Compositions and methods for cartilage regeneration and / or repair
Specific smRNAs enhance cartilage formation and reduce degradation, addressing the intrinsic repair mechanisms of osteoarthritis by promoting cartilage regeneration and treating the condition effectively.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2026-04-02
AI Technical Summary
Current treatments for osteoarthritis lack effective compositions and methods for cartilage regeneration, as they primarily focus on external strategies without addressing the intrinsic repair mechanisms of cartilage.
Compositions comprising specific small non-coding RNAs (smRNAs) such as miR-21, miR-31, and miR-93, and their complementary antisense oligonucleotides, administered with pharmaceutically acceptable carriers, enhance cartilage formation genes and suppress cytokine secretion, promoting cartilage regeneration.
The identified smRNAs enhance cartilage matrix gene expression, reduce degradation, and suppress cytokine secretion, effectively regenerating cartilage and potentially treating osteoarthritis.
Smart Images

Figure US2025048364_02042026_PF_FP_ABST
Abstract
Description
[0001]COMPOSITIONS AND METHODS FOR CARTILAGE REGENERATION AND / OR REPAIR CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 700,205 filed on September 27, 2024, the contents of which is incorporated by reference in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on September 26, 2025, is named “155554.00791.xml” and is 563,428 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety. BACKGROUND Osteoarthritis is a prevalent chronic disease that represents a large and growing global health burden of large unmet need with respect to diagnostics, prognostics and therapeutics. Based on data from the Global Burden of Disease 2010 Study, musculoskeletal conditions are the second greatest cause of disability, as measured by years lived with disability (YLDs) worldwide and across most regions of the world; the main contributors are low back pain (83.1 million YLDs), neck pain (33.6 million YLDs) and osteoarthritis (17.1 million YLDs) of the joints, such as the hip, knee and ankle. For instance, osteoarthritis of the knee accounts for 83% of this total. Globally, osteoarthritis of the knee affects 251 million individuals, and back and neck pain (likely largely also attributable to osteoarthritis) currently affect 964 million people worldwide. In the US, according to the Centers for Disease Control, osteoarthritis affects an estimated 26.9 million US adults (estimates from 2005, up 28% from the estimated 21 million US adults impacted in 1990). As the US population continues to age and struggle with obesity, the incidence and prevalence of the disease are expected to continue to grow. Consequently, the annual cost of osteoarthritis to the US, estimated to be $89.1 billion in 2001, is anticipated to continue to grow. Accordingly, there is a remaining need in the art for novel compositions and methods for treating osteoarthritis. SUMMARY Described herein, the inventors have identified specific small non-coding RNAs (smRNAs) correlated with cartilage regeneration in osteoarthritis across multiple species. These smRNAs enhanced expression of key cartilage formation genes, reduced cartilage degradation, and suppressed cytokine secretion from human cartilage and chondrocytes. Further, the inventors show region-specific regenerative capacity under osteoarthritic stress. Accordingly, the present disclosure provides compositions for cartilage regeneration and methods of using the same. One aspect of the present disclosure provides a composition for cartilage regeneration comprising a polynucleotide selected from the group consisting of: (a) at least one of SEQ ID NOs: 1-36, 66, 67, 68 or a homolog thereof having at least 90% identity thereto; (b) an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65, 69 or a homolog thereof having at least 90% identity thereto; or (c) combinations of (a) and (b); and a pharmaceutically acceptable carrier. In some embodiments, the composition comprises (a) at least one of SEQ ID NO: 1, 11, 22, 30; (b) an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37 or 41; or (c) combinations of (a) and (b). In some embodiments, the polynucleotide is an RNA. In some embodiments, the polynucleotides comprises at least one modified nucleotide. In some embodiments, the composition further comprises a nanocarrier. In some embodiments the nanocarrier is bound to or encompasses the polynucleotide. In some embodiments, the nanocarrier is selected from a lipid-based nanocarrier, a polymeric nanocarrier or an inorganic nanocarrier. In some embodiments, the composition further comprises a cargo molecule. In some embodiments, the carbo molecule comprises a polynucleotide, a polypeptide, an active pharmaceutical ingredient or therapeutic agent. Another aspect of the present disclosure provides a construct comprising a heterologous promoter operably connected to a polynucleotide encoding: (a) at least one of SEQ ID NOs: 1-36, 66, 67, 68 or a homolog thereof having at least 90% identity thereto; or (b) an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65, 69 or a homolog thereof having at least 90% identity thereto. In some embodiments, the construct comprises a lentiviral, retroviral or AAV vector. Another aspect of the present disclosure provides a method of regenerating cartilage in a subject in need thereof, the method comprising, administering any composition or construct described herein to the subject to allow regeneration of cartilage in the subject. In some embodiments, the composition is administered via injection into the affected tissue. In some embodiments, the affected tissue is a synovial joint. In some embodiments, the synovial joint is a hip, knee, ankle, shoulder, elbow, wrist, finger, temporomandibular or facet joint. In some embodiments, the subject in need is diagnosed with or suspected of having arthritis, cartilage tears, cartilage damage or is undergoing a surgery in or near a synovial joint. In some embodiments, the arthritis comprises osteoarthritis or rheumatoid arthritis. In some embodiments, the composition is administered at least one time. In some embodiments, the subject is diagnosed with or suspected of having arthritis and the composition is administered at least twice, or is formulated for sustained delivery. Another aspect of the present disclosure provides a method of treating osteoarthritis in a subject in need thereof, the method comprising administering any composition or construct described herein to the subject to treat osteoarthritis. In some embodiments, the composition is administered at least once or formulated for sustained delivery. In some embodiments, the composition is administered directly into the arthritic joint. In some embodiments, the method further comprises obtaining a biological sample from the subject and measuring the expression of at least one biomarker prior to administering the composition, wherein the biomarker is selected from the group consisting of: (a) CRAC1 (CRTAC1), CXCL7, CO8G, A2AP, A1BG, A2GL, AACT, ACTG, AMBP, APOB, APOE, B2MG, C1QC, C1R, C1RL, C4BPA, C4BPB, CD14, CD44, CERU, CFAB, CFAH, CFAI, CILP1, C1S, CNDP1, CO2, CO4B, CO5, CO6A3, CO8B, CO9, coll3, COMP, CTX1a, CTX1b, CTX2, CTXi, ECM1, FA12, FA5, FBLN1, FBLN3, FCGBP, FCN3, FETUA, FINC, GELS, HA, HABP2, haptoglobin, HEMO, HEP2, HGFA, HRG, hyaluronan, IC1, ITIH1, ITIH4, KNG1, LAMA2, LUM, LYAM1, MASP1, PCOC1, PGCA, PHLD, PLF4, PLMN, PRG4, RET4, SAMP, SHBG, TENX, TETN, THBG, TIMP1, TSP1, TSP4, VTDB, VTNC, ZA2G, ZPI, and any combination thereof; or (b) CSPG4, BGN, NRP1, CD109, VISG4, MARCO, CD163, LRP1, PTPRS, ANXA2, ANXA5, HSP90AB1, IL-11, IL-11RA, GP130, FN1, CD29, ITGA5, ICAM1, IL-21, FGA, FGB, FGG, TLN1, AMBP and any combination; and comparing the level of at least one biomarker in the sample to a reference level of the biomarker and administering the composition if the biomarker is increased as compared to the reference. In some embodiments, the biological sample comprises synovial fluid, chondrocytes, synoviocytes, blood, serum or plasma. In some embodiments, the method further comprises isolating extracellular vesicles from the synovial fluid, blood, serum or plasma prior to measuring the expression of at least one biomarker. In some embodiments, the osteoarthritis is osteoarthritis of the hip, knee, ankle, shoulder, elbow, wrist, finger, temporomandibular or facet joint. In some embodiments, the method further comprises administering one or more second therapeutic agents to the subject with increased expression of any one of the biomarkers. In some embodiments, the second therapeutic agent comprises an analgesic, a non-steroidal anti-inflammatory drug, steroid injection, surgery or combinations thereof. BRIEF DESCRIPTION OF THE DRAWINGS The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Figure 1. Research Framework: Exploring Cartilage smRNA and Regeneration in Osteoarthritis. This figure outlines the experimental workflow used to identify and characterize regenerative small (sm) RNAs in cartilage tissue. The process begins with RNA extraction and extracellular matrix (ECM) protein isolation from cartilage samples obtained from hip, knee, and ankle joints. RNA sequencing was performed to analyze both small non-coding (sc)RNA (SEQ ID NO: 423), including micro- and pi-RNA, and messenger RNA (mRNA), while mass spectrometry is used to examine ECM proteins and to determine their anabolic indices. This analysis led to the identification of 69 regenerative smRNAs (micro- and pi-RNAs). Based on their correlation with the protein anabolic indices, the identified smRNAs were categorized into pro-anabolic and anti- anabolic smRNAs. The mRNA targets and signaling pathways of these smRNAs were identified. The functions of a key pro-anabolic smRNA, miR-21 or scrambled control, were evaluated in vitro in a chondrocyte cell line and cartilage explants with lentiviral or adeno-associated virus 2 (AAV2)-based delivery vectors, respectively. The pro-anabolic function of miR-21 was confirmed through gene expression analysis, biochemical markers, and cytokine profiling. This comprehensive approach combined genomic, proteomic, and functional analyses to elucidate the role of smRNAs in cartilage regeneration, potentially opening new avenues for therapeutic interventions in cartilage-related disorders. Figure 2. Heatmap and Correlation Matrix of Pro-Anabolic and Anti-Anabolic smRNAs in OA and Non-OA Human Cartilage. A) Heatmap depicting the correlation of pro-anabolic and anti-anabolic small (sm)RNAs across ankle, knee, and hip cartilage from osteoarthritic (OA, top) and non-OA (bottom) samples. Based on correlation coefficients, smRNAs with positive correlations (blue dots) with the anabolic indices (of five separate proteins) and regenerative index (of the five proteins combined) were defined as pro-anabolic smRNAs, while those with negative correlations (red dots) were classified as anti-anabolic smRNAs. The five studied proteins were ACAN G1 (aggrecan G1 domain), COMP (cartilage oligomeric matrix protein), PRELP (Proline / Arginine-rich end Leucine-rich repeat protein), COL3A1 (type III collagen alpha 1 chain), and COL2A1 (type II collagen alpha 1 chain). The associations of smRNAs with joint location gradient (ankle-knee-hip) indicates that pro-anabolic smRNAs are enriched in the ankle, while anti-anabolic smRNAs are enriched in the hip. These patterns were readily apparent in OA but not non-OA samples. Among the group of 59 human cartilage regenerative miRNAs, 35.6 % (21 out of 59) were expressed during limb regeneration, compared to 31% (87 out of 280) of the remaining human cartilage miRNAs. B) The correlation matrix of the 69 small RNAs (including 59 miRNAs and 10 piRNAs), identified in human lower limb cartilage, is divided into