GPC1 gene and use thereof

Abstract

Provided are a GPC1 gene and the use thereof. The GPC1 gene encodes an amino acid sequence as shown in SEQ ID NO. 2. An increase in the single-gene expression level of the GPC1 gene leads to an increase in the whole-grain protein content in rice, and knockout of the gene results in a decrease in the whole-grain protein content in rice.

Description

A GPC1 gene and application thereof

[0001] Cross-reference to related applications

[0002] The present application claims priority to the Chinese patent application No. 2025118662917, filed on December 11, 2025, and entitled "A GPC1 gene and application thereof", the content of which is incorporated herein by reference in its entirety. TECHNICAL FIELD

[0003] The present application relates to the field of plant genetic engineering technology, more particularly to a GPC1 gene and application thereof, which regulates the protein content of whole grain rice. BACKGROUND

[0004] Rice is a cereal crop. Whole grain rice refers to whole grain rice with husks removed, also known as brown rice, which contains starchy endosperm, embryo and bran. Analysis shows that adequate intake of whole grains can comprehensively reduce the risk of various diseases such as cardiovascular and gastrointestinal diseases by about 30%. Compared with refined rice, whole grain rice can increase the edible part by more than 20%, and the increased part is rich in various nutrients and functional components.

[0005] In whole grain rice, protein is an important nutrient component with a content second only to starch, and is the main source of protein for people whose staple food is rice. Rice protein contains essential amino acids that the human body cannot synthesize, and the proportion of various amino acids is reasonable, low in fat, cholesterol-free and low in allergenicity, which is an ideal plant protein source. Through the research of rice functional genomics, the genes controlling rice protein content can be mined and functionally analyzed, which can provide an important technical basis for improving the nutritional and cooking taste quality of whole grain rice through molecular design breeding.

[0006] In view of the importance of whole grain, it is particularly urgent to mine and apply genes controlling rice protein content and improve the nutritional quality and cooking taste quality of whole grain rice, which is a technical problem to be solved by those skilled in the art. SUMMARY

[0007] Therefore, the present application provides a GPC1 gene and application thereof.

[0008] To solve the above technical problems, the present application adopts the following technical solutions:

[0009] A GPC1 gene, the amino acid sequence encoded by the GPC1 gene is shown as SEQ ID NO. 2.

[0010] Preferably, the nucleotide sequence of the GPC1 gene is shown as SEQ ID NO. 1.

[0011] In a second aspect, a GPC1 protein is provided, wherein the amino acid sequence of the GPC1 protein is shown as SEQ ID NO. 2.

[0012] In a third aspect, the application provides an application of the GPC1 gene or the GPC1 protein in increasing the whole grain protein content of rice, wherein the whole grain protein content of rice is increased by increasing the expression amount of the GPC1 gene or enhancing the activity of the GPC1 protein.

[0013] In a fourth aspect, the application provides an application of the GPC1 gene or the GPC1 protein in genetic breeding of rice, wherein the genetic breeding is breeding of high whole grain protein content germplasm, and the high whole grain protein content germplasm is bred by increasing the expression amount of the GPC1 gene or enhancing the activity of the GPC1 protein.

[0014] In a fifth aspect, the application provides an application of a biological material for increasing the expression amount of the GPC1 gene in increasing the whole grain protein content of rice, wherein the biological material is one of the following:

[0015] a. a nucleic acid molecule capable of encoding an amino acid sequence as shown in SEQ ID NO. 2;

[0016] b. an expression cassette capable of overexpressing the nucleic acid molecule of a;

[0017] c. a recombinant vector containing the expression cassette of b;

[0018] d. a recombinant microorganism containing the expression cassette of b or the recombinant vector of c;

[0019] e. a non-regenerative plant part containing the expression cassette of b or the recombinant vector of c or the recombinant microorganism of d.

[0020] In a sixth aspect, the application provides a method for increasing the whole grain protein content of rice, wherein the GPC1 gene is introduced into a receptor variety by hybridization, backcrossing, selfing or transgenic method, so as to significantly increase the whole grain protein content of rice.

[0021] Beneficial effects: the application provides the CPC1 gene and its application, and the increase of the single gene expression amount causes the significant increase of the whole grain protein content of rice, and the knockout of the gene causes the significant decrease of the whole grain protein content of rice, and the whole grain protein content of rice in the near-isogenic line of the allele has significant difference. The gene has great application potential and prospect for improving the traits of rice varieties, and provides a new genetic resource for improving the nutritional quality and cooking quality of rice breeding. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed to be used in the embodiments or prior art description will be briefly introduced. Obviously, the accompanying drawings in the following description only represent some of the embodiments of the present application, and all other drawings obtained by those of ordinary skill in the art without any creative effort based on the provided drawings also belong to the protection scope of the present application.

