Fungal test method, primer set, reagent set, and bacterial and fungal test method
A primer and probe-based method targeting fungal 25S/28S rRNA addresses the challenges of comprehensive detection and false positives in rapid fungal testing, achieving sensitive and accurate results in pharmaceutical samples with human nucleic acids.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-26
- Publication Date
- 2026-04-02
AI Technical Summary
Existing methods for rapid microbiological testing of fungi in pharmaceuticals with short shelf lives face challenges in comprehensive detection sensitivity and are prone to false positives due to high sequence identity with human rRNA, especially in samples containing human cells.
A method utilizing primer sets and fluorescent dye-labeled probes targeting conserved sequences in fungal 25S/28S rRNA, with specific primer and probe sequences designed to minimize false positives and enhance detection sensitivity, allowing for real-time quantification of fungal presence.
The method provides comprehensive fungal coverage and high detection sensitivity with reduced false positives, suitable for rapid testing of pharmaceuticals with short shelf lives, ensuring accurate fungal detection in samples with human nucleic acids.
Smart Images

Figure JPOXMLDOC01-APPB-T000001 
Figure JPOXMLDOC01-APPB-T000002 
Figure JPOXMLDOC01-APPB-T000003
Abstract
Description
Fungal testing methods, primer sets, reagent sets, and bacterial / fungal testing methods
[0001] This disclosure relates to fungal testing methods, primer sets, reagent sets, and bacterial / fungal testing methods.
[0002] Cell and gene therapies generally need to be administered to patients within 48 to 96 hours of manufacture. This means that cell and gene therapies have a shelf life of only 48 to 96 hours after manufacture. Microbiological testing by culture (for example, a 14-day culture test to determine the presence of bacteria and fungi) is not applicable to pharmaceuticals with such short shelf lives. There is a need for rapid microbiological testing that is applicable to pharmaceuticals with short shelf lives.
[0003] Nucleic acid amplification tests (NATs) are rapid tests that can detect nucleic acids quickly and are promising as rapid microbiological tests. Ribosomal RNA (rRNA) is a promising target for NAT microbiological testing. Because rRNA is the RNA (ribonucleic acid) that makes up ribosomes and exists in multiple copies within cells, it can be a highly sensitive target for NATs. In addition, rRNA sequences have been analyzed in a wide variety of organisms, and a comprehensive sequence database has been established. Therefore, rRNA sequences that are specific to microorganisms and common among microorganisms are promising targets for NAT microbiological testing.
[0004] For example, Patent Documents 1 to 3 disclose a microbial testing method that includes a step of amplifying a target region selected from 28S rRNA, 18S rRNA, or 23S rRNA of a microorganism.
[0005] U.S. Patent Application Publication No. 2010 / 0129821, Japanese Patent Publication No. 2004-201641, Japanese Patent Publication No. 2008-278871
[0006] Applying NAT, which targets fungal rRNA, to a test to determine the presence or absence of fungi in a sample presents challenges in terms of comprehensiveness and detection sensitivity. Specifically, it is necessary to be able to comprehensively detect rRNA from all fungi present in the sample, regardless of the type of fungus, and to be able to detect fungi even if the number of fungi in the sample is small. Furthermore, since fungal rRNA has a high degree of sequence identity with human rRNA, which is also a eukaryote, it is also necessary to avoid false positives based on human nucleic acids when the sample is human cells or human cell preparations.
[0007] This disclosure is made under the circumstances described above. The object of this disclosure is to provide a fungal testing method, a primer set, a reagent set, and a bacterial / fungal testing method.
[0008] The following embodiments are included as specific means for solving the aforementioned problems: <1> A method for testing for the presence or absence of fungi in a sample, comprising amplifying a conserved sequence in fungal 25S / 28S rRNA by PCR using a primer set consisting of the following primers (1) and (2); Primer (1): A primer having a sequence of 13 to 25 bases including the sequence of Sequence ID No. 2, and / or a primer having a sequence of 10 to 25 bases including a sequence in which 1 to 3 bases have been modified in the sequence of Sequence ID No. 2; Primer (2): A primer having the sequence of Sequence ID No. 3, and / or a primer having a sequence in which 1 to 3 bases have been modified in the sequence of Sequence ID No. 3. <2> The fungal testing method according to <1>, further comprising quantifying the amplification product of the PCR using a fluorescent dye-labeled probe to which a fluorescent dye is bound to the probe (3) below; probe (3): a probe having a sequence of 10 to 30 bases including the sequence of SEQ ID NO: 4, and / or a probe having a sequence of 10 to 30 bases including a sequence in which one or two bases are modified in the sequence of SEQ ID NO: 4. <3> The fungal testing method according to <1> or <2>, wherein the consensus sequence of the conserved sequence in the fungal 25S / 28S rRNA is SEQ ID NO: 1 or has 90% or more sequence identity with SEQ ID NO: 1. <4> A primer set comprising the following primers (1) and (2) for amplifying conserved sequences in fungal 25S / 28S rRNA: Primer (1): A primer having a 13-25 base sequence including the sequence of Sequence ID No. 2, and / or a primer having a 10-25 base sequence including a sequence in which 1-3 bases are modified in the sequence of Sequence ID No. 2; Primer (2): A primer having the sequence of Sequence ID No. 3, and / or a primer having a sequence in which 1-3 bases are modified in the sequence of Sequence ID No. 3. <5> The primer set according to <4>, wherein primer (1) includes a primer having a 13-25 base sequence including the sequence of Sequence ID No. 2, and / or a primer having a 10-25 base sequence including a sequence in which 1-3 bases of the 5' terminal of the sequence of Sequence ID No. 2 are substituted.<6> A reagent set comprising the primer set described in <4> or <5>, and a fluorescent dye-labeled probe to which a fluorescent dye is conjugated for detecting a conserved sequence in fungal 25S / 28S rRNA, the following probe (3): a probe having a 10 to 30 base sequence including the sequence of SEQ ID NO: 4, and / or a probe having a 10 to 30 base sequence including a sequence in which one or two bases are modified in the sequence of SEQ ID NO: 4. <7> The reagent set described in <6>, wherein the primer (1) comprises at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 5, a primer having the sequence of SEQ ID NO: 6, a primer having the sequence of SEQ ID NO: 7, a primer having the sequence of SEQ ID NO: 8, and a primer having the sequence of SEQ ID NO: 9, the primer (2) comprises a primer having the sequence of SEQ ID NO: 3, and the probe (3) comprises a probe having the sequence of SEQ ID NO: 10, and / or a probe having the sequence of SEQ ID NO: 11. <8> The reagent set according to <6> or <7>, wherein the primer (1) comprises two or three types of primers with different base sequences, and the probe (3) comprises two types of probes with different base sequences.<9> A reagent set according to any one of <6> to <8>, further comprising: a primer set consisting of the following primers (4) and (5) for amplifying a conserved sequence in bacterial 23S rRNA; and a fluorescent dye-labeled probe, to which a fluorescent dye is conjugated to the following probe (6) for detecting a conserved sequence in bacterial 23S rRNA; Primer (4): A primer having the sequence of SEQ ID NO: 29, and / or a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 29; Primer (5): At least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 32, a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 32, a primer having the sequence of SEQ ID NO: 35, a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 35, a primer having the sequence of SEQ ID NO: 36, a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 37, and a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 37. Probe (6): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 34, a probe having a sequence in which one base is modified from the sequence of SEQ ID NO: 34, a probe having the sequence of SEQ ID NO: 38, a probe having a sequence in which one base is modified from the sequence of SEQ ID NO: 38, a probe having the sequence of SEQ ID NO: 39, a probe having a sequence in which one base is modified from the sequence of SEQ ID NO: 39, a probe having the sequence of SEQ ID NO: 40, and a probe having a sequence in which one base is modified from the sequence of SEQ ID NO: 40.<10> A method for simultaneously testing for the presence or absence of bacteria and fungi in a sample, comprising amplifying the conserved sequence in bacterial 23S rRNA and the conserved sequence in fungal 25S / 28S rRNA by PCR using a primer set consisting of the following primers (4) and (5) and a primer set consisting of the following primers (1) and (2); a bacterial and fungal testing method; Primer (4): A primer having the sequence of SEQ ID NO: 29, and / or a primer having a sequence in which 1 to 3 bases have been modified in the sequence of SEQ ID NO: 29; Primer (5): At least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 32, a primer having a sequence in which 1 to 3 bases have been modified in the sequence of SEQ ID NO: 32, a primer having the sequence of SEQ ID NO: 35, a primer having a sequence in which 1 to 3 bases have been modified in the sequence of SEQ ID NO: 35, a primer having the sequence of SEQ ID NO: 36, a primer having a sequence in which 1 to 3 bases have been modified in the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 37, and a primer having a sequence in which 1 to 3 bases have been modified in the sequence of SEQ ID NO: 37; Primer (1): A primer having a 13-25 base sequence containing the sequence of Sequence ID No. 2, and / or a primer having a 10-25 base sequence containing a sequence in which 1-3 bases have been modified from the sequence of Sequence ID No. 2. Primer (2): A primer having the sequence of Sequence ID No. 3, and / or a primer having a sequence in which 1-3 bases have been modified from the sequence of Sequence ID No. 3.<11> The bacterial and fungal testing method according to <10>, further comprising quantifying the amplification product of the PCR using a fluorescent dye-labeled probe to which a fluorescent dye is bound to the probe (6) below and a fluorescent dye-labeled probe to which a fluorescent dye is bound to the probe (3) below; Probe (6): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 34, a probe having a sequence in which one base is modified in the sequence of SEQ ID NO: 34, a probe having the sequence of SEQ ID NO: 38, a probe having a sequence in which one base is modified in the sequence of SEQ ID NO: 38, a probe having the sequence of SEQ ID NO: 39, a probe having a sequence in which one base is modified in the sequence of SEQ ID NO: 39, a probe having the sequence of SEQ ID NO: 40, and a probe having a sequence in which one base is modified in the sequence of SEQ ID NO: 40; Probe (3): A probe having a 10 to 30 base sequence including the sequence of SEQ ID NO: 4, and / or a probe having a 10 to 30 base sequence including a sequence in which one or two bases are modified in the sequence of SEQ ID NO: 4.
