SCN2a-targeted oligomeric compounds, compositions and uses

Oligomeric compounds targeting SCN2A gene expression provide a treatment for rare diseases like SCN2A-associated autism and epilepsy, effectively reducing symptoms through selective gene expression reduction.

WO2026072149A1PCT designated stage Publication Date: 2026-04-02N-LOREM FOUNDATION
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-08-04
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

There are limited treatment options for rare diseases associated with SCN2A gene variants, such as SCN2A-associated medical conditions like epilepsy and autism, which affect millions globally but are often excluded from drug development due to their rarity.

Method used

Development of oligomeric compounds, particularly modified oligonucleotides, that can selectively reduce SCN2A expression and are used in compositions for treating conditions like SCN2A-associated autism and epileptic encephalopathy.

Benefits of technology

The oligomeric compounds effectively reduce SCN2A expression, providing therapeutic benefits for conditions like SCN2A-associated autism and epileptic encephalopathy, improving seizure frequency and behavioral symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025040466_02042026_PF_FP_ABST
    Figure US2025040466_02042026_PF_FP_ABST
Patent Text Reader

Abstract

The technology relates in part to oligomeric compounds that can reduce SCN2A expression, and that can selectively reduce expression of a SCN2A allele expression product for example. The technology also relates in part to uses of the oligomeric compounds, including treatment of a SCN2A-associated medical condition. The technology also relates in part to uses that include determining presence or absence of a differentiating variation site and / or pathogenic genetic variant in a SCN2A nucleic acid.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] SCN2A-TARGETED OLIGOMERIC COMPOUNDS, COMPOSITIONS AND USES RELATED APPLICATIONS This Patent Convention Treaty (PCT) International Application claims the benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application Serial No. (USSN) 63 / 700,165, filed September 27, 2024, and USSN 63 / 718,001, November 08, 2024. The aforementioned applications are expressly incorporated herein by reference in their entirety and for all purposes. All publications, patents, patent applications cited herein are hereby expressly incorporated by reference for all purposes. TECHNICAL FIELD The technology relates in part to oligomeric compounds that can reduce SCN2A expression, and that can selectively reduce expression of a SCN2A allele for example. The technology also relates in part to uses of the oligomeric compounds, including treatment of a SCN2A-associated medical condition. The technology also relates in part to uses that include determining presence or absence of a differentiating variation site and / or pathogenic genetic variant in a SCN2A nucleic acid. BACKGROUND Less than 10% of rare diseases have approved treatments (Kaufmann et al., Orphanet J. Rare Dis.13: 1-8 (2018)). Within rare diseases there are ultra-rare diseases with only 1-30 patients with the same pathogenic genetic variant worldwide (Crooke et al., Nat. Biotechnol.39: 671-677 (2021)). The rarity of these diseases often excludes them from drug development programs. While individually rare, these diseases collectively affect more than 263 million individuals worldwide, and developing strategies to meet the needs of these patients is challenging (Vockley et al., Genet. Med.25: 100022 (2023)). Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage- gated sodium channels function in the generation and propagation of action potentials in neurons and muscle. The SCN2A gene encodes one member of the sodium channel alpha subunit gene family. Variants of the SCN2A gene occur in different regions (Zeng et al., Front Mol Neurosci.15: 809951 (2022); doi: 10.3389 / fnmol.2022.809951) and recurrent variants result in the following amino acid substitutions: V261M, R853Q, H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, and P1658S. Certain variants of the SCN2A gene are associated with seizure disorders and autism spectrum disorder. The c.2558G>A variant in exon 15 of the SCN2A gene is a missense variant predicted to cause substitution of arginine by glutamine at amino acid 853 (p.Arg853Gln; Kong et al., Data in Brief 22: 492–501 (2019)). The c.5645G>A variant in exon 27 of the SCN2A gene also is a missense variant predicted to cause a Arg1882Gln substitution. The c.2558G>A variant and c.5645G>A variant in SCN2A, identified in only a few individuals worldwide, meet criteria to be classified as a pathogenic genetic variant for complex neurodevelopmental disorder (Mason et al., eNeuro 6(5), doi: 10.1523 / ENEURO.0141-19.2019), and have been identified in subjects having epileptic encephalopathy. The c.2558G>A variant leads to a mixed loss-and gain-of- function, while the c.5645G>A variant leads to a gain-of-function phenotype. SUMMARY Provided in certain aspects are oligomeric compounds comprising a modified oligonucleotide that can reduce SCN2A expression. Also provided in certain aspects are compositions containing the oligomeric compounds and uses of the oligomeric compounds for treatment of a medical condition such as a SCN2A-associated medical condition, for example. Provided also in certain aspects are uses that include determining presence or absence in a SCN2A nucleic acid of (i) a pathogenic genetic variant, (ii) a differentiating variation site, or (iii) a combination of (i) and (ii), and, if (i) and / or (ii) is present, administering an oligomeric compound targeted to the SCN2A nucleic acid. In certain aspects, provided are compositions, including products of manufacture and kits, and methods, for treating, preventing, reducing the symptoms or side effects of, or ameliorating a SCN2A-associated medical condition, such as SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy, for example. This Summary section is not limiting, and certain embodiments of the technology are described further in the accompanying description, claim(s) and drawings. The details of one or more exemplary embodiments of the invention are set forth in the accompa- nying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. All publications, patents, patent applications, American Type Culture Collection (ATCC) deposits and NCBI reference sequences cited herein are hereby expressly incorporated by reference in their entireties for all purposes. DESCRIPTION OF DRAWINGS The drawings illustrate certain embodiments of the technology and are not limiting. For clarity and ease of illustration, the drawings are not made to scale and, in some instances, various aspects can be shown exaggerated or enlarged to facilitate an understanding of particular embodiments. Like reference symbols in the various drawings indicate like elements. Figure 1 shows seizure counts pre-study and after treatment with study drug for Patient A. Figure 2 shows the percent of seizure-free days pre-treatment and post-treatment for Patient A. Figure 3 shows domains of the Aberrant Behavior Checklist for Patient A. Figure 4 shows gastrointestinal assessment as measured by the Bristol Stool Scale for Patient A. Figure 5 shows improvement in seizures for Patient B. Figure 6 shows Aberrant Behavior checklist results for Patient B. Figure 7 shows Repetitive Behavior Scale-Revised results for Patient B. Figure 8 shows Short Sensory Profile, Version 2, results for Patient B. Figure 9 shows Observer Reported Communication Ability results for Patient B. Figure 10 shows Bayley-4 Annualized Rate of Change results for Patient B. Figure 11 shows Vineland-3 Adaptive Behavior Subscale GSV Annualized Rate of Change results for Patient B. DETAILED DESCRIPTION The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. Definitions Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used. Unless otherwise indicated, the following terms have the following meanings. In alternative embodiments, “2’-deoxynucleoside” means a nucleoside including a 2’- H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2’-dcoxynuclcoside is a 2’-beta-D-deoxynucleoside and includes a 2’-beta-D-deoxyribosyl sugar moiety, which has the beta-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2’-deoxynucleoside or a nucleoside including an unmodified 2’-deoxyribosyl sugar moiety may include a modified nucleobase or may include an RNA nucleobase (uracil). In alternative embodiments, “2’-MOE” means a 2’-OCH2CH2OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. A “2’-MOE sugar moiety” or a “2’-O- methoxyethyl sugar moiety” or “2’-MOE ribosyl sugar moiety” means a sugar moiety with a 2’-OCH2CH2OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the beta-D configuration. “MOE” means O-methoxyethyl. “2’-MOE nucleoside” or “2’- O(CH2)2OCH3 nucleoside” means a nucleoside including a 2’- MOE sugar moiety (or 2’-O(CH2)2OCH3 ribosyl sugar moiety). In alternative embodiments, “2’-OMe” means a 2’-OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. A “2’-O-methyl sugar moiety” means a sugar moiety with a 2’-OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-OMe has the beta-D ribosyl stereochemical configuration. “2’-OMe nucleoside” means a nucleoside including a 2’-OMe sugar moiety. In alternative embodiments, “2’-F” means a 2’-fluoro group in place of the 2’-OH group of a ribosyl sugar moiety. A “2’-F sugar moiety” or “2’-fluororibosyl sugar moiety” means a sugar moiety with a 2’-F group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-F has the beta-D ribosyl stereochemical configuration. “2’-F nucleoside” means a nucleoside including a 2’-F sugar moiety . In alternative embodiments, “2’-substituted nucleoside” means a nucleoside including a 2’-substituted furanosyl sugar moiety. “2’-substituted” in reference to a sugar moiety means a sugar moiety including at least one 2'- substituent group other than H or OH. In alternative embodiments, “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase. In alternative embodiments, “abasic sugar moiety” means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to as “abasic nucleosides.” In alternative embodiments, “administration” or “administering” means providing a pharmaceutical agent or composition to cells. “Administration” or “administering” can be providing a pharmaceutical agent or composition to cells of a subject, and can be providing a pharmaceutical agent or composition to a subject. In alternative embodiments, “antisense activity” means any detectable and / or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound. In alternative embodiments, “antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound. In alternative embodiments, “antisense compound” means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group. In alternative embodiments, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group. In alternative embodiments, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNase H oligonucleotides and antisense RNAi oligonucleotides. In alternative embodiments, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide. Sense oligonucleotides include, but are not limited to, sense RNAi oligonucleotides. In alternative embodiments, “bicyclic nucleoside” or “BNA” means a nucleoside including a bicyclic sugar moiety. In alternative embodiments, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety including two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl sugar moiety. In alternative embodiments, “blunt” or “blunt ended” in reference to an oligomeric duplex formed by two oligonucleotides means that there are no terminal unpaired nucleotides (i.e., no overhanging nucleotides). One or both ends of a double-stranded RNAi agent can be blunt. In alternative embodiments, “cell-targeting moiety ” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types. In alternative embodiments, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (for example, osmolarity, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF. In alternative embodiments, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, where the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereo-random. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereo-random chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds including modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate internucleoside linkage. In alternative embodiments, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human. In alternative embodiments, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. “Complementary nucleobases” means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases are known. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. “Fully complementary” or “100% complementary ” in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length. “Complementary region” in reference to a region of an oligonucleotide means that at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. In alternative embodiments, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide and confers at least one property to the resulting conjugated oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. “Conjugate linker” means a single bond or a group of atoms including at least one bond that connects a conjugate moiety to an oligonucleotide. “Conjugate moiety” means a group of atoms covalently bound to an oligonucleotide via a conjugate linker. In alternative embodiments, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence and “contiguous nucleosides” means nucleosides that are immediately adjacent to each other in a sequence. In alternative embodiments, “constrained ethyl” or “cEt” or “cEt sugar moiety” means a beta-D ribosyl bicyclic sugar moiety where the second ring of the bicyclic sugar is formed via a bridge connecting the 4’-carbon and the 2’-carbon of the beta-D ribosyl sugar moiety, where the bridge has the formula 4'-CH(CH3)-O-2', and where the methyl group of the bridge is in the S configuration. The term “cEt nucleoside” means a nucleoside including a cEt sugar moiety. In alternative embodiments, “deoxy region” means a region of 5-12 contiguous nucleosides, where at least 70% of the nucleosides are 2’-beta-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2’-beta-D-deoxynucleoside, a bicyclic nucleoside, and a 2’-substituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is the gap or internal region of a gapmer. In alternative embodiments, “diluent” means an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, a diluent in an injected composition can be a liquid, for example, aCSF, phosphate buffered saline (PBS), or saline solution. In alternative embodiments, “double-stranded” in reference to a region or an oligonucleotide means a duplex formed by complementary strands of nucleic acids (including, but not limited to, oligonucleotides) hybridized to one another. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that has folded onto itself (for example, a hairpin structure). In alternative embodiments, “duplex” or “duplex region” means the structure formed by two oligonucleotides or portions thereof that are hybridized to one another. In alternative embodiments, “gapmer” means a modified oligonucleotide including an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, where the nucleosides in the internal region are chemically distinct from the nucleoside or nucleosides in the external regions. The internal region can be referred to as the “gap” and the external regions can be referred to as the “wings” or “wing segments.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5’-end of the internal region. Unless otherwise indicated, “gapmer’ refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2’-beta-D-deoxynucleoside. In certain embodiments, the gap includes one 2’- substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’-beta-D-deoxynucleosides. the term “MOE gapmer” indicates a gapmer having a gap including 2’-beta-D-deoxynucleosides and wings including 2’-MOE nucleosides. the term “mixed wing gapmer” indicates a gapmer having wings including modified nucleosides including at least two different sugar modifications. Unless otherwise indicated, a gapmer may include one or more modified internucleoside linkages and / or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications. In alternative embodiments, “hybridization” means the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target. In alternative embodiments, “internucleoside linkage” means the covalent linkage between contiguous nucleosides in an oligonucleotide. “Modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” or “PS internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. “Inverted nucleoside” means a nucleotide having a 3’ to 3’ and / or 5’ to 5’ internucleoside linkage, as shown herein. In alternative embodiments, “inverted sugar moiety” means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3’ to 3’ and / or 5’ to 5’ internucleoside linkage. In alternative embodiments, “linked nucleosides” are nucleosides that are connected in a contiguous sequence, where no additional nucleosides are presented between those that are linked. In alternative embodiments, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide. In alternative embodiments, “mismatch” or “non-complementary” means a nucleobase of a first nucleobase sequence that is not complementary with the corresponding nucleobase of a second nucleobase acid sequence or target nucleic acid when the first and second nucleobase sequences are aligned in opposing directions. In alternative embodiments, “motif’ means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide. In alternative embodiments, “non-bicyclic modified sugar moiety” means a modified sugar moiety that includes a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring. In alternative embodiments, "nucleobase" means an unmodified nucleobase or a modified nucleobase. An “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. “Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide, including such nucleobases that are each optionally independently modified or unmodified, and independent of any sugar or internucleoside linkage modification. “Nucleobase sequence of” a reference SEQ ID NO, refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, does not limit sugar or internucleoside linkage modifications. Unless otherwise specified, each nucleobase can be an unmodified nucleobase, or a modified nucleobase as defined herein. For example, “A” represents unmodified or modified adenine; “C” represents unmodified or modified cytosine, “T” represents unmodified or modified thymidine, “U” represents unmodified or modified uracil, and “G” represents unmodified or modified guanine. Modified nucleobases that fall outside of these definitions are represented in the sequence by a different symbol, such as an “X”. “Nucleoside” means a compound, or fragment of a compound, including a nucleobase and a sugar moiety. The nucleobase and sugar moiety each independently are unmodified or modified. In alternative embodiments, “modified nucleoside” means a nucleoside including a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence, where no additional nucleosides are presented between those that are linked. “Oligomeric agent” means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or can be an oligomeric duplex formed by two complementary oligomeric compounds. In alternative embodiments, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound can be paired with a second oligomeric compound that is complementary to the first oligomeric compound or can be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. In alternative embodiments, “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex can be referred to as a “duplexed oligomeric compound.” In alternative embodiments, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, where each nucleoside and internucleoside linkage can be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide, where at least one nucleoside or internucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not include any nucleoside modifications or internucleoside modifications. An oligonucleotide can be paired with a second oligonucleotide that is complementary to the oligonucleotide or it can be unpaired. A “single-stranded oligonucleotide” is an unpaired oligonucleotide. A “double-stranded oligonucleotide” is an oligonucleotide that is paired with a second oligonucleotide. In alternative embodiments, “pharmaceutically acceptable carrier” and “pharmaceutically acceptable diluent” means any substance suitable for use in administering to a subject. Certain carriers and diluents enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid. In alternative embodiments, “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts typically retain a desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. In alternative embodiments, “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines. In alternative embodiments, “population” with respect to molecules means a plurality of molecules of identical molecular formula. “Population” with respect to genetic variations refers to a plurality of individuals of the same species (humans for example). In alternative embodiments, “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzyme (for example, endogenous or viral enzyme) or chemicals present in cells or tissues and / or by physiologic conditions. In certain embodiments, the first form of the prodrug is less active than the second form. In alternative embodiments, “reducing” or “inhibiting” an amount or activity refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample. “Reducing” and “inhibiting” do not necessarily indicate a total elimination of transcriptional expression or activity. In alternative embodiments, “selectively reducing” or “selectively inhibiting” an amount or activity refers to relative reduction or blockade of gene expression or activity of one species relative to another species. The different species can be different alleles or allelic variants, and can be a mutant allele relative to a wild-type allele in certain embodiments. A compound that selectively reduces expression of a first allele relative to a second allele reduces expression of the first allele 2-fold or more relative to expression of the second allele. Stated another way, an expression level of a first allele is at least 2-fold lower than the expression level of a second allele in the presence of an allele-selective compound. A compound that does not selectively reduce expression of a first allele relative to a second allele reduces expression of the first allele less than 2-fold relative to expression of the second allele. Stated another way, an expression level of a first allele is less than 2-fold lower than the expression level of a second allele in the presence of a non-allele-selective compound. In certain embodiments, allele selectivity of an oligomeric compound is assessed by a selectivity ratio. In alternative embodiments, “RNA” means an RNA transcript and includes pre- mRNA and mature mRNA unless otherwise specified. “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount, activity, and / or splicing of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H. In alternative embodiments, “RNase H agent” means an antisense agent that acts through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. In certain embodiments, RNase H agents are single-stranded. In certain embodiments, RNase H agents are double-stranded. RNase H agents may include conjugate groups and / or terminal groups. In certain embodiments, an RNase H agent modulates the amount and / or activity of a target nucleic acid. The term “RNase H agent” excludes antisense agents that act principally through RISC / Ago2. In alternative embodiments, “antisense RNase H oligonucleotide” means an oligonucleotide including a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNase H-mediated nucleic acid reduction. In alternative embodiments, “antisense RNAi oligonucleotide” means an oligonucleotide including a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi-mediated nucleic acid reduction. In alternative embodiments, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself. In alternative embodiments, “single-stranded” means a nucleic acid, including but not limited to an oligonucleotide, that is unpaired and is not part of a duplex. Single- stranded compounds are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded. In alternative embodiments, “stabilized phosphate group” means a 5’-phosphate analog that is metabolically more stable than a 5’-phosphate as naturally occurs on DNA or RNA. In alternative embodiments, “stereo-random” and “stereo-random chiral center” in the context of a population of molecules of identical molecular formula refer to a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules including a stereo-random chiral center, the number of molecules having the (S) configuration of the stereo-random chiral center can be but is not necessarily the same as the number of molecules having (R) configuration of the stereo-random chiral center (“racemic”). In certain embodiments, the stereo-random chiral center is not racemic because one absolute configuration predominates following synthesis, for example, due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety. In certain embodiments, a stereo-random chiral center is a stereo-random phosphorothioate internucleoside linkage or a mesyl phosphoramidate internucleoside linkage. In alternative embodiments, “subject” means a human or non-human animal. In certain embodiments, the subject is a human, and in certain embodiments a subject is a patient. “Animal” means a human or non-human animal. In alternative embodiments, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. In alternative embodiments, “unmodified sugar moiety” means a 2’-OH(H) beta-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) beta-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position. In alternative embodiments, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. In alternative embodiments, "sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides including sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids. In alternative embodiments, “treating” means improving a subject’s medical condition by administering a pharmaceutical agent or composition, such as a pharmaceutical agent or composition comprising an oligomeric compound described herein for example. In certain embodiments, treating a subject improves a symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment. In certain embodiments, treatment reduces in the severity or frequency of a symptom or hallmark, or delays the onset of a symptom or hallmark, slows the progression of a symptom or hallmark, or slows the severity or frequency of a symptom or hallmark. In alternative embodiments, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom of a disease. In alternative embodiments, “medical condition” means a disease, disorder or other condition for which a subject receives medical attention, medical service, treatment, diagnosis, consultation or a drug prescription. A medical condition can be a SCN2A- associated medical condition, and in certain embodiments, is complex neurodevelopmental disorder, autosomal dominant complex neurodevelopmental disorder, encephalopathy, epileptic encephalopathy, developmental and epileptic encephalopathy, early infantile epileptic encephalopathy, epilepsy, or self-limited neonatal / infantile epilepsy. In certain embodiments, a SCN2A-associated medical condition is SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy. In alternative embodiments, “symptom or hallmark” means a physical feature or test result that indicates the existence or extent of a medical condition. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing the subject. In certain embodiments, a hallmark is a particular indicator, such as a molecular indicator for example. In certain embodiments, a hallmark is an indicator that can be identified by testing. In certain embodiments, a hallmark is identified by diagnostic testing. In certain embodiments, a hallmark is identified by invasive testing, such as a post-mortem test for example. In certain embodiments, a symptom or hallmark is seizure; self-limited seizure; developmental delay; intellectual disability; behavior disorder; autism spectrum disorder feature; poor muscle tone (hypotonia); movement disorder; feeding difficulty; vision difficulty; and cortical visual impairment (CVI). In alternative embodiments, “ameliorate” with reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment. In certain embodiments, amelioration is reduction in severity or frequency of a symptom or hallmark or delayed onset or slowing of progression in severity or frequency of a symptom or hallmark. Progression or severity of a symptom or hallmark can be determined by known subjective or objective measures. In alternative embodiments, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide. In alternative embodiments, “target nucleic acid,” which includes “target RNA,” means a nucleic acid that an antisense compound is designed to affect. Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified. “Target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize. A target region can be or can include a genetic variation site or portion thereof, and a genetic variation site can be a differentiating genetic variation site that is different between two alleles. A target region can be on a target allele and a target allele can be an allelic variant. A mutant allele and / or a wild-type allele can include a target region. In alternative embodiments, “targeted to” means an oligomeric compound designed to hybridize to a target region of a SCN2A nucleic acid. A modified oligonucleotide of a oligomeric compound targeted to a SCN2A nucleic acid can be at least 80% complementary to, or at least 85% complementary to, or at least 90% complementary to, or at least 95% complementary to, or 100% complementary to, an equal length target region portion of a SCN2A nucleic acid. In certain embodiments, an oligomeric compound oligonucleotide is 100% complementary to an equal-length target region portion of a SCN2A nucleic acid except for a one-nucleobase mismatch. In alternative embodiments, “allele” refers to one member of a pair of genes or one member of a series of different forms of a nucleic acid sequence that can exist at a single locus or marker on a specific chromosome. For a diploid organism or cell or for autosomal chromosomes, each allelic pair normally occupies corresponding positions (loci) on a pair of homologous chromosomes, one inherited from the mother and one inherited from the father. If these alleles are identical, the organism or cell is “homozygous” for that allele. If the alleles differ, the organism or cell is “heterozygous” for that allele. The term “allele” can refer to genomic nucleic acid, expressed RNA (for example, transcribed and / or processed RNA (pre-RNA or mRNA for example)) and / or expressed protein. A “SCN2A” allele refers to one member of a pair of SCN2A genes on a specific chromosome for example. In alternative embodiments, “allelic variant” refers to one of the pair of genes or nucleic acid sequence existing at a single locus. “Allelic variant nucleic acid” refers to a chromosome nucleic acid or transcription product nucleic acid such as a pre-mRNA or mRNA corresponding to a particular allele, for example. Allelic variants can include one or multiple genetic variation sites. Allelic variants typically include a first allele (or first allelic variant) containing a first genotype at a genetic variation site and a second allele (or second allelic variant) containing a second genotype at the genetic variation site. At each particular genetic variation site the allelic variants can have the same genotype (homozygous at the particular genetic variation site) or different genotype (heterozygous at the particular genetic variation site). In instances where a first genotype of a first allelic variant is different than a second genotype of a second allelic variant at a genetic variation site, the genetic variation site can be a differentiating genetic variation site. A differentiating genetic variation site can be a pathogenic genetic variation site, a first allelic variant can be a mutant allele containing a pathogenic genetic variant at the pathogenic genetic variation site, and a second allelic variant can be a wild-type allele not containing the pathogenic genetic variant present on the mutant allele at the pathogenic genetic variation site. A differentiating genetic variation site can be a non-pathogenic genetic variation site, a first allelic variant can include a first genetic variant at the non-pathogenic genetic variation site, and a second allelic variant can include a second genetic variant different than the first genetic variant at the non-pathogenic genetic variation site. An allelic variant can be referred to as a major allele or a minor allele, as defined herein. In alternative embodiments, “genetic variation” means a variation of one or more nucleobases between allelic variants of an individual and / or between genomes of individuals of the same species at a particular polymorphic position. A genetic variation generally occurs at a “genetic variation position” or at “genetic variation positions” within a “genetic variation site.” “Genetic variation position(s)” refers to the nucleobase position(s) of the polymorphic genetic variation on a reference nucleobase sequence within a genetic variation site. “Genetic variation site” refers to the genetic variation position(s) and linked nucleobases on one or both sides (5’ side and / or 3’ side) of the genetic variation position(s), which can be contained in a target region to which an oligomeric compound is targeted. In certain embodiments, a genetic variation position is flanked by conserved nucleobase sequences within a genetic variation site. A genetic variation can be a substitution of one nucleobase with another nucleobase, referred to as a single nucleobase variation (SNV); a substitution of a portion of linked nucleobases with a portion containing an equal number of linked nucleobases containing at least two different nucleobases; a substitution of one nucleobase with two or more nucleobases (an insertion); and / or a substitution of multiple linked nucleobases with a single nucleobase (a deletion). Different genetic variation sites can be in linkage disequilibrium (defined herein). A genetic variation can be a single nucleotide variation (SNV) or a single nucleotide polymorphism (SNP). A genetic variation position can be a SNV position or SNP position and a genetic variation site can be a SNV site that includes the SNV position or a SNP site that includes the SNP position. A genetic variation site can be a pathogenic genetic variation site, a non-pathogenic genetic variation site and / or a differentiating genetic variation site, each of which are defined herein. In alternative embodiments, "single nucleotide variation" or "SNV" is a particular type of genetic variation for which there is a single nucleotide variant at a particular polymorphic genetic variation position within a genetic variation site. A SNV typically is a single nucleotide substitution, and in some cases can be a single nucleotide deletion or insertion at a particular position within a site. A SNV can be a single nucleotide polymorphism (SNP) that occurs relatively frequently in genomes and contributes to genetic diversity. A SNV can be a variation that occurs less frequently than a SNP in certain instances. A SNV can be a “synonymous SNV,” also referred to as a “silent SNV,” that does not result in an amino acid substitution in a translated expression product. A SNV can be a “non-synonymous SNV,” also referred to as a “coding SNV,” that results in an amino acid substitution in a translated expression product relative to a reference nucleobase sequence. A mutant allele can include a pathogenic single nucleotide variant, and the pathogenic single nucleotide variant can be a non-synonymous SNV. A non-pathogenic single nucleotide variant on a mutant allele or wild-type allele can be (i) a synonymous SNV, (ii) a non- synonymous SNV, (iii) a major allele SNV, (iv) a minor allele SNV, (v) contain the same SNV position nucleotide in a SCN2A reference nucleobase sequence, or (vi) contain a different SNV position nucleotide of a SCN2A reference nucleobase sequence, or (vii) a combination of (i) and (iii); (i) and (iv); (ii) and (iii); (ii) and (iv); (i), (iii) and (v); (i), (iii) and (vi); (i), (iv) and (v); (i), (iv) and (vi); (ii), (iii) and (v); (ii), (iii) and (vi); (ii), (iv) and (v); or (ii), (iv) and (vi). An oligomeric compound oligonucleotide can be targeted to a SNV site. In certain embodiments, a nucleobase of the oligonucleotide that anneals to and aligns with the SNV position in the target region can occur at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the oligonucleotide, counted from the 5’ end of the oligonucleotide. The remainder of the oligonucleotide bases can have sufficient complementarity to the SNV site to facilitate hybridization. In alternative embodiments, “pathogenic genetic variation site” means a genetic variation site that can exist as a pathogenic genetic variant present on a mutant allele or a non-pathogenic genetic variant present on a wild-type allele. A pathogenic genetic variant typically is associated with a medical condition and can cause the medical condition. A genetic variant at a pathogenic genetic variation site associated with a medical condition is referred to as a “pathogenic genetic variant.” A pathogenic genetic variation site can be a differentiating genetic variation site targeted by an oligomeric compound. A pathogenic allelic variant is heterozygous in certain embodiments, and is present on a mutant allele and not on a wild-type allele in certain embodiments. A pathogenic genetic variant of a pathogenic genetic variation site typically is not present in a reference sequence (for example, a reference genomic sequence (accession no. ENSG00000136531; Genome Assembly GRCh38, release 112; chromosome 2 positions 165,194,993-165,392,310) or a reference cDNA sequence (accession no. ENST00000375437.7; Genome Assembly GRCh38, release 112)). In alternative embodiments, presence of pathogenic genetic variant on an allele can result in a wild-type protein loss of function (LOF). A pathogenic genetic variant on an allele may not result in a LOF and is referred to as a “non-LOF genetic variant.” A non-LOF genetic variant can be a dominant-negative (DN) genetic variant, which typically results in expression of a mutant protein that interferes with wild-type protein activity. A non-LOF genetic variant can be a gain-of-function (GOF) genetic variant, which typically results in a mutant protein activity not observed for wild-type protein. A GOF genetic variant phenotype can occur through various mechanisms, such as different substrate activity, different binding target specificity, constitutive activation, or protein aggregation of a mutant protein, for example, and can be a toxic GOF (TGOF) genetic variant in certain instances. A pathogenic genetic variation site can be a differentiating genetic variation site targeted by an oligomeric compound. In certain embodiments, a target region of a mutant allele targeted by an oligomeric compound oligonucleotide can be within a pathogenic genetic variation site or can include a pathogenic genetic variation site, typically contain the pathogenic genetic variation position(s) and typically includes the pathogenic genetic variant at the pathogenic genetic variation position(s). In alternative embodiments, “non-pathogenic genetic variation site” means a genetic variation site that does not include a pathogenic genetic variation position. A mutant allele and a wild-type allele can contain one or more non-pathogenic genetic variation sites. A genetic variant of a non-pathogenic genetic variation site sometimes is present in a reference sequence and sometimes is not present in a reference sequence (for example, a reference genomic sequence (accession no. ENSG00000136531; Genome Assembly GRCh38, release 112; chromosome 2 positions 165,194,993-165,392,310) or a reference cDNA sequence (accession no. ENST00000375437.7; Genome Assembly GRCh38, release 112)). A non-pathogenic genetic variation site can be a differentiating genetic variation site targeted by an oligomeric compound. In certain embodiments, a mutant allele contains a first genetic variant at a polymorphic position at a non-pathogenic genetic variation site and a wild-type allele contains a second genetic variant at the polymorphic position or the non-pathogenic genetic variation site different than the first genetic variant. In certain embodiments, a target region of an allele targeted by an oligomeric compound oligonucleotide (a mutant allele for example) can be within a non-pathogenic genetic variation site or can include a non- pathogenic genetic variation site, typically contains a non-pathogenic genetic variation position and optionally contains the first genetic variant at the non- pathogenic genetic variation position in a mutant allele. In alternative embodiments, “differentiating variation” and “differentiating genetic variation” mean a genetic variation permitting differentiation between different alleles and selective targeting of an allelic variant. A differentiating genetic variant typically occurs at a polymorphic differentiating genetic variation position within a differentiating genetic variation site for a particular allele. Each allelic variant can include a different genetic variant at a differentiating genetic variation site. A differentiating genetic variation can be a heterozygous genetic variation for an individual or individuals in a population. A differentiating variation site can be a pathogenic genetic variation site. A differentiating variation site can be a non- pathogenic genetic variation site. In certain embodiments, a particular genetic variant at a differentiating genetic variation site is selectively targeted by an oligomeric compound, and such an oligomeric compound can be used to selectively target an allele containing the genetic variant targeted. In alternative embodiments, “mutant allele” refers to an allele (allelic variant) that typically includes a pathogenic genetic variation site containing a pathogenic genetic variant, thereby having a genotype associated with a medical condition associated with the pathogenic genetic variant. A mutant allele can be referred to as a “pathogenic allele.” For example, a “mutant SCN2A allele” refers to a SCN2A allele containing a pathogenic genetic variant, thereby having a genotype associated with a medical condition, and can be referred to as a “pathogenic SCN2A allele.” A mutant allele can be referred to as a “mutant allelic variant” or “pathogenic allelic variant.” In addition to including a pathogenic genetic variant associated with a medical condition, a mutant allele can include a non-pathogenic genetic variation site and a particular genotype at the non-pathogenic genetic variation site. For example, a mutant allele can include multiple non-pathogenic genetic variation sites and a particular genotype at each of the non-pathogenic genetic variation sites. In alternative embodiments, “wild-type allele” refers to an allele (allelic variant) that typically does not include the pathogenic genetic variant included on a mutant allele at a pathogenic genetic variation site, and does not have a genotype associated with the medical condition associated with the pathogenic genetic variant. A wild-type allele can be referred to as a “non-pathogenic allele.” For example, a “wild-type SCN2A allele” refers to a SCN2A allele not containing a pathogenic genetic variant included on a mutant SCN2A allele, thereby not having a genotype associated with the medical condition associated with the pathogenic genetic variant, and can be referred to as a “non-pathogenic SCN2A allele.” As for a mutant allele, a wild-type allele can include a particular genotype at the non-pathogenic genetic variation site. For example, a wild-type allele can include a particular genotype at each of multiple non-pathogenic genetic variation sites. At each particular non-pathogenic genetic variation site, the genotype for the wild-type allele may be the same as the genotype for the mutant allele (homozygous at the particular non-pathogenic genetic variation site and the non-pathogenic genetic variation site is not a differentiating genetic variation site) or the genotype for the wild type allele may be different than the genotype for the mutant allele (heterozygous at the particular non-pathogenic genetic variation site and the non-pathogenic genetic variation site is a differentiating genetic variation site). In alternative embodiments, “linkage disequilibrium” is non-random association of different loci (including genetic variation sites for example) in a given population. Loci are in linkage disequilibrium when the frequency of association of their different alleles is higher or lower than expected if the loci were independent and associated randomly. In alternative embodiments, “haplotype” means a set of alleles of closely linked loci on a chromosome that generally are in are in linkage equilibrium and generally are inherited together. A haplotype may include two, three, four, or more loci or alleles. The set of alleles in a haplotype along a given segment of a chromosome generally are transmitted to progeny together unless there has been a recombination event. In alternative embodiments, “major allele” refers to an allele containing a particular genetic variant at a polymorphic site (a SNV nucleotide at a SNV position for example) present in a statistically significant proportion of individuals in a human population. In alternative embodiments, a “minor allele” refers to an allele containing a different genetic variant at a polymorphic site (a different SNV nucleotide at the SNV position for example) present in a relatively smaller proportion of individuals in the population than the major allele. In alternative embodiments, “selectively targeted to” means an oligomeric compound designed to hybridize to a target region of one SCN2A nucleic acid species preferentially over hybridizing to another target region of another SCN2A nucleic acid species. In certain embodiments, an oligomeric compound is targeted to a genetic variation site of a SCN2A nucleic acid species and is selectively targeted to a genetic variant at the site present on one SCN2A nucleic acid species and not present on another SCN2A nucleic acid species. In certain embodiments, an oligomeric compound is targeted to a genetic variation site of a SCN2A nucleic acid and is selectively targeted to a genetic variant at the site present on one SCN2A allelic variant and not present on another SCN2A allelic variant. In certain embodiments, an oligomeric compound is targeted to a genetic variation site of a SCN2A nucleic acid and is selectively targeted to a genetic variant at the site present on a mutant SCN2A allelic variant (pathogenic SCN2A allelic variant, for example) and not present on a wild-type SCN2A allelic variant. In alternative embodiments, “target allele” means a SCN2A allele containing a target region to which an oligomeric compound is targeted. In certain embodiments, a target region includes a differentiating genetic variation site, which in certain instances is a heterozygous differentiating site. A SCN2A allele containing a particular allelic variant at the differentiating genetic variation site can be targeted selectively by an oligomeric compound. In certain embodiments, a target region does not include a genetic variation site or does not include a differentiating genetic variation site (allelic variants at a genetic variation site can be homozygous for example), and SCN2A alleles can be targeted without allele-selectivity. In alternative embodiments, “genotype” means an identification of one or more nucleobases in genomic nucleic acid at a particular genetic location. The particular location or site can include a genetic variation site. A genotype can be identified in nucleic acid from an individual or group of individuals. A genotype can be a nucleobase, nucleobase sequence or symbol representative of the nucleobase or nucleobases. A genotype can be determined in situ or for sample nucleic acid. In alternative embodiments, “sample nucleic acid” means nucleic acid from a cell, tissue or subject, and can be nucleic acid isolated from cell, tissue or subject. A sample from a subject can be a fluid or solid sample. Exemplary Embodiments Non-limiting embodiments of the technology are described hereafter in a numbered format starting with embodiment A1 (for example, “A1” is “embodiment A1”). A1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein: the modified oligonucleotide comprises or consists of a nucleobase sequence that is at least 80% complementary to an equal length portion of a genetic variation site of a SCN2A nucleic acid; and the modified oligonucleotide comprises a modified nucleoside, or a modified internucleoside linkage, or a modified nucleoside and a modified internucleoside linkage. A2. The oligomeric compound of embodiment A1, wherein the equal length portion of the genetic variation site contains a differentiating variation. A3. The oligomeric compound of embodiment A1 or A2, which is capable of selectively reducing expression of a SCN2A allelic variant. A4. The oligomeric compound of any one of embodiments A1-A3, wherein the genetic variation site is a single nucleotide variation site. A5. The oligomeric compound of embodiment A4, wherein the single nucleotide variation site comprises a single nucleotide variation position and the modified oligonucleotide comprises a nucleoside aligned with the single nucleotide variation position. A6. The oligomeric compound of embodiment A5, wherein the modified oligonucleotide comprises a nucleoside aligned with and complementary to a nucleoside at the single nucleotide variation position. A7. The oligomeric compound of embodiment A6, wherein the modified oligonucleotide comprises a nucleoside aligned with and complementary to a first nucleoside at the single nucleotide variation position of a first SCN2A allelic variant and not complementary to a second nucleoside at the single nucleotide variation position of a second SCN2A allelic variant. A8. The oligomeric compound of embodiment A7, wherein the modified oligonucleotide is capable of selectively reducing expression of the first SCN2A allelic variant to a greater extent than expression of the second SCN2A allelic variant. A9. The oligomeric compound of embodiment A8, wherein: the modified oligonucleotide is capable of selectively reducing expression of the first SCN2A allelic variant by at least 2-fold compared to expression of the second SCN2A allelic variant; or optionally the oligomeric compound selectively reduces expression of the first SCN2A allelic variant according to a selectivity ratio of at least 2 or greater than 2, wherein the selectivity ratio is (i) inhibition of expression of the second SCN2A allelic variant to (ii) inhibition of expression of the first SCN2A allelic variant, or optionally wherein the inhibition of expression of the second SCN2A allelic variant is an IC50 value and the inhibition of expression of the first SCN2A allelic variant is an IC50 value. A10. The oligomeric compound of any one of embodiment A5-A9, wherein: the modified oligonucleotide consists of 10-30 linked nucleosides and the nucleoside at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the single nucleotide variation position; or the modified oligonucleotide consists of 18-22 linked nucleosides, or optionally 20 linked nucleosides, and the nucleoside at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the single nucleotide variation position. A11. The oligomeric compound of any one of embodiments A5-A10, wherein the modified oligonucleotide consists of 18-22 linked nucleosides, or optionally 20 linked nucleosides, and comprises: a 5’-region consisting of linked 5’-region nucleosides; a central region consisting of linked central region nucleosides; a 3’-region consisting of linked 3’-region nucleosides; the central region comprises a 5’ terminus; and the nucleoside at position 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of the central region, as counted from the 5' terminus of the central region, aligns with the single nucleotide variation position. A12. The oligomeric compound of any one of embodiments A4-A11, wherein: the single nucleotide variation site is within a SCN2A intron, or optionally is within SCN2A intron 3, intron 11, intron 13 intron 17, or intron 22, or optionally is within SCN2A intron 11 or intron 22. A13. The oligomeric compound of any one of embodiments A4-A12, wherein: the single nucleotide variation site is selected from one of rs3769931, rs72872496, rs544136707, rs72874313, rs3769944, rs3769947, rs2304017, rs72874358 and rs1368238, optionally is selected from one of rs3769931, rs72872496, rs72874313, rs3769944, rs72874358 and rs1368238, or optionally is rs72874313 or rs1368238. A14. The oligomeric compound of any one of embodiments A4-A13, wherein: the single nucleotide variation site is selected from one of SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:31, or optionally the single nucleotide variation site is selected from one of SEQ ID NO:26 to SEQ ID NO:30. A15. The oligomeric compound of embodiment A14, wherein: the single nucleotide variation site is SEQ ID NO:4, or optionally the single nucleotide variation site is SEQ ID NO:28, or optionally the single nucleotide variation site is SEQ ID NO:31. A15.1. The oligomeric compound of embodiment A14 or A15, wherein the modified oligonucleotide comprises or consists of a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:31; or optionally SEQ ID NO:26 to SEQ ID NO:30; or optionally SEQ ID NO:4; or optionally SEQ ID NO:28; or optionally SEQ ID NO:31. A15.2. The oligomeric compound of any one of embodiment A4-A15.1, wherein the modified oligonucleotide comprises or consists of a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SCN2A intron 3; or genetic variation site rs3769931; or a portion corresponding to SCN2A chromosome 2 positions 165299693-165299753; or a portion corresponding to SCN2A chromosome 2 positions 165299709- 165299738; or SEQ ID NO:1; or SEQ ID NO:26; or SCN2A intron 3; or genetic variation site rs72872496; or a portion corresponding to SCN2A chromosome 2 positions 165300913-165300973; or a portion corresponding to SCN2A chromosome 2 positions 165300938- 165300958; or SEQ ID NO:2; or SEQ ID NO:27; or SCN2A intron 11; or genetic variation site rs72874313; or a portion corresponding to SCN2A chromosome 2 positions 165322197-165322257; or a portion corresponding to SCN2A chromosome 2 positions 165322222- 165322242; or SEQ ID NO:4; or SEQ ID NO:28; or SCN2A intron 13; or genetic variation site rs3769944; or a portion corresponding to SCN2A chromosome 2 positions 165329668-165329728; or a portion corresponding to SCN2A chromosome 2 positions 165329684- 165329704; or SEQ ID NO:5; or SEQ ID NO:29; or SCN2A intron 17; or genetic variation site rs72874358; or a portion corresponding to SCN2A chromosome 2 positions 165355671-165355731; or a portion corresponding to SCN2A chromosome 2 positions 165355687- 165355709; or SEQ ID NO:8; or SEQ ID NO:30; or corresponding to SCN2A intron 22; or genetic variation site rs1368238; or a portion corresponding to SCN2A chromosome 2 positions 165375094- 165375154; or SEQ ID NO:31. A16. The oligomeric compound of any one of embodiments A5-A15.2, wherein the single nucleotide variation site comprises: (i) a nucleotide variant at the single nucleotide variation position described in Table C; or (ii) the “v1” nucleotide variant at the single nucleotide variation position described in Table C; or (iii) the “v2” nucleotide variant at the single nucleotide variation position described in Table C. A17. The oligomeric compound of any one of embodiments A4-A16, wherein the modified oligonucleotide comprises or consists of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NO:10 to SEQ ID NO:25 or SEQ ID NO:32; or optionally SEQ ID NO:10 to SEQ ID NO:14 or SEQ ID NO:16 to SEQ ID NO:19 or SEQ ID NO:22 to SEQ ID NO:25; or optionally SEQ ID NO:10 to SEQ ID NO:12; or optionally SEQ ID NO:13 or SEQ ID NO:14; or optionally SEQ ID NO:16 or SEQ ID NO:17; or optionally SEQ ID NO:18 or SEQ ID NO:19; or optionally SEQ ID NO:22 to SEQ ID NO:25. A18. The oligomeric compound of embodiment A17, wherein the modified oligonucleotide comprises or consists of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of SEQ ID NO:16 or SEQ ID NO:32. A19. The oligomeric compound of any one of embodiments A1-A18, the modified oligonucleotide comprises or consists of a nucleobase sequence that is at least 85% complementary to, or at least 90% complementary to, or at least 95% complementary, or is 100% complementary to, an equal length portion of the genetic variation site. A20. The oligomeric compound of any of embodiments A1-A19, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, or 20 to 50 linked nucleosides. A21. The oligomeric compound of any one of embodiments A4-A19, wherein the single nucleotide variation site comprises a synonymous single nucleotide variation. A22. The oligomeric compound of any one of embodiments A1-A21, wherein the genetic variation site comprises a genetic variant present in at least 20% of a population. A23. The oligomeric compound of embodiment A22, wherein the genetic variant is present in at least 25% of a population, or at least 30% of a population, or at least 35% of a population, or at least 40% of a population, or at least 45% of a population, or at least 50% of a population, or at least 55% of a population, or at least 60% of a population, or at least 65% of a population, or at least 70% of a population, or at least 75% of a population, or at least 80% of a population, or at least 85% of a population, or at least 90% of a population. A24. The oligomeric compound of embodiment A23, wherein the genetic variant is present in at least 75% of a population. A25. The oligomeric compound of embodiment A23, wherein the genetic variant is present in at least 80% of a population. A26. The oligomeric compound of any one of embodiments A3-A25, wherein the SCN2A allelic variant is a mutant SCN2A allele associated with a medical condition. A27. The oligomeric compound of any one of embodiments A3-A26, wherein the SCN2A allelic variant comprises a pathogenic genetic variation site associated with a medical condition. A28. The oligomeric compound of embodiment A26 or A27, wherein the medical condition is a SCN2A-associated medical condition, which optionally is SCN2A- associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A- associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy. A29. The oligomeric compound of embodiment A27 or A28, wherein the pathogenic genetic variation site is associated with a non-loss of function phenotype. A30. The oligomeric compound of embodiment A29, wherein the non-loss of function phenotype is a dominant negative phenotype, a gain of function phenotype or toxic gain of function phenotype. A31. The oligomeric compound of any one of embodiments A27-A30, wherein the pathogenic genetic variation site is a pathogenic single nucleotide variation site. A32. The oligomeric compound of embodiment A31, wherein the pathogenic single nucleotide variation site comprises a non-synonymous single nucleotide variation at a pathogenic genetic variation position. A33. The oligomeric compound of any one of embodiments A27-A32, wherein the pathogenic genetic variation site contains a variant resulting in an amino acid substitution in a SCN2A protein chosen from: V261M, R853Q, H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, P1658S or R1882Q. A34. The oligomeric compound of any one of embodiments A27-A33, wherein the pathogenic genetic variation site is in an exon of the SCN2A allelic variant, and optionally in exon 15 or exon 27. A35. The oligomeric compound of any one of embodiments A27-A34, wherein the pathogenic genetic variation site comprises a c.2558G>A genetic variant or c.5645G>A genetic variant, or optionally comprises a nucleobase sequence of SEQ ID NO:9 or SEQ ID NO:33. A36. The oligomeric compound of any one of embodiments A32-A35, wherein the equal length portion of the genetic variation site contains the pathogenic genetic variation position, or contains the pathogenic genetic variation site or portion thereof. A37. The oligomeric compound of any one of embodiments A32-A35, wherein the equal length portion of the genetic variation site does not contain the pathogenic genetic variation position, or does not contain the pathogenic genetic variation site or portion thereof. A38. The oligomeric compound of any one of embodiments A1-A37, which is single- stranded. A39. The oligomeric compound of any one of embodiments A1-A38, wherein the modified oligonucleotide is 85% or more complementary to, or optionally 90% or more complementary to, or optionally 95% or more complementary to, or optionally 100% complementary to, an equal length portion of a first SCN2A allele nucleic acid. A40. The oligomeric compound of embodiment A39, wherein the first SCN2A allele nucleic acid is a mutant SCN2A allele nucleic acid. A41. The oligomeric compound of embodiment A39 or A40, wherein the first SCN2A allele nucleic acid is a mutant SCN2A allele nucleic acid containing a pathogenic genetic variant. A42. The oligomeric compound of any one of embodiments A39-A41, wherein the pathogenic genetic variant is not within the equal length portion of the first SCN2A allele nucleic acid. A43. The oligomeric compound of any one of embodiments A39-A42, wherein the equal length portion of the first SCN2A allele nucleic acid contains a genetic variation site, or a genetic variation position, or a genetic variation site and a genetic variation position. A44. The oligomeric compound of any one of embodiments A39-A43, wherein the genetic variation site in the equal length portion of the SCN2A allele nucleic acid is a single nucleotide variation site containing a single nucleotide variation position. A45. The oligomeric compound of any one of embodiments A39-A44, wherein a second SCN2A allele nucleic acid is a wild type SCN2A allele nucleic acid. A46. The oligomeric compound of embodiment A45, wherein the first SCN2A allele nucleic acid is a mutant SCN2A allele nucleic acid containing a pathogenic genetic variant and the second SCN2A allele nucleic does not contain the pathogenic genetic variant present in the first SCN2A allele nucleic acid. A47. The oligomeric compound of any one of embodiments A39-A46, wherein the modified oligonucleotide is X% complementary to an equal length portion of a first SCN2A allele nucleic acid and Y% complementary to an equal length portion of a second SCN2A allele nucleic acid, and (i) X% and Y% each is nucleobase complementarity, (ii) X% and Y% are not equal, and (iii) X% is greater than Y%. A48. The oligomeric compound of embodiment A47, wherein a subtraction product of X% minus Y% is 1% to 10%, optionally 4% to 6% and optionally about 5%. A49. The oligomeric compound of embodiment A47 or A48, wherein X% is 100% nucleobase complementarity to the equal length portion of the first SCN2A allele nucleic acid and Y% is a precent equal to full nucleobase complementarity to the equal length portion of the second SCN2A allele nucleic acid except for a one- nucleobase mismatch or except for a two-nucleobase mismatch. A50. The oligomeric compound of embodiment A49, wherein at least one nucleobase mismatch is at a genetic variation position in the second SCN2A allele nucleic acid. A51. The oligomeric compound of any one of embodiments A1-A50, wherein a first SCN2A allele nucleic acid contains a nucleobase variant at a genetic variation position that is different from a corresponding nucleobase variant at the genetic variation position in a second SCN2A allele. A52. The oligomeric compound of embodiment A51, wherein the nucleobase sequence of the modified oligonucleotide contains a nucleobase (i) complementary to the nucleobase variant at the genetic variation position of the first SCN2A allele nucleic acid, and (ii) not complementary to the nucleobase variant at the genetic variation position of the second SCN2A allele nucleic acid. A53. The oligomeric compound of embodiment A51 or A52, wherein the corresponding equal length portion of the second SCN2A allele nucleic acid is identical to the equal length portion of the first SCN2A allele nucleic acid except for a one-nucleobase mismatch or two-nucleobase mismatch. A54. The oligomeric compound of embodiment A53, wherein the corresponding equal length portion of a second SCN2A allele nucleic acid is identical to the equal length portion of the first SCN2A allele nucleic acid except for a one-nucleobase mismatch. A55. The oligomeric compound of any one of embodiments A1-A54, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to an equal length portion of a first SCN2A allele nucleic acid and not 100% complementary to a corresponding equal length portion of a second SCN2A allele nucleic acid. A56. The oligomeric compound of embodiment A55, wherein the corresponding equal length portion of a second SCN2A allele nucleic acid is identical to the equal length portion of the first SCN2A allele nucleic acid except for a one-nucleobase mismatch or two-nucleobase mismatch. A57. The oligomeric compound of embodiment A56, wherein the corresponding equal length portion of a second SCN2A allele nucleic acid is identical to the equal length portion of the first SCN2A allele nucleic acid except for a one-nucleobase mismatch. A58. The oligomeric compound of embodiment A56 or A57, wherein at least one nucleobase mismatch is at a genetic variation position in the second SCN2A allele nucleic acid. A59. The oligomeric compound of any one of embodiments A1-A58, comprising or consisting of: 5ʹ-G-G-mU-mC-A-A-T-T-G-A-A-A-G-A-T-A-mU-mC-mC-mC-3ʹ (SEQ ID NO: 34), wherein: “m” is methyl; each of the underlined nucleosides is a modified nucleoside comprising a 2’-MOE sugar moiety; and optionally each mU is a 5-methyluridine and optionally each mC is a 5-methylcytidine. A60. The oligomeric compound (SEQ ID NO: 35) of any one of embodiments A1- A58, comprising or consisting of: 2ʹ-O-(2-methoxyethyl)-guanosine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-guanosine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-5-methyluridine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-5-methylcytidine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-adenosine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-thymidine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-thymidine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-thymidine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methyluridine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-5-methylcytidine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-5-methylcytidine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methylcytidine, nonadecasodium salt. A61. An oligomeric compound of any one of embodiments A1-A58, comprising or consisting of:

[0002] . A62. The oligomeric compound of any one of embodiments A1-A58, comprising or consisting of: 5ʹ- mU-G-mC-mC-mA-A-mC-A-A-T-G-T-A-mC-A-A-G-G-G-mU -3ʹ (SEQ ID NO: 36), wherein: “m” is methyl; each of the underlined nucleosides is a modified nucleoside comprising a 2’-MOE sugar moiety; and optionally each mU is a 5-methyluridine and optionally each mC is a 5-methylcytidine. A63. The oligomeric compound (SEQ ID NO: 37) of any one of embodiments A1- A58, comprising or consisting of: 2ʹ-O-(2-methoxyethyl)-5-methyluridine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methylcytidine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methylcytidine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- adenosine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-5-methylcytidine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-thymidine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-guanosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-thymidine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-5-methylcytidine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-methoxyethyl)- adenosine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methyluridine, nonadecasodium salt. A64. An oligomeric compound of any one of embodiments A1-A58, comprising or consisting of: . B1. The oligomeric compound of any one of embodiments A1-A64, wherein the modified oligonucleotide comprises at least one modified nucleoside. B2. The oligomeric compound of embodiment B1, wherein the at least one modified nucleoside comprises a modified sugar. B3. The oligomeric compound of embodiment B2, wherein the modified sugar comprises a bicyclic sugar. B4. The oligomeric compound of embodiment B3, wherein the bicyclic sugar comprises a 2’-4’ bridge selected from -O-CH2- and -O-CH(CH3)-. B5. The oligomeric compound of embodiment B1, wherein the at least one modified nucleoside comprises a non-bicyclic modified sugar. B6. The oligomeric compound of embodiment B5, wherein the non-bicyclic modified sugar moiety is a 2’-substituted sugar moiety or a 5’-substituted sugar moiety. B7. The oligomeric compound of embodiment B6, wherein the 2’-substitued sugar moiety is a 2'-MOE sugar moiety, a 2’-OMe sugar moiety or a 2’-F sugar moiety; or the 5’-substituted sugar moiety is a 5’-methyl modified sugar moiety or 5’-ethyl modified sugar moiety. B8. The oligomeric compound of embodiment B1, wherein the at least one modified nucleoside comprises a sugar surrogate. B9. The oligomeric compound of embodiment B8, wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), six- membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA). B10. The oligomeric compound of any one of embodiments A1-B9, wherein the modified oligonucleotide is a gapmer. B11. The oligomeric compound of any one of embodiments A1-B10, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. B12. The oligomeric compound of embodiment B11, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. B13. The oligomeric compound of any one of embodiments A1-B12, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. B14. The oligomeric compound of any one of embodiments B13, wherein the modified oligonucleotide comprises phosphodiester internucleoside linkages and a phosphorothioate internucleoside linkages. B15. The oligomeric compound of any one of embodiments B11-B14, wherein the modified oligonucleotide comprises at least one mesyl phosphoramidate linkage. B16. The oligomeric compound of any one of embodiments B11-B15, wherein the modified oligonucleotide comprises at least one busyl phosphoramidate linkage. B17. The oligomeric compound of any one of embodiments B11-B16, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. B18. The oligomeric compound of any one of embodiments B11-B17, wherein the modified oligonucleotide comprises an internucleoside linkage motif (from 5' to 3’) selected from sososssssssssssooss, sooosssssssssssooss and soooossssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage, and optionally each “s” represents a (S)-phosphorothioate internucleoside linkage. B19. The oligomeric compound of any one of embodiments A1-B18, wherein the modified oligonucleotide comprises at least one modified nucleobase. B20. The oligomeric compound of embodiment B19, wherein the modified nucleobase is a 5-methylcytosine. B21. The oligomeric compound of embodiment B20, wherein each cytosine is a 5- methylcytosine. B22. The oligomeric compound of any one of embodiments A1-B21, comprising a deoxy region consisting of two or more contiguous nucleosides each comprising a 2'- beta-deoxyribosyl sugar moiety. B23. The oligomeric compound of embodiment B22, wherein the deoxy region consists of 3, 4, 5, 6, 7, 8, 9, 10, or 3-10, contiguous nucleosides, each comprising a 2'-beta-deoxyribosyl sugar moiety. B24. The oligomeric compound of embodiment B22 or B23, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar. B25. The oligomeric compound of any one of embodiments A1-B25, wherein the modified oligonucleotide comprises: a 5’-region consisting of 1-6 linked 5’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’-region consisting of 1-6 linked 3’-region nucleosides; wherein: each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety, and three or more of the central region nucleosides comprise a 2’-beta-D-deoxyribosyl sugar moiety. B26. The oligomeric compound of any one of embodiments A1-B25, wherein the modified oligonucleotide comprises: a 5’-region consisting of 5 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 5 linked 3’-region nucleosides; wherein: each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety, and three or more of the central region nucleosides comprise a 2’-beta-deoxyribosyl sugar moiety. B27. The oligomeric compound of embodiment B25 or B26, wherein each of the 5’- region nucleosides and each of the 3’-region nucleosides comprises a 2’-substituted sugar moiety. B28. The oligomeric compound of embodiment B27, wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a 2’-MOE sugar moiety. B29. The oligomeric compound of any one of embodiments B25-B28, wherein the central region comprises four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten central region nucleosides comprising a 2'-beta- deoxyribosyl sugar moiety. B30. The oligomeric compound of any one of embodiments B25-B29, wherein the central region comprises 1, 2, 3, 4 or 5, or 1 to 5, modified sugar moieties. B31. The oligomeric compound of embodiment B30, wherein one or more of the modified sugar moieties is a non-bicyclic modified sugar moiety. B32. The oligomeric compound of embodiment B30 or B31, wherein one or more of the modified sugar moieties is a bicyclic modified sugar moiety. B33. The oligomeric compound of any one of embodiments B30-B32, wherein one or more of the modified sugar moieties comprises a 2’ substituent. B34. The oligomeric compound of embodiment B33, wherein one or more of the modified sugar moieties is a 2’-OMe modified sugar moiety. B35. The oligomeric compound of any one of embodiments B30-B34, wherein one or more of the modified sugar moieties comprises a 5’ substituent. B36. The oligomeric compound of embodiment B35, wherein one or more of the modified sugar moieties is a 5’-methyl modified sugar moiety or 5’-ethyl modified sugar moiety. B37. The oligomeric compound of any one of embodiments B25-B36, wherein: the central region comprises a 5’ terminus; and position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises a modified sugar moiety. B38. The oligomeric compound of embodiment B37, wherein position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises a modified sugar moiety comprising a 2’ substituent. B39. The oligomeric compound of embodiment B38, wherein the modified sugar moiety independently is a 2’-OMe modified sugar moiety. B40. The oligomeric compound of any one of embodiments B25-B39, wherein: the central region comprises a 5’ terminus; and position 3, or position 4, or positions 3 and 4 of the central region, as counted from the 5' terminus of the central region, each independently comprises a modified sugar moiety. B41. The oligomeric compound of embodiment B40, wherein position 3, or position 4, or positions 3 and 4 of the central region, as counted from the 5' terminus of the central region, each independently comprises modified sugar moiety comprising a 5’ substituent. B42. The oligomeric compound of embodiment B41, wherein position 3, or position 4, or positions 3 and 4 of the central region, as counted from the 5' terminus of the central region, each independently comprises a 5’-methyl modified sugar moiety. B43. The oligomeric compound of embodiment B42, wherein the 5’-methyl modified sugar moiety independently is a R-5’-methyl modified sugar moiety or a S-5’-methyl modified sugar moiety. B44. The oligomeric compound of any one of embodiments B25-B43, wherein the central region comprises 1, 2, 3, 4 or 5, or 1 to 5, mesyl phosphoramidite and / or busyl phosphoramidite internucleoside linkages. B45. The oligomeric compound of embodiment B44, wherein: the central region comprises a 5’ terminus; and position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises a mesyl phosphoramidite and / or a busyl phosphoramidite internucleoside linkage. B46. The oligomeric compound of any one of embodiments B25-B45, wherein the central region comprises 1, 2, 3, 4 or 5, 1 to 5, alkylphosphonate internucleoside linkages. B47. The oligomeric compound of embodiment B46, wherein: the central region comprises a 5’ terminus; and position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises an alkylphosphonate internucleoside linkage. B48. The oligomeric compound of embodiment B46 or B47, wherein the alkylphosphonate internucleoside linkage comprises methoxypropyl (MOP). B49. The oligomeric compound of any one of embodiments B25-B48, wherein the central region comprises the deoxy region of any one of embodiments B22-B24. B50. The oligomeric compound of embodiment B49, wherein the modified oligonucleotide comprises a sugar motif of 5’-eeeeeddddddddddeeeee-3’, wherein each "d " represents a 2’-beta-D-deoxyribosyl sugar moiety, each “e” represents a 2’- MOE sugar moiety. B51. The oligomeric compound of any one of embodiments A1-B50, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 18-22, or 18-20 linked nucleosides, or a pharmaceutically acceptable salt thereof. B52. The oligomeric compound of any one of embodiments A1-B51, wherein the modified oligonucleotide consists of 20 linked nucleosides, or a pharmaceutically acceptable salt thereof. B53. The oligomeric compound of embodiment B51 or B52, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium. B54. The oligomeric compound of any one of embodiments A1-B53, wherein the modified oligonucleotide consists of 20 linked nucleosides. B55. The oligomeric compound of any one of embodiments A1-B54, wherein the oligomeric compound consists of the modified oligonucleotide. B56. The oligomeric compound of any one of embodiments A1-B54, wherein the oligomeric compound comprises a conjugate group. B57. The oligomeric compound of embodiment B56, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. B58. The oligomeric compound of embodiment B57, wherein the conjugate linker is a phosphodiester linker. B59. The oligomeric compound of embodiment B57, wherein the conjugate linker consists of a single bond. B60. The oligomeric compound of any one of embodiments B57-B59, wherein the conjugate linker is cleavable. B61. The oligomeric compound of any one of embodiments B57-B60, wherein the conjugate linker comprises 1-3 linker-nucleosides. B62. The oligomeric compound of any one of embodiments B56-B61, wherein the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide. B63. The oligomeric compound of any one of embodiments B56-B62, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide. B64. The oligomeric compound of any one of embodiments A1-B63, wherein the oligomeric compound comprises a terminal group. B65. The oligomeric compound of any one of embodiments A1-B64, wherein the oligomeric compound does not comprise linker-nucleosides. C1. A composition, comprising an oligomeric compound of any one of embodiments A1-B65. C2. The composition of embodiment C1, wherein the oligomeric compound comprises at least one phosphorothioate internucleoside linkage, and the composition comprises a plurality of the oligomeric compound in a population of oligomeric compounds. C3. The composition of embodiment C2, wherein the population is a chirally enriched population, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration. C4. The composition of embodiment C3, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a (Sp) configuration. C5. The composition of embodiment C3, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a (Rp) configuration. C6. The composition of embodiment C3, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. C7. The composition of embodiment C6, wherein the population is enriched for modified oligonucleotides having a (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having a (Rp) configuration at each phosphorothioate internucleoside linkage. C8. The composition of embodiment C3, wherein the population is enriched for modified oligonucleotides having a (Rp) configuration at one particular phosphorothioate internucleoside linkage and a (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. C9. The composition of embodiment C3, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in (Sp), (Sp) and (Rp) configurations, in the 5’ to 3’ direction. C10. The composition of embodiment C2, wherein the phosphorothioate internucleoside linkages of the modified oligonucleotides in the population are stereo- random. C11. The composition of any one of embodiments C1-C10, wherein the modified oligonucleotides in the population is single stranded. C12. A composition of any one of embodiments C1-C11, comprising an oligomeric duplex, wherein: the oligomeric compound of any one of embodiments A1-B65 is a first oligomeric compound; the oligomeric duplex comprises the first oligomeric compound and a second oligomeric compound; and the second oligomeric compound comprises a second modified oligonucleotide. C13. The composition of embodiment C12, wherein: the second modified oligonucleotide consists of 12 to 50 linked nucleosides; and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. C14. The composition of embodiment C11 or C12, wherein the modified oligonucleotide of the first oligomeric compound and / or the second oligomeric compound comprises a 5’-stabilized phosphate group. C15. The composition of embodiment C14, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate. C16. The composition of any one of embodiments C12-C15, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety. C17. The composition of embodiment C16, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety. C18. The composition of embodiment C17, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH2- and -O-CH(CH3)-. C19. The composition of embodiment C18, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety. C20. The composition of embodiment C19, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-OMe sugar moiety or a 2’-F sugar moiety. C21. The composition of any one of embodiments C12-C120, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate. C22. The composition of any one of embodiments C12-C21, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage. C23. The composition of embodiment C22, wherein the at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage. C24. The composition of any one of embodiments C12-C23, wherein the second modified oligonucleotide comprises at least one mesyl phosphoramidate (MsPA) linkage. C25. The composition of embodiment C23, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage. C26. The composition of any one of embodiments C12-C25, wherein the second modified oligonucleotide comprises at least one modified nucleobase. C27. The composition of embodiment C26, wherein the at least one modified nucleobase is 5-methylcytosine. C28. The composition of any one of embodiments C12-C27, wherein the second oligomeric compound comprises a conjugate group. C29. The composition of embodiment C28, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. C30. The composition of embodiment C29, wherein the conjugate linker consists of a single bond. C31. The composition of embodiment C29 or C30, wherein the conjugate linker is cleavable. C32. The composition of any one of embodiments C29-C31, wherein the conjugate linker comprises 1-3 linker-nucleosides. C33. The composition of any one of embodiments C29-C32, wherein the conjugate linker is a phosphodiester linker. C34. The composition of any one of embodiments C28-C33, wherein the conjugate group is attached to the 5’-end of the second modified oligonucleotide. C35. The composition of any one of embodiments C28-C33, wherein the conjugate group is attached to the 3’-end of the second modified oligonucleotide. C36. The composition of any one of embodiments C28-C33, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide. C37. The composition of any one of embodiments C28-C36, wherein the conjugate group comprises a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. C38. The composition of any one of embodiments C28-C37, wherein the conjugate group comprises a cell-targeting moiety. C39. The composition of any one of embodiments C12-C38, wherein the second modified oligonucleotide comprises a terminal group. C40. The composition of embodiment C39, wherein the terminal group is an abasic sugar moiety. C41. A composition, comprising an antisense agent, the antisense agent comprising or consisting of an antisense compound, wherein the antisense compound is the oligomeric compound of any one of embodiments A1-B65 or is in a composition of any one of embodiments C1-C11. C42. A composition, comprising an antisense agent, wherein the antisense agent is the oligomeric duplex of any one of embodiments C12-C40. C43. The composition of embodiment C41 or C42, wherein the antisense agent is: (i) an RNase H agent capable of reducing the amount of SCN2A nucleic acid through the activation of RNase H; or (ii) an RNAi agent capable of reducing the amount of SCN2A nucleic acid through the activation of RISC / Ago2. C44. The composition of any one of embodiments C41-C43, wherein the antisense agent comprises a conjugate group, and wherein the conjugate group comprises a cell- targeting moiety. D1. A pharmaceutical composition comprising an oligomeric compound of any one of embodiments A1-B65 or a composition of any one of embodiments C1-C44, and a pharmaceutically acceptable diluent. D2. The pharmaceutical composition of embodiment D1, wherein the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial CSF (aCSF). D3. The pharmaceutical composition of embodiment D1 or D2, consisting essentially of the oligomeric compound of any one of embodiments A1-B65 or a composition of any one of embodiments C1-C44, and aCSF. D4. The pharmaceutical composition of embodiment D1 or D2, consisting essentially of the oligomeric compound of any one of embodiments A1-B65 or a composition of any one of embodiments C1-C44, and PBS. E1. A method for administering an oligomeric compound of any one of embodiments A1-B65, or a composition of any one of embodiments C1-C44, or pharmaceutical composition of any one of embodiments D1-D4, to a cell or tissue. E2. A method for administering an oligomeric compound of any one of embodiments A1-B65, or a composition of any one of embodiments C1-C44, or pharmaceutical composition of any one of embodiments D1-D4, to a cell or tissue of a subject. E3. The method of embodiment E1 or E2, wherein the oligomeric compound, composition or pharmaceutical composition is administered in vitro or ex vivo. E4. The method of embodiment E1 or E2, wherein the oligomeric compound, composition or pharmaceutical composition is administered in vivo. E5. The method of any one of embodiments E1-E4, wherein the oligomeric compound, composition or pharmaceutical composition is administered in an amount sufficient to selectively reduce expression of a SCN2A allelic variant. E6. The method of embodiment E5, wherein the oligomeric compound, composition or pharmaceutical composition is administered in an amount sufficient to selectively reduce expression of the SCN2A allelic variant by at least 20%. E6.1. The method of embodiment E5 or E6, wherein: the oligomeric compound, composition or pharmaceutical composition is administered in an amount sufficient to selectively reduce expression of the SCN2A allelic variant by at least 2-fold compared to expression of another SCN2A allelic variant; or optionally the oligomeric compound selectively reduces expression of a first SCN2A allelic variant according to a selectivity ratio of at least 2 or greater than 2, wherein the selectivity ratio is (i) inhibition of expression of a second SCN2A allelic variant to (ii) inhibition of expression of the first SCN2A allelic variant, or optionally wherein the inhibition of expression of the second SCN2A allelic variant is an IC50 value and the inhibition of expression of the first SCN2A allelic variant is an IC50 value. E7. The method of any one of embodiments E1-E6.1, to treat a SCN2A-associated medical condition, wherein the SCN2A-associated medical condition optionally is SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A- associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy. E8. A method for treating a SCN2A-associated medical condition, comprising administering an oligomeric compound of any one of embodiments A1-B65, or a composition of any one of embodiments C1-C44, or pharmaceutical composition of any one of embodiments D1-D4, to a cell or tissue of a subject in need thereof in an amount sufficient to treat the SCN2A-associated medical condition, wherein the SCN2A-associated medical condition optionally is SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy. E9. The method of embodiment E8, wherein the oligomeric compound, composition or pharmaceutical composition is administered in an amount sufficient to selectively reduce expression of a SCN2A allelic variant. E10. The method of embodiment E9, wherein the oligomeric compound, composition or pharmaceutical composition is administered in an amount sufficient to selectively reduce expression of the SCN2A allelic variant by at least 20%. E11. The method of embodiment E9 or E10, wherein: the oligomeric compound, composition or pharmaceutical composition is administered in an amount sufficient to selectively reduce expression of the SCN2A allelic variant by at least 2-fold compared to expression of another SCN2A allelic variant; or optionally the oligomeric compound selectively reduces expression of a first SCN2A allelic variant according to a selectivity ratio of at least 2 or greater than 2, wherein the selectivity ratio is (i) inhibition of expression of a second SCN2A allelic variant to (ii) inhibition of expression of the first SCN2A allelic variant, or optionally wherein the inhibition of expression of the second SCN2A allelic variant is an IC50 value and the inhibition of expression of the first SCN2A allelic variant is an IC50 value. E12. The method of any one of embodiments E7-E11, wherein at least one symptom or hallmark is ameliorated. E13. The method of embodiment E12, wherein the symptom or hallmark is one or more of seizure; self-limited seizure; developmental delay; intellectual disability; behavior disorder; autism spectrum disorder feature; poor muscle tone (hypotonia); movement disorder; feeding difficulty; vision difficulty; and cortical visual impairment (CVI). E14. The method of any one of embodiments E7-E13, wherein administering the oligomeric compound, composition or pharmaceutical composition reduces or delays onset or progression of one or more of seizure; self-limited seizure; developmental delay; intellectual disability; behavior disorder; autism spectrum disorder feature; poor muscle tone (hypotonia); movement disorder; feeding difficulty; vision difficulty; and cortical visual impairment (CVI). E15. The method of any one of embodiments E1-E14, wherein the cell is or the tissue comprises a neuronal cell, stem cell-derived neuronal cell or induced pluripotent stem cell (iPSc)-derived neuronal cell. E16. The method of any one of embodiments E1-E15, wherein the cell is or the tissue comprises a human cell. E17. The method of any of one of embodiments E2-E16, wherein the oligomeric compound, the composition or the pharmaceutical composition is administered to the central nervous system or is administered systemically. E18. The method of embodiment E17, wherein the oligomeric compound, the composition, or the pharmaceutical composition is administered by intrathecal administration or by intracerebroventricular administration. E19. The method of any one of embodiments E2-E18, wherein the subject is human. E20. The method of any one of embodiments E1-E19, wherein the cell or tissue comprises a SCN2A nucleic acid comprising a pathogenic genetic variant associated with a medical condition. E21. The method of embodiment E20, wherein the pathogenic genetic variant is associated with a non-loss of function effect, and optionally is associated with a dominant negative effect, gain of function or toxic gain of function. E22. The method of embodiment E20 or E21, wherein the medical condition is a SCN2A-associated medical condition, which optionally is SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy. E23. The method of any one of embodiments E20-E22, wherein the pathogenic genetic variant is a pathogenic single nucleotide variant. E24. The method of embodiment E23, wherein the pathogenic single nucleotide variant comprises a non-synonymous single nucleotide variant at a pathogenic genetic variation position. E25. The method of any one of embodiments E20-E24, wherein the pathogenic genetic variant results in one of the following amino acid substitutions: V261M, R853Q, H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, P1658S or R1882Q. E26. The method of any one of embodiments E20-E25, wherein the pathogenic genetic variant is in an exon, optionally in exon 15 or exon 27. E27. The method of any one of embodiments E20-E26, wherein the pathogenic genetic variant is c.2558G>A genetic variant or c.5645G>A genetic variant, or optionally is in a pathogenic genetic variation site comprising a nucleobase sequence of SEQ ID NO:9 or SEQ ID NO:33. F1. A method for selectively reducing expression of a SCN2A allelic variant containing a differentiating variation site in a cell, tissue or subject, comprising administering to a cell, tissue or subject an oligomeric compound comprising a modified oligonucleotide complementary to a differentiating variation site of a SCN2A allelic variant in an amount effective to selectively reduce expression of the SCN2A allelic variant. F2. The method of embodiment F1, wherein the differentiating variation site comprises or consists of a single nucleotide variation site. F3. The method of embodiment F2, wherein the single nucleotide variation site comprises a single nucleotide variation position and the modified oligonucleotide comprises a nucleoside aligned with the single nucleotide variation position. F4. The method of embodiment F3, wherein the modified oligonucleotide comprises a nucleoside aligned with and complementary to a nucleoside at the single nucleotide variation position. F5. The method of embodiment F4, wherein the SCN2A allelic variant is a first SCN2A allelic variant, the modified oligonucleotide comprises a nucleoside aligned with and complementary to a first nucleoside at the single nucleotide variation position of the first SCN2A allelic variant and not complementary to a second nucleoside at the single nucleotide variation position of a second SCN2A allelic variant. F6. The method of embodiment F5, wherein the modified oligonucleotide is capable of selectively reducing expression of the first SCN2A allelic variant to a greater extent than expression of the second SCN2A allelic variant. F7. The method of embodiment F6, wherein: the modified oligonucleotide is capable of selectively reducing expression of the first SCN2A allelic variant by at least 2-fold compared to expression of the second SCN2A allelic variant; or optionally the oligomeric compound selectively reduces expression of the first SCN2A allelic variant according to a selectivity ratio of at least 2 or greater than 2, wherein the selectivity ratio is (i) inhibition of expression of the second SCN2A allelic variant to (ii) inhibition of expression of the first SCN2A allelic variant, or optionally wherein the inhibition of expression of the second SCN2A allelic variant is an IC50 value and the inhibition of expression of the first SCN2A allelic variant is an IC50 value. F8. The method of any one of embodiment F3-F7, wherein: the modified oligonucleotide consists of 10-30 linked nucleosides and the nucleoside at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the single nucleotide variation position; or the modified oligonucleotide consists of 18-22 linked nucleosides, or optionally consists of 20 nucleosides, and the nucleoside at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the single nucleotide variation position. F9. The method of any one of embodiments F3-F8, wherein the modified oligonucleotide comprises: a 5’-region consisting of linked 5’-region nucleosides; a central region consisting of linked central region nucleosides; a 3’-region consisting of linked 3’-region nucleosides; the central region comprises a 5’ terminus; and the nucleoside at position 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of the central region, as counted from the 5' terminus of the central region, aligns with the single nucleotide variation position. F10. The method of any one of embodiments F2-F9, wherein: the single nucleotide variation site is within a SCN2A intron, or optionally is within SCN2A intron 3, intron 11, intron 13, intron 17, or intron 22, or optionally is within SCN2A intron 11 or intron 22. F11. The method of any one of embodiments F2-F10, wherein: the single nucleotide variation site is selected from one of rs3769931, rs72872496, rs544136707, rs72874313, rs3769944, rs3769947, rs2304017, rs72874358 and rs1368238, or optionally is selected from one of rs3769931, rs72872496, rs72874313, rs3769944, rs72874358 and rs1368238, or optionally is rs72874313 or rs1368238. F12. The method of any one of embodiments F2-F11, wherein: the single nucleotide variation site is selected from one of SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:31, or optionally is selected from one of SEQ ID NO:26 to SEQ ID NO:30. F12.1. The method of any one of embodiments F2-F12, wherein the single nucleotide variation site is in: SCN2A intron 3; or genetic variation site rs3769931; or a portion corresponding to SCN2A chromosome 