[0023] Figure 1 is a comparison of whole grain nutritional components of near-isogenic lines; A-C represent the contents of gluten and gliadin, soluble sugar and oil of whole grain of near-isogenic lines, respectively.

[0024] Figure 2 is a plasmid map of pU1301-GPC1 overexpression vector.

[0025] Figure 3 is a comparison of GPC1 gene expression levels of overexpression plants and wild type HHZ.

[0026] Figure 4 is a comparison of whole grain nutritional components of overexpression GPC1 gene and wild type HHZ; A-C represent the contents of whole grain gluten and gliadin, soluble sugar and oil, respectively.

[0027] Figure 5 is a schematic diagram of gene knockout vector pYLCRISPR / Cas9 Pubi-GPC1.

[0028] Figure 6 is the mutant sequence after GPC1 gene knockout.

[0029] Figure 7 is a comparison of whole grain nutritional components of gene knockout mutant plants and wild type HHZ; A-C represent the contents of whole grain gluten and gliadin, soluble sugar and oil, respectively. DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments only represent some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without any creative effort belong to the protection scope of the present application.

[0031] The experimental methods in the following embodiments are all conventional methods, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following embodiments can be obtained from commercial channels, unless otherwise specified.

[0032] Example 1 Near-isogenic lines carrying JZ type GPC1 allele significantly increase whole grain protein content

[0033] NIL-HHZ and NIL-JZ(HHZ) near-isogenic lines are obtained by crossing HHZ (Huanghuazhan) and JZ1560 (Jizhi 1560) (JZ) and using HHZ as recurrent parent for several times of backcrossing and GPC1 functional gene marker assisted selection. The background of the lines is HHZ, and the GPC1 allele is HHZ type and JZ type, respectively.

[0034] Original CDS sequence of GPC1 gene of JZ1560 type:

[0035] Amino acid sequence of GPC1 protein of JZ1560 type:

[0036] Functional gene marker primer sequence:

[0037] Del5-F: CGTCGTCTCGTGTCGTCT, SEQ ID NO. 3;

[0038] Del5-R: GATCTCGTGGCTGCAAGT, SEQ ID NO. 4.

[0039] The NIL-HHZ and NIL-JZ(HHZ) near-isogenic lines are planted in the field environment of the test farm of China National Rice Research Institute in Fuyang District, Hangzhou City, and the mature seeds are harvested. After the hull is removed, the nutritional components of the whole grain seeds are identified. The results show that the glutelin and alcohol-soluble protein content of the NIL-JZ(HHZ) near-isogenic line is significantly increased by 17.6% compared with that of the NIL-HHZ (see FIG. 1). The soluble sugar content and oil content have no significant difference.

[0040] Example 2: Overexpression of GPC1 gene significantly increases the whole grain protein content of transgenic plants

[0041] 1. Construction of GPC1 gene overexpression vector pU1301-GPC1

[0042] According to the cDNA sequence of GPC1 gene published on Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ), a pair of PCR specific primers with restriction endonuclease Kpnl and BamHI adapter (F: CGCGGATCCATGACGGGCAGTAGTTGT, SEQ ID NO. 5; R: AAAACTGCAGCTCACATTCTTCTTCCTCCG, SEQ ID NO. 6) were designed. The cDNA of rice variety JZ1560 was used as template for PCR amplification, and the reaction system was as follows: 2x Taq Mix 25 μL, cDNA 1 μL, primer-F / R 1 μL, and water to 50 μL. The PCR reaction program was as follows: 95 °C for 3 min, 95 °C for 30 sec, 55 °C for 30 sec, 72 °C for 60 sec, 72 °C for 5 min, 10 °C for 5 min, 35 cycles. The cDNA full length of the target gene from the start codon to the stop codon was finally obtained. The obtained GPC1 sequence was constructed into pU1301 expression vector by homologous recombination (see Figure 2 for plasmid map), and the overexpression vector pU1301-GPC1 was obtained.

[0043] The overexpression vector pU1301-GPC1 was genetically transformed into the callus of HHZ rice by Agrobacterium-mediated method, and the overexpression plant of GPC1 gene was obtained by identification.

