Figure 17B). BALB / c mice were immunized with each of the three Aerolysin truncated proteins to generate polyclonal antibodies recognizing the corresponding antigens. The results showed that all three Aerolysin truncated proteins could successfully induce mouse immunization, producing antibodies capable of specifically recognizing the full-length Aerolysin protein, and the titers were all above 1:50000 (Figure 17C). We used the polyclonal antibodies obtained by immunization with the three truncated proteins to perform Aerolysin toxin neutralization experiments, and the results showed that the antibodies produced by immunization with GST-Aerolysin 1-148aa could completely neutralize the toxicity of Aerolysin, while the antibodies produced by immunization with GST-Aerolysin 149-296aa and GST-Aerolysin 297-443aa only showed about 50% protection efficacy under high dose conditions (Figure 17D). This indicates that the main antigenic site inducing neutralizing antibodies is in 1-148aa (Figure 17E). To prepare Aerolysin neutralizing monoclonal antibodies, we further immunized BABL / c mice with GST-Aerolysin 1-148aa to prepare hybridoma cells. Seven Aerolysin monoclonal hybridoma strains were subcloned. Aerolysin toxin neutralization experiments were performed with the monoclonal antibodies produced by these hybridomas, and the results showed that under high dose antibody conditions, clone strains McAb2, McAb5, McAb10 had 100% protection effect, McAb1, McAb7, McAb8 had more than 65% protection effect, while McAb12 had less than 20% protection effect on Aerolysin (Figure 17F). The neutralization efficiency of the monoclonal antibodies was lower than that of the polyclonal antibodies produced by immunization with GST-Aerolysin 1-148aa, suggesting that further research can further screen monoclonal antibodies with higher titers, or use monoclonal antibodies that recognize different sites in combination to enhance the neutralization efficiency.

[0390] 1.2.14 Inhibitory effect of small molecule compounds and antibiotics on MTB bacteria

[0391] A variety of known small molecule compounds and known antibiotics were tested for their inhibitory effect on MTB bacteria, and the results are shown in Tables 14 and 15. A variety of known small molecule compounds and known antibiotics were tested for their inhibitory effect on MTB bacteria, and the results are shown in Tables 14 and 15. Table 15. Inhibition of MTB bacteria by known antibiotics

[0392] 1.2.14 Aerolysin NA vaccine can effectively prevent MTB-induced colitis

[0393] To explore the prevention method of UC, we detected the preventive effect of Aerolysin vaccine in MTB-induced colitis. We immunized the mice with Aerolysin vaccine 100 ug (Vaccine group dissolved in PBS) and 100 ul PBS (Ctr group) intraperitoneally before the construction of the MTB infection model, and then immunized them again 50 ug after 2 weeks. During this period, the MTB-induced modeling was repeated (Figure 18A). The mice in the Ctr group showed typical colitis model: weight loss, blood in stool, and increased histopathological score, and shortened colon (Figures 18B-E). The mice prevented by the vaccine did not show obvious colitis phenotype, and the colon mucosa was normal (Figures 18A-G). The expression level of Il17 was significantly reduced after the prevention of Aerolysin vaccine, and the expression levels of inflammatory factors and chemotactic factors such as Tnfa, Il6, Illb, Ifng, and Il22 were also significantly reduced (Figure 18H). Our research results showed that Aerolysin vaccine can effectively prevent colitis induced by MTB.