[0009] According to this disclosure, a fungal testing method, primer set, reagent set, and bacterial / fungal testing method are provided that offer excellent comprehensive coverage and detection sensitivity for fungi, and are less prone to false positives due to human nucleic acids.
[0010] Experiment 4: Amplification curve of RT-qPCR Experiment 5: Amplification curve of RT-qPCR Example 1: Amplification curve of RT-qPCR: A. brasiliensis, C. albicans, P. citrinum Example 1: Amplification curve of RT-qPCR: B. subtilis, C. sporogenes, P. aeruginosa Example 1: Amplification curve of RT-qPCR: S. aureus, C. acnes, E. coli Example 1: Amplification curve of RT-qPCR: M. luteus, K. rhizophila, S. epidermidis Example 1: Amplification curve of RT-qPCR: S. pneumoniae, S. pyogenes, A. baumannii Example 1: Amplification curve of RT-qPCR: A. calcoaceticus, B. diminuta, M. extorquens Example 1: Amplification curve of RT-qPCR: P. protegens, A. hydrophila, L. Pneumophila Example 1: Amplification curves of RT-qPCR: L. monocytogenes, S. enterica_Abony, S. enterica_Typhimurium Example 2: Amplification curves of RT-qPCR: Bacillus subtilis, Aspergillus brasiliensis Example 3: Amplification curves of RT-qPCR: Staphylococcus aureus, Candida albicans
[0011] The embodiments of this disclosure are described below. These descriptions and embodiments are illustrative and do not limit the scope of the embodiments.
[0012] In this disclosure, numerical ranges indicated using "~" represent a range that includes the numbers before and after "~" as the minimum and maximum values, respectively. In numerical ranges described in stages within this disclosure, the upper or lower limit of one numerical range may be replaced with the upper or lower limit of another numerical range described in stages. Furthermore, in numerical ranges described within this disclosure, the upper or lower limit of that numerical range may be replaced with the values shown in the examples.
[0013] In this disclosure, "A and / or B" is synonymous with "at least one of A and B." In other words, "A and / or B" may be A alone, B alone, or a combination of A and B.
[0014] In this disclosure, the term "process" includes not only independent processes but also processes that cannot be clearly distinguished from other processes, provided that their objectives are achieved.
[0015] When referring to the amount of each component in a composition in this disclosure, if there are multiple types of substances corresponding to each component in the composition, unless otherwise specified, it refers to the total amount of those multiple types of substances present in the composition.
[0016] Regarding substance concentration, "M" represents molar concentration, where 1M = 1 mol / L. Unless otherwise specified, "%" in relation to substance concentration refers to a mass basis.
[0017] The full spelling of abbreviations used in this disclosure is as follows: PCR: Polymerase Chain Reaction qPCR: Quantitative Polymerase Chain Reaction RT-PCR: Reverse Transcription-Polymerase Chain Reaction RT-qPCR: Reverse Transcription-Quantitative Polymerase Chain Reaction
[0018] qPCR is also called rtPCR (real-time Polymerase Chain Reaction). To avoid confusion between rt (real-time) and RT (Reverse Transcription), this disclosure will refer to it as qPCR, not rtPCR.
[0019] The degree of sequence identity (%) is calculated using the CLUSTAL W Multiple Sequence Alignment Program (ClustalW2.1).
[0020] <Experiment> The fungal testing method described herein was created based on the results of experiments conducted by the inventors. The inventors' nucleotide sequence analysis of fungal 25S / 28S rRNA, PCR experiments, and their results are described below.
[0021] [Sequencing Analysis of Fungal 25S / 28S rRNA] Fungal ribosomes contain either 25S rRNA (25S ribosomal RNA) or 28S rRNA (28S ribosomal RNA) in their large subunits. The gene encoding 25S / 28S rRNA on the fungal genomic DNA is called 25S / 28S rDNA (25S / 28S ribosomal DNA).
[0022] Three types of fungi (shown in Table 1) were selected for 25S / 28S rDNA sequence analysis. These three fungi are listed in ISO 24190:2023 "Biotechnology - Analytical methods - Risk-based approach for method selection and validation for rapid microbial detection in bioprocesses".
[0023]
[0024] A. brasiliensis has 28S rRNA, C. albicans has 25S rRNA, and P. citrinum has 28S rRNA.
[0025] The nucleotide sequences of the 25S / 28S rDNA of three fungal species were obtained from the National Center for Biotechnology Information (NCBI) database. The accession numbers of the 25S / 28S rDNA for each fungus are shown in Table 2.
[0026]
[0027] Sequence analysis revealed several highly conserved regions in the three fungal species. One of these regions is called the R1 region.
[0028] In the consensus sequences (total base count 2986 bp) obtained by aligning the 25S / 28S rDNA of three fungal species, the R1 region is located in the range of 849 bp to 1072 bp.
[0029] Sequence analysis revealed that the R1 region exhibits 94% to 99% sequence identity in comparisons between two of the three fungal species shown in Table 1.
[0030] [Experiment 1: Screening of Primer-Probe Sets with High Detection Sensitivity] Primer-probe sets No. 1-6 were prepared to amplify and detect the R1 region. The reverse primer also served as the reverse transcription primer. The probe was a fluorescently labeled probe with the fluorescent dye Cy5 bound to its 5' end and the quencher BHQ3 bound to its 3' end. The base sequences of the primers and probes are shown in Table 3.
[0031]
[0032] The RT-qPCR reaction solutions shown in Table 4 were prepared. "Hot Start TTx DNA Polymerase" (Toyobo Co., Ltd.) is a DNA polymerase derived from the Thermus thermophilus HB8 strain and is a DNA polymerase with reverse transcription activity. Hot Start TTx DNA Polymerase is a DNA polymerase used in so-called "hot start PCR" that has been inactivated by a neutralizing antibody.
[0033]
[0034] Total RNA of C. albicans or genomic DNA of C. albicans was used as a template, and RT-qPCR or qPCR was performed in the following cycles. <1> is a heat treatment that inactivates neutral antibodies and restores the activity of Hot Start TTx DNA Polymerase, <2> is an incubation for reverse transcription, <3> is a heat treatment that denatures DNA into single strands, and <4>-<5> are two-step PCR (denaturation / annealing and extension).
[0035] - When the template is RNA - <1> 90°C / 30 seconds <2> 60°C / 5 minutes <3> 95°C / 1 minute <4> 95°C / 10 seconds <5> 60°C / 15 seconds... fluorescence detection <4>-<5> are repeated 45 times
[0036] - When the template is DNA - <3> 95°C / 2 minutes <4> 95°C / 10 seconds <5> 60°C / 15 seconds... fluorescence detection <4>-<5> are repeated 45 times
[0037] The Ct value (Threshold Cycle) of each reaction is shown in Table 5. RT-qPCR or qPCR was performed with the template concentration diluted in 8 steps.
[0038]
[0039] The sequence identity in Table 5 is the sequence identity obtained by comparing the base sequence of the primer / probe set with the base sequences of the target regions of each of the three types of fungi. For example, Primer / Probe Set No. 1 has a sequence identity of 100% with the fungus having the highest sequence identity and a sequence identity of 90% with the fungus having the lowest sequence identity. '
[0040] From the results shown in Table 5, it was determined that Primer / Probe Sets No. 1, No. 2, and No. 3-1 have high detection sensitivity.
[0041] [Experiment 2: Screening of Primer / Probe Sets That Do Not Amplify Human Nucleic Acids] The conserved sequence of fungal 25S / 28S rRNA is likely to be a conserved sequence in human 28S rRNA. It was confirmed whether Primer / Probe Sets No. 1 to 6 amplify human nucleic acids.
[0042] A qPCR reaction solution was prepared using human genomic DNA as the template, with the composition shown in Table 4. qPCR was performed in the following cycle. The Ct values of the qPCR are shown in Table 6.
[0043] <3> 95°C / 2 minutes <4> 95°C / 10 seconds <5> 60°C / 15 seconds...Fluorescence detection Repeat <4>-<5> 45 times
[0044]
[0045] Based on the results shown in Table 6, we concluded that primer-probe set No. 3-1 does not amplify human nucleic acids.
[0046] [Experiment 3: Examination of the acceptable range of sequence identity for primer-probe set No. 3-1] Substitutions of 1 to 3 bases were made in the forward primer of primer-probe set No. 3-1, and their functionality was examined. The base sequences of each primer-probe set are shown in Table 7. The substituted bases are underlined.
[0047]
[0048] RT-qPCR reaction solutions were prepared using the composition shown in Table 4, with fungal total RNA (A. brasiliensis, C. albicans, or P. citrinum) as the template. RT-qPCR was performed using the same cycle as in Experiment 1. The Ct values of the RT-qPCR are shown in Table 8.
[0049]
[0050] The results shown in Table 8 indicate that the primer-probe sets shown in Table 7 are nearly equivalent to each other.
[0051] [Experiment 4: Searching for primer / probe sets that are less likely to cause false positives] When the sample is human cells or human cell preparations, human RNA is present in high concentrations in the sample. We searched for primer / probe sets that are less likely to cause false positives due to human RNA.