[0044] The RNA of the transgenic plant was extracted at the seedling stage, and the cDNA was obtained by reverse transcription. The expression level of GPC1 gene was identified by qRT-PCR. The specific operation process was as follows:

[0045] The total RNA was extracted from the leaves of wild type HHZ and OE-GPC1 overexpression plants by Trizol method, and 3 biological replicates were used. The cDNA was synthesized using reverse transcription kit AdvanceFast 1st Strand cDNA Synthesis Kit. The cDNA was amplified using SYBR Green reagent kit 10 μl system. The amplification was performed using a fluorescence quantitative PCR instrument, and the primer sequences were SEQ ID NO. 5 and SEQ ID NO. 6.

[0046] [According to Rule 91 correction 04.01.2026] The amplification program was divided into 95 °C for 3 min, 95 °C for 10 sec, 60 °C for 30 sec, and the amplification cycle was 38. The Ubiquitin gene was used as an internal reference, and the relative expression amount of the gene was calculated by 2 -ΔΔCT As shown in Figure 2, the overexpression of GPC1 gene in OE-GPC1 plant was successfully achieved.

[0047] 2. Comparison of whole grain nutrient content in GPC1 overexpression plants

[0048] Mature seeds of wild type HHZ and OE-GPC1 overexpression plants were harvested and dried to constant weight in an oven at 42°C. After the seed coat was removed (whole grain rice), the grains were ground and sieved for whole grain nutrient content analysis.

[0049] The whole grain protein content was determined by Coomassie brilliant blue method. The detailed procedure was as follows: 0.1 g of whole grain rice powder was placed in a 2 ml centrifuge tube, a steel ball and 1 mL of 0.1 mol / L NaOH solution were added, and the sample was ground with a sample grinder (50 hz 60 s). After standing for 30 minutes, the sample was centrifuged at 3500 rpm for 15 minutes, and the supernatant was then transferred to another centrifuge tube to obtain the gluten solution. The alcohol-soluble protein solution was obtained by replacing the 0.1 mol / L NaOH solution with 70% ethanol solution and following the above procedure. 3 μl of the gluten solution and 3 μl of the alcohol-soluble protein solution were mixed with 297 μl of Coomassie brilliant blue G-250 staining solution, respectively, and allowed to stand for 2 minutes. The absorbance was then measured at 595 nm using a microplate reader, and the concentrations of gluten and alcohol-soluble protein in the samples were determined by combining the standard curve.

[0050] The soluble sugar determination method was as follows: 0.1 g of whole grain rice powder was added to a 15 ml centrifuge tube containing 4 ml of 80% alcohol, and the sample was continuously stirred in a 80°C water bath for 50 min. The sample was then centrifuged at 2000 rpm for 3 min, and the supernatant was collected in a new 15 ml centrifuge tube. The supernatant was collected twice more from the residue and combined. The residue in the centrifuge tube was dried in a 80°C oven and stored for starch determination. 10 mg of activated carbon was added to the collected supernatant, and the sample was continuously stirred in a 80°C water bath for 40 min. The filtrate was collected by filtration in a funnel and diluted to 15 ml. 500 μL of the alcohol extract was added to a centrifuge tube containing 500 μL of ddH2O and 3 mL of 2% anthrone solution (concentrated sulfuric acid), and the sample was boiled in a 2M NaOH water bath at 100°C for 5 min. The sample was then boiled in a 100°C water bath for 15 min, and the absorbance was measured at 620 nm after cooling to room temperature. The standard curve for soluble sugar was plotted, and the concentration of soluble sugar in the sample was calculated.

[0051] The extraction and determination of total oil and fat mainly refer to the Folch method. The specific operation steps are as follows: after the 20 mL glass bottle is washed, it is placed in an oven at 80°C and dried to constant weight, and then cooled to room temperature in the drying box. The weight of the glass bottle is accurately measured and recorded as A. 1 g of whole grain flour (denoted as B) is weighed and placed in a 50 mL centrifuge tube. 20 mL of chloroform and methanol (2:1) mixed reagent is added to the 50 mL centrifuge tube, and the whole grain flour is mixed uniformly with the mixed reagent by shaking. Shake in the shaker for 2 h, centrifuge at 2000 rpm for 5 min, collect the supernatant and move it to a 50 mL centrifuge tube. Add 0.2 times the volume of 0.9% NaCl solution to the sample supernatant, vortex for 5 sec, and centrifuge at 2000 rpm for 10 min to obtain a two-phase liquid surface separation state. Collect the lower liquid, which is the oil and fat contained in the chloroform layer. According to the volatilization characteristics of chloroform, place the glass bottle on a stirring heater at 80°C in a fume hood and dry it to constant weight, and record the weight as C. The total fat content is calculated as follows: fat content (%) = 100*(C-A) / B.