[0394] Summary

[0395] To investigate the cause of UC intestinal barrier damage, we first performed pathological histology on UC and normal colon tissues, and found that even if the epithelial cell barrier is intact, the resident macrophage barrier next to the intestinal epithelial cell layer has been damaged. Therefore, we speculate that in the development of UC disease, the loss of the resident macrophage barrier precedes the damage to the intestinal epithelial cell layer, and the cause of the resident macrophage barrier damage may be the key to the etiology of UC. We identified a new Aeromonas sp. MTB that can produce Aerolysin toxin, which has strong selective toxicity to macrophages. We propose that MTB may be the pathogenic bacteria of ulcerative colitis. The argument is based on the following facts: a) MTB can colonize the mouse intestine for a long time under certain conditions (such as antibiotic and DSS pretreatment); b) MTB-induced colitis phenotype is similar to the clinical symptoms of UC; c) MTB bacteria have a higher epidemiological distribution rate in UC patients. The pathogenic factor of MTB is aerolysin, the evidence is: a) Aerolysin protein is detected in 40% of UC patients' colon tissues, and can infiltrate the whole layer of colon; b) Anti-Aerolysin antibody significantly inhibits MTB-induced colitis; c) Aerolysin expression-deficient MTB culture supernatant cannot induce macrophage death. Based on the above research results, we propose the mechanism of UC pathology, the colonization of MTB is promoted under pathological conditions such as epithelial damage and excessive use of antibiotics, MTB destroys the resident macrophage barrier in the intestinal mucosa by expressing Aerolysin, this damage makes the colon tissue more susceptible to harmful factors, and then causes severe damage to the epithelium, induces mucosal inflammation, and forms ulcers. The long-term colonization of MTB can make the inflammation persist, leading to the recurrence of the disease after treatment. Because the infiltration of bone marrow-derived mononuclear cells is difficult to supplement the resident macrophage barrier, MTB infection can gradually develop into chronic and recurrent inflammation (Figure 15). In addition, 1.16% of healthy individuals have MTB, which are MTB carriers and potential patients, and under certain pathological conditions, they can develop into UC.

[0396] Aeromonas, belonging to the family Aeromonadaceae, is a common, facultative anaerobic, Gram-negative bacterium found in aquatic environments. Among 36 subspecies of Aeromonas, A. caviae, A. veronii, A. dhakensis, and A. hydrophila are the most frequently isolated subspecies from human feces. Infections with these subspecies often result in acute gastroenteritis syndrome, wound infection, or bacteremia. Although these diseases can be fatal in immunocompromised patients, they are usually self-limiting and resolve spontaneously, suggesting that these strains are unlikely to colonize the gut for long periods. We observed that A. veronii strains (TH0426, ATCC35624) were unable to colonize the mouse gut, while MTB was able to colonize for at least 30 days. Although TH0426 highly expressed the Aerolysin toxin, it did not disrupt the resident macrophage barrier in the colon, suggesting that good colonization ability is a prerequisite for the induction of the macrophage barrier and colitis. Although Aerolysin, proteases, lecithinases, nucleases, amylases, and elastases are common pathogenic factors of Aeromonas, for ulcerative colitis, Aerolysin can be the major or only pathogenic factor, as anti-Aerolysin neutralizing antibodies effectively inhibited MTB-induced colitis, and the culture supernatant of MTB lacking Aerolysin expression did not induce macrophage death.

[0397] Resident macrophages in close proximity to epithelial cells in the colon tissue are essential for maintaining gut homeostasis, protecting the integrity of the gut barrier, and forming an immune defense in the gut. The macrophage barrier in the distal colon recognizes harmful pathogens and limits the absorption of colonocytes, thereby reducing epithelial cell death and maintaining the integrity of the epithelial barrier. Macrophage-produced metabolites also play an important role in maintaining epithelial homeostasis and epithelial damage recovery. The disruption of the macrophage barrier leads to epithelial barrier damage when the gut microbiota is altered or when opportunistic pathogenic bacteria infect. Notably, the CX3CR1 gene (macrophage biomarker gene) knockout leads to a decrease in resident macrophages and a decrease in resistance to enteric pathogenic bacteria, which subsequently leads to colitis. In this study, we also observed that the damage to the resident macrophage barrier in the lamina propria caused by MTB was sufficient to induce colitis similar to UC symptoms. These results again emphasize the very important role of colon resident macrophages in maintaining the epithelial barrier and inhibiting the occurrence of colitis. In addition, the decrease in these resident macrophages can also lead to cytomegalovirus infection, which can partially explain why UC patients often have cytomegalovirus infection complications. Without a doubt, intervention in the function of resident macrophages will help to inhibit the pathological process of UC and prevent the occurrence of complications.