2 positions 165299693-165299753; or a portion corresponding to SCN2A chromosome 2 positions 165299709- 165299738; or SEQ ID NO:1; or SEQ ID NO:26; or SCN2A intron 3; or genetic variation site rs72872496; or a portion corresponding to SCN2A chromosome 2 positions 165300913-165300973; or a portion corresponding to SCN2A chromosome 2 positions 165300938- 165300958; or SEQ ID NO:2; or SEQ ID NO:27; or SCN2A intron 11; or genetic variation site rs72874313; or a portion corresponding to SCN2A chromosome 2 positions 165322197-165322257; or a portion corresponding to SCN2A chromosome 2 positions 165322222- 165322242; or SEQ ID NO:4; or SEQ ID NO:28; or SCN2A intron 13; or genetic variation site rs3769944; or a portion corresponding to SCN2A chromosome 2 positions 165329668-165329728; or a portion corresponding to SCN2A chromosome 2 positions 165329684- 165329704; or SEQ ID NO:5; or SEQ ID NO:29; or SCN2A intron 17; or genetic variation site rs72874358; or a portion corresponding to SCN2A chromosome 2 positions 165355671-165355731; or a portion corresponding to SCN2A chromosome 2 positions 165355687- 165355709; or SEQ ID NO:8; or SEQ ID NO:30; or corresponding to SCN2A intron 22; or genetic variation site rs1368238; or a portion corresponding to SCN2A chromosome 2 positions 165375094- 165375154; or SEQ ID NO:31. F13. The method of embodiment F12 or F12.1, wherein: the single nucleotide variation site is SEQ ID NO:4, or optionally is SEQ ID NO:28. F14. The method of any one of embodiments F2-F13, wherein the single nucleotide variation site comprises: (i) a nucleotide variant at the single nucleotide variation position described in Table C; or (ii) the “v1” nucleotide variant at the single nucleotide variation position described in Table C; or (iii) the “v2” nucleotide variant at the single nucleotide variation position described in Table C. F15. The method of any one of embodiments F2-F14, wherein the modified oligonucleotide comprises or consists of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NO:10 to SEQ ID NO:25 or SEQ ID NO:32; or optionally SEQ ID NO:10 to SEQ ID NO:14 or SEQ ID NO:16 to SEQ ID NO:19 or SEQ ID NO:22 to SEQ ID NO:25; or optionally SEQ ID NO:10 to SEQ ID NO:12; or optionally SEQ ID NO:13 or SEQ ID NO:14; or optionally SEQ ID NO:16 or SEQ ID NO:17; or optionally SEQ ID NO:18 or SEQ ID NO:19; or optionally SEQ ID NO:22 to SEQ ID NO:25. F16. The method of embodiment F15, wherein the modified oligonucleotide comprises or consists of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of SEQ ID NO:16 or SEQ ID NO:32. F17. The method of any one of embodiments F1-F16, the modified oligonucleotide comprises or consists of a nucleobase sequence that is at least 85% complementary to, or at least 90% complementary to, or at least 95% complementary, or is 100% complementary to, an equal length portion of the differentiating variation site. F18. The method of any of embodiments F1-F17, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, or 20 to 50 linked nucleosides. F19. The method of any one of embodiments F2-F18, wherein the single nucleotide variation site comprises a synonymous single nucleotide variation. F20. The method of any one of embodiments F1-F19, wherein the differentiating variation site comprises a genetic variant present in at least 20% of a population. F21. The method of embodiment F20, wherein the differentiating genetic variant is present in at least 25% of a population, or at least 30% of a population, or at least 35% of a population, or at least 40% of a population, or at least 45% of a population, or at least 50% of a population, or at least 55% of a population, or at least 60% of a population, or at least 65% of a population, or at least 70% of a population, or at least 75% of a population, or at least 80% of a population, or at least 85% of a population, or at least 90% of a population. F22. The method of any one of embodiments F1-F21, wherein the differentiating genetic variant is present in at least 75% of a population. F23. The method of embodiment F22, wherein the differentiating genetic variant is present in at least 80% of a population. F24. The method of any one of embodiments F1-F23, wherein the SCN2A allelic variant is a mutant SCN2A allele associated with a medical condition. F25. The method of any one of embodiments F1-F24, wherein the SCN2A allelic variant comprises a pathogenic genetic variation site associated with a medical condition. F26. The method of embodiment F24 or F25, wherein the medical condition is a SCN2A-associated medical condition, which optionally is SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy. F27. The method of any embodiment F25 or F26, wherein the pathogenic genetic variation site is associated with a non-loss of function phenotype. F28. The method of embodiment F27, wherein the non-loss of function phenotype is a dominant negative phenotype, a gain of function phenotype or toxic gain of function phenotype. F29. The method of any one of embodiments F25-F28, wherein the pathogenic genetic variation site is a pathogenic single nucleotide variation site. F30. The method of embodiment F29, wherein the pathogenic single nucleotide variation site comprises a non-synonymous single nucleotide variation at a pathogenic genetic variation position. F31. The method of any one of embodiments F25-F30, wherein the pathogenic genetic variation site contains a variant resulting in one of the following amino acid substitutions: V261M, R853Q, H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, P1658S or R1882Q. F32. The method of embodiment F31, wherein the pathogenic genetic variation site is in an exon, optionally in exon 15 or exon 27. F33. The method of any one of embodiments F25-F32, wherein the pathogenic genetic variation site comprises a c.2558G>A genetic variant or c.5645G>A genetic variant, or optionally comprises a nucleobase sequence of SEQ ID NO:9 or SEQ ID NO:33. F34. The method of any one of embodiments F30-F33, wherein the equal length portion of the differentiating variation site contains the pathogenic genetic variation position, or contains the pathogenic genetic variation site or portion thereof. F35. The method of any one of embodiments F30-F33, wherein the equal length portion of the differentiating variation site does not contain the pathogenic genetic variation position, or does not contain the pathogenic genetic variation site or portion thereof. F36. The method of any one of embodiments F1-F35, wherein the oligomeric compound, composition or pharmaceutical composition is administered in an amount sufficient to selectively reduce expression of the SCN2A allelic variant by at least 20%. F37. The method of any one of embodiments F1-F36, wherein the oligomeric compound is administered in vitro or ex vivo. F38. The method of any one of embodiments F1-F36, wherein the oligomeric compound is administered in vivo. F39. The method of any one of embodiments F1-F38, wherein the oligomeric compound is administered to a cell or tissue of a subject in need thereof in an amount sufficient to treat a SCN2A-associated medical condition, which optionally is SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A- associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy. F40. The method of embodiment F39, wherein at least one symptom or hallmark of a SCN2A-associated medical condition is ameliorated. F41. The method of embodiment F40, wherein the symptom or hallmark is one or more of seizure; self-limited seizure; developmental delay; intellectual disability; behavior disorder; autism spectrum disorder feature; poor muscle tone (hypotonia); movement disorder; feeding difficulty; vision difficulty; and cortical visual impairment (CVI). F42. The method of any one of embodiments F39-F41, wherein administering the oligomeric compound reduces or delays onset or progression of one or more of seizure; self-limited seizure; developmental delay; intellectual disability; behavior disorder; autism spectrum disorder feature; poor muscle tone (hypotonia); movement disorder; feeding difficulty; vision difficulty; and cortical visual impairment (CVI). F43. The method of any one of embodiments F1-F42, wherein the cell is or the tissue comprises a neuronal cell, stem cell-derived neuronal cell or induced pluripotent stem cell (iPSc)-derived neuronal cell. F44. The method of any one of embodiments F1-F43, wherein the cell is or the tissue comprises a human cell. F45. The method of any of one of embodiments F1-F44, wherein the oligomeric compound, the composition or the pharmaceutical composition is administered to the central nervous system or is administered systemically. F46. The method of embodiment F45, wherein the oligomeric compound is administered by intrathecal administration or by intracerebroventricular administration. F47. The method of any one of embodiments F1-F46, wherein the subject is human. F48. The method of any one of embodiments F1-F47, wherein the oligomeric compound is of any one of embodiments A1-B65, or is in a composition of any one of embodiments C1-C44, or is in a pharmaceutical composition of any one of embodiments D1-D4. G1. A method for administering an oligomeric compound, comprising: determining presence or absence of a differentiating variation site in a SCN2A nucleic acid; and if a differentiating variation site is present, administering an oligomeric compound targeted to the differentiating variation site. G2. The method of embodiment G1, comprising: genotyping a genetic variation site of the SCN2A nucleic acid, thereby providing a SCN2A nucleic acid genotype; and determining presence or absence of the differentiating variation site according to the genotype. G3. The method of embodiment G1 or G2, wherein the SCN2A nucleic acid is from a cell or tissue. G4. The method of any one of embodiments G1-G3, wherein the SCN2A nucleic acid is from a subject. G5. The method of embodiment G3 or G4, wherein the cell, tissue or subject is a human cell, human tissue or human subject. G6. The method of any one of embodiments G1-G5, wherein the SCN2A nucleic acid is from a subject having a medical condition. G7. The method of embodiment G6, wherein the medical condition is a SCN2A- associated medical condition, which optionally is SCN2A-associated autism, SCN2A- associated neurodevelopmental disorder, SCN2A-associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A- associated self-limited neonatal / infantile epilepsy. G8. The method of any one of embodiments G1-G7, wherein the SCN2A nucleic acid comprises a mutant SCN2A allelic variant. G9. The method of embodiment G8, wherein a genotype is determined for the mutant SCN2A allelic variant. G10. The method of embodiment G8 or G9, comprising determining whether the mutant SCN2A allelic variant comprises a differentiating variant at the genetic variation site, thereby determining presence or absence of a differentiating variant. G11. The method of embodiment G10, comprising, if a differentiating variant is present, administering an oligomeric compound targeted to the differentiating variant. G12. The method of any one of embodiments G8-G11, comprising characterizing a pathogenic genetic variation site in the mutant SCN2A allelic variant. G13. The method of embodiment G12, wherein the characterizing comprises determining a genotype of the pathogenic genetic variant. G14. The method of embodiment G12 or G13, wherein the characterizing comprises determining presence or absence of a non-loss of function genetic variant. G15. The method of embodiment G14, wherein the characterizing comprises determining presence or absence of a dominant negative variant, gain of function genetic variant or toxic gain of function genetic variant. G16. The method of any one of embodiments G12-G15, wherein the pathogenic genetic variation site contains a variant resulting in one of the following amino acid substitutions: V261M, R853Q, H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, P1658S or R1882Q. G17. The method of any one of embodiments G12-G16, wherein the pathogenic genetic variation site is in an exon, optionally in exon 15 or exon 27. G18. The method of any one of embodiments G12-G16, wherein the pathogenic genetic variation site comprises a c.2558G>A genetic variant or c.5645G>A genetic variant, or optionally comprises a nucleobase sequence of SEQ ID NO:9 or SEQ ID NO:33. G19. The method of any one of embodiments G14 or G15, comprising, if presence of the pathogenic genetic variant is determined, or optionally if presence of the non-loss of function genetic variant is determined, administering the oligomeric compound targeted to the differentiating variation site. G20. The method of any one of embodiments G1-G19, wherein determining the presence or absence of the differentiating variation site, optionally characterizing the pathogenic genetic variant, and optionally the genotyping, comprises sequencing the SCN2A nucleic acid. G21. The method of embodiment G20, wherein the sequencing comprises short read sequencing, or long read sequencing, or short read sequencing and long read sequencing. G22. The method of any one of embodiments G1-G21, wherein the oligomeric compound is of any one of embodiments A1-B65, is in a composition of any one of embodiments C1-C44, or is in a pharmaceutical composition of any one of embodiments D1-D4. G23. The method of any one of embodiments G1-G22, wherein administering the oligomeric compound is according to any one of embodiments E1-E27. G24. The method of any one of embodiments G1-G23, wherein the oligomeric compound is targeted to a SCN2A allelic variant and is capable of selectively reducing expression of the SCN2A allelic variant. G25. The method of any one of embodiments G1-G24, wherein administering the oligomeric compound is according to any one of embodiments F1-F48. H1. An oligomeric compound of any one of embodiments A1-B65, a composition of any one of embodiments C1-C44, or a pharmaceutical composition of any one of embodiments D1-D4, for reducing SCN2A expression. H2. An oligomeric compound of any one of embodiments A1-B65, a composition of any one of embodiments C1-C44, or a pharmaceutical composition of any one of embodiments D1-D4, for treating a medical condition. H3. Use of an oligomeric compound of any one of embodiments A1-B65, a composition of any one of embodiments C1-C44, or a pharmaceutical composition of any one of embodiments D1-D4, for reducing SCN2A expression. H4. Use of an oligomeric compound of any one of embodiments A1-B65, a composition of any one of embodiments C1-C44, or a pharmaceutical composition of any one of embodiments D1-D4, for treating a medical condition. H5. Use of oligomeric compound of any one of embodiments A1-B65, a composition of any one of embodiments C1-C44, or a pharmaceutical composition of any one of embodiments D1-D4, for the manufacture of a medicament for reducing SCN2A expression. H6. Use of oligomeric compound of any one of embodiments A1-B65, a composition of any one of embodiments C1-C44, or a pharmaceutical composition of any one of embodiments D1-D4, for the manufacture of a medicament for treating a medical condition. H7. The oligomeric compound, composition, pharmaceutical composition or use of any one of embodiments H2, H4 or H6, wherein the medical condition is a SCN2A- associated medical condition, which optionally is SCN2A-associated autism, SCN2A- associated neurodevelopmental disorder, SCN2A-associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A- associated self-limited neonatal / infantile epilepsy. H8. The oligomeric compound, composition, pharmaceutical composition or use of any one of embodiments H1-H7, for administration according to any one of embodiments E1-E27, F1-F48 or G1-G25. H9. An oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H8, with the proviso that the oligomeric compound oligonucleotide is not according to the following formula: TGomComCoAoAmCAATGTAmCAAoGoGGT (SEQ ID NO: 38), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage unless there is a phosphodiester internucleoside linkage designated by an “o” and wherein each “mC” is a 5-methyl cytidine. H10. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H9, with the proviso that the oligomeric compound oligonucleotide does not comprise or consist of the nucleobase sequence: TGCCAACAATGTACAAGGGT (SEQ ID NO: 39). H11. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H10, with the proviso that the oligomeric compound oligonucleotide is not complementary to an equal length portion containing positions hg38:Chr2: 165375115 to 165375135 of a SCN2A nucleic acid. H12. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H11, with the proviso that the oligomeric compound oligonucleotide is not complementary to an equal length portion containing a rs1368238 SNV site or SNV position of a SCN2A nucleic acid. H13. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H12, with the proviso that the oligomeric compound oligonucleotide is not complementary to an equal length portion containing a SNV site or SNV position in intron 22 of a SCN2A nucleic acid. H14. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H13, wherein the oligomeric compound is administered to a subject having a SCN2A nucleic acid that does not include a c.5645G>A variant. H15. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H10, wherein the oligomeric compound is administered to a subject having a SCN2A nucleic acid that does not include a SNV encoding a p.R1882Q amino acid substitution. H16. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H15, wherein the oligomeric compound is administered to a subject having a SCN2A nucleic acid not containing a SNV associated with hyperexcitability of neurons and / or increased sodium currents. H17. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H16, wherein the oligomeric compound is administered to a subject assessed as having one or more of: choreoathetosis, dysphagia, anxiety, and history of kidney stones. H18. The oligomeric compound, composition, pharmaceutical composition, method or use of any one of embodiments A1-H17, wherein the oligomeric compound oligonucleotide is administered to a subject assessed as not having one or more of: irritability, sensory processing disorder, gastrointestinal features, seizures, movement disorder, and hypotonia. Exemplary Oligonucleotides In certain embodiments, provided are oligomeric compounds comprising oligonucleotides that consist of linked nucleosides. Oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or can be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. Modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described. Exemplary Modified Nucleosides Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases can be incorporated into antisense oligonucleotides. Exemplary Sugar Moieties In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including, but not limited to, substituents at the 2’, 3’, 4’, and / or 5’ positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 2’-position, referred to as 2’-substituted sugar moieties. Examples of substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: -F, -OCH3 (“OMe” or “O-methyl” or “methoxy”), and - OCH2CH2OCH3 (“MOE” or “O-methoxyethyl”). In certain embodiments, 2’- substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, O-C1-C10 substituted alkoxy, O-C1-C10 alkyl, O-C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O- alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O- alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rm and Rn is, independently, hydrogen, an amino protecting group, or substituted or unsubstitutedC1-C10 alkyl, -O(CH2)2ON(CH3)2 (“DMAOE”), 2’- O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and the 2’-substituent groups described in Cook et al., U.S.6,531,584; Cook et al., U.S.5,859,221; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2,OCH2CH2OCH3 (“MOE”), O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn),O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rm and Rn is, independently, hydrogen, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl. In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3 (“NMA”). In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”). In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH3, and OCH2CH2OCH3. In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, a 2’-deoxyfuranosyl sugar moiety can be in seven isomeric configurations other than the naturally occurring beta-D-deoxyribosyl configuration. Such modified sugar moieties are described in, for example, WO2019 / 157531. A 2’-modified sugar moiety has an additional stereocenter at the 2’- position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.2’-modified sugar moieties described herein are in the beta-D-ribosyl isomeric configuration unless otherwise specified. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4’-position. Examples of substituent groups suitable for the 4’-position of modified sugar moieties include but are not limited to alkoxy (for example, methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3’-position. Examples of substituent groups suitable for the 3’-position of modified sugar moieties include, but are not limited to, alkoxy (for example, methoxy) and alkyl (for example, methyl, ethyl). In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 5’-position. Examples of substituent groups suitable for the 5’-position of modified sugar moieties include, but are not limited to, vinyl, alkoxy (for example, methoxy), and alkyl (e g., methyl (R or S), ethyl). In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836). In naturally occurring (unmodified) nucleic acids, sugars are linked to one another 3’ to 5’. In certain embodiments, oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ position or inverted 5’ to 3’. For example, where the linkage is at the 2’ position, the 2’- substituent groups may instead be at the 3’-position. Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'- CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (referred to as “constrained ethyl” or “cEt”), 4’-CH2-O-CH2-2’, 4’-CH2-N(R)-2’, 4'-CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, for example, Seth et al., U.S.7,399,845, Bhat et al., U.S.7,569,686, Swayze et al., U.S.7,741,457, and Swayze et al., U.S.8,022,193), 4'-C(CH3)(CH3)-O-2’ and analogs thereof (see, for example, Seth et al., U.S.8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, for example, Prakash et al., U.S.8,278,425), 4'-CH2-O-N(CH3)-2' (see, for example, Allerson et al., U.S.7,696,345 and Allerson et al., U.S.8,124,745), 4'-CH2- C(H)(CH3)-2' (see, for example, Zhou, et al., J. Org. Chem. ,2009, 74, 118-134), 4'- CH2-C(=CH2)-2' and analogs thereof (see for example,, Seth et al., U.S.8,278,426),4’-C(RaRb)-N(R)-O-2’, 4’-C(RaRb)-O-N(R)-2’, 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)-O-2', where each R, Ra, and Rb, is, independently, hydrogen, a protecting group, or C1-C12 alkyl (see, for example Imanishi et al., U.S.7,427,672). In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, - C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)X-, and -N(Ra)-; where: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, hydrogen, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2- C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7alicyclic radical, substituted C5-C7alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1 and J2 is, independently, hydrogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group. Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Inverts. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S.7,053,207, Imanishi et al., U.S. 6,268,490, Imanishi et al. U.S.6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S.6,794,499, Wengel et al., U.S.6,670,461; Wengel et al., U.S.7,034,133, Wengel et al., U.S.8,080,644; Wengel et al., U.S.8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S.7,572,582; and Ramasamy et al., U.S.6,525,191, Torsten et al., WO 2004 / 106356, Wengel et al., WO 1999 / 014226; Set et al. WO 2007 / 134181; Seth et al., U.S.7,547,684; Seth et al., U.S.7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S.7,750,131; Seth et al., U.S.8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S.8,546,556; Seth et al., U.S.8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S.8,501,805; Allerson et al., US2008 / 0039618; and Migawa et al., US2015 / 0191727. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) can be in the alpha-L configuration or in the beta- D configuration. LNA (beta-D-configuration) alpha-L-LNA (alpha-L-configuration) bridge = 4'-CH2-O-2' bridge = 4'-CH2-O-2' Alpha-L-methyleneoxy (4’-CH2-O-2’) or alpha-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off- target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al., (2007) Mai Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (for example, LNA or cEt) are identified in embodiments herein, they are in the beta-D configuration, unless otherwise specified. In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (for example, 5’- substituted and 4’-2’ bridged sugars). In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, for example, with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, for example, Bhat et al., U.S.7,875,733 and Bhat et al., U.S. 7,939,677) and / or the 5’ position. In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans can be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (see, for example, Leumann, CJ. Bioorg. & Med. Chem.2002, 10, 841-854), fluoro HNA: F-HNA (“F-HNA”, see for example, Swayze et al., U.S.8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S.8,796,437; and Swayze et al., U.S.9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: where, independently, for each of the modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 each, independently, is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is hydrogen, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; q1, q2, q3, q4, q5, q6 and q7 are each, independently, hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of R1 and R2 is independently selected from among hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S or NJ1 and each J1, J2, and J3 is, independently, hydrogen or C1-C6 alkyl. In certain embodiments, modified THP nucleosides are provided where q1, q2, q3, q4, q5, q6 and q7 each is hydrogen. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than hydrogen. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided where one of R1 and R2 is fluorine. In certain embodiments, R1 is fluorine and R2 is hydrogen, in certain embodiments, R1 is methoxy and R2 is hydrogen, and in certain embodiments, R1 is methoxyethoxy and R2 is hydrogen. In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et ai., U.S. 5,698,685; Summerton et al., U.S.5,166,315; Summerton et al., U.S.5,185,444; and Summerton et al., U.S.5,034,506). As used here, the term “morpholino” means a sugar surrogate that can be in a nucleoside having the following structure, where Bx is a nucleobase moiety: In certain embodiments, morpholinos can be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.” In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoliaran et al., WO2011 / 133876. In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but arc not limited to, U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500. In certain embodiments, sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. UNA is an unlocked acyclic nucleic acid, where any of the bonds of the sugar has been removed, forming an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US Patent No.8,314,227; and US Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020. In certain embodiments, a sugar surrogate is a glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below: (S)-GNA where Bx represents a nucleobase moiety. Many other bicyclic and tricyclic sugar and sugar surrogates are known in the art that can be used in modified nucleosides. Exemplary Modified Nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, 2- aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5- propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5- halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2- aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6- N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3- diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3- diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S.3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 5, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443. Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US 2003 / 0158403; Manoharan et al., US 2003 / 0175906; Dinh et al., U.S.4,845,205; Spielvogel et al., U.S.5,130,302; Rogers et al., U.S.5,134,066; Bischofberger et al., U.S.5,175,273; Urdea et al., U.S.5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S.5,434,257; Gmeiner et al., U.S.5,457,187; Cook et al., U.S.5,459,255; Froehler et al., U.S.5,484,908; Matteucci et al., U.S.5,502,177; Hawkins et al., U.S.5,525,711; Haralambidis et al., U.S.5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S.5,594,121; Switzer et al., U.S.5,596,091; Cook et al., U.S.5,614,617; Froehler et al., U.S.5,645,985; Cook et al., U.S.5,681,941; Cook et al., U.S.5,811,534; Cook et al., U.S.5,750,692; Cook et al., U.S.5,948,903; Cook et al., U.S.5,587,470; Cook et al., U.S.5,457,191; Matteucci et al., U.S.5,763,588; Froehler et al., U.S.5,830,653; Cook et al., U.S.5,808,027; Cook et al., U.S. 6,166,199; and Matteucci et al., U.S.6,005,096. Exemplary Modified Internucleoside Linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, nucleosides of modified oligonucleotides can be linked together using one or more modified internucleoside linkages. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O- C(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)- N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non- phosphorous-containing internucleoside linkages are well known to those skilled in the art. In certain embodiments, a modified internucleoside linkage is any of those described in WO 2021 / 030778. In certain embodiments, a modified internucleoside linkage comprises the formula: where independently for each internucleoside linking group of the modified oligonucleotide: X is selected from O or S; R1 is selected from hydrogen, C1-C6 alkyl, and substituted C1-C6 alkyl; and T is selected from SO2R2, C(=O)R3, and P(=O)R4R5, where: R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3 and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyd and a conjugate group; and R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl. In certain embodiments, a modified internucleoside linkage comprises a mesyl phosphoramidate linking group having a formula: . In certain embodiments, a mesyl phosphoramidate internucleoside linkage may comprise a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, where “B” indicates a nucleobase:

[0003] In certain embodiments, a modified internucleoside linkage comprises a busyl phosphoramidate linking group having a formula: Figure img f0 0002 8_00 02 . A busyl phosphoramidate internucleoside linkage may comprise a chiral center. In certain embodiments, a modified oligonucleotide can include (Rp) and / or (Sp) busyl phosphoramidates having structures corresponding to those shown for (Rp) or (Sp) mesyl phosphoramidates, respectively. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates, phosphoramidates, and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereo-random internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages where all of the phosphorothioate internucleoside linkages arc stereo-random. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereo-configuration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, for example, methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res.42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, where “B” indicates a nucleobase: Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereo-random or in a particular stereochemical configuration. Neutral internucleoside linkages include, without limitation, phosphotriesters, alkylphosphonates, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'- CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research', Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts. In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, as shown below: where each Bx independently represents any nucleobase. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain such embodiments, additional features (such as a conjugate group) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide. In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage above will be present. In certain such embodiments, additional features (such as a conjugate group) can be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide. In certain embodiments, nucleic acids can be linked 2’ to 5’ rather than the standard 3’ to 5’ linkage. Such a linkage is illustrated below, where each Bx represents any nucleobase: In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide can be described by its sugar motif, nucleobase motif and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). Exemplary Sugar Motifs In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications described herein. In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or "wings" and a central or internal region or “gap.” The three regions of a gapmer motif (the 5'-wing, the central region (or gap), and the 3’-wing) form a contiguous sequence of nucleosides where at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3’-most nucleoside of the 5’-wing and the 5’-most nucleoside of the 3’-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5’-wing differs from the sugar motif of the 3’-wing (asymmetric gapmer). In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, the central region (or gap) of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2’-beta-D-deoxyribosyl sugar moiety. In certain embodiments, at least three nucleosides, which sometimes are at least three contiguous nucleosides, of the central region of a gapmer comprise a 2’-beta-D-deoxyribosyl sugar moiety. In certain embodiments, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleosides, or 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 contiguous nucleosides, in a central region each comprise a 2’-beta-D- deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the central region of a gapmer comprises a modified sugar moiety. In certain embodiments, one or two nucleosides of the central region of a gapmer comprises a modified sugar moiety. Certain embodiments in which a central region includes at least one nucleoside comprising a modified sugar moiety and / or at least one modified internucleoside linkage are described herein. In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing / gap junction comprise 2’-beta-D- deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing / gap junction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2’-beta-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety or 2’-MOE sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, where each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2’-modification. Herein, the lengths (number of nucleosides) of the three regions of a gapmer can be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’-wing]. Thus, a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2’- beta-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing, 10 linked 2’-beta-D-deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3’-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2’-beta-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3’-wing. A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5’-wing, 8 linked 2’-beta-D- deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3’-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5’-wing and / or the 3’-wing. In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers. In certain embodiments, modified oligonucleotides have a sugar motif of 5’- eeeeeddddddddddeeeee-3’, where each "d " represents a 2’-beta-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety. Exemplary Nucleobase Motifs In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’- end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’- end of the oligonucleotide. In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’-beta-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from a 2-thiopyrimidine and a 5- propynepyrimidine. Exemplary Internucleoside Linkage Motifs In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereo-random phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, where the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereo-random. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, or Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (from 5’ to 3’) sososssssssssssooss or sooosssssssssssooss or soooossssssssssooss, where each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is a (S)- phosphorothioate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif comprising one or more mesyl phosphoramidate internucleoside linkages. In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motifs herein is substituted with a mesyl phosphoramidate internucleoside linkage. It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a scries of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides. Exemplary Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif can be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer can be the same or different from one another and can be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence. Certain oligonucleotide modifications can enhance antisense activity. An oligonucleotide may include one or more modifications described in Shen et al., Nature Biotechnology 640(37): 640–650 (2019); Migawa et al., Nucleic Acids Research 47(11): 5465–5479 (2019); Anderson et al., Nucleic Acids Research 49(16): 9026–9041 (2021) and Vasquez et al., Nucleic Acids Research 49(4): 1828–1839 (2021). In certain embodiments, an oligomeric compound comprises a central region, and the central region comprises 1 to 5 (1, 2, 3, 4 or 5 for example) mesyl phosphoramidite and / or busyl phosphoramidite internucleoside linkages. In certain embodiments, the central region comprises a 5’ terminus, and position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises a mesyl phosphoramidite and / or a busyl phosphoramidite internucleoside linkage. In certain embodiments, the central region comprises a 5’ terminus, and position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises a mesyl phosphoramidite internucleoside linkage. In certain embodiments, an oligomeric compound comprises a central region, and the central region comprises 1 to 5 alkylphosphonate internucleoside linkages. In certain embodiments, the central region comprises a 5’ terminus; and position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises an alkylphosphonate internucleoside linkage. In certain embodiments, the central region comprises a 5’ terminus, and position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises a mesyl phosphoramidite and / or a busyl phosphoramidite internucleoside linkage. In certain embodiments, the alkylphosphonate internucleoside linkage comprises methoxypropyl (MOP). In certain embodiments, the alkylphosphonates internucleoside linkage comprises methyl. In certain embodiments, an oligomeric compound comprises a central region, and the central region comprises 1 to 5 (1, 2, 3, 4 or 5 for example) modified sugar moieties. In certain embodiments, each of the 1 to 5 modified sugar moieties independently is a non-bicyclic modified sugar moiety. In certain embodiments, each of the 1 to 5 modified sugar moieties independently is a bicyclic modified sugar moiety. In certain embodiments, a modified sugar moiety comprises a 2’ substituent, and in certain instances is a 2’-OMe modified sugar moiety. In certain embodiments, a modified sugar moiety comprises a 5’ substituent, and in certain instances is a 5’-methyl or 5’- ethyl modified sugar moiety. In certain embodiments, the central region comprises a 5’ terminus, and position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises a modified sugar moiety. In certain embodiments, position 2, or position 3, or positions 2 and 3 of the central region, as counted from the 5' terminus of the central region, each independently comprises a modified sugar moiety comprising a 2’ substituent. In certain embodiments, the modified sugar moiety independently is a 2’-OMe modified sugar moiety. In certain embodiments, an oligomeric compound comprises a central region, the central region comprises a 5’ terminus; and position 3, or position 4, or positions 3 and 4 of the central region, as counted from the 5' terminus of the central region, each independently comprises a modified sugar moiety. In certain embodiments, position 3, or position 4, or positions 3 and 4 of the central region, as counted from the 5' terminus of the central region, each independently comprises modified sugar moiety comprising a 5’ substituent. In certain embodiments, position 3, or position 4, or positions 3 and 4 of the central region, as counted from the 5' terminus of the central region, each independently comprises a 5’-methyl modified sugar moiety. In certain embodiments, the 5’-methyl modified sugar moiety independently is a R-5’-methyl modified sugar moiety or a S-5’-methyl modified sugar moiety. of Modified Oligonucleotides Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereo- random populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereo-random in a stereo-random population. In a chirally enriched population, at least one particular chiral center is not stereo-random in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for beta-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereo-random. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both beta-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration. Exemplary Nucleobase Sequences In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid. In certain embodiments, provided are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups can be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and / or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’- end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides. Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified. In certain embodiments, oligo nucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, for example, a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety. A cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, for example, nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system, or may contain two or more rings, for example, fused rings. The cyclic carrier can be a fully saturated ring system, or it may contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, for example, fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. A. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett, 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, for example, do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEES Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, for example, di-hexadecyl-rac-glycerol or triethyl- ammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777- 3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (for example, WO2014 / 179620). In certain embodiments, conjugate groups can be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, CH alkyl, C9 alkyl, C8 alkyl, Cl alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, Cl alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, CH alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds. In certain embodiments, a conjugate group is a lipid having the following structure: Exemplary Moieties Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e g., GalNAc), antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes. In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Exemplary Linkers Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. In certain embodiments, a conjugate linker comprises pyrrolidine. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, for example, those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but arc not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1- carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, where a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker- nucleosides comprise a modified sugar moiety. In certain embodiments, linker- nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5- methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds. Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside. In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group. In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and / or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'- deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'- deoxyadenosine. Cell-Targeting Moieties In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula: Cell-targeting moiety Conjugate Linker where n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0. In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3 , j is 1 and k is 1. In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group. In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, a conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, a conjugate group has the general formula: Cell-targeting conjugate moiety Conjugate Linker where n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0. In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group. In certain embodiments, the cell-targeting moiety targets neurons. In certain embodiments, the cell-targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See for example, WO 2011 / 131693, WO 2014 / 064257. In certain embodiments, conjugate groups comprise cell-targeting moieties that have affinities for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, a conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art including but not limited to those described in WO1991 / 004753; W02013 / 103800; WO2014 / 144060; WO2016 / 081643; WO2016 / 179257; WO2016 / 207240; WO2017 / 221883; WO2018 / 129384; WO2018 / 124121; WO2019 / 151539; WO2020 / 132584; W02020 / 028864; US 7,208,174; US 9,034,329; and US 10,550,188. In certain embodiments, a fragment of an anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the protein or peptide capable of binding TfR1 can be any known in the art including but not limited to those described in W02019 / 140050; W02020 / 037150; W02020 / 124032; and US 10,138,483. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 can be any known in the art including but not limited to those described in WO2013 / 163303; WO2019 / 033051; and WO2020 / 245198. Exemplary Terminal Groups In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5’- phosphate. Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2’-linked nucleosides or sugar moieties. In certain such embodiments, the 2’-linked group is an abasic sugar moiety. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity and such oligomeric compounds and oligomeric duplexes are referred to as “antisense compounds.” In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity, and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity. For certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA and can include modified oligonucleotide of antisense compounds. In certain embodiments, antisense compounds are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated. For certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi agents. RNAi agents can be double- stranded (siRNA or dsRNAi) or single-stranded (ssRNAi). In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid. An antisense activity can be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and / or a phenotypic change in a cell or subject. In certain embodiments, observation or detection of an allele-selective antisense activity involves observation or detection of a change in an amount of nucleic acid or protein encoded by a target allele, a change in the ratio of nucleic acid or protein encoded by a target allele (a mutant or pathogenic allele for example) nucleic acid or protein encoded by a non-target allele (a wild-type allele for example) and / or a phenotypic change in a cell or subject. Exemplary Target Nucleic Acids In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre- mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule. Complementarity / Mismatches to Target Nucleic Acid and Duplex Complementarity In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length. It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst.93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides. In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non- target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, a mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region (central region). In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3’- end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3’-end of the wing region. SCN2A In certain embodiments, oligomeric compounds reduce SCN2A expression, and in certain embodiments selectively reduce expression of a SCN2A allele (also referred to as “a SCN2A allelic variant”). In certain embodiments, an oligomeric compound comprises or consists of an oligonucleotide comprising a region that is complementary to a target region in a SCN2A nucleic acid, and thereby targets the SCN2A nucleic acid. In certain embodiments, an oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target region that is or is within a genetic variation site in a SCN2A nucleic acid, and thereby targets the SCN2A nucleic acid. In certain embodiments, an oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target region that is or is within a particular genetic variant of a SCN2A allele (a particular SCN2A allelic variant) nucleic acid, and thereby selectively targets the SCN2A allelic variant nucleic acid. In certain embodiments, contacting a cell with an oligomeric compound targeted to a SCN2A nucleic acid target region reduces the amount of SCN2A RNA, and in certain embodiments reduces the amount of SCN2A protein. In certain embodiments, contacting a cell with an oligomeric compound targeted to a SCN2A allele nucleic acid target region selectively reduces the amount of SCN2A allele RNA, and in certain embodiments selectively reduces the amount of SCN2A allele protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group. In certain embodiments, contacting a cell with an oligomeric compound targeted to a SCN2A nucleic acid target region reduces the amount of SCN2A RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound targeted to a SCN2A allele nucleic acid target region selectively reduces the amount of SCN2A allele RNA in a cell. In certain embodiments, contacting a cell with an oligomeric compound targeted to a SCN2A nucleic acid target region reduces the amount of SCN2A protein in the cell. In certain embodiments, contacting a cell with an oligomeric compound targeted to a SCN2A allele nucleic acid target region reduces the amount of SCN2A allele protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound targeted to a SCN2A nucleic acid target region ameliorates one or more symptoms or hallmarks of a SCN2A associated medical condition. In certain embodiments, contacting a cell in a subject with an oligomeric compound targeted to a SCN2A allele nucleic acid target region ameliorates one or more symptoms or hallmarks of a SCN2A-associated medical condition. In certain embodiments, the medical condition is SCN2A- associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A- associated developmental and epileptic encephalopathy, or SCN2A-associated self- limited neonatal / infantile epilepsy. In certain embodiments, an oligomeric compound targeted to a SCN2A nucleic acid target region is capable of reducing the amount of SCN2A RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay. In certain embodiments, an oligomeric compound targeted to a SCN2A nucleic acid target region is capable of reducing the amount of SCN2A RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered. In certain embodiments, an oligomeric compound targeted to a SCN2A nucleic acid target region is capable of reducing the amount of SCN2A protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay. In certain embodiments, an oligomeric compound targeted to a SCN2A nucleic acid target region is capable of reducing the amount of SCN2A protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered. In certain embodiments, an oligomeric compound targeted to a SCN2A nucleic acid target region is capable of reducing the amount of SCN2A RNA in a cell of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound targeted to a SCN2A nucleic acid target region is capable of reducing the amount of SCN2A protein or the amount of SCN2A protein in a cell of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. A standard in vitro assay is the quantitative polymerase chain reaction (PCR) assay described in Example 1, with a suitable type of cell. Suitable cells include induced pluripotent stem cell (iPSc) or cells derived therefrom (for example, iPSc-derived neuronal cells), neuronal cells, cells from a subject, or combination thereof, for example. An oligomeric compound that selectively targets a particular SCN2A allele can selectively reduce expression of the particular SCN2A allele. In certain embodiments, expression of a SCN2A allele selectively targeted by an oligomeric compound is less than expression of another SCN2A allele that is not targeted by the oligomeric compound. In certain embodiments, expression of a mutant SCN2A allele containing a pathogenic genetic variant is less than expression of a wild-type SCN2A allele. In certain embodiments, a first SCN2A allele nucleic acid comprises a first genetic variant at a differentiation variation site; a second SCN2A allele nucleic acid comprises a second genetic variant at the differentiation variation site; the oligomeric compound is targeted to the first genetic variant at the differentiation variation site; and expression of the first SCN2A allele is less than expression of the second SCN2A allele. In certain embodiments, the first SCN2A allele is a mutant allele comprising a pathogenic genetic variant, such as a pathogenic genetic variant associated with a SCN2A-associated medical condition for example (SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy, for example). In certain embodiments, the second SCN2A allele is a wild- type allele not containing a pathogenic genetic variant. In certain embodiments, expression of a particular SCN2A allele (the first SCN2A allele for example) is at least two-fold less than expression of a different SCN2A allele (the second SCN2A allele for example). In certain embodiments, expression of a particular SCN2A allele (the first SCN2A allele for example) is at least three-fold less, at least four-fold less, at least five-fold less, at least six-fold less, at least seven- fold less, at least eight-fold less, at least nine-fold less, at least ten-fold less, at least 11-fold less, at least 12-fold less, at least 13-fold less, at least 14-fold less, at least 15- fold less, at least 16-fold less, at least 17-fold less, at least 18-fold less, at least 19-fold less, or at least 20-fold less, than expression of a different SCN2A allele (the second SCN2A allele for example). In certain embodiments, expression is RNA expression of a particular SCN2A allele. In certain embodiments, expression is protein expression of a particular SCN2A allele. Expression of a particular SCN2A allele can be assessed as an amount, concentration and / or level of expression of the allele (expression of a mutant SCN2A allele or wild-type SCN2A allele, for example). In certain embodiments, expression of a SCN2A allele in a cell is determined in vitro. In certain embodiments, expression of a particular SCN2A allele in a cell is determined in vitro by a quantitative polymerase chain reaction (qPCR) assay described in Example 1. In certain embodiments, expression of a particular SCN2A allele is determined for a cell, tissue or subject. Allele selectivity of an oligomeric compound can be assessed by a selectivity ratio. In certain embodiments, a selectivity ratio for an oligomeric compound is (i) an expression inhibition value (IC50 value, for example) measured for a first allele (a wild-type allele for example) as a numerator, to (ii) an expression inhibition value (IC50 value, for example) measured for a second allele (a mutant allele for example) as a denominator. In certain embodiments, each expression inhibition value (IC50 value, for example) is determined by a multi-point dose response curve (for example, containing at least 4 or 5 doses of an oligomeric compound). In certain embodiments, a selectivity ratio for an oligomeric compound is at least 2 or greater than 2, at least 3 or greater than 3, at least 4 or greater than 4, at least 5 or greater than 5, at least 6 or greater than 6, at least 7 or greater than 7, at least 8 or greater than 8, at least 9 or greater than 9, at least 10 or greater than 10, at least 11 or greater than 11, at least 12 or greater than 12, at least 13 or greater than 13, at least 14 or greater than 14, at least 15 or greater than 15, at least 16 or greater than 16, at least 17 or greater than 17, at least 18 or greater than 18, at least 19 or greater than 19, or at least 20 or greater than 20. In certain embodiments, an oligomeric compound when administered is capable of reducing mutant SCN2A allele RNA according to the quantitative polymerase chain reaction (PCR) in vitro assay described in Example 1 herein. In certain embodiments, an oligomeric compound when administered is capable of reducing mutant SCN2A allele RNA by at least 50% according to the quantitative polymerase chain reaction (PCR) in vitro assay described in Example 1 herein. In certain embodiments, an oligomeric compound when administered reduces mutant SCN2A allele RNA by at least 50% at a concentration of the oligomeric compound of 60 micromolar or less, or 30 micromolar or less, or 20 micromolar or less, or 15 micromolar or less or 10 micromolar or less, or 5 micromolar or less or 1 micromolar or less, according to the quantitative polymerase chain reaction (PCR) in vitro assay described in Example 1 herein. In certain embodiments, an oligomeric compound when administered is capable of reducing mutant SCN2A allele RNA by at least 60%, or at least 70%, or at least 75%, at least 80%, or at least 85%, or at least 90%, according to the quantitative polymerase chain reaction (PCR) in vitro assay described in Example 1. In certain embodiments, an oligomeric compound when administered is capable of reducing mutant SCN2A allele RNA to a level at least two-fold less than a level of wild-type SCN2A allele RNA, according to the quantitative polymerase chain reaction (PCR) in vitro assay described in Example 1 herein. Human SCN2A is located on chromosome 2 and Table A provides access information for a SCN2A genomic reference nucleic acid sequence (accession no. ENSG00000136531; chromosome 2 positions 165,194,993-165,392,310). Table A also provides access information for a SCN2A complementary DNA (cDNA) sequence (accession no. ENST00000375437.7; Genome Assembly GRCh38, release 112) and a SCN2A protein sequence (accession no. ENSP00000364586.2; Genome Assembly GRCh38, release 112). Each of the genomic, cDNA and protein sequence referenced in Table A is from Genome Assembly GRCh38, release 112 (May 2024), accessible at World Wide Web URL useast.ensembl.org / . Table A also provides certain intron subregion boundaries in the SCN2A reference genomic sequence (accession no. ENSG00000136531; chromosome 2 positions 165,194,993-165,392,310) according to chromosome position, and certain SNV sites within the introns according to SNP references accessible at World Wide Web Address URL ncbi.nlm.nih.gov / snp / . Table A: SCN2A nucleobase sequences Each of chromosomal portion of SCN2A, defined by start and end positions of the chromosomal portion, is according to Genome Assembly GRCh38, release 112 (May 2024), accessible at World Wide Web URL useast.ensembl.org / . A SCN2A nucleic acid portion can correspond to a portion of a SCN2A chromosomal sequence when the portions are aligned to one another (in the same direction for example) by a standard alignment process and are observed as being at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical, or differ by fewer than 5 mismatches (for example, differ by 4, 3, 2, 1 or no mismatches). In certain embodiments, a target region in a SCN2A nucleic acid to which an