[0052] Primer-probe set No. 7 was prepared. The nucleotide sequences of No. 7 and No. 3-1 are shown in Table 9. Bases common to both No. 7 and No. 3-1 are underlined.
[0053]
[0054] The RT-qPCR reaction solutions shown in Table 10 were prepared. The fungal primer / probe set was No. 7 or No. 3-1. The template was total RNA from human cells (maximum concentration 300 ng / reaction, serially diluted 10-fold), or single-stranded RNA synthesized based on the common base sequence of 28S rRNA of A. brasiliensis and P. citrinum (hereinafter referred to as "28S ssRNA") (maximum concentration 1 × 10⁻¹⁶). 7 This involves copies / reaction (serial dilution by a factor of 10).
[0055]
[0056] The final concentrations of the primers and probes in the RT-qPCR reaction solution are 0.25 μM for the forward primer, 0.25 μM for the reverse primer, and 0.05 μM for the probe, respectively, for bacterial and fungal reactions.
[0057] RT-qPCR was performed using the RT-qPCR reaction mixture shown in Table 10, following the cycle below: <1> 90°C / 30 sec <2> 65°C / 5 sec <3> 95°C / 1 sec <4> 95°C / 10 sec <5> 60°C / 25 sec...fluorescence detection Repeat <4>-<5> 45 times
[0058] The amplification curves of RT-qPCR are shown in Figure 1. No. 7 did not show false positives even with a total human cell RNA of 300 ng. On the other hand, No. 7 showed high detection sensitivity for 28S ssRNA, although slightly inferior to No. 3-1.
[0059] [Experiment 5: Confirmation of the detection power of Primer-Probe Set No. 7] To confirm the detection power of Primer-Probe Set No. 7, RNA was extracted from samples in which fungi were added to human cells, and RT-qPCR was performed.
[0060] HEK293 cells (Human Embryonic Kidney 293 cells) 2×10 6 C. albicans (99 CFU) was added to cells, and RNA was extracted from this sample. In addition, HEK293 cells (2 × 10⁶) were used. 6RNA was extracted from *C. cells* and *C. albicans* (99 CFU), respectively. Using the extracted RNA as a template, the RT-qPCR reaction mixtures shown in Table 10 were prepared, and RT-qPCR was performed using the same cycle as in Experiment 4.
[0061] The amplification curves of the RT-qPCR are shown in Figure 2. As shown in (a), No. 7 did not show false positives for total RNA of HEK293 cells. On the other hand, as shown in (b), No. 7 detected total RNA of C. albicans. Therefore, (c) shows that No. 7 detected C. albicans in a sample containing both HEK293 cells and C. albicans.
[0062] Based on the experimental results described above, this disclosure provides a new method for fungal testing. The fungal testing method, primer set, probe, and reagent set of this disclosure are described below.
[0063] <Fungal Testing Method> The fungal testing method disclosed herein is a method for testing for the presence or absence of fungi in a sample by PCR targeting conserved sequences within fungal 25S / 28S rRNA.
[0064] The fungal testing method described herein includes both a form in which nucleic acid reverse transcription is performed prior to PCR and a form in which nucleic acid reverse transcription is not performed. In the former form, the reverse transcript of 25S / 28S rRNA and 25S / 28S rDNA can be amplified by PCR. In the latter form, 25S / 28S rDNA can be amplified by PCR.
[0065] The fungal testing method described herein includes PCR using a primer set consisting of primer (1) and primer (2) as described below.
[0066] Primer (1): A primer having a 13-25 base sequence containing the sequence of SEQ ID NO: 2 (TCTGGGTGGAGGCT), and / or a primer having a 10-25 base sequence containing a sequence in which 1-3 bases are modified from the sequence of SEQ ID NO: 2. Primer (2): A primer having the sequence of SEQ ID NO: 3 (CTTCTTTACATATTTTAAAAGTTTGAGAAT), and / or a primer having a sequence in which 1-3 bases are modified from the sequence of SEQ ID NO: 3.
[0067] The primer set consisting of primer (1) and primer (2) is a primer set that amplifies the R1 region as described above. The consensus sequences obtained by aligning the nucleotide sequences of the R1 regions of the three fungi shown in Table 1 are shown below.
[0068] SEQ ID NO: 1: GGAAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAA GTTTCCCTCAGGATAGCAGTAACGCGAANTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGGCCTTGGGGTTGAAAACAACCTTAACCTATTCTCAAACTTTAAAATATGTAAGAAG
[0069] Sequence ID 1 corresponds to the region from 849 bp to 1072 bp in the consensus sequence (total base count 2986 bp) obtained by aligning the 25S / 28S rDNA of three fungal species. The underlined portions within Sequence ID 1 correspond to the sequence of Sequence ID 2, Sequence ID 4, and the complementary sequence of Sequence ID 3, respectively.
[0070] The consensus sequence may not be identical to Sequence ID No. 1, depending on the alignment algorithm, the database from which the base sequences of fungal 25S / 28S rDNA are obtained, and the number of fungal species from which base sequences are obtained. Preferably, the consensus sequence has 90% or more sequence identity with Sequence ID No. 1, and more preferably, 95% or more sequence identity with Sequence ID No. 1.
[0071] The R1 region nucleotide sequence is a highly conserved sequence in fungi. Furthermore, SEQ ID NO: 2 is a nucleotide sequence common to the forward primer of primer-probe set No. 7 and the forward primer of No. 3-1, and SEQ ID NO: 3 is a nucleotide sequence that constitutes the reverse primer of No. 7 and the reverse primer of No. 3-1. It has been confirmed that No. 7 and No. 3-1 have high sensitivity for detecting fungal 25S / 28S rRNA, No. 3-1 does not amplify human DNA, and No. 7 does not amplify high concentrations of human RNA. For these reasons, PCR using a primer set consisting of primer (1) and primer (2) can comprehensively and sensitively determine the presence or absence of fungi and is less prone to false positives due to human nucleic acids. Therefore, the fungal testing method disclosed herein is excellent in comprehensive fungal coverage and detection sensitivity and is less prone to false positives due to human nucleic acids.
[0072] The fungal testing method of this disclosure quantifies PCR amplification products, for example, by electrophoresis or fluorescence measurement. Preferably, the fungal testing method of this disclosure includes real-time quantification of PCR amplification products by a fluorescence monitoring method. The fluorescence monitoring method may be either an intercalator method using a double-stranded DNA-binding fluorescent dye or a probe method using a fluorescent dye-labeled probe.
[0073] From the viewpoint of superior comprehensive coverage and detection sensitivity of fungi, the fungal testing method of this disclosure is preferably quantified using a fluorescent dye-labeled probe to which a fluorescent dye is bound, and more preferably performed in real time by a probe method using the fluorescent dye-labeled probe.
[0074] Probe (3): A probe having a 10 to 30 base sequence including the sequence of Sequence ID No. 4 (TGCCGAAGT), and / or a probe having a 10 to 30 base sequence including a sequence in which one or two bases are modified in the sequence of Sequence ID No. 4.
[0075] Sequence ID 4 is located within Sequence ID 1. In other words, probe (3) is a probe that binds to the amplification product of a primer set consisting of primer (1) and primer (2). Sequence ID 4 is a base sequence common to both the probe of primer-probe set No. 7 and the probe of No. 3-1, and it has been confirmed that No. 7 and No. 3-1 have high detection sensitivity for fungal 25S / 28S rRNA. Therefore, the fungal testing method of this disclosure is superior in fungal coverage and detection sensitivity by using a fluorescent dye-labeled probe, to which a fluorescent dye is bound, for real-time quantification.
[0076] An example of an embodiment of the fungal testing method of this disclosure is realized by performing the following steps (1) and (2).
[0077] Step (1): Preparation of qPCR reaction solution or RT-qPCR reaction solution. Step (2): PCR and real-time quantification, or reverse transcription, PCR and real-time quantification.
[0078] The fungal testing method described herein includes both a form in which reverse transcription of nucleic acids is performed prior to PCR, and a form in which reverse transcription of nucleic acids is not performed. In the former form, it is preferable to prepare a qPCR reaction solution and perform PCR and real-time quantification. In the latter form, it is preferable to prepare an RT-qPCR reaction solution and perform reverse transcription, PCR and real-time quantification.
[0079] Reverse transcription and PCR are achieved by temperature cycling that activates the enzyme. Reverse transcription of nucleic acids is achieved by maintaining the RT-qPCR reaction mixture at a temperature at which the reverse transcriptase functions for a certain period of time. PCR may be a three-step PCR (denaturation / annealing / extension) or a two-step PCR (denaturation / annealing and extension). The appropriate step is performed depending on the enzyme contained in the reaction mixture.
[0080] Real-time quantification is preferably performed using a fluorescence monitoring method. PCR is repeated while monitoring the fluorescence intensity. When the fluorescence intensity reaches the threshold, it is determined to be positive (i.e., fungi are present in the sample). When the fluorescence intensity does not reach the threshold, it is determined to be negative (i.e., no fungi are present in the sample). The PCR threshold and the number of cycles are predetermined by preliminary experiments.
[0081] The qPCR reaction solution contains all the components necessary for the qPCR reaction. The RT-qPCR reaction solution contains all the components necessary for the RT-qPCR reaction. These components include nucleic acid samples prepared from the sample, primer sets, double-stranded DNA-binding fluorescent dyes or fluorescent dye-labeled probes, enzymes, and dNTPs.
[0082] [Samples and nucleic acid samples] Samples are derived from the objects to be tested for fungi. Examples of such objects include pharmaceuticals, quasi-drugs, cosmetics, active pharmaceutical ingredients, reagents, food, food ingredients, health foods, supplements, animal feed, drinking water, tap water, medical gases, medical components, medical devices, sanitary materials, biological samples, blood, and cultured cells. Examples of pharmaceuticals include small molecule drugs, medium molecule drugs (e.g., peptide drugs, nucleic acid drugs), biopharmaceuticals (e.g., antibody drugs), cell preparations, and gene preparations.