OA (top right), and non- OA (bottom left) tissue. In OA cartilage, pro-anabolic and anti-anabolic smRNAs demonstrated strong correlations within their respective groups, while they were inversely correlated with each other. In contrast, non-OA cartilage exhibited only weak and sparse correlations among smRNAs, indicating less interaction between pro- and anti-anabolic factors. Figure 3. Differential Expression and Enrichment Analysis of Pro-Anabolic and Anti- Anabolic smRNAs in OA Cartilage: Volcano Plot, Functional Classification, and ECM Gene Set Enrichment. A) Volcano plot showing differential expression of 102 significant smRNAs (p < 0.05) between ankle and hip osteoarthritic (OA) cartilage. The x-axis represents the log2 fold change, while the y-axis represents the –log10 of the p-value. Pro-anabolic smRNAs enumerated in Figure 2 are depicted in blue and are upregulated in ankle, while the anti-anabolic smRNAs enumerated in Figure 2 are shown in red and are upregulated in hip. The classification (B) and enrichment (C) analysis, based on differentially expressed genes and curated canonical pathways in the Molecular Signatures Database (MSigDB), respectively, show that these genes were highly associated with extracellular matrix (ECM) related functional groups. The horizontal bar chart (B) shows the number of genes belonging to each functional category, with the x-axis representing the number of occurrences. C) dot plot showing significantly enriched functional groups, with the size of each dot representing the gene cluster size and the color indicating the q-value (red for lower q- values, representing higher significance). D) Gene Set Enrichment Analysis (GSEA) plots for three highly enriched gene sets related to the ECM: NABA_Collagens, NABA_Basement Membranes, and NABA_ECM Glycoproteins. The enrichment score (ES), and the associated p-values are shown for each pathway. Figure 4. miR-21 Enhances Cartilage Matrix Gene Expression Without Impacting Chondrocyte Viability Under OA-Like Stress. A) Cell viability assay of C28 / I2 chondrocytes transduced with either miR-21 or scrambled control (SC) lentiviral constructs. No significant differences in cell viability were observed between miR-21 and control groups, indicating that miR-21 overexpression does not affect chondrocyte viability. B) miR21 expression levels in C28 / I2 cells under Control (normal media conditions) and osteoarthritic (OA)-like stress (OA stress) conditions with media supplemented with hyaluronic acid fragments (HA) + lipopolysaccharide (LPS). miR21 expression significantly increased under OA-like stress in both miR-21-transduced and scrambled control (SC)-transduced cells; miR-21 overexpression by miR- 21 transduction resulted in amplified responses compared with OA stress alone including, gene expression levels of (C) ACAN (aggrecan), (D) COL2A1 (type II collagen alpha 1 chain), and (E) MMP13 (matrix metalloproteinase 13) that were all significantly elevated in miR-21-transduced cells compared to the scrambled control, suggesting that miR-21 promotes both matrix production and proteolytic activity under OA-like conditions. Overall, these data demonstrate that miR-21 overexpression in chondrocytes enhances the expression of cartilage matrix-related genes when exposed to OA-like stress, without affecting cell viability. Figure 5. AAV-Mediated miR-21 Transduction Enhances Cartilage Matrix Integrity and Reduces Cytokine Secretion in Primary Human Cartilage Explants. A) Exogenous Green Fluorescent Protein (GFP, shown in red), delivered via adeno-associated virus 2 (AAV2), was expressed in nearly 100% of chondrocytes, co-localizing with 4′,6-diamidino-2-phenylindole (DAPI)-stained nuclei (blue) at 14 days post-transduction. This indicates efficient transduction in the chondrocyte population in situ. B) GFP (shown in red) expression was observed throughout the entire depth of the articular cartilage explants, from the superficial (top) to the deep (bottom) layer, further confirming effective widespread transduction with the AAV vector. C) GFP gene expression was significantly upregulated in AAV-transduced cartilage explants at both 14 and 28 days post-transduction, compared to non-transduced (D0) controls in which GFP expression was absent. This confirms the success of the transduction system. D) Comparison of aggrecan (soluble glycosaminoglycan, sGAG) and collagen loss (C-terminal cross-linked telopeptides of type II collagen, CTX-II) from human cartilage explants without (micro-RNA scrambled control, miSC, white bars) vs with AAV-mediated transduction of miR-21 (miR21, blue bars); miR-21 resulted in a 37% reduction in sGAG loss and a 14% reduction in collagen degradation (CTX-II) compared to explants transduced with the scrambled control sequence. The reduced sGAG loss was observed after 14 days of in vitro culture, with subsequent reductions in CTX-II levels at later time points. This pattern aligns with the expected temporal sequence of proteoglycan and collagen degradation reported in previous in vitro studies. E) Analysis of culture supernatants collected over the 28-day culture period revealed a general decrease in cytokine secretion from AAV-miR-21-transduced cartilage explants including significant reductions in interleukin (IL)-2, IL-6, and IL-10 levels, with a trend toward reduced IL-1β secretion. F) Expression of cartilage matrix gene ACAN (aggrecan) was upregulated with a similar trend for COL2A1 (type II collagen alpha 1 chain) in miR-21-transduced primary human cartilage explants compared to those transduced with the scrambled control sequence, indicating an anabolic effect of miR-21 on cartilage matrix synthesis. Figure 6. Differential Expression and Disease-Specific Targeting of miRNAs and piRNAs in OA and Non-OA Cartilage. A) SmRNA sequencing of cartilage identified a total of 463 small RNAs (smRNAs) present in at least 50% of the samples, including 339 miRNAs and 124 piRNAs. B) Predicted target genes of differentially expressed miRNAs (DE miRNAs), based on miRNA Enrichment Analysis and Annotation (MIEAA), included key QA-related genes such as MMP13, FOX03, FGFR3, TGFBJ, COX2, and TGFBR2. The expression of these target genes varied with disease status, with only 359 (14.9%) target genes shared between OA and non-OA cartilage. C) The FoxO pathway was implicated in both OA and non-OA cartilage, yet only 4 (10%) miRNAs were common between the two disease states (C). Similarly, the predicted target genes for piRNAs also showed disease-specific differences, with only 535 (12.7%) target genes common between OA and non-OA cartilage (D). Figure 7. Cytokine Secretion Profile in AAV-miR-21-Transduced Cartilage Explants. In contrast to the general decrease in cytokine secretion from human cartilage explants in response to AAV-miR-21-transduction (Figure 5), transduction of miR-21 (miR21) did not alter the secretion of human matrix metalloproteinase-1 (MMP-1), MMP-3, or MMP-9 in culture supernatants compared with miR-scrambled control (miSC). Figure 8. Regenerative miRNAs interact with HOX genes and nanoparticles can be delivered to knee. (A) Predicted interaction network shows that all 6 candidate miRNAs, those that are highly conserved across appendage regenerating organisms and humans, target HOX genes (Fig. 8A, part 1), known to be strongly involved in limb patterning and development (Fig.8A part 2). (B) CellChat analysis of early jaw ligament regeneration in zebrafish demonstrates enriched extracellular matrix, inflammatory, and cell adhesion signaling pathways across cell types. (C) Cationic SM-102 lipid nanoparticles (LNPs) penetrate the full thickness of 4 mm bovine knee cartilage explants at 2 hours post-treatment (left) with no adverse cytotoxic effects compared to canonical Lipofectamine RNAiMAX transfection reagent (right). DETAILED DESCRIPTION Human genetic and biochemical studies indicate that osteoarthritis (OA) arises when chondrocytes fail to maintain the balance between anabolic and catabolic activity, especially of collagen. While much research focuses on external strategies to promote cartilage regeneration this study investigates the intrinsic repair mechanisms of cartilage. As described herein, the inventors have identified specific small non-coding RNAs (smRNAs) correlated with cartilage regeneration in osteoarthritis across multiple species. These smRNAs enhanced expression of key cartilage formation genes, reduced cartilage degradation, and suppressed cytokine secretion from human cartilage and chondrocytes. Further, the inventors show region-specific regenerative capacity under osteoarthritic stress. Accordingly, the present disclosure provides compositions for cartilage regeneration and methods of using the same. Compositions: One aspect of the present invention provides a composition for cartilage regeneration. Generally, the composition comprises a polynucleotide selected from the group consisting of (a) at least one of SEQ ID NOs: 1-36, 66, 67, 68 or a homolog thereof having at least 90% identity thereto; (b) an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65, 69 or a homolog thereof having at least 90% identity thereto; or a combination of (a) and (b). These compositions may further include a pharmaceutically acceptable carrier. In some embodiments, the composition comprises one or more of miR- 146a-5p, miR-21-5p, mirR-31-5p, miR-93-5p, and / or an antisense oligonucleotide complementary to at least a portion of miR-204-5p or let-7c-5p. In some embodiments, the composition comprises one or more of SEQ ID NOs: 1, 11, 22, and 30 and an antisense oligonucleotide complementary to at least a portion of SEQ ID NO: 37 or 41. In some embodiments, the composition comprises miR-21-5p. In some embodiments, the composition comprises SEQ ID NO: 11. In some embodiments the homologs of the human smRNAs provided herein can be found in SEQ ID NOs: 70-422. Cartilage is the main type of connective tissue in the body. It serves a variety of structural and functional purposes and exists in different types throughout our joints, bones, lungs, ears, spine and nose. Cartilage is composed of cells called chondrocytes that produce a large amount of collagenous extracellular matrix, abundant ground substance that is rich in proteoglycan and elastin fibers. Cartilage is classified into three types — elastic cartilage, hyaline cartilage, and fibrocartilage — which differ in their relative amounts of collagen and proteoglycan. As used herein, “regeneration” is a biological process of renewal, restoration, growth or replacement of damaged or missing cells or tissues. Cartilage regeneration refers to the renewal, restoration, replacement, or generation of cartilage, the induction or enhancement of cartilage forming genes or proteins, reduction of cartilage degradation, or alteration of cartilage or chondrocyte cytokines. The term “polynucleotide” is used herein interchangeably with the term “nucleic acid” and “oligonucleotide” and refers to an organic polymer composed of two or more monomers including nucleotides, nucleosides or analogs thereof, including but not limited to single stranded or double stranded, sense or antisense deoxyribonucleic acid (DNA) of any length and, where appropriate, single stranded or double stranded, sense or antisense ribonucleic acid (RNA) of any length, including siRNA, mRNA or modified RNAs. The polynucleotides may include both cDNA or genomic DNA. Accordingly, the term polynucleotide includes nucleic acids of any length, including DNA, RNA, ORFs, analogs and fragments thereof. Polynucleotides homologous to the polynucleotides described herein are also provided. Those of skill in the art understand the degeneracy of the genetic code and that a variety of polynucleotides can encode the same polypeptide. A complementary antisense oligonucleotide refers to small pieces of single-stranded