[0398] Aerolysin is a pore-forming enterotoxin protein and the major pathogenic factor in A. veronii associated fish diseases. Aerolysin is secreted as an inactive dimeric precursor, which is activated by proteolytic cleavage of the C-terminal peptide. Active Aerolysin can bind to cell membrane surface glycosylphosphatidylinositol (GPI)-anchored proteins (e.g. CD52, Thy-1, contactin, CD14, semaphorin K1, N-CAM, etc.) and polymerize into a heptameric complex, inserting into the cell membrane to form a pore, causing ion imbalance (e.g. Na + , K + , Ca 2+ and water) to disrupt the ion balance and osmotic stability of the cell, thereby mediating cytotoxicity, further leading to cell swelling, vacuolization, and eventually cell rupture and lysis. We observed that macrophages are more sensitive to Aerolysin-induced cell death. Interfering with the expression of Cd14, Bst1 and Smpdl3b genes in Raw264.7 significantly reduced GST-Aerolysin-induced cell death. Therefore, in addition to the known Aerolysin receptor CD14, other macrophage membrane surface GPI receptors also bind to Aerolysin, mediating the toxic effects on macrophages together or separately. Undoubtedly, further study of the toxic effects of Aerolysin on other tissue-derived cells will help us understand the extra-intestinal syndrome of UC.

[0399] The discovery of pathogenic bacteria Aeromonas sp. MTB and its virulence factor Aerolysin is of great significance for the diagnosis and treatment of UC. First, the detection of MTB in fecal samples and / or Aerolysin in colonic tissues will help to confirm the diagnosis of UC. According to our research results, 22.78% to 72.15% of UC feces showed MTB positive, which was significantly higher than that of normal people, CD patients and intractable constipation patients, and had obvious diagnostic value. Although the sensitivity (p1407: 59.4% and pASA: 78.2%) and specificity (p1407: 96.6% and pASA: 89.4%) of the PCR method established here are different, but both of them can meet the basic requirements of clinical examination. In addition, Aerolysin protein can be detected in about 40% of UC colonic tissues, and the detection of Aerolysin protein in colonic tissues may also help the diagnosis of UC. Second, the elimination of MTB or Aerolysin may be a new treatment strategy for UC. Since anti-Aerolysin antibodies can neutralize Aerolysin activity in vitro and significantly inhibit MTB-induced colitis in mice in vivo, humanized anti-Aerolysin antibodies will be a promising treatment strategy for UC. The antigenic site analysis of Aerolysin neutralizing antibodies will facilitate the subsequent vaccine and antibody research. Since MTB is resistant to most antibiotics, the development of phage therapy or Aerolysin vaccination may be more advantageous.

Claims

1. Use of a gasolin inhibitor for the manufacture of a medicament for preventing or treating ulcerative colitis in a subject.

2. The use according to claim 1, wherein the gasolin (a) is a gasolin derived from Aeromonas sp. MTB, veronii, sobria, DNP9, FDAARGOS 1411, allosaccharophila, HMWF015, Y318-3, JL9, australiensis, 159, jandaei or hydrophila; or (b) comprises an amino acid sequence as shown in any one of SEQ ID NOs: 1 to 21 and 180 to 184 or an amino acid sequence having at least 80% sequence identity to each of them.

3. The use according to claim 1 or 2, wherein the gasolin inhibitor is selected from the group consisting of an antibody or antigen-binding fragment thereof, a small nucleic acid molecule, an aptamer, a small molecule compound and a gene editing complex.