[0083] A typical example of a sample is a pharmaceutical product. The fungal testing method of this disclosure is suitable for the purpose of testing for fungi in pharmaceutical products with a short shelf life after manufacturing (e.g., cell preparations, gene preparations).
[0084] The method for preparing nucleic acid samples from a sample is not limited, and any known nucleic acid extraction and purification methods are applicable. If the sample is a liquid or suspension, a portion of the liquid or suspension is taken and nucleic acid is extracted. If the sample is a powder, for example, the powder is dissolved or suspended in sterile water and nucleic acid is extracted. If the sample is a solid, for example, the solid surface is washed with sterile water and nucleic acid is extracted from this washing solution. If the sample is a gas, for example, the gas is passed through a sterile filter, the filter is washed with sterile water, and nucleic acid is extracted from this washing solution.
[0085] When preparing nucleic acid samples from a sample, hydrolysis of the DNA contained in the nucleic acid sample may or may not be performed. DNA hydrolysis can be achieved by adding deoxyribonuclease (DNase) to the nucleic acid sample and incubating it.
[0086] When DNA in a nucleic acid sample is hydrolyzed, the 25S / 28S rDNA on the genomic DNA is not amplified by PCR. In this case, reverse transcription of the nucleic acid is necessary prior to PCR. In this configuration, the amplified product, which is reverse transcribed from 25S / 28S rRNA, is quantified in real time.
[0087] If the DNA in the nucleic acid sample is not hydrolyzed, reverse transcription of the nucleic acid may or may not be performed prior to PCR. In the former case, the amplification products of 25S / 28S rRNA and 25S / 28S rDNA are quantified in real time. In the latter case, the amplification product of 25S / 28S rDNA is quantified in real time.
[0088] When preparing nucleic acid samples from a sample, the sample may be treated with a cell-impermeable or cytodegradable nucleic acid crosslinking agent prior to lysis. Cell-impermeable nucleic acid crosslinking agents irreversibly crosslink nucleic acids (e.g., double-stranded DNA, double-stranded RNA, single-stranded DNAs, single-stranded RNAs) of dead bacteria (i.e., cells with damaged cell membranes). Cytodegradable nucleic acid crosslinking agents are indegradable by dead bacteria and therefore irreversibly crosslink nucleic acids (e.g., double-stranded DNA, double-stranded RNA, single-stranded DNAs, single-stranded RNAs) of dead bacteria. Both types of nucleic acid crosslinking agents inhibit the amplification of nucleic acids from dead bacteria. Therefore, treating the sample with a cell-impermeable or cytodegradable nucleic acid crosslinking agent before lysis can suppress false positives due to nucleic acids from dead bacteria in the fungal testing method of this disclosure. Examples of cell-impermeable or cell-degradable nucleic acid crosslinking agents include ethidium monoazide, propidium monoazide, and nucleic acid modification compounds disclosed in International Publication No. 2022 / 051405.
[0089] [Primer Set] A primer set consists of primer (1) and primer (2). Primer (1) acts as the forward primer, and primer (2) acts as the reverse primer. Primer (2) also serves as the reverse transfer primer.
[0090] Primer (1) is a primer having a 13-25 base sequence containing the sequence of Sequence ID No. 2, and / or a primer having a 10-25 base sequence containing a sequence in which 1-3 bases have been modified in the sequence of Sequence ID No. 2.
[0091] A base modification in the sequence of Sequence ID No. 2 means at least one selected from the group consisting of base substitution, deletion, addition, and insertion. A single base modification is a base substitution, deletion, addition, or insertion. A two-base or three-base modification is any combination of base substitution, deletion, addition, and insertion totaling two or three bases. Examples of two-base or three-base modifications include two-base or three-base substitution; two-base or three-base deletion; one-base deletion and one-base substitution; and so on.
[0092] The primer having a 13-25 base sequence including the sequence of Sequence ID No. 2 is preferably 14-22 bases, more preferably 15-20 bases, and even more preferably 15-19 bases. The sequences in the primer other than Sequence ID No. 2 preferably have 90% or more sequence identity with the sequences before and after Sequence ID No. 2 in Sequence ID No. 1, and more preferably 95% or more sequence identity.
[0093] A primer having a 10-25 base sequence that includes a sequence in which 1-3 bases have been modified in the sequence of Sequence ID No. 2 is preferably 13-25 bases, more preferably 14-22 bases, even more preferably 15-20 bases, and even more preferably 15-19 bases. The sequences in the primer other than Sequence ID No. 2 preferably have 90% or more sequence identity with the sequences before and after Sequence ID No. 2 in Sequence ID No. 1, and more preferably 95% or more sequence identity. The base modification in the sequence of Sequence ID No. 2 is preferably a modification of 1-3 bases among the three bases at the 5' or 3' end, and more preferably a substitution of 1-3 bases among the three bases at the 5' end. In other words, it is preferable that the 4th to 10th bases from the 5' end of the sequence of Sequence ID No. 2 are not modified.
[0094] The primer (1) preferably includes at least one selected from the group consisting of a primer having a sequence of 13 to 25 bases including the sequence of Sequence ID No. 2, and a primer having a sequence of 10 to 25 bases including a sequence in which 1 to 3 bases of the 3 bases at the 5' end of the sequence of Sequence ID No. 2 are substituted. The number of bases of the primer is preferably 13 to 25 bases, more preferably 14 to 22 bases, even more preferably 15 to 20 bases, and even more preferably 15 to 19 bases.
[0095] Primer (2) is a primer having the sequence of Sequence ID No. 3, and / or a primer having a sequence in which one to three bases are modified in the sequence of Sequence ID No. 3.
[0096] A base modification in the sequence of Sequence ID No. 3 means at least one selected from the group consisting of base substitution, deletion, addition, and insertion. A single base modification is a base substitution, deletion, addition, or insertion. A two-base or three-base modification is any combination of base substitution, deletion, addition, and insertion totaling two or three bases. Examples of two-base or three-base modifications include a two-base or three-base substitution; a one-base deletion and a one-base addition; and a three-base insertion.
[0097] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 3 is preferably 24 to 30 bases, more preferably 25 to 29 bases, and even more preferably 26 to 28 bases.
[0098] Primer (1) may be of the same type, or two or more types with different base sequences may be used in combination. Primer (2) may be of the same type, or two or more types with different base sequences may be used in combination.
[0099] In this disclosure, a mixture of primers with similar but not identical base sequences is referred to as "degenerate primers." The use of degenerate primers is preferable from the viewpoint of comprehensive fungal coverage.
[0100] When primer (1) is a degenerate primer, from the viewpoint of balancing fungal coverage and detection sensitivity, primer (1) is preferably a mixture of two to four types of primers, and more preferably a mixture of two or three types of primers. When primer (2) is a degenerate primer, from the viewpoint of balancing fungal coverage and detection sensitivity, primer (2) is preferably a mixture of two or three types of primers, and more preferably a mixture of two types of primers.
[0101] Primer (1) and / or primer (2) may have modifying groups introduced to adjust the strength of hydrogen bonds between complementary strands for the purpose of controlling the Tm value (the temperature at which 50% of the double-stranded DNA dissociates into single-stranded DNA). Examples of modifying groups introduced to primers to control the Tm value include the introduction of an amino group at the 2 position of adenine and the introduction of a methyl group at the 5 position of cytosine. In this disclosure, the introduction of modifying groups to primers to control the Tm value is not included in base substitution and base modification.
[0102] [Double-stranded DNA-binding fluorescent dye or fluorescent dye-labeled probe] Real-time quantification of PCR amplification products is preferably performed by a fluorescence monitoring method. The fluorescence monitoring method may be an intercalator method using a double-stranded DNA-binding fluorescent dye, or a probe method using a fluorescent dye-labeled probe.
[0103] An example of a double-stranded DNA-binding fluorescent dye is SYBR Green.
[0104] Examples of fluorescent dye-labeled probes include hydrolysis probes that emit fluorescence when hydrolyzed by a DNA extension reaction initiated by a primer; probes that emit fluorescence when their hairpin structure opens upon binding to a complementary strand; and probe sets in which two probes emit fluorescence when they bind to a complementary strand. These fluorescent dye-labeled probes are sequence-specific probes and are designed based on the base sequence of the nucleic acid to be quantified.
[0105] As a fluorescent dye-labeled probe, a fluorescent dye-labeled probe in which a fluorescent dye is bound to the probe (3) is preferred from the viewpoint of having excellent comprehensive coverage of fungi and detection sensitivity.
[0106] Probe (3) is a probe having a 10 to 30 base sequence including the sequence of Sequence ID No. 4, and / or a probe having a 10 to 30 base sequence including a sequence in which one or two bases have been modified in the sequence of Sequence ID No. 4.
[0107] A base modification in the sequence of Sequence ID No. 4 means at least one selected from the group consisting of base substitution, deletion, addition, and insertion. A single base modification is a base substitution, deletion, addition, or insertion. A double base modification is any combination of base substitution, deletion, addition, and insertion totaling two bases. Examples of double base modifications include double base substitution; double base deletion; single base substitution and single base deletion; and so on.
[0108] The probe having a 10- to 30-base sequence including the sequence of Sequence ID No. 4 is preferably 12 to 28 bases, more preferably 14 to 26 bases, and even more preferably 15 to 24 bases. The sequences in the probe other than Sequence ID No. 4 preferably have 90% or more sequence identity with the sequences before and after Sequence ID No. 4 in Sequence ID No. 1, and more preferably 95% or more sequence identity.