DNA or RNA that can bind through complementary base pairing to specific RNA molecules to modulate gene expression or function of an RNA molecule. Antisense oligonucleotides may degrade RNA, block translation, alter splicing of a target, block binding or function of an RNA / DNA molecule complement or perform other functions. In some embodiments, an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65, 69 or a homolog thereof is provided, such that the antisense oligonucleotide binds through complementary base pairing to a portion, fragment or all of at least one of SEQ ID NO: 37-65 or 69 or a homolog thereof and reduces its expression or function. As used herein a portion of a sequence is at least 8, 1012, 14, 15, 16, 17, 18, 19, 20 or more nucleotides in length and may be complementary to the full-length of the target molecule. The complementary polynucleotides described herein also need not be perfectly complementary. The complementary polynucleotides may have one, two, three or four mismatches across the complementary portion of the sequence. Those of skill in the art will appreciate that a shorter complementary oligonucleotide will need to have no or one mismatched nucleotide, whereas longer or more complete complementary oligonucleotides can tolerate more mismatches. Thus an 8, 10 or 12-mer oligonucleotide may have no mismatched or non-complementary nucleotides, but longer complementary oligonucleotides such as 20-mers may allow for non-complementary nucleotides. "Percentage of sequence identity" and "percentage homology" are used interchangeably herein to refer to comparisons among polynucleotides and polypeptides, and are determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence for optimal alignment of the two sequences. The percentage may be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Alternatively, the percentage may be calculated by determining the number of positions at which either the identical nucleic acid base or amino acid residue occurs in both sequences or a nucleic acid base or amino acid residue is aligned with a gap to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Those of skill in the art appreciate that there are many established algorithms available to align two sequences. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, (1981) Adv. Appl. Math.2:482, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman, (1988) Proc. Natl. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA), or by visual inspection (see generally, Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1995 Supplement)). Sequence conservation refers to the process where certain DNA, RNA or protein sequences remain relatively unchanged across different species or over long evolutionary periods. In some embodiments, the sequences provided herein are conserved across multiple species. In some embodiments the sequences have at least about 80% identity, at least about 82% identity, at least about 84% identity, at least about 86% identity, at least about 88% identity, at least about 90% identity, at least about 92% identity, at least about 94% identity, at least about 95%, at least about 96% identity, at least about 98% identity, at least about 99% identity, or at least about 100% identity among different species. Polynucleotides described herein have at least 85% identity across human, dog, horse, guinea pig, mouse, rat, hamster, miniature pig and zebrafish as demonstrated in the Sequence Listing. Those of skill in the art will appreciate that these sequences may have small variations within a species and thus even within the human population these sequences may share 95%, 97%, 98%, 99% or 100% identity with each other and all variations within a species are also included herein. For example, miR-21 (SEQ ID NO: 16) has 100% sequence identity with the miR-21 sequence from dogs, horse, guinea pig, mouse, rat, hamster, and mini pig, and 95% identity with zebrafish. Thus, while human sequences are exemplified herein, it is contemplated that species- specific polynucleotides could be used in other species. For example, an equivalent composition comprising dog specific polynucleotides could be used to regenerate cartilage in dogs. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 70-98, comprises an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 99-115, combinations thereof, or sequences with at least 90% identity thereto, in dogs. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 116-145, comprises an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 146-156, combinations thereof, or sequences with at least 90% identity thereto, in horses. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 157-187, comprises an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 188-202, combinations thereof, or sequences with at least 90% identity thereto, in guinea pigs. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 203-234, comprises an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 235-248, combinations thereof, or sequences with at least 90% identity thereto, in mice. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 249-279, comprises an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 280-296, combinations thereof, or sequences with at least 90% identity thereto, in rats. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 297-327, comprises an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 328-342, combinations thereof, or sequences with at least 90% identity thereto, in hamster. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 343-372, comprises an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 373-388, combinations thereof, or sequences with at least 90% identity thereto, in miniature pigs. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 389-414, comprises an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 415-422, combinations thereof, or sequences with at least 90% identity thereto, in zebrafish. In some embodiments, the composition comprises a pro-anabolic miRNA, including SEQ ID NO: 1-36, an antisense oligonucleotide complementary to at least a portion of a catabolic (anti-anabolic) miRNA including SEQ ID NO: 37-59, combinations thereof or sequences with at least 90% identity thereto. In some embodiments, the polynucleotide is an RNA. In some embodiments, the RNA is a small RNA or small non-coding RNA (sncRNA). Small non-coding RNAs (sncRNAs) are short RNA molecules (<200 nucleotides) that don't code for proteins but regulate various cellular processes, including gene expression. sncRNAs include microRNAs (miRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PIWI-interacting RNA (piRNA), rDNA-derived RNA (srRNA), Y RNA-derived small RNA (ysRNA), and tRNA- derived small RNA (tsRNA). As disclosed herein, the inventors identified 59 regenerative miRNAs and 10 regenerative piRNAs significantly (p<0.05) associated with cartilage ECM protein anabolic indicis and the overall regenerative index of OA cartilage from the lower limb joints. The piRNAs of the present disclosure comprise SEQ ID NO: 60-69 with SEQ ID NOs: 60- 65 and 69 being anti-anabolic and SEQ ID NO: 66, 67 and 68 being pro-anabolic. In some embodiments, the polynucleotide comprises at least one modified nucleotide. Modified nucleotides are standard nucleic acid building blocks (A, G, C, U) that have undergone chemical alteration, either naturally or synthetically. Nucleotide modification may alter immune evasion, polynucleotide stability, or expression. Modifications can occur on the sugar, phosphate backbone, or the nucleobase. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g. adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5- methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5- iodouridine, C5- propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadeno sine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)- methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2′-fluororibose, ribose, 2′- deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages). These modifications may be made to the RNAs to add stability or make the RNAs nuclease resistant. In some embodiments, a composition described herein comprises a polynucleotide selected from at least one of SEQ ID NO: 1-36, 66, 67, 68 or a sequence with at least 90% identity to SEQ ID NO: 1-36, 66, 67, or 68. In some embodiments, the composition may comprise an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65, 69 or a sequence with at least 90% identity to SEQ ID NO: 37-65 or 69. In some embodiments the composition comprises a combination of at least one of SEQ ID NOs: 1-36, 66, 67, or 68 and an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65 or 69. In some embodiments, the composition comprises a pharmaceutically acceptable carrier. As used herein, the term “carrier” refers to a pharmaceutically acceptable solid or liquid filler, diluent or encapsulating material. A water-containing liquid carrier can contain pharmaceutically acceptable additives such as acidifying agents, alkalizing agents, antimicrobial preservatives, antioxidants, buffering agents, chelating agents, complexing agents, solubilizing agents, humectants, solvents, suspending and / or viscosity-increasing agents, tonicity agents, wetting agents or other biocompatible materials. A tabulation of ingredients listed by the above categories, may be found in the U.S. Pharmacopeia National Formulary, 1857-1859, (1990). Some examples of the materials which can serve as pharmaceutically acceptable carriers are sugars, such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen free water; isotonic saline; Ringer's solution, ethyl alcohol and phosphate buffer solutions, as well as other nontoxic compatible substances used in pharmaceutical formulations. Wetting agents, emulsifiers and lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions, according to the desires of the formulator. Examples of pharmaceutically acceptable antioxidants include water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfite, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol and the like; and metal-chelating agents such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid and the like. In another embodiment, the present formulation may also comprise other suitable agents such as a stabilizing delivery vehicle, carrier, support or complex-forming species. The coordinate administration methods and combinatorial formulations of the instant invention may optionally incorporate effective carriers, processing agents, or delivery vehicles, to provide improved formulations for delivery of a composition described herein. The composition may additionally include a biologically acceptable buffer to maintain a pH close to neutral (7.0-7.3). Such buffers preferably used are typically phosphates, carboxylates, and bicarbonates. More preferred buffering agents are sodium phosphate, potassium phosphate, sodium citrate, calcium lactate, sodium succinate, sodium glutamate, sodium bicarbonate, and potassium bicarbonate. The buffer may comprise about 0.0001-5% (w / v) of the vaccine formulation, more preferably about 0.001-1% (w / v). Other excipients, if desired, may be included as part of the final composition. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservative. In some embodiments, the composition further comprises a nanocarrier. The nanocarrier may be part of delivery system. A delivery system facilitates the introduction of a composition to the tissue in need. For example, a delivery system may allow for the administration of a substance to a specific location within the body or specific cell type, may facilitate the administration at a specific rate, may facilitate the administration of more than one composition, or combinations thereof. A delivery system may comprise a controlled-release system, a targeted-release system, a stimuli-release system or combinations thereof. A delivery system may be administered by any means known in the art, for example local, systemic, topical, enteral, or parenteral. In some embodiments, the nanocarrier is bound to or encompasses the polynucleotide. In some embodiments, the nanocarrier is selected from a lipid-based nanocarrier, a polymeric nanocarrier or an inorganic nanocarrier. In some embodiments, the nanocarriers may comprise lipid-based nanocarriers such as liposomes, nanoparticles and nano-emulsions; polymeric nanocarriers or inorganic nanocarriers. In some embodiments the nanocarrier may comprise a cationic lipid nanoparticle, for example those disclosed in International Patent Publication No. WO2025043212, or Gonzales G, Hoque J, Gilpin A, Maity B, Zauscher S, Varghese S. Branched poly-l-lysine for cartilage penetrating carriers. Bioeng Transl Med. 2024;9(3):e10612. doi: 10.1002 / btm2.10612. eCollection 2024 May, which are incorporated by reference herein. In some embodiments, a composition described herein further comprises a cargo molecule. A cargo molecule may comprise any molecule which is to be transported or delivered with the composition. By way of example and not limitation a cargo molecule may comprise RNA, smRNA, mRNA, DNA, active pharmaceutical ingredients, adjuvants, proteins, therapeutic cargo, gene editing cargo such as Cas9, delivery of vaccines including mRNA and / or adjuvants. Cargo may be organ, tissue or cell type specific. In some embodiments, the cargo molecule comprises a polynucleotide, a polypeptide, an active pharmaceutical ingredient or therapeutic agent. A construct is also provided herein. The construct may include a heterologous promoter operably connected to a polynucleotide encoding (a) at least one of SEQ ID NOs: 1-36, 66, 67, 68 or a homolog thereof having at least 90% identity thereto; or (b) an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65, 69 or a homolog thereof having at least 90% identity thereto. The term "construct" or "polynucleotide construct" is a polynucleotide which allows the encoded sequence to be replicated and / or expressed in the target cell. A construct may contain an exogenous promoter, operably linked to any one of the polynucleotides described herein. As used herein, a polynucleotide is “operably connected” or “operably linked” when it is placed into a functional relationship with a second polynucleotide sequence. As used herein, the terms “heterologous promoter,” “promoter,” “promoter region,” or “promoter sequence” refer generally to transcriptional regulatory regions of a gene, which may be found at the 5’ or 3’ side of a polynucleotides described herein, or within the coding region of said polynucleotides. Typically, a promoter is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3’ direction) coding sequence. The typical 5’ promoter sequence is bounded at its 3’ terminus by the transcription initiation site and extends upstream (5’ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence is a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. In some embodiments, the construct is an expression construct, a vector or a viral vector. A vector is any particle used as a vehicle to artificially carry a foreign nucleic sequence, typically DNA into another cell, where it can be replicated and / or expressed. A vector containing foreign DNA is termed recombinant DNA. The four major types of vectors are plasmids, viral vectors, cosmids, and artificial chromosomes. Expression constructs comprise a heterologous promoter and the nucleic acid sequence encoding protein or nucleotide (RNA) of interest (e.g., and one, or combination of SEQ ID NO: 1-69 or a homolog thereof having at least 90% identity thereto, such as those provided in SEQ ID NO: 70-422) which is capable of expression in the cell in which it is introduced. The expression constructs include vectors which are capable of directing the expression of exogenous genes to which they are operatively linked. Such vectors are referred to herein as "recombinant constructs," "expression constructs," "recombinant expression vectors" (or simply, "expression vectors" or "vectors") and may be used interchangeably. Suitable vectors are known in the art and contain the necessary elements in order for the gene encoded within the vector to be expressed as a protein in the host cell. The term "vector'' refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA or RNA segments may be ligated into the viral genome. Viral vectors are incorporated into viral particles that are then used to transport the viral polynucleotide encoding the protein of interest into the target cells. Certain vectors are capable of autonomous replication in a host cell into which they are introduced. Other vectors can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome (e.g., lentiviral vectors). Moreover, certain vectors are capable of directing the expression of exogenous genes to which they are operatively linked. In general, vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification "vector" includes expression vectors, such as viral vectors (e.g., replication defective retroviruses (including lentiviruses), adenoviruses and adeno-associated viruses (AAV)), which serve equivalent functions. The vectors are heterogeneous exogenous constructs containing sequences from two or more different sources. Suitable vectors include, but are not limited to, plasmids, expression vectors, lentiviruses (lentiviral vectors), adeno-associated viral vectors (rAAV), and retroviral vectors, among others and includes constructs that are able to express the protein of interest. Suitable methods of making and using vectors are known in the art. Methods: Another aspect of the present invention provides a method of regenerating cartilage in a subject in need thereof. Generally, the method comprises administering a composition or the construct described herein to the subject to allow regeneration of cartilage in the subject. As used herein, the term "administering" is intended to refer to contacting or dispensing, delivering or applying the therapeutic agent to a subject by any suitable route for delivery of the composition to the desired location in the subject, including delivery by either the parenteral or oral route, intramuscular injection, subcutaneous / intradermal injection, intravenous injection, intrathecal administration, buccal administration, intercranial administration, intracerebral administration, transdermal delivery, topical administration, and administration by the intranasal or respiratory tract route. For topical administration, the compound(s) may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art. Systemic formulations include those designed for administration by injection, e.g., subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal oral or pulmonary administration. Useful injectable preparations include sterile suspensions, solutions or emulsions of the active compound(s) in aqueous or oily vehicles. The compositions may also contain formulating agents, such as suspending, stabilizing and / or dispersing agent. The formulations for injection may be presented in unit dosage form, e.g., in ampules or in multidose containers, and may contain added preservatives. Alternatively, the injectable formulation may be provided in powder form for reconstitution with a suitable vehicle, including but not limited to sterile pyrogen free water, buffer, dextrose solution, etc., before use. To this end, the active compound(s) may be dried by any art-known technique, such as lyophilization, and reconstituted prior to use. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are known in the art. For oral administration, the pharmaceutical compositions may take the form of, for example, lozenges, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate). The tablets may be coated by methods well known in the art with, for example, sugars, films or enteric coatings. Liquid preparations for oral administration may take the form of, for example, elixirs, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, cremophore™ or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p- hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, preservatives, flavoring, coloring and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated to give controlled release of the compound, as is well known. For buccal administration, the compositions may take the form of tablets or lozenges formulated in a conventional manner. For rectal and vaginal routes of administration, the compound(s) may be formulated as solutions (for retention enemas) suppositories or ointments containing conventional suppository bases such as cocoa butter or other glycerides. For nasal administration or administration by inhalation or insufflation, the compound(s) can be conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, fluorocarbons, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges for use in an inhaler or insufflator (for example capsules and cartridges comprised of gelatin) may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch. For ocular administration, the compound(s) may be formulated as a solution, emulsion, suspension, etc. suitable for administration to the eye. A variety of vehicles suitable for administering compounds to the eye are known in the art. For prolonged delivery, the compound(s) can be formulated as a depot preparation for administration by implantation or intramuscular injection. The compound(s) may be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, e.g., as a sparingly soluble salt. Alternatively, transdermal delivery systems manufactured as an adhesive disc or patch which slowly releases the compound(s) for percutaneous absorption may be used. To this end, permeation enhancers may be used to facilitate transdermal penetration of the compound(s). In preferred embodiments, the composition is administered via injection into the affected tissue. The affected tissue may be a synovial joint. Synovial joints include elbow, knee, ankle, shoulder, hip, neck, wrist, finger, toe, temporomandibular, facet and spine joints. In some embodiments the synovial joint is a knee, ankle, hip, shoulder, elbow, wrist, finger, temporomandibular or facet joint. When used to treat or prevent a disease, such as osteoarthritis, or to promote and / or enhance cartilage regeneration and / or repair in a subject suffering osteoarthritis, the compounds described herein may be administered singly, as mixtures of one or more compounds or in mixture or combination with other agents (e.g., therapeutic agents) useful for treating such diseases and / or the symptoms associated with such diseases. Such agents may include, but are not limited to, anti-inflammatory medications and anti-pain medications to name a few. The compounds may be administered in the form of compounds per se, or as pharmaceutical compositions comprising a compound. As used herein, “subject” or "patient" refers to both mammals and non-mammals. The term “subject” does not denote a particular age or sex. The term “subject” may be used interchangeably with the terms “individual” and “patient”. A subject or “subject in need may” refer to a subject in need of treatment for a disease or disorder associated with cartilage regeneration. In one embodiment, the subject or subject in need is a human. In one embodiment, the subject, or subject in need is a dog, horse, guinea pig, mouse, rat, hamster, and mini pig or zebrafish. In some embodiments, the subject in need is diagnosed with or suspected of having arthritis, cartilage tears, cartilage damage or is undergoing a surgery in or near a synovial joint. Compositions described herein may be administered at least one time. In some embodiments, the subject in need is diagnosed with or suspected of having osteoarthritis or