4. The use according to any one of claims 1 to 3, wherein the gasolin inhibitor is an anti-gasolin antibody or antigen-binding fragment thereof; preferably, the anti-gasolin antibody interferes with the association of gasolin with a GPI-anchored protein; optionally, the anti-gasolin antibody is a polyclonal antibody or a monoclonal antibody; optionally, the anti-gasolin antibody binds to a domain of a gasolin comprising the N-terminal 1-148 amino acid fragment of an amino acid sequence as shown in any one of SEQ ID NOs: 180 to 184; optionally, the anti-gasolin antibody is a humanized antibody or a human antibody; optionally, the anti-gasolin monoclonal antibody comprises a light chain variable region and a heavy chain variable region, the heavy chain variable region comprising HCDR1, HCDR2 and HCDR3, the light chain variable region comprising LCDR1, LCDR2, LCDR3, wherein the sequences of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3 are selected from the group consisting of: (a) SEQ ID NOs: 36, 37, 38, 54, 55 and 56, respectively; (b) SEQ ID NOs: 39, 40, 41, 57, 58 and 59, respectively; (c) SEQ ID NOs: 42, 43, 44, 60, 61 and 62, respectively; (d) SEQ ID NOs: 45, 46, 47, 63, 64 and 65, respectively; (e) SEQ ID NOs: 48, 49, 50, 66, 67 and 68, respectively; (f) SEQ ID NOs: 51, 52, FGH, 69, 70 and 71, respectively; (g) SEQ ID NOs: 51, 52, FGH, 72, 73 and 74, respectively; optionally, the sequences of the light chain variable region and the heavy chain variable region of the anti-gasolin monoclonal antibody are selected from the group consisting of: (a) SEQ ID NOs: 23 and 24, respectively; (b) SEQ ID NOs: 25 and 26, respectively; (c) SEQ ID NOs: 27 and 28, respectively; (d) SEQ ID NOs: 29 and 30, respectively; (e) SEQ ID NOs: 31 and 32; (f) SEQ ID NOs: 33 and 34; and (g) SEQ ID NOs: 33 and 35.

5. The use of claim 3, wherein the aerolysin inhibitor is a small nucleic acid molecule comprising a nucleotide fragment complementary to a portion of an endogenous nucleic acid sequence encoding aerolysin, and is selected from the group consisting of small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), and antisense oligonucleotide (ASO).

6. A polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 and 180 to 184, or an immunogenic fragment thereof, preferably the immunogenic fragment is a fragment comprising amino acids 1-148 and / or 149-296 and / or 297-443 of any one of SEQ ID NOs: 180 to 184; a polynucleotide encoding the polypeptide or the immunogenic fragment thereof; a vector comprising the polynucleotide; or a host cell comprising the vector.

7. A method of preparing an antibody for preventing or treating ulcerative colitis, the method comprising: (a) immunizing an animal with the polypeptide or the immunogenic fragment thereof of claim 6; and (b) isolating and screening antibodies against the polypeptide or the immunogenic fragment thereof from the animal; optionally, the antibody is a polyclonal antibody or a monoclonal antibody; optionally, the monoclonal antibody is a humanized antibody or a human antibody; optionally, in step (b), the antibody is screened for binding to the 1-148 amino acid fragment of the polypeptide of any one of SEQ ID NOs: 180 to 184; preferably, the animal is a rodent, such as a mouse or a rat; more preferably, the animal is a humanized transgenic mouse or rat.

8. A method of screening a drug candidate for preventing or treating ulcerative colitis, the method comprising: (a) contacting a test substance with a polypeptide comprising an amino acid sequence as set forth in any one of SEQ ID NOs: 180 to 184, (b) evaluating the test substance for inhibition of an activity of the polypeptide; and (c) identifying a test substance with an inhibition exceeding a pre-set threshold as a drug candidate; preferably, the test substance is a small molecule compound; optionally, the activity of the polypeptide is characterized by a killing effect of the polypeptide on macrophages.

9. Aeromonas MTB bacteria, deposited with the China General Microbiological Culture Collection Center under accession number CGMCC No. 30776 or CGMCC No. 30777.