[0109] A probe having a 10 to 30-base sequence that includes a sequence in which one or two bases are modified in the sequence of Sequence ID No. 4 is preferably 12 to 28 bases, more preferably 14 to 26 bases, and even more preferably 15 to 24 bases. The sequences in the probe other than Sequence ID No. 4 preferably have 90% or more sequence identity with the sequences before and after Sequence ID No. 4 in Sequence ID No. 1, and more preferably 95% or more sequence identity. The modification of the bases in the sequence of Sequence ID No. 4 is preferably a modification of one or two bases of the two bases at the 5' or 3' end, and more preferably a deletion of one or two bases at the 5' end.
[0110] The probe (3) may be of the same type, or two or more probes with different base sequences may be used in combination.
[0111] In this disclosure, a mixture of probes with similar but not identical base sequences is referred to as a "degenerate probe." The use of a degenerate probe is preferable from the viewpoint of comprehensive fungal coverage. When probe (3) is a degenerate probe, from the viewpoint of balancing comprehensive fungal coverage and detection sensitivity, probe (3) is preferably a mixture of two to four types of probes, more preferably a mixture of two or three types of probes, and even more preferably a mixture of two types of probes.
[0112] The probe (3) may have a modifying group introduced to adjust the strength of the hydrogen bond between complementary chains for the purpose of controlling the Tm value. Examples of introducing a modifying group to the probe to control the Tm value include introducing an amino group to the 2-position of adenine and introducing a methyl group to the 5-position of cytosine. In this disclosure, the introduction of a modifying group to the probe to control the Tm value is not included in base substitution and base modification.
[0113] The following are examples of preferred combinations of primer (1), primer (2), and probe (3) used in the fungal testing method of this disclosure. A configuration in which primer (1) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 5 (GGAAACTCTGGGGAGGCT), a primer having the sequence of SEQ ID NO: 6 (TCTGGGGGAGGCTCG), a primer having the sequence of SEQ ID NO: 7 (TGTGGGGGAGGCTCCG), a primer having the sequence of SEQ ID NO: 8 (AGTGGGGGAGGCTCCG), and a primer having the sequence of SEQ ID NO: 9 (AGAGGGGGAGGCTCCG); primer (2) includes a primer having the sequence of SEQ ID NO: 3; and probe (3) includes a probe having the sequence of SEQ ID NO: 10 (GGTTCCCTGCGAAGT), and / or a probe having the sequence of SEQ ID NO: 11 (TGCCGAAGTTTCCCTCCAGGGATAGC).
[0114] From the viewpoint of balancing comprehensive fungal coverage and detection sensitivity, the above configuration is preferable in which the primer (1) includes two or three types of primers with different base sequences, and the probe (3) includes two types of probes with different base sequences.
[0115] [Enzymes] The qPCR reaction solution contains DNA polymerase. The RT-qPCR reaction solution contains reverse transcriptase and DNA polymerase. Reverse transcriptase and DNA polymerase may be separate enzymes, or an enzyme may possess both reverse transcriptase activity and DNA polymerase activity in a single enzyme. Examples of the latter include the DNA polymerase of the hyperthermophilic bacterium Thermus thermophilus, and DNA polymerases modified from said DNA polymerase.
[0116] One example of an enzyme embodiment is a hot-start PCR enzyme that has been inactivated by a neutralizing antibody.
[0117] [dNTPs] dNTPs (deoxynucleoside triphosphates) are a mixture of dATP (deoxyadenosine triphosphate), dCTP (deoxycytidine triphosphate), dGTP (deoxyguanosine triphosphate), and dTTP (deoxythymidine triphosphate). Generally, dNTPs are an equimolar mixture of dATP, dCTP, dGTP, and dTTP.
[0118] The concentrations of nucleic acid sample, primer set, double-stranded DNA-binding fluorescent dye, fluorescently labeled probe, enzyme, and dNTPs contained in the qPCR reaction solution or RT-qPCR reaction solution may be the same as those of a typical qPCR reaction solution or RT-qPCR reaction solution.
[0119] [Other components] The solvent and dispersion medium for the qPCR reaction solution and RT-qPCR reaction solution are water. The qPCR reaction solution and RT-qPCR reaction solution contain stabilizers for each component, divalent cations (e.g., Mg 2+ Mn 2+ ), may contain pH adjusters, pH buffers, etc. The pH of the qPCR reaction solution and the RT-qPCR reaction solution is preferably in the range of 8.0 to 8.2.
[0120] The type of pH buffer contained in the qPCR reaction solution and the RT-qPCR reaction solution is not limited. Examples of pH buffers include Good's buffers. Preferred Good's buffers have an optimal pH range in the alkaline range, and examples include Tricinene, Bicinene, TAPS, TAPSO, EPPS, HEPPSO, and POPSO. pH adjustment is preferably performed with sodium hydroxide or potassium hydroxide.
[0121] This disclosure further provides a reagent set suitable for fungal testing ("Fungal Testing Reagent Set") and a reagent set suitable for bacterial and fungal testing ("Bacterial and Fungal Testing Reagent Set"). The Fungal Testing Reagent Set, the Bacterial and Fungal Testing Method, and the Bacterial and Fungal Testing Reagent Set will be described in order below.
[0122] <Reagent Set for Fungal Testing> The reagent set for fungal testing described herein is a reagent set for preparing a qPCR reaction solution or an RT-qPCR reaction solution to be used in the fungal testing method described herein.
[0123] The fungal test reagent set described herein includes at least a primer set and a fluorescently labeled probe. The primer set and the fluorescently labeled probe are housed in separate containers. A set of reagents housed in these separate containers constitutes a reagent set.
[0124] [Primer Set] The form of the primer set is as described above in the description of the fungal testing method in this disclosure, and the preferred form is also as described above.
[0125] The primers (1) and (2) that make up the primer set may be housed in separate containers, or they may be housed together in a single container. The primers may be housed in a container in a form dissolved or dispersed in a buffer solution, for example.
[0126] [Fluorescent dye-labeled probe] The morphology of the fluorescent dye-labeled probe is as described above in the description of the fungal testing method of this disclosure, and the preferred morphology is also as described above.
[0127] Fluorescent dye-labeled probes are, for example, contained in light-shielding containers in a form dissolved or dispersed in a buffer solution.
[0128] [Other Reagents] The fungal test reagent set of this disclosure may further contain enzymes. The enzymes are housed in a separate container from the primer set and the fluorescent dye-labeled probes.
[0129] The form of the enzyme is as previously described in the description of the fungal testing method of this disclosure, and the preferred form is also as previously described. The enzyme is contained in a container, for example, dissolved or dispersed in 50% (v / v) glycerol / buffer solution.
[0130] The fungal test reagent set disclosed herein may include all the reagents necessary for fungal testing. The fungal test reagent set disclosed herein may also include the instruments used for fungal testing.
[0131] The fungal test reagent set of this disclosure is preferably distributed in a form that preserves the functionality of the primer and fluorescent dye-labeled probe, for example, in a light-shielded form.
[0132] <Bacterial and Fungal Testing Method> The bacterial and fungal testing method disclosed herein is a method for simultaneously testing for the presence or absence of bacteria and fungi in a sample by multiplex PCR targeting conserved sequences in bacterial 23S rRNA and conserved sequences in fungal 25S / 28S rRNA.
[0133] Bacterial ribosomes contain 23S rRNA (23S ribosomal RNA) in their large subunits. The gene that encodes 23S rRNA on the bacterial genomic DNA is called 23S rDNA (23S ribosomal DNA).
[0134] The conserved sequences within bacterial 23S rRNA may be known conserved sequences or newly discovered conserved sequences. For example, the base sequences of 23S rDNA from multiple bacterial species can be obtained from existing databases, sequence analysis can be performed, and newly discovered conserved sequences can be identified. Examples of bacteria to be analyzed include those listed in ISO 24190:2023 "Biotechnology — Analytical methods — Risk-based approaches for the selection and validation of methods for rapid microbial detection in bioprocesses."
[0135] The bacterial and fungal testing methods described herein include both forms in which nucleic acid reverse transcription is performed prior to PCR, and forms in which nucleic acid reverse transcription is not performed. In the former form, the rRNA reverse transcript and rDNA can be amplified by PCR. In the latter form, rDNA can be amplified by PCR.
[0136] The bacterial and fungal testing method described herein includes PCR using the first and second primer sets described below. This PCR is a so-called multiplex PCR because it uses multiple types of primer sets together.
[0137] First primer set: A primer set consisting of forward primers and reverse primers for amplifying conserved sequences in bacterial 23S rRNA.
[0138] Second primer set: A primer set consisting of primer (1) and primer (2) for amplifying conserved sequences in fungal 25S / 28S rRNA. The morphologies of primer (1) and primer (2) are as previously described in the description of the fungal testing method of this disclosure, and the preferred morphologies are also as previously described.
[0139] The bacterial and fungal testing method disclosed herein quantifies PCR amplification products, for example, by electrophoresis or fluorescence measurement. Preferably, the bacterial and fungal testing method disclosed herein includes real-time quantification of PCR amplification products by a fluorescence monitoring method. The fluorescence monitoring method may be either an intercalator method using a double-stranded DNA-binding fluorescent dye or a probe method using a fluorescent dye-labeled probe.
[0140] From the viewpoint of superior comprehensiveness and detection sensitivity of bacteria and fungi, the bacterial and fungal testing method disclosed herein preferably performs real-time quantification using a probe method with the first and second probes described below.
[0141] First probe: A fluorescently labeled probe for detecting conserved sequences within bacterial 23S rRNA. The first probe is a sequence-specific probe that binds to the DNA amplified by the first primer set.