rheumatoid arthritis. Wherein the subject is diagnosed with or suspected of having arthritis the composition may be administered at least twice, or is formulated for sustained delivery. Sustained delivery involves releasing a composition at a controlled rate over an extended period of time. Another aspect of the present disclosure provides a method treating osteoarthritis in a subject in need thereof, the method comprising administering a composition or construct described herein to the subject to treat osteoarthritis. In some embodiments, osteoarthritis is in a synovial joint. In some embodiments, the osteoarthritis is osteoarthritis of the hip, knee, ankle, shoulder, elbow, wrist, finger, temporomandibular or facet joint. In some embodiments, the composition is administered at least once. In some embodiments, the composition is administered two, three, four, five, six, seven, eight, nine, ten, twenty or more times. In some embodiments, the composition is administered as many times or as long as needed to treat osteoarthritis in the subject. The composition may be administered multiple times over a long period of time at regular intervals, such as weekly, bimonthly, monthly, quarterly or annually. In some embodiments, the composition is administered directly into the arthritic joint. As used herein, the terms “treating” or “to treat” each mean to alleviate symptoms, eliminate the causation of resultant symptoms either on a temporary or permanent basis, and / or to prevent or slow the appearance or to reverse the progression or severity of resultant symptoms of arthritis, including osteoarthritis. As used herein the term “effective amount” refers to the amount or dose of the composition that provides the desired effect regardless of whether improvement is realized. In some embodiments, the effective amount is the amount or dose of the composition, upon single or multiple dose administration to the subject, which provides the desired effect in the subject under diagnosis or treatment. Suitably the desired effect may be to treat or reduce the symptoms of arthritis, including osteoarthritis. In some embodiments, the small RNAs described herein may treat arthritis by increasing or decreasing the expression of arthritis-related genes or proteins they interact with. Affected genes may include, but are not limited to MMP13, FOXO3, FGFR3, TGFB1, COX2, TGFBR2, BMP2, FGF13, JUN, MAPK13, SMAD2, TLR3, SMURF2, BMPR1B, NFKBIA, CCL2, JUN, including PRKACA, MAPKAPK5, ACTB, NFKBIA, TLR4, LRP6, PSMF1, MON1B, STX6, TGOLN2, and VPS41. The amount of compound(s) administered will depend upon a variety of factors, including, for example, the particular indication being treated, the mode of administration, whether the desired benefit is prophylactic or therapeutic, the severity of the indication being treated and the age and weight of the patient, the bioavailability of the particular compound(s) the conversion rate and efficiency of the active drug compound under the selected route of administration, etc. Determination of an effective dosage of compound(s) for a particular use and mode of administration is well within the capabilities of those skilled in the art. Effective dosages may be estimated initially from in vitro activity and metabolism assays. For example, an initial dosage of compound for use in animals may be formulated to achieve a circulating blood or serum concentration of the metabolite active compound that is at or above an IC50 of the particular compound as measured in an in vitro assay. Calculating dosages to achieve such circulating blood or serum concentrations taking into account the bioavailability of the particular compound via the desired route of administration is well within the capabilities of skilled artisans. Initial dosages of compound can also be estimated from in vivo data, such as animal models. Animal models useful for testing the efficacy of the active metabolites to treat or prevent the various diseases described above are well-known in the art. Animal models suitable for testing the bioavailability and / or metabolism of compounds into active metabolites are also well-known. Ordinarily skilled artisans can routinely adapt such information to determine dosages of particular compounds suitable for human administration. Dosage amounts will typically be in the range of from about 0.0001 mg / kg / day, 0.001 mg / kg / day or 0.01 mg / kg / day to about 100 mg / kg / day, but may be higher or lower, depending upon, among other factors, the activity of the active compound, the bioavailability of the compound, its metabolism kinetics and other pharmacokinetic properties, the mode of administration and various other factors, discussed above. In some embodiments, the dosage may be in the range of about 0.1µM to about 50nM, about 0.1µM to about 20nM, about 0.1µM to about 10nM or any value in between. Dosage amount and interval may be adjusted individually to provide plasma levels of the compound(s) and / or active metabolite compound(s) which are sufficient to maintain therapeutic or prophylactic effect. For example, the compounds may be administered once per week, several times per week (e.g., every other day), once per day or multiple times per day, depending upon, among other things, the mode of administration, the specific indication being treated and the judgment of the prescribing physician. In cases of local administration or selective uptake, such as local topical administration, the effective local concentration of compound(s) and / or active metabolite compound(s) may not be related to plasma concentration. Skilled artisans will be able to optimize effective dosages without undue experimentation. The term “disease” as used herein includes, but is not limited to, any abnormal condition and / or disorder of a structure or a function that affects a part of an organism. It may be caused by an external factor, such as an infection, or by internal dysfunctions, such as cancer, cancer metastasis, and the like. In some embodiments, the disease comprises osteoarthritis. As used herein, the term “osteoarthritis” refers to those degenerative joint diseases in which the tissues (e.g., cartilage) in the joint break down over time. In some embodiments, the method of treating osteoarthritis in a subject in need thereof further comprises obtaining a biological sample from the subject and measuring the expression of at least one biomarker prior to administering the composition. In some embodiments, the level of at least one biomarker in the sample is compared to a reference level of the biomarker and the composition is administered if the biomarker is increased as compared to the reference. The term “biological sample” as used herein includes, but is not limited to, a sample containing tissues, cells, and / or biological fluids isolated from a subject. Examples of biological samples include, but are not limited to, tissues, cells, synovial fluid, synovial tissue, bone, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus and tears. In some embodiments, the biological sample comprises synovial fluid, chondrocytes, synoviocytes, blood, serum or plasma. As used herein, a biomarker may be used to identify subjects that can benefit from the treatments disclosed herein. A biomarker is a measurable indicator of some biological state or condition, such as arthritis. As used herein, a biomarker may be an indicator of arthritis including osteoarthritis. In the present disclosure, a biomarker may be used to identify subjects that may benefit from the compositions and treatment disclosed herein, or may identify subjects to be diagnosed with arthritis, or may provide a prognosis of arthritis in a subject. Biomarkers may include those disclosed in U.S. Patent No. 11,560,594 and WO2025 / 081155, which are incorporated herein by reference in their entirety. By way of example, and not limitation, a biomarker may be selected from the group consisting of CRAC1 (CRTAC1), CXCL7, CO8G, A2AP, A1BG, A2GL, AACT, ACTG, AMBP, APOB, APOE, B2MG, C1QC, C1R, C1RL, C4BPA, C4BPB, CD14, CD44, CERU, CFAB, CFAH, CFAI, CILP1, C1S, CNDP1, CO2, CO4B, CO5, CO6A3, CO8B, CO9, coll3, COMP, CTX1a, CTX1b, CTX2, CTXi, ECM1, FA12, FA5, FBLN1, FBLN3, FCGBP, FCN3, FETUA, FINC, GELS, HA, HABP2, haptoglobin, HEMO, HEP2, HGFA, HRG, hyaluronan, IC1, ITIH1, ITIH4, KNG1, LAMA2, LUM, LYAM1, MASP1, PCOC1, PGCA, PHLD, PLF4, PLMN, PRG4, RET4, SAMP, SHBG, TENX, TETN, THBG, TIMP1, TSP1, TSP4, VTDB, VTNC, ZA2G, ZPI, and any combination thereof. By way of example, and not limitation, a biomarker may be selected from the group consisting of CSPG4, BGN, NRP1, CD109, VISG4, MARCO, CD163, LRP1, PTPRS, ANXA2, ANXA5, HSP90AB1, IL-11, IL-11RA, GP130, FN1, CD29, ITGA5, ICAM1, IL- 21, FGA, FGB, FGG, TLN1, AMBP and any combination thereof. Also disclosed herein are biomarkers which correlate with regenerative environment for cartilage repair and can be used to identify therapeutic targets for promoting and / or enhancing regeneration and / or repair. In some embodiments, the biomarker comprises a small RNA. Fragments and genetic variants of biomarkers and compounds provided herein are also encompassed by the present disclosure. “Fragment” is intended to include a portion of the amino acid sequence and hence a portion of the protein encoded thereby. A fragment or a biomarker peptide will generally encode at least 7, 8, 9, 10, 12, 15, 17, 20, 22, 25, 30 or more contiguous amino acids, or up to the total number of amino acids present in a full-length biomarker. “Variant” is intended to mean substantially similar sequences. Generally, variants of a particular biomarker of the invention will have at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more amino acid identity to that biomarker as determined by amino acid alignment programs. In some embodiments, the method further comprises isolating extracellular vesicles from the biological sample, including synovial fluid, blood, serum or plasma prior to measuring the expression of at least one biomarker. Extracellular vesicles are lipid bilayer- delimited particles that are naturally released from almost all types of cells but cannot replicate. Extracellular vesicles include small (such as exosome), medium-sized (such as microvesicles), and large (such as apoptotic bodies) extracellular vesicles. Methods of isolating and measuring biomarkers from an extracellular vesicle are known to those of ordinary skill in the art. In some embodiments, the method of treating osteoarthritis in a subject in need thereof further comprises administering one or more second therapeutic agents to the subject with increased expression of any one of the biomarkers. The second therapeutic agent may be any therapeutic that is known to treat osteoarthritis. In some embodiments, the second therapeutic agent comprises an analgesic, a non-steroidal anti-inflammatory drug, steroid injection, surgery or combinations thereof. In some embodiments, the methods of the present disclosure may further include administering an anti-inflammatory or anti-pain therapeutic to the subject if the subject is diagnosed with osteoarthritis or predicted to have non-progressive or progressive disease. Suitable anti-inflammatory therapeutics are known to those skilled in the art and may include, without limitation, nonsteroidal anti-inflammatory drugs (NSAIDs), disease-modifying osteoarthritis drugs (DMOADs), disease-modifying antirheumatic drugs (DMARDs), corticosteroids, and hyaluronans. Several classes of DMARDs may be used in accordance with the present invention including, but not limited to, traditional DMARDs such as methotrexate, hydroxycholorquine, sulfasalazine, leflunomide, cyclophosphamide and azathioprine; biologics such as anti-IL-1 therapeutics, anti-TNF therapeutics, metalloproteinase inhibitors, p38 inhibitors, abatacept, adalimumab, anakinra, certolizumab pegol, etanercept, infliximab, golimumab and rituximab; and JAK inhibitors such as Tofacitinib. Suitable anti-pain therapeutics include, without limitation, non-opioid analgesics (e.g., acetaminophen), nonsteroidal anti-inflammatory drugs (NSAIDs), opioid analgesics, and co-analgesics and most likely in future, nerve growth factor inhibitors. Subjects having stable or non-progressive disease may be treated with topical or ingestible pain or anti- inflammatory medications. Subjects identified as having progressive destructive or aggressive disease likely to lead to joint destruction may be referred for injectable lubricant or biologic agent procedures, stronger pain medications such as opioids, bone-acting agents such as calcitonin, bisphosphonates and hormonal therapies, physical therapy, arthroscopic surgery, osteotomy, fibulectomy or joint replacement surgery. Additional definitions The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and / or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. Ordinal indicators, such as first, second, and third, as used in the description and the claims to refer to various structures or method steps, are not meant to be construed to indicate any specific structures or steps, or any particular order or configuration to such structures or steps. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless otherwise claimed. No language in the specification, and no structures shown in the drawings, should be construed as indicating that any non-claimed element is essential to the practice of the disclosed subject matter. Unless otherwise specified or indicated by context, the terms “a”, “an”, and “the” mean “one or more.” For example, “a molecule” should be interpreted to mean “one or more molecules.” As used herein, “about”, “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” and “approximately” will mean plus or minus ≤10% of the particular term and “substantially” and “significantly” will mean plus or minus >10% of the particular term. As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” The terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms “consist” and “consisting of” should be interpreted as being “closed” transitional terms that do not permit the inclusion additional components other than the components recited in the claims. The term “consisting essentially of” should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word “about” to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount are included in that amount, such as values that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in forming measurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise. In those instances where a convention analogous to “at least one of A, B and C, etc.” is used, in general such a construction is intended in the sense of one having ordinary skill in the art would understand the convention (e.g., “a system having at least one of A, B and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description or figures, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or ‘B or “A and B.” No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference, unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or description found in the cited references. Preferred aspects of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred aspects may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect a person having ordinary skill in the art to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context. The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims. EXAMPLES Reference is made to the manuscript: Hsueh et al., "Anabolic indices of matrix proteins identify regenerative small RNA intrinsic to human cartilage," Sci. Adv.11, eadu8440 (2025). DOI:10.1126 / sciadv.adu8440, the content of which is incorporated herein by reference in its entirety Example 1: Anabolic Indices of Matrix Proteins Identify Regenerative Small RNA Intrinsic to Human Cartilage Some vertebrates regenerate appendages through the action of small non-coding RNAs (smRNAs) expressed in their blastema. Inspired by these models, we investigated whether similar smRNA- mediated mechanisms might contribute to the intrinsic repair capacity of human cartilage. Although humans lack the capacity to regenerate entire limbs, digit tip regrowth and joint cartilage repair following joint distraction suggest latent regenerative potential. Using mass spectrometry and RNA sequencing, we quantified anabolic indices of cartilage extracellular matrix proteins and identified 69 smRNAs correlated with cartilage regeneration in osteoarthritis–six concordantly regulated across species (human, axolotl, zebrafish, bichir)–including miR-21. MiR-21 enhanced expression of key cartilage formation genes, reduced cartilage degradation, and suppressed cytokine secretion from human cartilage and chondrocytes. In contrast to knee and hip, ankle cartilage exhibited regenerative capacity under osteoarthritic stress, offering a model for a regeneration-permissive joint environment that could inform osteoarthritis therapies. Some animals, such as the axolotl, zebrafish, bichir, and lizard, have remarkable regenerative abilities, capable of regrowing appendages like limbs or tails. This process is orchestrated by small non-coding RNAs (smRNAs) expressed by the blastema, a cluster of undifferentiated cells responsible for regeneration (1-4). Although humans cannot regrow entire limbs, young individuals can regenerate digit tips (5), and distal limb regeneration has been observed in young mice (6). Cartilage regeneration in adults, particularly in the knee and ankle, has been seen in some patients undergoing joint distraction procedures (7-9). This suggests that mammals, including humans, have a limited intrinsic capacity for tissue regeneration that diminishes with age. Human genetic (10) and biochemical (11, 12) studies indicate that osteoarthritis (OA) arises when chondrocytes fail to maintain the balance between anabolic and catabolic activity, especially of collagen (13). OA, the most prevalent form of arthritis, affects over 500 million people worldwide (14). While much research focuses on external strategies to promote cartilage regeneration (15, 16), this study investigates the intrinsic repair mechanisms of cartilage. We hypothesize that a set of smRNAs in human cartilage coordinates a regenerative response to stress similar to that seen in blastema-driven limb regeneration. We assessed cartilage anabolism by measuring ‘anabolic indices’ using mass spectrometry to track deamidation levels of five extracellular matrix (ECM) proteins. Deamidation, the hydrolysis of amide groups in Asn or Gln residues (17), serves as a molecular clock for assessing tissue anabolism. Because cartilage ECM lacks known enzymatic systems to revert deamidated amino acids to their native forms (18), this method measures cartilage protein anabolism, facilitating the identification of smRNA implicated in disease pathogenesis or compensatory responses to stress. We previously identified three micro (mi)RNAs (miR-21, miR-31, and miR-181c) involved in regeneration across multiple species (2) and confirmed their association with cartilage anabolism in human OA tissue (19). Given the need for disease-modifying OA treatments, we expanded this work to analyze smRNA in human cartilage using RNA sequencing (Fig. 1). By correlating smRNA expression with the anabolic indices of five key ECM proteins, we uncovered a coordinated regulatory network of smRNAs, including both miRNAs and piwi-interacting (pi) RNAs, linked to a regenerative cartilage phenotype, particularly in ankle OA cartilage. Results Multiple cartilage regenerative smRNAs identified by correlation with cartilage extracellular matrix protein anabolic indices For the current study, we focused on differences between OA and non-OA joints by analyzing full-thickness cartilage of ankle, knee and hip joints. Through RNA sequencing of cartilage, we identified 463 smRNAs in at least 50% of the samples, comprising 339 miRNAs and 124 piRNAs (Fig.6A). To identify regenerative smRNAs, we assessed their correlation with the anabolic indices of five cartilage extracellular matrix (ECM) proteins aggrecan (ACAN), cartilage oligomeric matrix protein (COMP), prolargin (PRELP), and collagen types II and III (COL2A1 and COL3A1), determined through mass spectrometry. Additionally, we created an overall regenerative index based on the sum of these protein anabolic indices. We identified 69 regenerative smRNAs significantly (p<0.05) associated with the cartilage ECM protein anabolic indices and the overall regenerative index of OA cartilage from the lower limb joints. Fig. 2A (OA-related ‘ankle cartilage enrichment’) illustrates the relative enrichment of the 39 pro-anabolic smRNA and relative depletion of the 30 anti-anabolic smRNA in OA ankle vs OA knee and OA hip cartilage, highlighting a regenerative gradient regulated by a select set of smRNA across the OA lower extremity joints. Among these smRNAs, 59 were miRNAs; six of these (miR-146a-5p, miR-21-5p, miR-31-5p, miR-93-5p, miR204-5p, and let7c-5p) exhibited expression patterns in human ankle cartilage that were congruent with appendage regeneration in axolotl, bichir and zebrafish (2) with miR-146a-5p, miR-21-5p, miR-31-5p, and miR-93-5p upregulated, and miR204-5p, and let7c-5p downregulated. Furthermore, the associations of smRNA with anabolic and regenerative protein indices were only observed in lower extremity joints with OA, whereas non-OA cartilages exhibited a random, disordered pattern (Fig. 2A). Pro-anabolic smRNAs exhibited strong positive correlations with each other and strong negative correlations with anti- anabolic smRNAs, but only in OA cartilage (Fig.2B). Together, these findings suggest an intrinsic countermeasure to cartilage stress orchestrated by smRNAs, partially recapitulating the limb regeneration responses observed in organisms capable of appendage regeneration. Our results demonstrate a coordinated, pro-regenerative response of smRNAs in OA-affected ankle but not OA hip cartilage, with OA knee cartilage showing an intermediate anabolic phenotype. Transcriptomics of human ankle compared to hip cartilage To further explore the distal-proximal gradient of cartilage smRNA expression, we compared the smRNA expression profiles in ankle and hip cartilages, controlling for age, gender and BMI. In OA cartilage, 102 differentially expressed (DE) smRNAs (p<0.05) were identified (Fig. 3A). Predicted target genes of DE miRNAs, based on miRNA Enrichment Analysis and Annotation (MIEAA), included key OA-related genes MMP13, FOXO3, FGFR3, TGFB1, COX2, and TGFBR2 (Fig.6B, also see table S1 Hsueh et al). The expression of these target genes was strongly influenced by disease status, with only 359 (14.9%) identical between OA and non-OA cartilage (Fig.6B). Additional KEGG pathways associated with OA, based on MIEAA predictions with DE miRNAs, included the FoxO, MAPK, PI3K-Akt, and TGF-beta pathways (see table S2 Hsueh et al). Although most pathways were common between OA and non-OA cartilages, the specific miRNAs involved differed (see table S2 Hsueh et al). For example, the FoxO pathway was identified in both OA and non-OA cartilage, but only four (10%) miRNAs were identical between the disease and non-disease state (Fig.6C). DE piRNAs also identified OA-related target genes and KEGG pathways, including BMP2, FGF13, JUN, MAPK13, SMAD2, and TLR3 (see table S3 Hsueh et al), as well as pathways such as glycolysis and gluconeogenesis, p53 signaling, NOD-like receptor, and T cell receptor pathways (see table S4 Hsueh et al). Similar to miRNAs, the target genes associated with piRNAs were affected by disease status, with only 535 (12.7%) target genes common between OA and non-OA cartilage (Fig.6D). Compared to non-OA cartilage, piRNA-related