10. A method of screening a drug candidate for preventing or treating ulcerative colitis, the method comprising: (a) contacting a test substance with the Aeromonas MTB bacteria of claim 9, (b) evaluating the test substance for inhibition of the bacteria; and (c) identifying a test substance with an inhibition exceeding a pre-set threshold as a drug candidate. ​ Optionally, the inhibitory effect is characterized by at least one of a minimum inhibitory concentration (MIC), a minimum bactericidal concentration (MBC), a half maximal effective concentration (EC50), and a half maximal inhibitory concentration (IC50); preferably, the test substance is a small molecule compound or a bacteriophage.

11. Use of an inhibitor of A. mtcb of claim 9 for the manufacture of a medicament for preventing or treating ulcerative colitis in a subject; preferably, the medicament is a small molecule compound; preferably, the small molecule compound has the structure of Formula I: wherein at least two of R1, R2and R3are hydroxyl, and in case not all of R1, R2and R3are hydroxyl, one of R1, R2and R3is selected from the group consisting of H, C1-C 20 alkyl, C1-C 20 alkyl, C1-C 20 alkyl or C3-C8cycloalkyl; preferably, R1, R2and R3are all hydroxyl; R4 is selected from hydroxyl group, C1-C 20 Alkyl groups, halogen-substituted C1-C groups 20 Alkyl, C1-C 20 Alkoxy groups, halogenated C1-C 20 The small molecule compound is selected from alkoxy, C3-C8 cycloalkyl, halogen-substituted C3-C8 cycloalkyl, and is absent; preferably, R4 is selected from hydroxyl and C1 to C8 alkoxy; preferably, R4 is hydroxyl, methoxy, ethoxy, propoxy, isopropoxy, butoxy, tert-butoxy, isobutoxy, pentoxy, or isopentoxy; optionally, the small molecule compound does not include gallic acid, ethyl gallate, bis-ethyl gallate, or galloyl glucose; preferably, the small molecule compound is isopentyl gallate.

12. An antibody or antigen-binding fragment thereof capable of specifically binding to the polypeptide of claim 6 or an immunogenic fragment thereof; preferably, the antibody interferes with the association of aerolysin with a GPI-anchored protein; optionally, the antibody is a polyclonal antibody or a monoclonal antibody; optionally, the monoclonal antibody is a humanized antibody or a human antibody; optionally, the antibody is modified or labeled, e.g., fluorescently labeled; optionally, the monoclonal antibody comprises a light chain variable region and a heavy chain variable region, the heavy chain variable region comprising HCDR1, HCDR2, and HCDR3, the light chain variable region comprising LCDR1, LCDR2, LCDR3, wherein the sequences of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3 are selected from the group consisting of: (a) SEQ ID NOs: 36, 37, 38, 54, 55, and 56; (b) SEQ ID NOs: 39, 40, 41, 57, 58, and 59; (c) SEQ ID NOs: 42, 43, 44, 60, 61, and 62; (d) SEQ ID NOs: 45, 46, 47, 63, 64, and 65; (e) SEQ ID NOs: 48, 49, 50, 66, 67, and 68; (f) SEQ ID NOs: 51, 52, FGH, SEQ ID NOs: 69, 70, and 71; (g) SEQ ID NOs: 51, 52, FGH, SEQ ID NOs: 72, 73, and 74; Optionally, the sequences of the light chain variable region and the heavy chain variable region of the monoclonal antibody are selected from the group consisting of: (a) SEQ ID NOs: 23 and 24; (b) SEQ ID NOs: 25 and 26; (c) SEQ ID NOs: 27 and 28; (d) SEQ ID NOs: 29 and 30; (e) SEQ ID NOs: 31 and 32; (f) SEQ ID NOs: 33 and 34; and (g) SEQ ID NOs: 33 and 35.