[0142] Second probe: A fluorescently labeled probe, to which a fluorescent dye is conjugated, for detecting conserved sequences in fungal 25S / 28S rRNA. The morphology of probe (3) and the fluorescently labeled probe are as previously described in the description of the fungal testing method of this disclosure, and the preferred morphology is also as previously described.
[0143] The first primer set and the first probe may be commercially available products, or they may be newly designed and manufactured primer sets and probes.
[0144] Preferably, the fluorescent dyes of the first probe and the second probe have the same principle of controlling fluorescence emission. The fluorescent dyes of the first probe and the second probe may be the same or different. If the fluorescent dyes of the first probe and the second probe are different, bacteria and fungi can be detected separately.
[0145] An example of an embodiment of the bacterial and fungal testing method of this disclosure is realized by performing the following steps (11) and (12).
[0146] Step (11): Preparation of qPCR reaction solution or RT-qPCR reaction solution. Step (12): PCR and real-time quantification, or reverse transcription, PCR and real-time quantification.
[0147] The bacterial and fungal testing methods disclosed herein include both forms in which nucleic acid reverse transcription is performed prior to PCR, and forms in which nucleic acid reverse transcription is not performed. In the former form, a qPCR reaction solution is prepared, and PCR and real-time quantification are performed. In the latter form, an RT-qPCR reaction solution is prepared, and reverse transcription, PCR, and real-time quantification are performed.
[0148] The forms of processes (11) and (12) are the same as those of processes (1) and (2) described above.
[0149] The qPCR reaction solution contains all the components necessary for the qPCR reaction. The RT-qPCR reaction solution contains all the components necessary for the RT-qPCR reaction. These components include a nucleic acid sample prepared from the sample, a primer set (first primer set and second primer set), a double-stranded DNA-binding fluorescent dye or a fluorescent dye-labeled probe (first probe and second probe), an enzyme, and dNTPs. The form of each of the above components is as previously described in the description of the fungal testing method of this disclosure, and the preferred form is also as previously described.
[0150] <Reagent Set for Bacterial and Fungal Testing> The reagent set for bacterial and fungal testing disclosed herein is a reagent set for preparing a qPCR reaction solution or an RT-qPCR reaction solution to be used in the bacterial and fungal testing method disclosed herein. The reagent set for bacterial and fungal testing disclosed herein is a reagent set for simultaneously testing for the presence or absence of bacteria and fungi in a sample.
[0151] The bacterial and fungal test reagent set disclosed herein comprises at least a first primer set, a first fluorescent dye-labeled probe, a second primer set, and a second fluorescent dye-labeled probe. The above four components are housed in separate containers. A set of reagents housed in each of these containers constitutes a reagent set.
[0152] The bacterial and fungal test reagent set disclosed herein may further contain enzymes. The enzymes are housed in a separate container from the four reagents described above.
[0153] The bacterial and fungal testing reagent set disclosed herein may include all the reagents necessary for bacterial and fungal testing. The bacterial and fungal testing reagent set disclosed herein may also include the instruments used for bacterial and fungal testing.
[0154] The forms of each of the reagents described above are as previously stated in the description of the fungal test reagent set of this disclosure, and the preferred forms are also as previously stated.
[0155] The following are examples of preferred combinations of primers (1), primers (2), and probes (3) that constitute the fungal test reagent set, bacterial and fungal test reagent set, and bacterial and fungal test method of this disclosure. Primer (1) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 5, a primer having the sequence of SEQ ID NO: 6, a primer having the sequence of SEQ ID NO: 7, a primer having the sequence of SEQ ID NO: 8, and a primer having the sequence of SEQ ID NO: 9; Primer (2) includes a primer having the sequence of SEQ ID NO: 3; and Probe (3) includes a probe having the sequence of SEQ ID NO: 10, and / or a probe having the sequence of SEQ ID NO: 11.
[0156] From the viewpoint of balancing comprehensive fungal coverage and detection sensitivity, the above configuration is preferable in which the primer (1) includes two or three types of primers with different base sequences, and the probe (3) includes two types of probes with different base sequences.
[0157] The fungal testing method and bacterial / fungal testing method of this disclosure will be explained below with reference to examples. The materials, amounts used, concentrations, processing procedures, etc., shown in the following examples can be modified as appropriate, as long as they do not deviate from the spirit of this disclosure. Therefore, the scope of the fungal testing method and bacterial / fungal testing method of this disclosure should not be interpreted as being limited by the specific examples shown below.
[0158] <Example 1> Three types of fungi and 21 types of bacteria shown in Table 11 were cultured. These fungi and bacteria are listed in ISO 24190:2023 "Biotechnology — Analytical methods — Risk-based approaches for the selection and validation of methods for rapid microbial detection in bioprocesses".
[0159]
[0160] The culture medium of each bacterium was ultracentrifuged to concentrate the bacteria. The bacteria were suspended in a buffer solution, and cell wall-degrading enzymes and proteolytic enzymes were added. Next, nucleic acid extraction was performed using the Boom method, during which DNA was hydrolyzed with DNase I. The extracted RNA was washed and concentrated to obtain RNA samples.
[0161] The RT-qPCR reaction solutions shown in Table 12 were prepared. The primer-probe set for fungi is Primer-Probe Set No. 3-1, as described in Tables 3, 7, and 9. The primer-probe set for bacteria is a primer-probe set for amplifying and detecting conserved sequences in bacterial 23S rRNA. The base sequences of the primers and probes are shown in Table 13. The probe is a fluorescently labeled probe with the fluorescent dye FAM bound to its 5' end and the quencher BHQ1 bound to its 3' end. The templates were RNA samples extracted from three types of fungi and 21 types of bacteria, respectively.
[0162]
[0163]
[0164] The bacterial primer-probe set consists of three degenerate forward primers and two degenerate reverse primers. The bases that differ from the first forward primer and the first reverse primer are underlined.
[0165] Equivalent results can be expected even if the reverse primer and / or probe of the bacterial primer and / or probe set shown in Table 13 is replaced with the reverse primer and / or probe shown in Table 14.
[0166]
[0167] The following is an example of a consensus sequence of a conserved sequence within bacterial 23S rRNA.
[0168] SEQ ID NO: 41: CATCGCTCCAACGGATAAAAGGTACNCCCGGGGATAACAGGCTGATCTCGCCCAAGAGTTCATATCGACGGCGGGGTTTGGCACCTCGATGTCGGCT CATCGCATCCTGGGGCTGAAGTNGGTCCCAAGGGTTNGGCTGTTCGCCNATTAAAGCGGTACGCGAGCTGGGTTCAGAACGTCGTGAGACAGTTCGGTCCCCTAT
[0169] Sequence ID 41 corresponds to the region from 2800 bp to 2999 bp in the consensus sequence (total base count 3305 bp) obtained by aligning the 23S rDNA of 21 bacterial species shown in Table 11. The underlined portions of Sequence ID 41 correspond to the sequence of Sequence ID 29, Sequence ID 34, and the complementary sequence of Sequence ID 32, respectively.
[0170] The consensus sequence related to bacterial 23S rRNA may differ from SEQ ID NO: 41 depending on the algorithm for alignment, the database for obtaining the nucleotide sequence of bacterial 23S rDNA, and the number of bacterial species from which the nucleotide sequence is obtained. Examples of the consensus sequence related to bacterial 23S rRNA include an example having 90% or more sequence identity with SEQ ID NO: 41, or an example having 95% or more sequence identity with SEQ ID NO: 41.
[0171] Using the RT-qPCR reaction solution shown in Table 12, RT-qPCR was performed in the following cycle. <1> 90°C / 30 seconds <2> 60°C / 5 minutes <3> 95°C / 1 minute <4> 95°C / 10 seconds <5> 60°C / 25 seconds... fluorescence detection <4> - <5> was repeated 45 times
[0172] The concentration of the template was diluted to 7 levels (5.0×10 6 copies, 5.0×10 5 copies, 5.0×10 4 copies, 5.0×10 3 copies, 5.0×10 2 copies, 5.0×10 1 copies, 5.0×10 0 copies) and RT-qPCR was performed. The amplification curves of RT-qPCR for each bacterium are shown in FIGS. 3 to 10. As is clear from FIGS. 3 to 10, the primer / probe sets for fungi and the primer / probe sets for bacteria had a detection output for 50 copies each of 3 types of fungi and 21 types of bacteria.
[0173] Based on Experiments 1 to 5 and Example 1, the present disclosure provides the following reagent set
[101] (that is, a reagent set for bacterial and fungal tests), and bacterial and fungal test methods
[102] and
[103] .
[0174]
[101] A reagent set comprising: a primer set consisting of primer (4) and primer (5) for amplifying a conserved sequence in bacterial 23S rRNA; a fluorescent dye-labeled probe having a fluorescent dye bound to a probe (6) for detecting a conserved sequence in bacterial 23S rRNA; a primer set consisting of primer (1) and primer (2) for amplifying a conserved sequence in fungal 25S / 28S rRNA; and a fluorescent dye-labeled probe having a fluorescent dye bound to a probe (3) for detecting a conserved sequence in fungal 25S / 28S rRNA.
[0175]
[102] A method for simultaneously testing for the presence of bacteria and fungi in a sample, comprising amplifying conserved sequences in bacterial 23S rRNA and fungal 25S / 28S rRNA by PCR using a primer set consisting of primer (4) and primer (5) and a primer set consisting of primer (1) and primer (2).
[0176]
[103] The bacterial and fungal testing method according to
[102] , further comprising quantifying the PCR amplification product using a fluorescent dye-labeled probe in which a fluorescent dye is bound to probe (6) and a fluorescent dye-labeled probe in which a fluorescent dye is bound to probe (3).