pathways in OA cartilage were unique. Additionally, comparing table S1 (Hsueh et al) (for miRNAs) and table S3 (for piRNAs, Hsueh et al), only 222 (6.4%) target genes were common between miRNAs and piRNAs. These findings indicate that while smRNAs expressed in lower limb joints are similar, their expression patterns and associated pathways differ by joint type and disease state. Comparing messenger (m)RNA sequencing results of human OA ankle and hip cartilage, we identified 7,360 DE genes (Log2FC ≥ 1, FDR ≤ 0.001). Genes encoding ECM-associated proteins, such as ECM glycoproteins, collagens, and proteoglycans, were highly abundant and significantly enriched in ankle cartilage (Fig. 3B & C). Gene set enrichment analysis (GSEA) revealed that gene sets encoding collagen proteins, structural components of basement membranes, and ECM glycoproteins were significantly upregulated in ankle cartilage (Fig.3D). These results underscore the upregulation of ECM-encoding genes in ankle cartilage under OA stress, and highlight key pathways involved in this modulation. We found striking similarities in mRNA expression patterns between human OA cartilage and axolotl regenerative tissues (data from Monaghan et al. (20)). Up-regulated limb regeneration genes in the axolotl that were similarly upregulated in ankle OA compared to hip OA cartilage (mean ± standard deviation of log2-fold change in human cartilage, range of FDR p-value, see table S5 (Hsueh et al) for fuller list of genes with concordant expression) included: ZFP36L2 (8.5±3.0, 3.32E-67 - 2.76E-12), GLUL (5.0±0.4, 4.81E-94 - 1.49E-38) and IGFBP2 (9.5±0.6, 1.35E-05 – 5.79E-02) associated with limb defects in humans or mice when mutated; PRICKLE2 (5.4±4.9, 3.92E-49 – 2.82E-01), FGFR1 (4.2±3.0, 5.24E-55 – 2.57E-05), and DUSP6 (3.2±1.4, 2.54E-14 – 1.31E-01) that are key regulators of signaling pathways known to be necessary for axolotl limb development and limb regeneration; MCM3 (8.3±4.4, 4.16E-51 – 1.E+0) involved in genome replication; CCNA2 (6.91, 3.74E-02 – 1.98E-01) involved in cell cycle and mitosis; and SORBS3 (11.54, 2.55E-31 – 1.62 E-19) involved in cell proliferation and differentiation. Interaction of smRNA with gene networks in human ankle compared to hip cartilage To elucidate the gene networks associated with regenerative smRNAs, we analyzed the interactions between the 69 regenerative smRNAs and gene networks in human ankle and hip cartilage. Our analysis revealed 309 genes related to pro-anabolic smRNAs and 312 genes related to anti-anabolic smRNAs (see table S6 Hsueh et al). Of these, 147 genes (31%) were common to both groups, while 162 and 168 genes were unique to pro-anabolic and anti-anabolic smRNAs, respectively. Among the 39 pro-anabolic smRNAs, 37 were miRNAs and 2 were piRNAs. Half of the piRNA-related genes (n=22) were also associated with miRNAs, while 286 genes were exclusively related to miRNAs (see table S7 Hsueh et al). The 30 anti-anabolic smRNAs consisted of 17 miRNAs and 13 piRNAs. Among the genes associated with these two groups, 113 genes (36.2%) were uniquely related to anti-anabolic miRNAs and 99 genes (31.7%) were uniquely related to piRNAs. Analysis of the 309 pro-anabolic smRNA-related genes identified several gene clusters and associated pathways. The main cluster of 118 genes included SMURF2, BMPR1B, NFKBIA, CCL2, and JUN (see table S8 Hsueh et al), with enrichment in TGF-beta and IL-17 signaling pathways (see table S9 Hsueh et al). In contrast, the 312 anti-anabolic smRNA-related genes formed a main cluster of 62 genes, including PRKACA, MAPKAPK5, ACTB, NFKBIA, TLR4, LRP6, and PSMF1 (see table S8 Hsueh et al). This cluster was enriched in distinct pathways compared to the pro-anabolic genes, including PI3K-Akt, NF-kappa B, Wnt, and MAPK signaling pathways (see table S9 Hsueh et al). A unique feature of the pro-anabolic gene network was the membrane trafficking pathway, involving MON1B, STX6, TGOLN2, and VPS41. Both pro- and anti-anabolic networks shared gene clusters enriched in carbon metabolism, the citrate cycle, and mRNA splicing pathways. The pro-anabolic gene network was primarily driven by pro-anabolic miRNAs, with piRNAs showing limited pathway enrichment, mainly in the regulation of pathway- restricted SMAD protein phosphorylation and BMP signaling. The anti-anabolic smRNA gene network mirrored the main clusters identified in the anti-anabolic miRNA network, including enrichment in Wnt, NF-kappa B, and MAPK signaling pathways. Uniquely, the anti-anabolic miRNA network also revealed a gene cluster enriched in ECM-related pathways. These findings underscore the distinct pathways associated with pro- and anti-anabolic smRNA gene networks in cartilage regenerative responses under OA stress. Pro-anabolic miR-21 upregulated ECM genes in vitro in two model systems To assess the function of the pro-anabolic smRNA, miR-21, we employed two in vitro model systems, the C28 / I2 human chondrocyte cell line, and primary human cartilage explants, consisting of primary chondrocytes within their native extracellular matrix. The rationale for focusing on miR-21 is supported by multiple lines of evidence: (1) our previous study (19) highlighting its relevance; (2) results in Fig. 2 showing miR-21 upregulation in regenerating human cartilage and during limb regeneration of three species (axolotl, zebrafish, bichir), suggesting a conserved role in tissue repair; and (3) its strong positive correlation with the anabolic index of all five ECM proteins examined (ACAN G1, COMP, PRELP, COL3A1, and COL2A1), as well as with the overall Regenerative Index. This study demonstrated that miR-21 is intrinsic to human articular cartilage, highly abundant, pro-anabolic, and upregulated in vivo in ankle OA cartilage. C18 / I2 and cartilage explants were transduced with lentiviral and adeno-associated viral constructs (miR-21 or scrambled control), respectively. In C28 / I2 cells, miR-21 expression did not affect cell viability (Fig.4A). To replicate an OA-like condition in vitro, we used a combination of hyaluronic acid (HA) fragments and lipopolysaccharide (LPS), a physiologically relevant system that we previously established could synergistically activate an OA-like state (21). In C28 / I2 cells, OA-like stress increased chondrocyte expression of miR21 as expected, and ACAN expression (Fig.4B-C comparing the scrambled control without and with OA stress). enhanced ACAN expression under non-OA stress conditions (Fig. 4C comparing scrambled control vs miR-21 without OA stress). Under OA stress conditions, C28 / I2 cells transduced with miR-21 increased the expression of ACAN, COL2A1 and MMP13, a gene encoding a key proteolytic enzyme (MMP-13) (Fig. 4C&E comparing the scrambled control to miR-21 transduction under OA stress conditions). AAV-mediated transduction of human cartilage was highly efficient. Starting at 14 days post-transduction and continuing through 28 days (the last time point analyzed), green fluorescent protein (GFP) reporter expression was observed in nearly 100% of chondrocytes across the entire cartilage depth, from superficial to deep layers (Fig.5A & B). As expected, GFP gene expression was absent in Day 0 control cartilage explants but was significantly upregulated in AAV- transduced cartilage explants at 14 and 28 days post-transduction (Fig. 5C). Based on sulfated glycosaminoglycan (sGAG) and C-telopeptide fragments of type II collagen (CTX-II) loss from cartilage, reflecting aggrecan and type II collagen catabolism, respectively, we observed anti- catabolic effects of miR-21. MiR-21 reduced sGAG loss throughout the 28 days of explant culture, with reductions in CTX-II loss starting at 14 days of explant culture. Overall, miR-21 reduced proteoglycan loss by an average 37% and collagen degradation by an average of 14% compared to control conditions (Fig. 5D). MiR-21 also decreased the secretion of several cytokines, including interleukin (IL)-2, IL-6, and IL-10 (Fig.5E), while upregulating the expression of key cartilage ECM genes, ACAN (p-0.007) and COL2A1 (p=0.054), though only ACAN reached statistical significance (Fig.5F). Notably, miR-21 did not significantly alter the secretion of human matrix metalloproteinases, MMP-1, MMP-3, or MMP-9, in culture supernatants (Fig.7). Discussion Across all lower extremity joints, smRNA expression levels were strongly correlated with protein anabolism, suggesting a shared regulatory mechanism. Specifically, the expression of 69 key cartilage smRNAs were strongly correlated with anabolic indices of five major ECM cartilage proteins, reinforcing a conserved regulatory framework for cartilage anabolism, regardless of OA etiology. Among these joints, OA ankle cartilage exhibited the most pronounced pro-regenerative profile, with the greatest upregulation of 39 pro-anabolic smRNAs and the greatest downregulation of 30 anti-anabolic smRNAs. This dual mechanism mirrors limb regeneration in species such as axolotls and zebrafish (2). Notably, six miRNAs identified in human cartilage were concordantly regulated across all three regenerating species—four pro-anabolic upregulated and two anti- anabolic downregulated—indicating a potentially conserved mechanism across species. While piRNAs have not yet been studied in limb-regenerating organisms, future research may reveal additional parallels. Further supporting this, we observed striking similarities in mRNA expression patterns between human OA ankle cartilage and axolotl regenerative tissues (20). In contrast, hip OA cartilage exhibited minimal regenerative potential, while knee OA displayed an intermediate phenotype. This conclusion is supported by higher levels of protein modification and absence of a regenerative smRNA profile in hip cartilage, highlighting site-specific differences in cartilage plasticity. The ultimate regulators of this smRNA-driven regenerative gradient—whether mechanical load, joint injury, anatomy, or epigenetic mechanisms—remain to be fully elucidated. Nevertheless, regardless of OA induction or the factors influencing smRNA expression, smRNAs regulate anabolic responses across lower extremity joints, with the ankle exhibiting the most robust regeneration. Consequently, ankle OA cartilage represents a regeneration-permissive environment and could serve as a template for enhancing cartilage repair in less regenerative joints. We propose that the prevalence and progression of OA in lower extremity joints are governed by two key factors: susceptibility to injury (both micro and macro) and the tissue’s intrinsic repair capacity. Major joint injury is a well-established contributor to knee OA (22), with knee injuries being the most common among athletes, as illustrated by National Football League athletes (23). While the hip is less prone to injury, once OA develops, it progresses at twice the rate of knee OA (24), likely due to the hip’s lower anabolic repair capacity. In contrast, despite similar chondrocyte density (25), ankle cartilage exhibits superior repair potential compared to knee cartilage, though the molecular basis of this difference was previously unknown. Our current and prior work (19) reveal a gradient in cartilage regeneration capacity across OA joint sites, with the OA ankle displaying the highest regenerative potential, followed by the OA knee and then the OA hip. This gradient provides a mechanistic explanation for the faster progression of hip OA compared to knee OA (24, 26), and the distinct etiologies of OA across these joints—where injury accounts for up to 78% of ankle OA cases, 10% of knee OA cases, and only 2% of hip OA cases (27). The ankle’s superior intrinsic repair capacity, despite similar cartilage cellularity to the knee (25), appears to stem from its distinct smRNA expression profile, likely contributing to its relative protection from primary (idiopathic) OA. However, when a major