oligomeric compound is targeted is 100% identical to an equal length portion in the SCN2A reference genomic sequence (accession no. ENSG00000136531; Genome Assembly GRCh38, release 112; chromosome 2 positions 165,194,993-165,392,310) or SCN2A cDNA sequence (accession no. ENST00000375437.7; Genome Assembly GRCh38, release 112). In certain embodiments, a SCN2A target region to which an oligomeric compound is targeted is at least 80% identical to, or at least 85% identical to, or at least 90% identical to, or at least 95% identical to, an equal length portion in the SCN2A reference genomic sequence (accession no. ENSG00000136531; Genome Assembly GRCh38, release 112; chromosome 2: 165,194,993-165,392,310) or SCN2A cDNA sequence (accession no. ENST00000375437.7; Genome Assembly GRCh38, release 112). In certain embodiments, a target region to which an oligomeric compound is targeted is identical to an equal length portion in the SCN2A reference genomic sequence (accession no. ENSG00000136531; Genome Assembly GRCh38, release 112; chromosome 2 positions 165,194,993-165,392,310) or SCN2A cDNA sequence (accession no. ENST00000375437.7; Genome Assembly GRCh38, release 112) except for a one-nucleobase mismatch. In certain embodiments, an oligomeric compound oligonucleotide comprises or consists of a nucleobase sequence that is 100% complementary to the target region. In certain embodiments, (i) a target region to which an oligomeric compound is targeted is 100%, or in certain embodiments is at least 85% identical to, or at least 90% identical to, or at least 95% identical to, an equal length portion in a SCN2A allele nucleic acid, and (ii) the oligonucleotide of the oligomeric compound is 100% complementary to the target region. In certain embodiments, a mutant SCN2A allele is targeted that comprises a pathogenic genetic variant associated with a medical condition. In certain embodiments, the medical condition is a SCN2A-associated medical condition (for example, SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy). In certain instances, a pathogenic genetic variation is a single nucleotide variation (SNV) at a pathogenic genetic variation position, and sometimes is a non-synonymous SNV located in an exon of a mutant SCN2A nucleic acid. In certain embodiments, a non- synonymous SNV of a mutant SCN2A nucleic acid results in one of the following amino acid modifications (amino acid substitutions): V261M, R853Q, H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, P1658S or R1882Q. In certain embodiments, a pathogenic genetic variation site and / or a pathogenic genetic variation position occurs in exon 15 or exon 27. In certain embodiments, a pathogenic genetic variant occurs at chromosome 2 position 165342465 or position 165389451, aligning at position 165342465 or position 165389451, respectively, of the SCN2A chromosomal reference sequence accessed by accession no. ENSG00000136531; Genome Assembly GRCh38, release 112; chromosome 2 positions 165,194,993- 165,392,310). In certain embodiments, a mutant SCN2A allele comprises the pathogenic genetic variant c.2558G>A and in certain instance comprises the nucleobase sequence (SEQ ID NO:9): TGGAAGGATTGTCAGTTCTCCGATCATTCCAGCTGGTAAATTAACTGGGAG TGTTCATAAA (SEQ ID NO: 40), where the nucleobase in bold text is at the polymorphic position. A wild-type, non- pathogenic SCN2A allele can include the nucleobase sequence (SEQ ID NO:9): TGGAAGGATTGTCAGTTCTCCGATCATTCCGGCTGGTAAATTAACTGGGAG TGTTCATAAA (SEQ ID NO: 41), where the nucleobase in bold text is at the polymorphic position. In certain embodiments, a SCN2A mutant allele nucleic acid comprises a pathogenic genetic variation resulting in the SCN2A protein modification p.Arg853Gln (in SCN2A protein at accession no. ENSP00000364586.2; Genome Assembly GRCh38, release 112). In certain embodiments, a mutant SCN2A allele comprises the pathogenic genetic variant c.5645G>A and in certain instance comprises the nucleobase sequence (SEQ ID NO:33): TGGATGCCCTTCGAATACAGATGGAAGAGCAATTCATGGCATCAAACCCCT CCAAAGTCTC (SEQ ID NO: 42), where the nucleobase in bold text is at the polymorphic position. A wild-type, non- pathogenic SCN2A allele can include the nucleobase sequence (SEQ ID NO:33): TGGATGCCCTTCGAATACAGATGGAAGAGCGATTCATGGCATCAAACCCCT CCAAAGTCTC (SEQ ID NO: 43), where the nucleobase in bold text is at the polymorphic position. In certain embodiments, a SCN2A mutant allele nucleic acid comprises a pathogenic genetic variation resulting in the SCN2A protein modification p.Arg1882Gln (in SCN2A protein at accession no. ENSP00000364586.2; Genome Assembly GRCh38, release 112). In certain embodiments, a SCN2A allele is targeted, such as a mutant SCN2A allele for example, comprising a non-pathogenic genetic variation site. In certain embodiments, a target region of a SCN2A nucleic acid, a mutant SCN2A allele nucleic acid for example, comprises or consists of a non-pathogenic genetic variation site, where the non-pathogenic genetic variation site can be a differentiating variation site. In certain embodiments, a target region of a SCN2A nucleic acid, a mutant SCN2A allele nucleic acid for example, comprises or consists of a non-pathogenic differentiating variation site, and the SCN2A nucleic acid targeted also comprises a pathogenic genetic variation site in a separate location. In certain embodiments, a target region on the SCN2A nucleic acid targeted does not contain the pathogenic genetic variation site, and in certain embodiments a nucleic acid targeted by an oligomeric compound is a wild-type SCN2A allele nucleic acid. In certain embodiments, a differentiating variation site within a SCN2A target region is a single nucleotide variation (SNV) site, which can be a single nucleotide polymorphism (SNP) site in certain instances. In certain embodiments, a SCN2A target region comprises or consists of a non-pathogenic SNV site, and the SNV site is a synonymous SNV site. In certain embodiments, a SCN2A target region comprises or consists of a non-pathogenic SNV site and the SNV site is in an intron of a SCN2A nucleic acid. A non-pathogenic SNV site within a SCN2A target region can be in intron 3, intron 11, intron 13, intron 17 or intron 22, for example. Each intron is defined by the chromosome position boundaries shown in Table A within the SCN2A genomic reference sequence (accession no. ENSG00000136531; Genome Assembly GRCh38, release 112; chromosome 2 positions 165,194,993-165,392,310). In certain embodiments, an oligomeric compound is targeted to a SCN2A target region comprising or consisting of a non-pathogenic SNV site defined in Table B, Table C and / or Table D. In Table B, Table C and Table D, each SNV site and SNV polymorphic position is a single nucleotide polymorphic (SNP) site and SNP position. In Table B, Table C and Table D, the “DB ref.” column notates a reference in a public database for a SNP site (accessible at World Wide Web Address URL ncbi.nlm.nih.gov / snp / ). In Table B, Table C and Table D, the “SNV site” column notates an SNV site, all or a portion of which can be targeted by an oligomeric compound, according to start and end positions on chromosome 2, as occurring in a SCN2A genomic nucleic acid (accession no. ENSG00000136531; Genome Assembly GRCh38, release 112; chromosome 2 positions 165,194,993-165,392,310). The “SNV pstn.” column in Table B and Table C provides the corresponding SNV polymorphic position within the SNV site, according to the position on chromosome 2, that can be targeted by an oligomeric compound. The final two rows in Table B and Table C designating rs794727152 and rs794727444 provide information concerning the SNV site and position for the pathogenic SNV c.2558G>A and pathogenic SNV c.5645G>A, respectively, and the preceding rows in each of Table B and Table C provide information concerning SNV site and position for non-pathogenic SNVs in SCN2A. The non-pathogenic SNV positions in Table B and Table C were heterozygous among mutant and wild-type alleles for a particular patient having the pathogenic SNV. In certain embodiments, an oligomeric compound oligonucleotide comprises a nucleobase sequence aligned to, and often complementary to, the nucleoside at the genetic variation position in the SNV site specified in the third column of Table B and depicted in bold text in the fourth column of Table B. The nucleobase shown in bold text for each SNV site variant sequence in the fourth column of Table B, and third column of Table D, is a single nucleotide variant at the SNV position designated in the third column of Table B. The “SID” column specifies a “SEQ ID NO” designator corresponding to the nucleobase sequence in the fourth column of Table B and in the third column of Table D. Table B: SCN2A single nucleotide variation (SNV) sites and positions Table C provides additional information concerning SNV sites that can be targeted by oligomeric compounds in particular embodiments. Table C: SCN2A single nucleotide variation (SNV) sites, positions and allelic variants The “SNV site variant 1” (“v1”) can be in a mutant, pathogenic allele, which in certain instances is carrying the mutant rs794727152 variant c.2558G>A or the mutant rs794727444 variant c.5645G>A. The “SNV site variant 2” (“v2”) can be in a wild-type allele, which in certain instances is not carrying the pathogenic c.2558G>A variant or c.5645G>A variant. The presence or absence of a v1 or v2 variant on a particular allele can be determined from sample SCN2A nucleic acid from a patient. The “ref. vrnt.” column indicates which of the “v1” or “v2” allele can be present on the reference SCN2A gene (accession no. ENSG00000136531; Ensembl GRCh38, release 112; chromosome 2: 165,194,993-165,392,310). Table C shows the frequency of each non-pathogenic SNV position variant in the sixth column (for the “v1” variant) and seventh column (for the “v2” variant), and each frequency can be converted to a percentage by multiplying the value shown in the Table by 100. The final two rows in Table C designating rs794727152 and rs794727444 provides information concerning the SNV site and position for the pathogenic SNV c.2558G>A and pathogenic SNV c.5645G>A, respectively, and the preceding rows provide information concerning non-pathogenic SNV sites and positions. The v1 frequency for each of rs794727152 and rs794727444 is not published at World Wide Web Address URL ncbi.nlm.nih.gov / snp. Table D provides exemplary portions within genetic variation sites presented in Table B, to which certain oligomeric compounds described herein are complementary. The third column of Table D provides the contiguous nucleobase sequence of each exemplary portion within a genetic variation site presented in Table B. The first column of Table D provides the corresponding DB reference designation for the genetic variation site, and the second column of Table D provides corresponding start and end positions in chromosome 2 for the nucleobase sequence provided in the third column. The fourth column of Table D provides the corresponding sequence identifier (SEQ ID NO:) for each nucleobase sequence in the third column. Table D: Certain Exemplary Genetic Variation Site Portions In certain embodiments, a genetic variation site to which a modified oligonucleotide is targeted comprises a genetic variant present in at least 20% of a population, or at least 25% of a population, or at least 30% of a population, or at least 35% of a population, or at least 40% of a population, or at least 45% of a population, or at least 50% of a population, or at least 55% of a population, or at least 60% of a population, or at least 65% of a population, or at least 70% of a population, or at least 75% of a population, or at least 80% of a population, or at least 85% of a population, or at least 90% of a population, or at least 95% of a population. In certain embodiments, a genetic variation site to which a modified oligonucleotide is targeted comprises a minor allele genetic variant present in at least 20% of a population; or at least 25% of a population, or at least 30% of a population, or at least 35% of a population, or at least 40% of a population, or at least 45% of a population. In certain embodiments, an oligomeric compound oligonucleotide contains a nucleobase complementary to a nucleobase at the position in the third column of Table C. In certain embodiments, a nucleobase at position 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 of an oligomeric compound oligonucleotide, as counted from the 5' terminus of the oligonucleotide, aligns with (“the aligned nucleobase”) and is complementary to the nucleobase at the position in the SCN2A nucleic acid target region corresponding to the chromosome 2 position designated in the third column of Table C. In certain embodiments, the aligned nucleobase in the oligomeric compound oligonucleotide is complementary to the nucleobase in the fourth column of Table C, and can be targeted to a mutant SCN2A allele. In certain embodiments, the aligned nucleobase in the oligomeric compound oligonucleotide is complementary to the nucleobase in the fifth column of Table C, and can be targeted to a wild-type SCN2A allele. In certain embodiments, at least a portion of an oligomeric compound oligonucleotide is complementary to an equal-length portion of consecutive nucleobases within a target region shown in the second column of Table C, the second column of Table B (having a nucleobase sequence shown in the fourth column of Table B for example), or the second column of Table D (having a nucleobase sequence shown in the fourth column of Table D for example). In certain embodiments, the equal length portion is within, or comprises or consists of, a nucleobase sequence defined in the second column of Table C, the second column of Table B (having a nucleobase sequence shown in the fourth column of Table B for example), or the second column of Table D (having a nucleobase sequence shown in the fourth column of Table D for example). In certain embodiments, an equal length portion is within, or comprises or consists of, a nucleobase sequence defined in the second column of Table C, the second column of Table B (having a nucleobase sequence shown in the fourth column of Table B for example), or the second column of Table D (having a nucleobase sequence shown in the fourth column of Table D for example), and optionally is selectively targeted to a mutant SCN2A allele and contains the “v1” nucleotide specified in the fourth column of Table C. In certain embodiments, an equal length portion is within, or comprises or consists of, a nucleobase sequence designated in the second column of Table C, the second column of Table B (having a nucleobase sequence shown in the fourth column of Table B for example), or the second column of Table D (having a nucleobase sequence shown in the fourth column of Table D for example), and optionally is selectively targeted to a wild-type SCN2A allele and contains the “v2” nucleobase specified in the fifth column of Table C. In certain embodiments, an oligomeric compound oligonucleotide consists of 10-30, 15-25, 18- 22 or 20 linked nucleosides and comprises or consists of a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases 100% complementary to an equal-length portion of consecutive nucleobases within the chromosome position range designated in the second column of Table C, or the second column of Table B (having a nucleobase sequence shown in the fourth column of Table B for example), or the second column of Table D (having a nucleobase sequence shown in the fourth column of Table D for example). In certain embodiments, an oligomeric compound oligonucleotide consists of 10-30, 15- 25, 18-22 or 20 linked nucleosides and is 100% complementary to an equal-length portion of consecutive nucleobases within a target region shown in the fourth column of Table B, and contains a nucleobase at a position depicted in the third column of Table C. In certain embodiments, an oligomeric compound oligonucleotide comprises a central region consisting of 6-10 linked central region nucleosides, and the central region is complementary to an equal length portion of linked nucleosides within chromosome 2 positions designated in the second column of Table C or the second column of Table B (having a nucleobase sequence shown in the fourth column of Table B for example), or the second column of Table D (having a nucleobase sequence shown in the fourth column of Table D for example). In certain embodiments, position 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the central region, as counted from the 5' terminus of the central region, aligns with the nucleoside at the position in the SCN2A nucleic acid target region corresponding to chromosome 2 position in the third column of Table C. In certain embodiments, an oligomeric compound oligonucleotide consists of 10-30, 15-25, 18-22 or 20 linked nucleosides and is 100% complementary to an equal length portion of the nucleobase sequence in the second or fourth column of Table B, where the equal length portion can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleobases. In certain embodiments, an oligomeric compound oligonucleotide consists of 10-30, 15-25, 18-22 or 20 linked nucleosides and is 100% complementary to an equal length portion of the nucleobase sequence in the second or third column of Table D, where the equal length portion can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleobases as applicable. In certain embodiments, an oligomeric compound comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides and comprising or consisting of a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of nucleobases within: SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:31; or optionally SEQ ID NO:26 to SEQ ID NO:30; or optionally SEQ ID NO:4; or optionally SEQ ID NO:28; or optionally SEQ ID NO:31. In certain embodiments, an oligomeric compound comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides and comprising or consisting a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: (i) SCN2A intron 3; or genetic variation site rs3769931; or a portion corresponding to SCN2A chromosome 2 positions 165299693-165299753; or a portion corresponding to SCN2A chromosome 2 positions 165299709-165299738; or SEQ ID NO:1; or SEQ ID NO:26; or (ii) SCN2A intron 3; or genetic variation site rs72872496; or a portion corresponding to SCN2A chromosome 2 positions 165300913-165300973; or a portion corresponding to SCN2A chromosome 2 positions 165300938-165300958; or SEQ ID NO:2; or SEQ ID NO:27; or (iii) SCN2A intron 11; or genetic variation site rs72874313; or a portion corresponding to SCN2A chromosome 2 positions 165322197-165322257; or a portion corresponding to SCN2A chromosome 2 positions 165322222-165322242; or SEQ ID NO:4; or SEQ ID NO:28; or (iv) SCN2A intron 13; or genetic variation site rs3769944; or a portion corresponding to SCN2A chromosome 2 positions 165329668-165329728; or a portion corresponding to SCN2A chromosome 2 positions 165329684-165329704; or SEQ ID NO:5; or SEQ ID NO:29; or (v) SCN2A intron 17; or genetic variation site rs72874358; or a portion corresponding to SCN2A chromosome 2 positions 165355671-165355731; or a portion corresponding to SCN2A chromosome 2 positions 165355687-165355709; or SEQ ID NO:8; or SEQ ID NO:30; or (vi) SCN2A intron 22; or genetic variation site rs1368238; or a portion corresponding to SCN2A chromosome 2 positions 165375094-165375154; or SEQ ID NO:31. In certain embodiments, the modified oligonucleotide consists of 10-30, 15-25, 18-22 or 20 linked nucleosides and is 100% complementary to the specified equal length portion. Nucleobase sequences for each of the target regions designated in the second column of Table B and Table C are provided in the fourth column of Table B. The fourth column of Table B shows SNV position nucleotide variants in bold text and within brackets. The nucleobase sequence in the fourth column of Table B consists of 61 consecutive nucleobases and contains one of the nucleobases shown in bold text within the brackets. Generally each nucleobase sequence entry in the fourth column represents one of two nucleobase sequences. For example, the first target region for rs3769931 spanning chromosome 2 positions 165299693-165299753 can have one of the two following nucleobase sequences (SEQ ID NO:1): TATTCCTCTTGTTGCAAACCCTAGACTTAAATCCTGATTTTCTGACTTCAA GTACAGTGTC (SEQ ID NO: 44); or TATTCCTCTTGTTGCAAACCCTAGACTTAAGTCCTGATTTTCTGACTTCAA GTACAGTGTC (SEQ ID NO: 45); and an oligomeric compound oligonucleotide can be targeted to (100% complementary to, for example) an equal length portion within one of the nucleobase sequences represented. An exception is for rs544136707, where the nucleobase sequence entry in the fourth column of Table B represents one of three nucleobase sequences (SEQ ID NO:3): TGCTGATAAAGACATACCTGAGACTGGGCAATTTACCAAAGAAAGACATTT AATTGGACTT (SEQ ID NO: 46); or TGCTGATAAAGACATACCTGAGACTGGGCACTTTACCAAAGAAAGACATTT AATTGGACTT (SEQ ID NO: 47); or TGCTGATAAAGACATACCTGAGACTGGGCAGTTTACCAAAGAAAGACATTT AATTGGACTT (SEQ ID NO: 48). In certain embodiments, an oligomeric compound oligonucleotide consists of 10-52 linked nucleosides, 10-42 linked nucleosides, 10-35 linked nucleosides, 10-30 linked nucleosides, 15-25 linked nucleosides, 18-22 linked nucleosides or 20 linked nucleosides. In certain embodiments, an oligomeric compound oligonucleotide is complementary to an equal length portion at positions 1-51, positions 6-56, positions 11-61, positions 6-51, positions 11-56, positions 16-61, positions 6-46, positions 11- 51, positions 16-56, positions 8-44, positions 13-49, positions 18-54, positions 11-41, positions 16-46, positions 21-51, positions 13-39, positions 18-44, positions 23-49, positions 11-31, positions 12-32, positions 13-33, positions 14-34, positions 15-35, positions 16-36, positions 17-37, positions 18-38, positions 19-39, positions 20-40, positions 21-41, positions 22-42, positions 23-43, positions 24-44, positions 25-45, positions 26-46, positions 27-47, positions 28-48, positions 29-49, positions 30-50, or positions 31-41, of a nucleobase sequence in the second column or in the fourth column of Table B. In certain embodiments, an oligomeric compound oligonucleotide comprises a central gap region consisting of 5-15 nucleosides, 8-12 nucleosides or 10 nucleosides. In certain embodiments, an oligomeric compound oligonucleotide comprises a central gap region complementary to an equal length portion at positions 16-36, positions 21- 41, positions 26-46, positions 18-34, positions 23-39, positions 28-44, positions 21- 31, positions 22-32, positions 23-33, positions 24-34, positions 25-35, positions 26- 36, positions 27-37, positions 28-38, positions 29-39, positions 30-40, or positions 31- 41, of a nucleobase sequence in the second column or in the fourth column of Table B. In certain embodiments, a modified oligonucleotide of a oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides, and optionally is complementary to a nucleobase sequence in the second column or in the fourth column of Table B or a nucleobase sequence in the second or third column in Table D. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises or consists of a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SEQ ID NO:1 to SEQ ID NO:8; or optionally SEQ ID NO:26 to SEQ ID NO:30 or SEQ ID NO:31; or optionally SEQ ID NO:4; or optionally SEQ ID NO:28; or optionally SEQ ID NO:31. In certain embodiments, a modified oligonucleotide of an oligomeric compound comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of: any of SEQ ID NO:10 to SEQ ID NO:25 or SEQ ID NO:32; optionally SEQ ID NO:10 to SEQ ID NO:14 or SEQ ID NO:16 to SEQ ID NO:19 or SEQ ID NO:22 to SEQ ID NO:25; or optionally SEQ ID NO:16; or optionally SEQ ID NO:32. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotides is a MOE gapmer. In certain embodiments, a modified oligonucleotide of a oligomeric compound is a 5-10- 5 MOE gapmer. In certain embodiments, the sugar motif for the gapmer is (from 5’ to 3’) eeeeeddddddddddeeeee, where each “d” represents a 2' -beta-D-deoxy ribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. In certain embodiments, the internucleoside linkages of a modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises or consists of internucleoside linkages according to the linkage motif sososssssssssssooss or sooosssssssssssooss or soooossssssssssooss, in order from 5’ to 3’, where each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is a (S)-phosphorothioate internucleoside linkage. In certain embodiments, each cytidine is a 5-methylcytidine. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SCN2A intron 3; or genetic variation site rs3769931; or a portion corresponding to SCN2A chromosome 2 positions 165299693-165299753; or a portion corresponding to SCN2A chromosome 2 positions 165299709-165299738; or SEQ ID NO:1; or SEQ ID NO:26. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18- 22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of any of SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:12. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotides is a MOE gapmer. In certain embodiments, a modified oligonucleotide of a oligomeric compound is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif for the gapmer is (from 5’ to 3’) eeeeeddddddddddeeeee, where each “d” represents a 2' - beta-D-deoxy ribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. In certain embodiments, the internucleoside linkages of a modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises or consists of internucleoside linkages according to the linkage motif sososssssssssssooss or sooosssssssssssooss or soooossssssssssooss, in order from 5’ to 3’, where each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is a (S)-phosphorothioate internucleoside linkage. In certain embodiments, each cytidine is a 5-methylcytidine. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SCN2A intron 3; or genetic variation site rs72872496; or a portion corresponding to SCN2A chromosome 2 positions 165300913-165300973; or a portion corresponding to SCN2A chromosome 2 positions 165300938-165300958; or SEQ ID NO:2; or SEQ ID NO:27. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18- 22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of SEQ ID NO:13 or SEQ ID NO:14. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotides is a MOE gapmer. In certain embodiments, a modified oligonucleotide of a oligomeric compound is a 5-10- 5 MOE gapmer. In certain embodiments, the sugar motif for the gapmer is (from 5’ to 3’) eeeeeddddddddddeeeee, where each “d” represents a 2' -beta-D-deoxy ribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. In certain embodiments, the internucleoside linkages of a modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises or consists of internucleoside linkages according to the linkage motif sososssssssssssooss or sooosssssssssssooss or soooossssssssssooss, in order from 5’ to 3’, where each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is a (S)-phosphorothioate internucleoside linkage. In certain embodiments, each cytidine is a 5-methylcytidine. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SCN2A intron 11; or genetic variation site rs72874313; or a portion corresponding to SCN2A chromosome 2 positions 165322197-165322257; or a portion corresponding to SCN2A chromosome 2 positions 165322222-165322242; or SEQ ID NO:4; or SEQ ID NO:28. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18- 22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of SEQ ID NO:16 or SEQ ID NO:17. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotides is a MOE gapmer. In certain embodiments, a modified oligonucleotide of a oligomeric compound is a 5-10- 5 MOE gapmer. In certain embodiments, the sugar motif for the gapmer is (from 5’ to 3’) eeeeeddddddddddeeeee, where each “d” represents a 2' -beta-D-deoxy ribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. In certain embodiments, the internucleoside linkages of a modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises or consists of internucleoside linkages according to the linkage motif sososssssssssssooss or sooosssssssssssooss or soooossssssssssooss, in order from 5’ to 3’, where each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is a (S)-phosphorothioate internucleoside linkage. In certain embodiments, each cytidine is a 5-methylcytidine. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SCN2A intron 13; or a portion corresponding to SCN2A chromosome 2 positions 165329668-165329728; or genetic variation site rs3769944; or a portion corresponding to SCN2A chromosome 2 positions 165329684-165329704; or SEQ ID NO:5; or SEQ ID NO:29. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18- 22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of SEQ ID NO:18 or SEQ ID NO:19. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotides is a MOE gapmer. In certain embodiments, a modified oligonucleotide of a oligomeric compound is a 5-10- 5 MOE gapmer. In certain embodiments, the sugar motif for the gapmer is (from 5’ to 3’) eeeeeddddddddddeeeee, where each “d” represents a 2' -beta-D-deoxy ribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. In certain embodiments, the internucleoside linkages of a modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises or consists of internucleoside linkages according to the linkage motif sososssssssssssooss or sooosssssssssssooss or soooossssssssssooss, in order from 5’ to 3’, where each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is a (S)-phosphorothioate internucleoside linkage. In certain embodiments, each cytidine is a 5-methylcytidine. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SCN2A intron 17; or genetic variation site rs72874358; or a portion corresponding to SCN2A chromosome 2 positions 165355671-165355731; or a portion corresponding to SCN2A chromosome 2 positions 165355687-165355709; or SEQ ID NO:8; or SEQ ID NO:30. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18- 22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of any of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24 or SEQ ID NO:25. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotides is a MOE gapmer. In certain embodiments, a modified oligonucleotide of a oligomeric compound is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif for the gapmer is (from 5’ to 3’) eeeeeddddddddddeeeee, where each “d” represents a 2' -beta-D-deoxy ribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. In certain embodiments, the internucleoside linkages of a modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises or consists of internucleoside linkages according to the linkage motif sososssssssssssooss or sooosssssssssssooss or soooossssssssssooss, in order from 5’ to 3’, where each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is a (S)-phosphorothioate internucleoside linkage. In certain embodiments, each cytidine is a 5-methylcytidine. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SCN2A intron 22; or genetic variation site rs1368238; or a portion corresponding to SCN2A chromosome 2 positions 165375094-165375154; or SEQ ID NO:31. In certain embodiments, a modified oligonucleotide of an oligomeric compound consists of 18-22 linked nucleosides, 19-21 linked nucleosides or 20 linked nucleosides and comprises 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases of SEQ ID NO:32. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotides is a MOE gapmer. In certain embodiments, a modified oligonucleotide of a oligomeric compound is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif for the gapmer is (from 5’ to 3’) eeeeeddddddddddeeeee, where each “d” represents a 2' -beta-D-deoxy ribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. In certain embodiments, the internucleoside linkages of a modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises or consists of internucleoside linkages according to the linkage motif sososssssssssssooss or sooosssssssssssooss or soooossssssssssooss, in order from 5’ to 3’, where each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is a (S)-phosphorothioate internucleoside linkage. In certain embodiments, each cytidine is a 5-methylcytidine. Certain Target Nucleic Acids in Certain Tissues In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, where the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, a pharmacologically relevant tissue includes a neuronal cell or stem cell-derived neuronal cell or neural cell derived from an induced pluripotent stem cell. In certain embodiments, a pharmaceutically relevant tissue includes a neuronal cell or stem cell-derived neuronal cell or other cell to which an oligomeric compound can be targeted. Exemplary Methods and Uses Certain embodiments provided relate to methods of reducing or inhibiting SCN2A expression or activity, which can be useful for treating, preventing, or ameliorating a SCN2A-associated medical condition. In certain embodiments, the medical condition is SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A- associated self-limited neonatal / infantile epilepsy. In certain embodiments, a method comprises administering to a subject an oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence complementary to an equal length portion of SCN2A nucleic acid, or a composition containing the compound as described herein. In certain embodiments, a method for treating a SCN2A-associated medical condition comprises administering to a subject an oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence complementary to an equal length portion of a SCN2A nucleic acid, or a composition containing the compound as described herein. In certain embodiments, a method of reducing expression of SCN2A, for example, reducing expression of SCN2A RNA and / or reducing expression of SCN2A protein, in a cell, comprises contacting the cell with an oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence complementary to an equal length portion of SCN2A nucleic acid, or a composition containing the compound as described herein. Certain embodiments are drawn to an oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence complementary to an equal length portion of SCN2A nucleic acid, or a composition containing the compound as described herein, for use in treating a SCN2A-associated medical condition (for example, SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy). An oligomeric compound utilized can be any suitable oligomeric compound described herein. In certain embodiments, a subject has or is at risk for developing a SCN2A-associated medical condition. In certain embodiments, the subject has or is at risk for developing SCN2A-associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A- associated developmental and epileptic encephalopathy, or SCN2A-associated self- limited neonatal / infantile epilepsy. In certain embodiments, the subject has a SCN2A- associated medical condition and in certain instances has been diagnosed as having a SCN2A-associated medical condition. In certain embodiments, at least one symptom or hallmark of a SCN2A-associated medical condition is ameliorated. In certain embodiments, a symptom or hallmark is one or more of seizure; self-limited seizure; developmental delay; intellectual disability; behavior disorder; autism spectrum disorder feature; poor muscle tone (hypotonia); movement disorder; feeding difficulty; vision difficulty; and cortical visual impairment (CVI). Certain embodiments provided relate to determining presence or absence of a differentiating variation site in a SCN2A nucleic acid. In certain embodiments, an oligomeric compound targeted to the differentiating variation site is administered if a differentiating variation site is present. A SCN2A nucleic acid can be any described herein, including a SCN2A allele nucleic acid, such as a mutant allele SCN2A nucleic acid and / or a wild-type allele SCN2A nucleic acid in certain embodiments. A differentiating variation site can be any described herein, such as (i) a heterozygous SNV differentiating variation site and / or position (for example, a SNV site and / or SNV position provided in Table B or Table C), (ii) a pathogenic genetic variation site and / or position, and / or (iii) a non-pathogenic genetic variation site and / or position, for example. A genetic variation site and / or a genetic variation position can be assessed for a SCN2A nucleic acid in situ or from a sample. A sample can be a sample containing cells or tissue, and can be from a subject. A sample from a subject can be a solid sample or liquid sample. Certain embodiments include genotyping a genetic variation site and / or a genetic variation position of a SCN2A nucleic acid, thereby providing a SCN2A nucleic acid genotype, and determining presence or absence of the differentiating variation site according to the genotype. A genotype can be determined in any suitable manner known, including by sequencing SCN2A nucleic acid and / or by utilizing nucleic acid probes targeted to a genetic variation site for which a genotype is determined. Any suitable sequencing process can be utilized, including a sequencing process that determines sequences from long reads, or from short reads, or from short reads and long reads, for example. In certain embodiments, short read sequencing processes typically generate sequencing reads of about 50 to about 300 nucleobases often by sequencing by synthesis or ligation processes. Non-limiting examples of short read sequencing processes include (i) solid phase bridge amplification followed by labeled nucleotide incorporating monitored by fluorescence detection (Illumina sequencing process, for example); (ii) emulsion PCR, generating microbead-bound DNA clones, followed by nucleotide incorporation monitored by pyrophosphate release (454 pyrosequencing process, for example); (iii) emulsion PCR, generating microbead- bound DNA clones, followed by nucleotide incorporation monitored by a pH sensor as protons are released (Ion Torrent sequencing process, for example); (iv) emulsion PCR followed by hybridization to amplicons a complementary strand grown by DNA ligase (SOLiD sequencing process, for example); and (v) hybridizing an anchor sequence and probes to DNA template in a series of ligation reactions taking place on a nanoball (cPAL sequencing process, for example). In certain embodiments, a long read sequencing process generates nucleobase sequence reads of about 1,000 to about 30,000 nucleobases. Non-limiting examples of long read sequencing processes include nanopore sequencing processes (Oxford Nanopore Technologies) and zero- mode waveguide processes (Pacific Biosciences single molecule real-time (SMRT) sequencing). Certain embodiments include determining presence or absence of a pathogenic genetic variant in a SCN2A allele nucleic acid. Certain embodiments include determining a genotype of a pathogenic genetic variation site and / or a pathogenic genetic variation position. Certain embodiments include determining presence or absence of a non-loss of function genetic variant, which in certain instances can be a dominant negative genetic variant or gain of function genetic variant. Certain embodiments include determining presence or absence of a pathogenic genetic variant resulting in an amino acid substitution selected from: V261M, R853Q, H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, P1658S or R1882Q. Certain embodiments include determining presence or absence of a pathogenic genetic variant in an exon, optionally in exon 15, and certain embodiments include determining presence or absence of a pathogenic genetic variant comprising c.2558G>A, optionally in a pathogenic genetic variation site comprising a nucleobase sequence of SEQ ID NO:9. Certain embodiments include determining presence or absence of a pathogenic genetic variant in exon 27, or include determining presence or absence of a pathogenic genetic variant resulting in a p.Arg1882Gln amino acid substitution in a SCN2A protein, or include determining presence or absence of a pathogenic genetic variant comprising c.5645G>A, or include determining presence or absence of a pathogenic genetic variant in a nucleobase sequence of SEQ ID NO:33. Certain embodiments include administering an oligomeric compound targeted to a differentiating variation site of a mutant SCN2A allele nucleic acid if presence of the pathogenic genetic variant is determined. A pathogenic genetic variation site and / or position can be characterized (genotyped for example) for a SCN2A nucleic acid in situ or from a sample. A sample can be a sample containing cells or tissue, and can be from a subject. A sample from a subject can be a solid sample or liquid sample. In certain embodiments, an oligomeric compound oligonucleotide is not according to the following formula: TGomComCoAoAmCAATGTAmCAAoGoGGT (SEQ ID NO: 38), where each internucleoside linkage is a phosphorothioate internucleoside linkage unless there is a phosphodiester internucleoside linkage designated by an “o” and where each “mC” is a 5-methyl cytidine. In certain embodiments, an oligomeric compound oligonucleotide does not include the nucleobase sequence: TGCCAACAATGTACAAGGGT (SEQ ID NO: 39). In certain embodiments, an oligomeric compound oligonucleotide is not complementary to an equal length portion containing positions hg38:Chr2: 165375115 to 165375135 of a SCN2A nucleic acid. In certain embodiments, an oligomeric compound oligonucleotide is not complementary to an equal length portion containing a rs1368238 SNV site or SNV position of a SCN2A nucleic acid. In certain embodiments, an oligomeric compound oligonucleotide is not complementary to an equal length portion containing a SNV site or SNV position in intron 22 of a SCN2A nucleic acid. In certain embodiments, an oligomeric compound is administered to a subject having a SCN2A nucleic acid that does not include a c.5645G>A variant. In certain embodiments, an oligomeric compound is administered to a subject having a SCN2A nucleic acid that does not include a SNV encoding a p.R1882Q amino acid substitution. In certain embodiments, an oligomeric compound is administered to a subject having a SCN2A nucleic acid not containing a SNV associated with hyperexcitability of neurons and / or increased sodium currents. In certain embodiments, an oligomeric compound is administered to a subject assessed as having one or more of: choreoathetosis, dysphagia, anxiety, and history of kidney stones. In certain embodiments, an oligomeric compound oligonucleotide is administered to a subject assessed as not having one or more of: irritability, sensory processing disorder, gastrointestinal features, seizures, movement disorder, and hypotonia. Exemplary Pharmaceutical Compositions In certain embodiments, provided is a pharmaceutical composition comprising one or more oligomeric compounds described herein. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. A pharmaceutical composition consisting essentially of a modified oligonucleotide and artificial cerebrospinal fluid can include one or more other components that do not materially affect solubility of the modified oligonucleotide in the pharmaceutical composition. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2. In certain embodiments, a pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone. In certain embodiments, an oligomeric compound can be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of a pharmaceutical composition or formulation. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. In certain embodiments, an oligomeric compound in a pharmaceutical composition can include any pharmaceutically acceptable salt of the oligomeric compound, ester of the oligomeric compound, or salt of such ester. In certain embodiments, a pharmaceutical composition comprising an oligomeric compound, upon administration to a subject, including a human subject, is capable of providing (directly or indirectly) a biologically active metabolite or residue of the oligomeric compound. For example, included are pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, where the conjugate group is cleaved by endogenous nucleases within a subject. In certain embodiments, oligomeric compounds are lyophilized and isolated as sodium salts. In certain embodiments, a sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, a pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, a sodium salt of an oligomeric compound is mixed with PBS. In certain embodiments, a sodium salt of an oligomeric compound is mixed with aCSF. Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain methods, an oligomeric compound is introduced into preformed liposomes or lipoplexes comprising mixtures of cationic lipids and neutral lipids. In certain methods, complexes containing oligomeric compound with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue. In certain embodiments, a pharmaceutical composition comprises a delivery system. Non-limiting examples of delivery systems include liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used. In certain embodiments, a pharmaceutical composition comprises one or more tissue- specific delivery molecules designed to deliver an oligomeric compound to specific tissues or cell types. For example, in certain embodiments, a pharmaceutical composition includes liposomes coated with a tissue-specific antibody. In certain embodiments, a pharmaceutical composition comprises a co-solvent system. Certain co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. A non-limiting example of a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v polyethylene glycol 300. Proportions of components in a co-solvent system can be varied without significantly altering their solubility and toxicity characteristics. Components of a co-solvent system can be varied: for example, other surfactants can be used instead of Polysorbate 80™; the fraction size of polyethylene glycol can be varied; other biocompatible polymers may replace polyethylene glycol (with polyvinyl pyrrolidone for example); and other sugars or polysaccharides may substitute for dextrose. In certain embodiments, a pharmaceutical composition is prepared for oral administration. In certain embodiments, a pharmaceutical composition is prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (for example, intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV) and the like). In certain embodiments, a pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, oner or more other ingredients are included, including one or more ingredients that aid in solubility or serve as preservatives for example. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. In certain embodiments, a pharmaceutical composition for injection is provided in unit dosage form, and can be provided in an ampoule or in a multi-dose container for example. In certain embodiments, a pharmaceutical composition for injection is a suspension, solution or emulsion in an oily or aqueous vehicle, and optionally can contain a formulatory agent such as a suspending, stabilizing and / or dispersing agent. Non-limiting examples of solvents suitable for use in pharmaceutical compositions for injection include lipophilic solvents and fatty oils (sesame oil for example), synthetic fatty acid esters (ethyl oleate or triglycerides for example), and liposomes. Under certain conditions, an oligomeric compound can function as an acid. While an oligomeric compound can be depicted or described in protonated (free acid) form or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution typically exists in equilibrium among free acid, anion and salt forms. In certain embodiments, a composition comprising a plurality of oligomeric compound molecules includes all such forms. Also, for example, certain oligonucleotides have several linkages, each of which is in equilibrium, and oligonucleotides in solution typically exist in an ensemble of forms at multiple positions all at equilibrium. In certain embodiments, a composition comprising a plurality of oligomeric compound molecules includes all such forms. Depicted structures necessarily depict a single form, and unless otherwise indicated, such depictions include corresponding forms. For example, a structure depicting the free acid of an oligomeric compound followed by the term “or a pharmaceutically acceptable salt thereof” includes all such forms that can be fully or partially protonated, de-protonated and in association with a cation or a combination of cations. In certain embodiments, one or more specific cations is identified. Non-limiting examples of cations include sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” includes all such forms that can be fully or partially protonated, de-protonated and in association with one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, an oligomeric compound is in aqueous solution with sodium. In certain embodiments, an oligomeric compound is in aqueous solution with potassium. In certain embodiments, an oligomeric compound is in PBS. In certain embodiments, an oligomeric compound is in water. In certain embodiments, the pH of the solution is adjusted with a base (NaOH for example) and / or an acid (HCl for example) to achieve a desired pH. An oligomeric compound can be provided in a pharmaceutical composition at a suitable dose. A dose can be in the form of a dosage unit. A dose or dosage unit of a modified oligonucleotide or an oligomeric compound in milligrams typically indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. While the free acid is in equilibrium with anionic and salt forms as described, the dose is calculated with an assumption that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid. In certain embodiments, where a modified oligonucleotide or an oligomeric compound is in a solution comprising sodium (for example, saline), the modified oligonucleotide or oligomeric compound can be partially or fully deprotonated and in association with sodium ions. The mass of the protons typically is counted toward the weight of the dose, and the mass of the sodium ions typically is not counted toward the weight of the dose. In certain embodiments, where a modified oligonucleotide or oligomeric compound is in a solution, such as aCSF, comprising sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound can be partially or fully de- protonated and in association with sodium, potassium, calcium, and / or magnesium. The mass of the protons typically is counted toward the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions typically is not counted toward the weight of the dose. In certain embodiments, where an oligomeric compound comprises a conjugate group, the mass of the conjugate group can be included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group typically is assumed as being fully protonated for the purpose of calculating dose. Products of manufacture and Kits Provided are products of manufacture and kits for practicing methods as provided herein, and optionally the products of manufacture and kits comprise components to practice methods as provided herein, or to practice compounds as provided herein. Optionally, products of manufacture and kits further comprise instructions for practicing methods as provided herein. The invention will be further described with reference to the examples described herein; however, it is to be understood that the invention is not limited to such examples. EXAMPLES In alternative embodiments, recombinant DNA techniques are carried out according to standard protocols, for example, as described in Sambrook et al. (2012) Molecular Cloning: A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory Press, NY and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Other references for standard molecular biology techniques include Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY, Volumes I and II of Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK). Standard materials and methods for polymerase chain reactions can be found in Dieffenbach and Dveksler (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and in McPherson at al. (2000) PCR - Basics: From Background to Bench, First Edition, Springer Verlag, Germany. The examples set forth below illustrates certain embodiments and do not limit the technology. Example 1: In vitro assessment of test oligomeric compounds The ASO7 and ASO17 compounds described in this Example were identified as clinical candidates for treating patients having a SCN2A mutant allele from a primary screen of several test oligomeric compounds designed to target different SNV sites on the SCN2A gene. Test oligomeric compounds, referred to as antisense oligonucleotides (ASOs), were designed to promote selective degradation of the pathogenic mutant SCN2A allele transcript containing the c.2558G>A mutation (for Patient A) or c.5645G>A mutation (for Patient B) through recruitment of RNase H1 to the RNA-ASO heteroduplex. To identify differentiating variations that could be targeted by ASOs, it was determined by long-read sequencing that sample SCN2A nucleic acid from the human patient having the pathogenic SCN2A allele that several single nucleotide polymorphism (SNP) non-pathogenic sites were heterozygous. Non- pathogenic SNV sites and SNV positions are described in Table B and Table C herein (excluding the last row of each Table). In short, to achieve allele selectivity, non- pathogenic SNPs were identified and then used to design ASOs. To this end, PacBio or Nanopore HiFi long-read, high resolution whole genome sequencing was performed to allow for haplotype phasing, and identifying SNPs in both the wild-type allele and mutant allele. Test ASOs were designed to target the SNP allele variants at non-pathogenic SNV sites present on the pathogenic allele, and were screened in vitro to identify test ASOs that selectively reduced the patient’s SCN2A pathogenic allele nucleic acid. Table 1 defines the oligonucleotide nucleobase sequence of each oligomeric compound ASO assessed. The “cmpd.” column notates a reference for an oligomeric compound targeted to the corresponding SNV site referenced in the “DB ref.” column. The “oligo SID” column specifies a “SEQ ID NO” designator corresponding to the oligonucleotide nucleobase sequence in the third column. The nucleobase in bold text of the oligonucleotide specified in third column of Table 1 aligns with the target SNV polymorphic position in the SCN2A mutant allele, and is complementary to the “v1” nucleobase of Table C at that position. Table 1: SCN2A allele-selective oligomeric compound oligonucleotides Each of the modified oligonucleotides of the ASOs of Table 1 is a 5-10-5 MOE gapmer with mixed phosphorothioate and phosphodiester (PS / PO) internucleoside linkages. Each modified oligonucleotide of Table 1: (i) consists of 20 linked nucleosides; (ii) has the following sugar motif (from 5' to 3'): eeeeeddddddddddeeeee, where each "e" represents a 2' -MOE ribosyl sugar moiety, and each "d" represents a 2’-deoxyribosyl sugar moiety; (iii) has the following nucleoside linkage motif (from 5' to 3 '): soooossssssssssooss, where each "s" represents a (S)-phosphorothioate internucleoside linkage, and each "o" represents a phosphodiester internucleoside linkage; and (iv) each “C” nucleoside is a 5-methylcytosine. The ASO1 to ASO16 oligomeric compounds in Table 1 were selected according to potency and allele-selectivity assessments from two successive screens of a larger number or oligomeric compound candidates. The first screen was performed using a single oligomeric compound concentration. The subsequent second screen was performed using multiple concentrations of selected oligomeric compounds, and was initiated with free uptake of each oligomeric compound at concentrations of 0.0781 µM, 0.3125 µM, 1.25 µM, 5 µM and 20 µM by iPSc-derived neurons from Patient A followed by 5 day maintenance in oligomeric compound-free media. The screens employed primer probe sets that specifically and efficiently amplified mutant SCN2A allele mRNA and wild-type SCN2A allele mRNA in a quantitative real-time PCR reaction (qPCR with Taqman probes). Cells were harvested and RNA isolated using RNA easy 96 well kit (Qiagen) according to the manufacture’s instructions. SCN2A mRNA was quantitated using a quantitative RT-PCR (TaqMan) assay on an Applied Biosystems 7900H Fast Real-Time PCR System. Inhibition of mutant SCN2A allele RNA expression by selected oligomeric compound assessed in the second screen is reported as a micromolar IC50 value in the fourth column of Table 2. The ASO17 oligomeric compound in Table 1 was selected according to the following assessment. In vitro potency and allele-selectivity were determined following a dose response of the lead mutant allele-selective SCN2A ASO17 in cells from Patient B using free uptake at concentrations of 0.065 µM, 0.16 µM, 0.4 µM, 1.024 µM, 2.56 µM, 6.4 µM, 16 µM, and 40 µM. The patient’s cells were iPSC-derived neurons. This compound does not result in lowering of the wild type SCN2A allele. PCR was performed with probes to identify both the wild type and mutant allele expression. Cells were harvested and RNA isolated using RNA easy 96 well kit (Qiagen) according to the manufacturer’s instructions. SCN2A mRNA was quantitated using quantitative RT-PCR (TaqMan) assay on an Applied Biosystems 7900H Fast Real- Time PCR System. ASO17 is predicted to bind to an intronic sequence of the SCN2A gene on the allele that contains the causal pathogenic mutation in this patient, which is homologous to the annotated sequence. There is a differentiating SNP in this patient’s wild type allele at this position, which allows for differential binding and target reduction thus sparing the wild type SCN2A allele in this patient. Table 2: Inhibition activity of SCN2A-targeted oligomeric compounds The mutant allele selectivity ratio in the fifth column of Table 2 is the ratio of the IC50 value determined for the wild-type allele (numerator, data not shown) to the IC50 value determined for the mutant allele (denominator, fourth column of Table 2), with each IC50 value determined by a multi-point dose response curve. The number of oligomeric compounds reported in Table 2 is more than 4-fold less than the total number of oligomeric compounds assessed by the first screen. Example 2: Pre-clinical ASO treatment assessments Preclinical assessment of Patient A treatment with ASO7 Tolerability and potential toxicity of an antisense oligonucleotide (ASO) drug targeting a mutant SCN2A allele containing the c.2558G>A mutation was assessed in preclinical studies to inform clinical treatment of a human patient (Patient A). Test article ASO7 shown in Table 1 of Example 1, and having the chemical structure shown in embodiment A61 herein, was assessed in an 8-week single intracerebroventricular dose study in mice, an 8-week single intrathecal dose study in rats, and a GLP compliant 13-week once monthly intrathecal dose study in Sprague Dawley rats. A summary of toxicity studies is provided in Table 3 below. Table 3: Summary of ASO7 Toxicology Studies A.8-Week Single ICV Dose Tolerability Study with ASO7 in Mice Objective The objective of this study was to evaluate the tolerability and potential toxicity of ASO7 in C57 / Bl6 mice after a single intracerebroventricular (ICV) dose followed by 8 weeks of observation. The data from this study was used to inform dose selection for a subsequent GLP toxicology study. Methods Four female animals / group were assigned to treatment groups receiving a single ICV injection of PBS or ASO7 at 0.7 mg. Terminal sacrifice was performed on Day 56. Table 4: Study Design F = Female a Control and test article were administered once on Day 0 by intracerebroventricular injection with necropsies occur...