[0177] Primer (4): A primer having the sequence of Sequence ID No. 29 (CATCGCTCAACGGGATAAAAAG), and / or a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No. 29. Primer (5): At least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 32 (ATAGGGACCGAACTGTTCTCAC), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 32, a primer having the sequence of SEQ ID NO: 35 (GGACCGAACTGTTCTCACGAACGTCT), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 35, a primer having the sequence of SEQ ID NO: 36 (GATAGGGGACCGAACTGTTCTCACGAACG), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 37 (ACGTTCTGAGACCCAGCTCGCGT), and a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 37. Probe (6): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 34 (TTTGGCACACCTCGATGTCGGC), a probe having a sequence in which one base is modified from the sequence of SEQ ID NO: 34, a probe having the sequence of SEQ ID NO: 38 (TTTGGCACACCTCGATGTCGGCTC), a probe having a sequence in which one base is modified from the sequence of SEQ ID NO: 38, a probe having the sequence of SEQ ID NO: 39 (TGGCACACCTCGATGTCGGG), a probe having a sequence in which one base is modified from the sequence of SEQ ID NO: 39, a probe having the sequence of SEQ ID NO: 40 (CACCTCCGATGTCGGC), and a probe having a sequence in which one base is modified from the sequence of SEQ ID NO: 40. Primer (1): A primer having a sequence of 13 to 25 bases including the sequence of SEQ ID NO: 2, and / or a primer having a sequence of 10 to 25 bases including a sequence in which one to three bases are modified from the sequence of SEQ ID NO: 2. Primer (2): A primer having the sequence of Sequence ID No. 3, and / or a primer having a sequence in which one to three bases are modified in the sequence of Sequence ID No. 3.Probe (3): A probe having a 10- to 30-base sequence containing the sequence of Sequence ID No. 4, and / or a probe having a 10- to 30-base sequence containing a sequence in which one or two bases are modified in the sequence of Sequence ID No. 4. Primer (5) also serves as a reverse transcription primer. Primer (2) also serves as a reverse transcription primer.
[0178] Modification of bases in the sequences of SEQ ID NO: 29, 32, 35, 36, 37, 34, 38, 39, and 40 means at least one selected from the group consisting of base substitution, deletion, addition, and insertion.
[0179] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 29 is preferably 18 to 23 bases, more preferably 19 to 22 bases, and even more preferably 20 to 21 bases.
[0180] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 32 is preferably 18 to 24 bases, more preferably 19 to 23 bases, and even more preferably 20 to 23 bases.
[0181] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 35 is preferably 20 to 30 bases, more preferably 21 to 29 bases, and even more preferably 22 to 27 bases.
[0182] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 36 is preferably 20 to 30 bases, more preferably 22 to 28 bases, and even more preferably 23 to 26 bases.
[0183] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 37 is preferably 18 to 23 bases, more preferably 19 to 23 bases, and even more preferably 20 to 22 bases.
[0184] The following are examples of preferred combinations of primers (4), primer (5), probe (6), primer (1), primer (2), and probe (3) that constitute the reagent set
[101] and the bacterial and fungal testing methods
[102] and
[103] .
[0185] A configuration in which primer (4) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 29, a primer having the sequence of SEQ ID NO: 30, and a primer having the sequence of SEQ ID NO: 31; primer (5) includes a primer having the sequence of SEQ ID NO: 32, and / or a primer having the sequence of SEQ ID NO: 33; probe (6) includes a probe having the sequence of SEQ ID NO: 34; primer (1) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 5, a primer having the sequence of SEQ ID NO: 6, a primer having the sequence of SEQ ID NO: 7, a primer having the sequence of SEQ ID NO: 8, and a primer having the sequence of SEQ ID NO: 9; primer (2) includes a primer having the sequence of SEQ ID NO: 3; and probe (3) includes a probe having the sequence of SEQ ID NO: 10, and / or a probe having the sequence of SEQ ID NO: 11.
[0186] From the viewpoint of balancing comprehensive bacterial and fungal coverage with detection sensitivity, the above configuration is preferable in which primer (4) includes two or three types of primers with different base sequences, primer (5) includes two types of primers with different base sequences, primer (1) includes two or three types of primers with different base sequences, and probe (3) includes two types of probes with different base sequences.
[0187] The bacterial and fungal testing reagent set
[101] of this disclosure is preferably a combination of the bacterial primer / probe set and the fungal primer / probe set shown in Table 15, from the viewpoint of balancing comprehensive coverage of bacteria and fungi with detection sensitivity. The bacterial and fungal testing method
[103] of this disclosure is preferably a combination of the bacterial primer / probe set and the fungal primer / probe set shown in Table 15, from the viewpoint of balancing comprehensive coverage of bacteria and fungi with detection sensitivity.
[0188]
[0189] <Example 2> The bacterium Bacillus subtilis and the fungus Aspergillus brasiliensis were co-cultured in the same container. The bacteria were cultured in 1 ml of 110 CFU / ml for 3 hours, and the fungus was cultured in 1 ml of 9 CFU / ml for 3 hours. The culture medium was ultracentrifuged to concentrate the bacteria. The bacteria were suspended in buffer, and cell wall-degrading enzymes and proteolytic enzymes were added. Next, nucleic acid extraction was performed by the Boom method, during which DNA was hydrolyzed with DNase I. The extracted RNA was washed and concentrated to obtain an RNA sample.
[0190] The RT-qPCR reaction solutions shown in Table 16 were prepared. The bacterial primer-probe set was Bacterial Primer-Probe Set No. 5, as described in Table 15. The bacterial probe was a fluorescently labeled probe with the fluorescent dye FAM bound to its 5' end and the quencher BHQ1 bound to its 3' end. The fungal primer-probe set was Fungal Primer-Probe Set No. 7, as described in Table 15. The fungal probe was a fluorescently labeled probe with the fluorescent dye Cy5 bound to its 5' end and the quencher BHQ3 bound to its 3' end. The template was a mixture of RNA samples extracted from the bacterium Bacillus subtilis and RNA samples extracted from the fungus Aspergillus brasiliensis.
[0191]
[0192] RT-qPCR was performed using the RT-qPCR reaction mixture shown in Table 16, following the cycle below: <1> 90°C / 30 sec <2> 60°C / 5 sec <3> 95°C / 1 sec <4> 95°C / 10 sec <5> 60°C / 25 sec...fluorescence detection Repeat <4>-<5> 45 times
[0193] RT-qPCR was performed 16 times using the same sample. The Ct values of RT-qPCR are shown in Table 17, and the amplification curves of RT-qPCR are shown in Figure 11. As is clear from Table 17 and Figure 11, it was shown that simultaneous detection of the bacterium Bacillus subtilis and the fungus Aspergillus brasiliensis is possible with the primer-probe set combinations shown in Table 15.
[0194]
[0195] <Example 3> The bacterium Staphylococcus aureus and the fungus Candida albicans were co-cultured in the same container. The bacteria were cultured at 1 ml of 9 CFU / ml for 3 hours, and the fungus was cultured at 1 ml of 110 CFU / ml for 3 hours. RNA samples were obtained from the culture medium using the same procedure as in Example 2.
[0196] The RT-qPCR reaction solutions shown in Table 16 were prepared. The bacterial primer-probe sets and fungal primer-probe sets were the same as those used in Example 2. The template was a mixture of RNA samples extracted from the bacterium Staphylococcus aureus and RNA samples extracted from the fungus Candida albicans.
[0197] RT-qPCR was performed using the RT-qPCR reaction mixture shown in Table 16, following the cycle below: <1> 90°C / 30 sec <2> 60°C / 5 sec <3> 95°C / 1 sec <4> 95°C / 10 sec <5> 60°C / 25 sec...fluorescence detection Repeat <4>-<5> 45 times
[0198] Sixteen RT-qPCR tests were performed using the same sample. The Ct values for RT-qPCR are shown in Table 18, and the amplification curves for RT-qPCR are shown in Figure 12. As is clear from Table 18 and Figure 12, the combination of primer-probe sets shown in Table 15 demonstrated that simultaneous detection of the bacterium Staphylococcus aureus and the fungus Candida albicans is possible.
[0199]
[0200] <Example 4: Fungal testing (or bacterial / fungal testing) of cell preparations> [Preparation of nucleic acid samples] Cell preparations are autologous cell preparations for cancer treatment, manufactured, for example, by introducing specific genes into T cells collected from the blood of cancer patients.
[0201] A portion of the cell preparation is collected, and the cells are separated by centrifugation, or by filter filtration that allows bacteria and fungi to pass through. After separating the cells, ultracentrifugation may be performed to concentrate the bacteria and fungi. The recovered bacteria and fungi are suspended in a buffer solution to obtain a suspension.
[0202] A cell-impermeable or cytodegradable DNA crosslinking agent is added to the suspension to irreversibly crosslink the genomic DNA of the dead bacteria. The suspension is washed with buffer and resuspended in buffer.
[0203] Cell wall-degrading enzymes are added to the suspension to degrade the cell walls of bacteria and fungi. Next, proteolytic enzymes are added to the suspension to degrade the proteins contained in the suspension. Then, nucleic acid extraction is performed using the Boom method. DNA may be hydrolyzed with DNase I during this process. The extracted nucleic acids are washed and concentrated to obtain a nucleic acid sample.
[0204] [RT-qPCR (or Multiplex RT-qPCR)] A fungus-specific primer set (i.e., a primer set consisting of primer (1) and primer (2)), a fungus-specific fluorescent dye-labeled probe (i.e., a fluorescent dye-labeled probe to which a fluorescent dye is bound, probe (3)), dNTPs, reverse transcriptase, and DNA polymerase are added to the nucleic acid sample to prepare an RT-qPCR reaction mixture. RT-qPCR is then performed using this RT-qPCR reaction mixture.