[0052] The results show that the content of whole grain gluten and prolamin in the OE-GPC1 transgenic plants is increased by 27.5% compared with the wild type HHZ, and there is no significant difference in the content of soluble sugar and oil (see Figure 4), which is consistent with the results of the near-isogenic line test in Example 1.

[0053] Example 3 Knocking out GPC1 gene significantly reduces the content of whole grain protein in transgenic plants

[0054] 1. Construct the GPC1 gene knockout vector pYLCRISPR / Cas9Pubi-GPC1.

[0055] According to the GPC1 gene sequence (such as SEQ ID No. 1), select appropriate target sequences to design primers gRNA-GPC1-F (GGCACCAGCTGCTGTACCCTCGC, SEQ ID NO. 7) and gRNA-GPC1-R (AAACGCGAGGGTACAGCAGCTGG, SEQ ID NO. 8). The primer pair gRNA-GPC1-F / R is denatured and annealed to obtain a gRNA-GPC1-F / R dimer product. The gRNA-GPC1-F / R dimer product is connected to the pYLgRNA-U3 vector to obtain an intermediate vector. The intermediate vector is connected to the pYLCRISPR / Cas9Pubi-H final vector (see Figure 5) by the method of cutting and connecting, to obtain a single-target GPC1 CRISPR / Cas9 gene editing vector pYLCRISPR / Cas9Pubi-GPC1. After the vector is successfully constructed, the T0 generation transgenic plants are obtained by Agrobacterium-mediated transformation of HHZ callus.

[0056] DNA of the transgenic plants was extracted, primers were designed to amplify the target sequence of the gene knockout, sequence variation after GPC1 gene knockout was identified, and the primers were amplified:

[0057] Crgpc1-F: AGAGACCATTTCCCTCCT, SEQ ID NO. 9;

[0058] Crgpc1-R: AGGACGACGTCGTAGG, SEQ ID NO. 10.

[0059] The sequencing results of the amplification products showed that the mutant plants gpc1-1 and gpc1-2 after GPC1 gene knockout respectively lacked 7 and 2 bases relative to the wild type HHZ (see FIG. 6). The results confirmed that the knockout vector pYLCRISPR / Cas9Pubi successfully mutated the GPC1 gene.

[0060] 2. Comparison of whole grain nutritional components of mutant plants after GPC1 gene knockout

[0061] The mature seeds of the wild type HHZ and the knockout mutants gpc1-1 and gpc1-2 were harvested, and the determination method of Example 2 was used to identify the concentration of glutelin and prolamin, the soluble sugar content, and the oil content in the samples.

[0062] The results showed that, relative to the wild type HHZ, the knockout mutants gpc1-1 and gpc1-2 significantly reduced the whole grain glutelin and prolamin content by 11.2%, and there was no significant difference in the soluble sugar content and oil content (see FIG. 7).

[0063] Each of the embodiments in the specification is described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the embodiments can be referred to each other.

[0064] The above description of the disclosed embodiments enables a person skilled in the art to implement or use the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to the embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A GPC1 gene, characterized in that, The amino acid sequence encoded by the GPC1 gene is shown as SEQ ID NO.

2.

2. A GPC1 protein, characterized in that, The amino acid sequence of the GPC1 protein is shown as SEQ ID NO.

2.

3. Use of the GPC1 gene of claim 1 or the GPC1 protein of claim 2 for increasing the whole grain protein content of rice, characterized in that, The rice whole grain protein content is increased by increasing the expression of the GPC1 gene or enhancing the activity of the GPC1 protein.

4. Use of the GPCl gene of claim 1 or the GPCl protein of claim 2 in the genetic breeding of rice, characterized in that, The genetic breeding is to breed high rice whole grain protein content germplasm, and the high rice whole grain protein content germplasm is bred by increasing the expression of the GPC1 gene or enhancing the activity of the GPC1 protein.

5. The use of a biological material that increases the expression of GPC1 gene in increasing the protein content of whole grain rice, characterized in that, The biological material is one of the following: a. a nucleic acid molecule capable of encoding an amino acid sequence as shown in SEQ ID NO. 2; b. an expression cassette capable of overexpressing the nucleic acid molecule of a; c. a recombinant vector containing the expression cassette of b; d. a recombinant microorganism containing the expression cassette of b or the recombinant vector of c; e. a non-regenerative plant part containing the expression cassette of b or the recombinant vector of c or the recombinant microorganism of d.

6. A method for increasing the protein content of whole grain rice, comprising, The GPC1 gene of claim 1 is introduced into a recipient variety by hybridization, backcrossing, selfing or transgenic method, so that the rice whole grain protein content is significantly increased.

Images