Claims

WHAT IS CLAIMED IS:

1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein: the modified oligonucleotide comprises or consists of a nucleobase sequence that is at least 80% complementary to an equal length portion of a genetic variation site of a SCN2A nucleic acid; and the modified oligonucleotide comprises a modified nucleoside, or a modified internucleoside linkage, or a modified nucleoside and a modified internucleoside linkage.

2. The oligomeric compound of claim 1, which is capable of selectively reducing expression of a SCN2A allelic variant.

3. The oligomeric compound of claim 1 or claim 2, wherein the equal length portion of the genetic variation site contains a differentiating variation.

4. The oligomeric compound of any one of claims 1-3, wherein: the genetic variation site is a single nucleotide variation site; and optionally wherein the single nucleotide variation site comprises a synonymous single nucleotide variation.

5. The oligomeric compound of claim 4, wherein: the single nucleotide variation site comprises a single nucleotide variation position and the modified oligonucleotide comprises a nucleoside aligned with the single nucleotide variation position; and optionally wherein the modified oligonucleotide comprises a nucleoside aligned with and complementary to a nucleoside at the single nucleotide variation position.

6. The oligomeric compound of claim A6, wherein: the modified oligonucleotide comprises a nucleoside aligned with and complementary to a first nucleoside at the single nucleotide variation position of a first SCN2A allelic variant and not complementary to a second nucleoside at the single nucleotide variation position of a second SCN2A allelic variant; optionally the modified oligonucleotide is capable of selectively reducing expression of the first SCN2A allelic variant to a greater extent than expression of the second SCN2A allelic variant;optionally the oligomeric compound selectively reduces expression of the first SCN2A allelic variant according to a selectivity ratio of at least 2 or greater than 2, wherein the selectivity ratio is (i) inhibition of expression of the second SCN2A allelic variant to (ii) inhibition of expression of the first SCN2A allelic variant, optionally wherein the inhibition of expression of the second SCN2A allelic variant is an IC50 value and the inhibition of expression of the first SCN2A allelic variant is an IC50 value.

7. The oligomeric compound of claim 5 or claim 6, wherein: the modified oligonucleotide consists of 10-30 linked nucleosides and the nucleoside at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the single nucleotide variation position; or the modified oligonucleotide consists of 18-22 linked nucleosides, or optionally 20 linked nucleosides, and the nucleoside at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the single nucleotide variation position.

8. The oligomeric compound of any one of claims 5-7, wherein the modified oligonucleotide consists of 18-22 linked nucleosides, or optionally 20 linked nucleosides, and comprises: a 5’-region consisting of linked 5’-region nucleosides; a central region consisting of linked central region nucleosides; a 3’-region consisting of linked 3’-region nucleosides; the central region comprises a 5’ terminus; and the nucleoside at position 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of the central region, as counted from the 5' terminus of the central region, aligns with the single nucleotide variation position.

9. The oligomeric compound of any one of claims 4-8, wherein: the single nucleotide variation site is within a SCN2A intron; or optionally is within SCN2A intron 3, intron 11, intron 13, intron 17 or intron 22; or optionally is within SCN2A intron 11 or intron 22; oroptionally the single nucleotide variation site is selected from one of rs3769931, rs72872496, rs544136707, rs72874313, rs3769944, rs3769947, rs2304017, rs72874358 and rs1368238; or optionally is selected from one of rs3769931, rs72872496, rs72874313, rs3769944, rs72874358 and rs1368238; or optionally is rs72874313 or rs1368238.

10. The oligomeric compound of any one of claims 4-9, wherein the modified oligonucleotide comprises or consists of a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to an equal length portion of contiguous nucleobases within: SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:31; or optionally SEQ ID NO:26 to SEQ ID NO:30; or optionally SEQ ID NO:4; or optionally SEQ ID NO:28; or optionally SEQ ID NO:

31.

11. The oligomeric compound of any one of claims 4-10, wherein: the modified oligonucleotide comprises or consists of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NO:10 to SEQ ID NO:25 or SEQ ID NO:32, or optionally SEQ ID NO:10 to SEQ ID NO:14 or SEQ ID NO:16 to SEQ ID NO:19 or SEQ ID NO:22 to SEQ ID NO:25; or optionally, the modified oligonucleotide comprises or consists of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of SEQ ID NO:16 or SEQ ID NO:

32.

12. The oligomeric compound of any one of claims 1-11, the modified oligonucleotide comprises or consists of a nucleobase sequence that is at least 85% complementary to, or at least 90% complementary to, or at least 95% complementary, or is 100% complementary to, an equal length portion of the genetic variation site.

13. The oligomeric compound of any of claims 1-12, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 13 to 20, 13 to 25, 13 to 30, 14 to 20, 14 to 25, 14 to 30, 15 to 20, 15 to 25, 15 to 30, 16 to 18, 16 to 20, 16 to 25,16 to 30, 17 to 20, 17 to 25, 17 to 30, 18 to 20, 18 to 25, 18 to 30, 19 to 20, 19 to 25, 19 to 30, 20 to 25 or 20 to 30 linked nucleosides.

14. The oligomeric compound of any one of claims 2-13, wherein: the SCN2A allelic variant is a mutant SCN2A allele associated with a medical condition; or optionally the SCN2A allelic variant comprises a pathogenic genetic variation site associated with a medical condition; or optionally the medical condition is a SCN2A-associated medical condition; or optionally the SCN2A-associated medical condition is chosen from SCN2A- associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A- associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy.

15. The oligomeric compound of claim 14, wherein: the pathogenic genetic variation site is associated with a non-loss of function phenotype; or optionally the non-loss of function phenotype is a dominant negative phenotype, a gain of function phenotype or toxic gain of function phenotype.

16. The oligomeric compound of claim 14 or claim 15, wherein: the pathogenic genetic variation site is a pathogenic single nucleotide variation site; or optionally the pathogenic single nucleotide variation site comprises a non- synonymous single nucleotide variation at a pathogenic genetic variation position.

17. The oligomeric compound of any one of claims 14-16, wherein: the pathogenic genetic variation site is in an exon of the SCN2A allelic variant; or optionally the pathogenic genetic variation site is in exon 15 or exon 27 of the SCN2A allelic variant; or optionally the pathogenic genetic variation site contains a variant resulting in an amino acid substitution in a SCN2A protein chosen from: V261M, R853Q,H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, P1658S or R1882Q; or optionally the pathogenic genetic variation site comprises a c.2558G>A genetic variant or c.5645G>A genetic variant; or optionally the pathogenic genetic variation site comprises a nucleobase sequence of SEQ ID NO:9 or SEQ ID NO:

33.

18. The oligomeric compound of any one of claims 14-17, wherein: the equal length portion of the genetic variation site contains the pathogenic genetic variation position, or contains the pathogenic genetic variation site or portion thereof; or optionally the equal length portion of the genetic variation site does not contain the pathogenic genetic variation position, or does not contain the pathogenic genetic variation site or portion thereof.

19. The oligomeric compound of any one of claims 1-18, wherein: the modified oligonucleotide comprises at least one modified internucleoside linkage; or optionally the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

20. The oligomeric compound of claim 19, wherein the modified oligonucleotide comprises an internucleoside linkage motif (from 5' to 3’) selected from sososssssssssssooss, sooosssssssssssooss and soooossssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage, and optionally each “s” represents a (S)- phosphorothioate internucleoside linkage.

21. The oligomeric compound of any one of claims 1-20, wherein: the modified oligonucleotide comprises at least one modified nucleoside; or optionally the at least one modified nucleoside comprises a modified sugar; or optionally the at least one modified nucleoside is a 2’-substituted sugar moiety; or optionally the 2’-substitued sugar moiety is a 2'-MOE sugar moiety.

22. The oligomeric compound of claim 21, wherein the modified oligonucleotide comprises a sugar motif of 5’-eeeeeddddddddddeeeee-3’, wherein each "d " represents a 2’-beta-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety.

23. The oligomeric compound of any one of claims claim 19-22, wherein the modified oligonucleotide: (i) consists of 20 linked nucleosides; (ii) consists of a sugar motif (from 5' to 3'): eeeeeddddddddddeeeee, wherein each "e" represents a 2' -MOE ribosyl sugar moiety, and each "d" represents a 2’-deoxyribosyl sugar moiety; (iii) consists of a nucleoside linkage motif (from 5' to 3 '): soooossssssssssooss, wherein each "s" represents a (S)-phosphorothioate internucleoside linkage, and each "o" represents a phosphodiester internucleoside linkage; and (iv) each “C” nucleoside is a 5-methylcytosine.

24. The oligomeric compound of any one of claims 1-23, wherein the modified oligonucleotide comprises: a 5’-region consisting of 1-6 linked 5’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’-region consisting of 1-6 linked 3’-region nucleosides; wherein: each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety, and three or more of the central region nucleosides comprise a 2’-beta-D-deoxyribosyl sugar moiety.

25. The oligomeric compound of any one of claims 1-24, wherein the modified oligonucleotide comprises: a 5’-region consisting of 5 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 5 linked 3’-region nucleosides; wherein: each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety, and three or more of the central region nucleosides comprise a 2’-beta-deoxyribosyl sugar moiety.

26. The oligomeric compound of any one of claims 1-25, comprising or consisting of: 5ʹ-G-G-mU-mC-A-A-T-T-G-A-A-A-G-A-T-A-mU-mC-mC-mC-3ʹ (SEQ ID NO: 34), wherein: “m” is methyl and each of the underlined nucleosides is a modified nucleoside comprising a 2’-MOE sugar moiety;optionally each mU is a 5-methyluridine; and optionally each mC is a 5-methylcytidine.

27. The oligomeric compound (SEQ ID NO: 35) of any one of claims 1-25, comprising or consisting of: 2ʹ-O-(2-methoxyethyl)-guanosine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-guanosine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-5-methyluridine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-5-methylcytidine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-adenosine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-thymidine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-thymidine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-thymidine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-adenosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methyluridine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-5-methylcytidine-(3ʹ-O→5ʹ-O)-^ 2ʹ-O-(2-methoxyethyl)-5-methylcytidine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methylcytidine, nonadecasodium salt.

28. An oligomeric compound of any one of claims 1-25, comprising or consisting of:.

29. The oligomeric compound of any one of claims 1-25, comprising or consisting of: 5ʹ- mU-G-mC-mC-mA-A-mC-A-A-T-G-T-A-mC-A-A-G-G-G-mU -3ʹ (SEQ ID NO: 36), wherein: “m” is methyl; each of the underlined nucleosides is a modified nucleoside comprising a 2’-MOE sugar moiety; and optionally each mU is a 5-methyluridine and optionally each mC is a 5-methylcytidine.

30. The oligomeric compound (SEQ ID NO: 37) of any one of claims 1-25, comprising or consisting of: 2ʹ-O-(2-methoxyethyl)-5-methyluridine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methylcytidine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methylcytidine -(3ʹ-O→5ʹ-O)-2ʹ-O-(2-methoxyethyl)- adenosine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-5-methylcytidine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-thymidine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-guanosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-thymidine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-5-methylcytidine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-deoxy)-adenosine -(3ʹ-O→5ʹ-O) 2ʹ-O-(2-methoxyethyl)- adenosine -(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)- guanosine-(3ʹ-O→5ʹ-O)- 2ʹ-O-(2-methoxyethyl)-5-methyluridine, nonadecasodium salt.

31. An oligomeric compound of any one of claims 1-25, comprising or consisting of:.

32. A composition, comprising an oligomeric compound of any one of claims 1-31; or a pharmaceutical composition comprising an oligomeric compound of any one of claims 1-31 and a pharmaceutically acceptable diluent.

33. An oligomeric compound of any one of claims 1-31, or a composition or a pharmaceutical composition of claim 32, for reducing SCN2A expression, and optionally for selectively reducing expression of a SCN2A allelic variant.

34. An oligomeric compound of any one of claims 1-31, a composition or a pharmaceutical composition of claim 32, for treating a SCN2A-associated medical condition; wherein optionally the SCN2A-associated medical condition is SCN2A- associated autism, SCN2A-associated neurodevelopmental disorder, SCN2A- associated epileptic encephalopathy, SCN2A-associated developmental and epileptic encephalopathy, or SCN2A-associated self-limited neonatal / infantile epilepsy.

35. The oligomeric compound, composition or pharmaceutical composition of claim 34, wherein at least one symptom or hallmark is ameliorated, and optionally wherein the symptom or hallmark is one or more of: seizure; self-limited seizure; developmental delay; intellectual disability; behavior disorder; autism spectrum disorder feature; poor muscle tone (hypotonia); movement disorder; feeding difficulty; vision difficulty; and cortical visual impairment (CVI).

36. The oligomeric compound, composition or pharmaceutical composition of any one of claims 33-35, comprising: determining presence or absence of a differentiating variation site in a SCN2A nucleic acid; and if a differentiating variation site is present, administering an oligomeric compound targeted to the differentiating variation site.

37. The oligomeric compound, composition or pharmaceutical composition of claim 36, wherein the SCN2A nucleic acid comprises a mutant SCN2A allelic variant, and optionally characterizing a pathogenic genetic variation site in the mutant SCN2A allelic variant.

38. The oligomeric compound, composition or pharmaceutical composition of any one of claims 33-37, wherein:the SCN2A nucleic acid is a mutant SCN2A nucleic acid and the SCN2A allelic variant is a mutant SCN2A allelic variant, each comprising a pathogenic genetic variant associated with a medical condition; or optionally the pathogenic genetic variant is associated with a non-loss of function effect; or optionally the pathogenic genetic variant is associated with a dominant negative effect, gain of function or toxic gain of function; or optionally the pathogenic genetic variant is a pathogenic single nucleotide variant; or optionally the pathogenic single nucleotide variant comprises a non- synonymous single nucleotide variant at a pathogenic genetic variation position; or optionally the pathogenic genetic variant results in one of the following amino acid substitutions: V261M, R853Q, H1853R, E999K, E1211K, R1319Q, A1500T, R1629H, P1658S, or R1882Q; or optionally the pathogenic genetic variant is in an exon; or optionally the pathogenic genetic variant is in exon 15 or exon 27; or optionally the pathogenic genetic variant is c.2558G>A or is c.5645G>A; or optionally the pathogenic genetic variant in a pathogenic genetic variation site comprising a nucleobase sequence of SEQ ID NO:9 or SEQ ID NO:33.

Citation Information

Patent Citations

  • Treatment of sodium channel, voltage-gated, alpha subunit (SCNA) related diseases by inhibition of natural antisense transcript to scna

    US20180002696A1

  • Antisense oligomers for treatment of conditions and diseases

    US20200024603A1