[0205] Multiplex RT-qPCR may be performed by adding a bacterial-specific primer set and a bacterial-specific fluorescent dye-labeled probe for amplifying and detecting conserved sequences within bacterial 23S rRNA to the above RT-qPCR reaction mixture. The fluorescent dyes of the bacterial-specific probe and the fungus-specific probe may be the same or different. If the fluorescent dyes of the bacterial-specific probe and the fungus-specific probe are different, bacteria and fungi can be detected separately.
[0206] Real-time quantification is performed using a fluorescence monitoring method. PCR is repeated a predetermined number of times while monitoring the fluorescence intensity. When the fluorescence intensity reaches the threshold, it is determined to be positive (i.e., the cell preparation is contaminated with fungi and / or bacteria). When the fluorescence intensity does not reach the threshold, it is determined to be negative (i.e., the cell preparation is not contaminated with fungi and / or bacteria). The PCR threshold and the number of cycles are predetermined by preliminary experiments.
[0207] By automating the preparation of nucleic acid samples and RT-qPCR (or multiplex RT-qPCR), it is possible to perform fungal testing (or bacterial / fungal testing) of cell preparations in a sterile room without human intervention.
[0208] All documents, patent applications, and technical standards described herein are incorporated by reference to the same extent as if each individual document, patent application, and technical standard were specifically and individually noted to be incorporated by reference.
[0209] The disclosure of Japanese application number 2024-171187, filed on 30 September 2024, is incorporated herein by reference in its entirety.
Claims
1. A method for testing for the presence or absence of fungi in a sample, comprising amplifying a conserved sequence in fungal 25S / 28S rRNA by PCR using a primer set consisting of the following primers (1) and (2): Primer (1): A primer having a 13-25 base sequence including the sequence of Sequence ID No. 2 (TCTGGGTGGAGGCT), and / or a primer having a 10-25 base sequence including a sequence in which 1-3 bases have been modified from the sequence of Sequence ID No. 2; Primer (2): A primer having the sequence of Sequence ID No. 3 (CTTCTTTACATATTTTAAAAGTTTGAGAAT), and / or a primer having a sequence in which 1-3 bases have been modified from the sequence of Sequence ID No.
3.
2. The fungal testing method according to claim 1, further comprising quantifying the amplification product of the PCR using a fluorescent dye-labeled probe to which a fluorescent dye is bound; Probe (3): A probe having a sequence of 10 to 30 bases including the sequence of Sequence ID No. 4 (TGCCGAAGT), and / or a probe having a sequence of 10 to 30 bases including a sequence in which one or two bases are modified in the sequence of Sequence ID No.
4.
3. The fungal testing method according to claim 1 or claim 2, wherein the consensus sequence of the conserved sequence in the fungal 25S / 28S rRNA is Sequence ID No. 1 or has 90% or more sequence identity with Sequence ID No.
1.
4. A primer set consisting of the following primers (1) and (2) for amplifying conserved sequences in fungal 25S / 28S rRNA: Primer (1): A primer having a 13-25 nucleotide sequence including the sequence of Sequence ID No. 2 (TCTGGGTGGAGGCT), and / or a primer having a 10-25 nucleotide sequence including a sequence in which 1-3 nucleotides have been modified from the sequence of Sequence ID No. 2; Primer (2): A primer having the sequence of Sequence ID No. 3 (CTTCTTTACATATTTTAAAAGTTTGAGAAT), and / or a primer having a sequence in which 1-3 nucleotides have been modified from the sequence of Sequence ID No.
3.
5. The primer set according to claim 4, wherein the primer (1) includes a primer having a 13- to 25-base sequence containing the sequence of Sequence ID No. 2 (TCTGTGGGAGGCT), and / or a primer having a 10- to 25-base sequence containing a sequence in which one to three of the three bases at the 5' end of the Sequence ID No. 2 sequence are substituted.
6. A reagent set comprising: a primer set according to claim 4 or claim 5; and a fluorescently labeled probe having a fluorescent dye bound to the following probe (3) for detecting a conserved sequence in fungal 25S / 28S rRNA; Probe (3): A probe having a 10 to 30 base sequence including the sequence of Sequence ID No. 4 (TGCCGAAGT), and / or a probe having a 10 to 30 base sequence including a sequence in which one or two bases are modified in the sequence of Sequence ID No.
4.
7. The primer (1) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 5 (GGAAACTCTGGGGAGAGCT), a primer having the sequence of SEQ ID NO: 6 (TCTGGGGGAGGCTCCG), a primer having the sequence of SEQ ID NO: 7 (TGTGGGGGAGGCTCCG), a primer having the sequence of SEQ ID NO: 8 (AGTGGGGGAGGCTCCG), and a primer having the sequence of SEQ ID NO: 9 (AGAGGGGGAGGCTCCG), and the primer (2) includes a primer having the sequence of SEQ ID NO: 3 (CTTCTTTACATATTTAAAGTTTGAGAAT), The reagent set according to claim 6, wherein the probe (3) includes a probe having the sequence of sequence number 10 (GGTTCCCTGCGAAGT) and / or a probe having the sequence of sequence number 11 (TGCCGAAGTTTCCCTCAGGATAGC).
8. The reagent set according to claim 7, wherein the primer (1) comprises two or three types of primers with different base sequences, and the probe (3) comprises two types of probes with different base sequences.
9. A reagent set according to claim 6, further comprising: a primer set consisting of the following primers (4) and (5) for amplifying a conserved sequence in bacterial 23S rRNA; and a fluorescent dye-labeled probe, to which a fluorescent dye is conjugated, for detecting a conserved sequence in bacterial 23S rRNA; Primer (4): A primer having the sequence of Sequence ID No. 29 (CATCGCTCAACGGGATAAAAAG), and / or a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No.
29. Primer (5): At least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 32 (ATAGGGACCGAACTGTCTTCAC), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 32, a primer having the sequence of SEQ ID NO: 35 (GGACCGAACTGTCTCACGACGTCT), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 35, a primer having the sequence of SEQ ID NO: 36 (GATAGGGGACCGAACTGTCTCACGACG), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 37 (ACGTTCTGAGACCCAGCTCGCGT), and a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO:
37. Probe (6): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 34 (TTTGGCACACCTCGATGTCGGC), a probe having a sequence in which one nucleotide is modified from the sequence of SEQ ID NO: 34, a probe having the sequence of SEQ ID NO: 38 (TTTGGCACACCTCGATGTCGGCTC), a probe having a sequence in which one nucleotide is modified from the sequence of SEQ ID NO: 38, a probe having the sequence of SEQ ID NO: 39 (TGGCACACCTCGATGTCGGG), a probe having a sequence in which one nucleotide is modified from the sequence of SEQ ID NO: 39, a probe having the sequence of SEQ ID NO: 40 (CACCTCGATGTCGGC), and a probe having a sequence in which one nucleotide is modified from the sequence of SEQ ID NO:
40.
10. A method for simultaneously testing for the presence of bacteria and fungi in a sample, comprising: amplification of conserved sequences in bacterial 23S rRNA and fungal 25S / 28S rRNA by PCR using a primer set consisting of the following primers (4) and (5) and a primer set consisting of the following primers (1) and (2); Primer (4): A primer having the sequence of Sequence ID No. 29 (CATCGCTCAACGGGATAAAAAG), and / or a primer having a sequence in which 1 to 3 bases have been modified in the sequence of Sequence ID No. 29; Primer (5): At least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 32 (ATAGGGACCGAACTGTCTTCAC), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 32, a primer having the sequence of SEQ ID NO: 35 (GGACCGAACTGTCTCACGACGTCT), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 35, a primer having the sequence of SEQ ID NO: 36 (GATAGGGGACCGAACTGTCTCACGACG), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 37 (ACGTTCTGAGACCCAGCTCGCGT), and a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO:
37. Primer (1): A primer having a 13-25 base sequence including the sequence of SEQ ID NO: 2 (TCTGGGTGGAGGCT), and / or a primer having a 10-25 base sequence including a sequence in which 1-3 bases have been modified from the sequence of SEQ ID NO:
2. Primer (2): A primer having the sequence of SEQ ID NO: 3 (CTTCTTTACATATTTTAAAAGTTTGAGAAT), and / or a primer having a sequence in which 1-3 bases have been modified from the sequence of SEQ ID NO:
3.
11. The bacterial and fungal testing method according to claim 10, further comprising quantifying the amplification product of the PCR using a fluorescent dye-labeled probe to which a fluorescent dye is bound to the probe (6) below and a fluorescent dye-labeled probe to which a fluorescent dye is bound to the probe (3) below; Probe (6): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 34 (TTTGGCACACCTCGATGTCGGC), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 34, a probe having the sequence of SEQ ID NO: 38 (TTTGGCACACCTCGATGTCGGCTC), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 38, a probe having the sequence of SEQ ID NO: 39 (TGGCACACCTCGATGTCGGG), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 39, a probe having the sequence of SEQ ID NO: 40 (CACCTCGATGTCGGC), and a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 40 Probe (3): A probe having a 10 to 30 base sequence including the sequence of Sequence ID No. 4 (TGCCGAAGT), and / or a probe having a 10 to 30 base sequence including a sequence in which one or two bases are modified in the sequence of Sequence ID No. 4.
Citation Information
Patent Citations
Detection of eumycetes
JP2004201641A
Probe set, probe carrier and method for discriminating and identifying fungus
JP2008278871A
Pathogen inactivation assay
US20040170954A1
Real-time polymerase chain reaction using large target amplicons
US20040170981A1