13. Use of an antibody or an antigen-binding fragment thereof capable of specifically binding to an aerolysin in the manufacture of a kit for diagnosing ulcerative colitis in a subject; optionally, the aerolysin (a) is an aerolysin derived from Aeromonas veronii, sobria, DNP9, FDAARGOS 1411, allosaccharophila, HMWF015, Y318-3, JL9, australiensis, 159, jandaei, or hydrophila; or (b) comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 21 and 180 to 184, or an amino acid sequence having at least 80% sequence identity to each of them; optionally, the antibody is a polyclonal antibody or a monoclonal antibody; optionally, the antibody is modified or labeled, e.g., fluorescently labeled.

14. A method of detecting in vitro whether a sample comprises the Aeromonas MTB bacteria of claim 9, comprising (a) contacting an anti-aerolysin antibody or an antigen-binding fragment thereof with the sample in vitro, (b) detecting binding of the antibody or antigen-binding fragment thereof to the Aeromonas MTB bacteria, and (c) the presence of the binding indicates that the sample comprises the Aeromonas MTB bacteria; optionally, the sample is a fecal sample; preferably, the anti-aerolysin antibody is the antibody of claim 12.

15. A method of detecting in vitro whether a sample comprises the Aeromonas MTB bacteria of claim 9, comprising (a) amplifying a polynucleotide encoding the polypeptide or immunogenic fragment thereof of claim 6; and / or (b) amplifying gene 1407, wherein a positive amplification result of (a) and / or (b) indicates that the sample comprises the Aeromonas MTB bacteria; optionally, the sample is a fecal sample.

16. A method of detecting in vitro whether a sample comprises the Aeromonas MTB bacteria of claim 9, comprising (a) culturing the sample to obtain a culture supernatant, (b) co-culturing the culture supernatant with macrophages, and (c) detecting killing effect of the culture supernatant on the macrophages, wherein the presence of the killing effect indicates that the sample comprises the MTB bacteria.

17. A vaccine composition comprising the polypeptide or immunogenic fragment thereof of claim 6, or a polynucleotide encoding the polypeptide or immunogenic fragment thereof; optionally, the vaccine composition further comprises an adjuvant.

18. Use of an aerolysin in the manufacture of a vaccine composition for preventing ulcerative colitis; optionally, the aerolysin (a) is an aerolysin derived from Aeromonas veronii, sobria, DNP9, FDAARGOS 1411, allosaccharophila, HMWF015, Y318-3, JL9, australiensis, 159, jandaei or hydrophila; or (b) comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 21 and 180 to 184 or an amino acid sequence having at least 80% sequence identity to each of them; preferably, the aerolysin comprises a polypeptide of an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 5 or an immunogenic fragment thereof; preferably, the immunogenic fragment is a fragment comprising amino acids 1-148 and / or 149-296 and / or 297-443 of any one of SEQ ID NOs: 180 to 184.

19. A method of establishing an animal model of ulcerative colitis, the method comprising colonizing the intestines of the animal with the Aeromonas MTB bacteria of claim 9; optionally, the animal is a mammal, preferably a rodent or a non-human primate, more preferably a mouse, a rat or a monkey; optionally, the method comprises orally administering the bacteria to the animal; preferably, the method further comprises subjecting the colon epithelium of the animal to injury prior to administering the bacteria to the animal, for example by administering to the animal an aqueous solution of dextran sodium sulfate, for example at 1-5%, for example having a molecular weight of 36000-50000; preferably, the method further comprises depleting the normal gut flora of the animal prior to administering the bacteria to the animal, for example by administering to the animal an antibiotic or a mixture of antibiotics.

Citation Information

Patent Citations

  • Aeromonas hydrophila aerolysin Dot-ELISA detection method

    CN102012429A

  • A highly bioactive egg yolk antibody and its preparation method

    CN102276720A

  • Completely humanized genetic engineering fragment antigen binding (Fab) antibody against hepatitis C virus core antigen, preparation method thereof and application

    CN103159853A

  • Anti-CTLA4 antibodies and uses thereof

    CN111406069A

  • Development and application of humanized anti-IL21 antibody

    CN116554323A