injury exceeds the joint’s intrinsic compensatory repair mechanisms, it leads to post-traumatic OA, explaining the predominance of trauma-related OA in the ankle. Irrespective of the mechanism of OA induction or OA etiology, our data reveal a smRNA-regulated anabolic response in OA cartilage that varies by joint site. Understanding these site-specific differences in cartilage repair capacity could provide valuable insights into OA pathogenesis and inform targeted therapeutic strategies. ECM remodeling is central to regeneration, serving as a promoter of organizer formation, which instructs surrounding cells to adopt specific fates in the vicinity of a wound (28). The exact mechanism of action of miR-21 remains unclear (29), with prior studies reporting conflicting results—detrimental in murine OA models (30) but beneficial in primary human chondrocytes (31). Our findings suggest a potential disease-modifying role for miR-21, notably, upregulating ECM genes (COL2A1 and ACAN) and MMP13, but not the secretion of MMPs -1, -3 or -9 proteins. An upregulation of MMP13 by miR-21 has also been observed in a rat model of OA (32). Although MMPs are generally associated with OA pathogenesis, MMP-13 has beneficial effects on cartilage repair by cleaving and enabling removal of damaged type II collagen (33), thereby facilitating deposition of newly synthesized collagen, and is one of the genes that is up-regulated by injury (axolotl flank wound), enriched in limb tissue during axolotl limb regeneration, and associated with limb defects in humans when mutated—a condition known as Pyle’s Disease (20). Taken together, these data support essential roles for both pro-anabolic and cartilage remodeling processes in regeneration. The 59 identified miRNAs are involved in arthritis-related processes like inflammation and cartilage degradation (miR-9, -21, -146a), cartilage homeostasis, chondrocyte metabolism, and proteolytic enzyme activity (miR-27a, -101, -146a), cell proliferation and apoptosis in chondrocytes (miR-132), modulation of TGF signaling (miR-21, -146), and angiogenesis (miR- 126) (29). While some miRNAs have been studied in animal models, discrepancies exist (34, 35), highlighting the need for human-specific studies to optimize therapeutic approaches. A key strength of this study was the use of mass spectrometry-derived anabolic indices, providing a clearer understanding of smRNA function in human cartilage without confounding factors inherent in animal models. The human capacity for limited distal appendage regeneration is reminiscent of late blastemas that can self-repair but are refractory to reprogramming and lose organizer properties over time (28). In contrast, early blastemas can instruct and recruit cells from host tissue but require a nerve for reprogramming cues (36). However, mature human cartilage is aneural, likely imposing a barrier to full limb regeneration that necessitates further research. Human distal limb cartilage regeneration is also reminiscent of the more robust regenerative capabilities of distal compared with proximal axolotl appendages with repeated amputations (37). MiRNAs hold promise for therapeutic applications due to their lack of integration into the genome (38) and “druggability,” already demonstrated in a human phase I trial for cancer (39). Further research into these smRNA networks could inform therapies for OA and other tissue injuries. Although the specific gene networks regulated by cartilage regenerative smRNA require further elucidation, this study showed involvement of various networks, including TGF-beta signaling, NF-kappa B signaling, and PI3K-Akt signaling networks. While mechanical factors may influence joint-specific smRNA expression, the presence of a lower extremity expression gradient in OA—but not in non-OA joints—suggests that mechanical factors are not the primary determinant of the gradient. Moreover, regeneration occurs in both load-bearing (limbs) and non-load bearing (fins, tails) appendages (6), and equally well in forelimbs and hindlimbs. Epigenetic memory, such as miRNA expression and histone modification, likely plays a key role in maintaining phenotypic and positional information during cartilage regeneration as it does in blastema cells (40). This study was limited by its exclusive focus on cartilage; including other joint tissues or types of arthritis could yield different insights. In addition, our in vitro explant experiments were conducted using non-lesioned OA cartilage. It is possible that transduced miR-21 may have had a greater effect in non-OA cartilage, as OA cartilage—even in areas remote from lesions—may already exhibit some upregulation of the smRNA repair response, potentially blunting the effect of exogenous smRNA. In summary, this study uncovers region-specific regenerative differences in human OA cartilage, with important clinical implications. The mass spectrometry-derived anabolic and regenerative indices provide a quantitative framework for assessing cartilage anabolic repair responses, advancing our understanding of smRNA function in vivo. The robust intrinsic regenerative capacity of ankle cartilage highlights joint-specific differences in repair potential and identifies therapeutic targets for enhancing regeneration in less favorable environments, such as the knee and hip. These findings offer a blueprint for deciphering cartilage repair mechanisms and guiding the development of regenerative therapies for OA. Further research is needed to investigate the roles and therapeutic potential of miR-21 and other cartilage regenerative smRNAs. While human OA cartilage regeneration does not fully replicate limb regeneration in species like axolotls, our findings reveal conserved molecular mechanisms that warrant deeper exploration. Materials and Methods Human cartilage sample collection Under Duke (Pro00008622) Review Board approval as exempt human subjects research, ankle, knee, and hip joints (nine healthy non-OA and nine OA) were obtained as surgical waste specimens from 18 patients of similar age, with three samples collected for each of the six joint types. Full- thickness cartilage samples were collected from the load-bearing perilesional regions of the hip, knee, and ankle joints. OA specimens were obtained during total joint replacement surgery for end-stage OA. Healthy, non-OA cartilage was acquired within hours of acute joint trauma during surgery; the absence of OA was confirmed by the surgeon and by macroscopic inspection upon receipt of the sample in the laboratory. Within 2 hours of surgical acquisition, all specimens were snap frozen in tubes on dry ice and stored at -80°C until further analysis. As previously described (19), 20 adjacent sections (12 µm thickness) were collected at three different distances from the cartilage surface to represent superficial (0 to 240 mm), middle (480 to 720 mm), and deep (960 to 1200 mm) layers; proteomic results of all of three layers were summed to represent the total cartilage. The healthy non-OA patients (n=9, 44% male) were mean age 58.8 years (range 30-82 years); the OA patients (n=9, 33% male) were mean age 59.8 years (range 42-87 years). The demographics—mean age (age range, % male)—by joint site were as follows: ankle non-OA 59.0 years (30-82 years, 33% male); ankle OA 61.3 years (43-76 years, 67% male); knee non-OA 46.3 years (36-54 years, 67% male); knee OA 59.0 years (42-79 years, 33% male); hip non-OA 61.0 years (35-81 years, 33% male); hip OA 69.3 years (57-87 years, 0% male). Proteomic analyses Frozen cartilage sections were extracted using 4 M guanidine-HCl extraction buffer with 0.2% RapiGest (Waters Corporation, Milford, MA) for 24 hours on an orbital shaker at 4°C. Protein extracts were reduced with 4 mM dithiothreitol, alkylated with 16 mM iodoacetamide, and then precipitated with ethanol (9:1) overnight at 4°C. Samples were digested with 2 μg of trypsin, then filtered through a 30-kDa filter (Pall Life Sciences, Port Washington, NY) to remove residual polysaccharides. Samples were run on a quadrupole Orbitrap benchtop mass spectrometer (Q Exactive, Thermo Fisher Scientific, Waltham, WA) equipped with an EASY-nLC 1000 system (Thermo Scientific, Waltham, MA) as previously described (19). Protein identification and quantification of MS1 precursor ions were performed using Proteome Discoverer 2.1 (Thermo Scientific). Determination of the anabolic indices and the regenerative index of cartilage ECM proteins The relative proportion of old (deamidated) and new (non-deamidated) forms of a protein in a specimen indicate the amount of protein anabolism. The level of anabolism of each peptide was determined through the following steps: first, the peptide transitions for the deamidated (old) and non-deamidated (young) forms were summed. Next, the ratio of old to total (equal to ‘old’ plus ‘young’) peptide forms was calculated for each peptide across samples to compute the ‘deamidation ratio’. The resulting ratios were then standardized using z-scores to ensure comparability across peptides. Finally, the z-scores were multiplied by -1 to create a metric that directly reflects anabolism. The mean standardized values of peptides derived from a single protein were used to quantify the anabolic activity level of a particular protein (see table S10 Hsueh et al). We use the term ‘anabolic index’ to refer to the amount of protein anabolism indicated by mass spectrometric quantification of the amounts of the old and young protein forms as follows: protein anabolic index = [standardized deamidation ratio * -1], standardized deamidation ratio = amount of ‘old’ deamidated protein / amount of total protein, total protein = sum deamidated and non-deamidated protein A high anabolic index value represents high protein anabolism. Additionally, we computed an overall cartilage ‘regeneration index’ by summing the anabolic indices of five key cartilage ECM proteins, aggrecan, cartilage oligomeric matrix protein (COMP), prolargin (PRELP), and collagen types II and III. RNA extraction Total RNA was extracted from cartilage regions adjacent to those harvested for proteomic analyses. Total RNA was extracted for smRNA sequencing and mRNA sequencing. Cartilage was dissected transversely from the surface. Total RNA was extracted using a Qiagen miRNeasy Mini Kit (Qiagen) following the manufacturer’s instruction with modifications. Samples were immersed in Qiazol reagent at room temperature for 15 mins and centrifuged at 12,000 g for 5 mins to remove insoluble cartilage ECM. Supernatant was collected into a new tube followed by the addition of chloroform and centrifuged at 12,000 g at 4°C for 15 mins. Sodium chloride and sodium acetate were added to the upper fraction to remove the proteoglycan from the cartilage ECM (41). Total RNA was extracted using RNeasy mini spin columns. Extracted total RNA was used for down- stream analyses, including RNA sequencing and real-time polymerase chain reaction (PCR). smRNA sequencing Cartilage total RNA from human lower limb joints was submitted to the Duke Sequencing Core facility for smRNA sequencing to comprehensively evaluate the smRNA profile within cartilage using a non-targeted approach. SmRNA sequencing libraries were constructed using the QIAseq miRNA Library Kit. After standard quality control via the 2100 Bioanalyzer, sequencing was performed using 10 ng total RNA on the Illumina NovaSeq 6000. After sequencing, QIAseq miRNA / piRNA sequencing FASTQ files were uploaded to the GeneGlobe® Data Analysis Center for further analysis. Briefly, miRNA / piRNA entry reads were first trimmed at the 3’ adapter using Cutadapt (42), and the resulting insert sequences and unique molecular index (UMI) sequences were identified. To annotate the insert and UMI sequences, a sequential alignment strategy was followed to map to the Human Genome Reference Consortium, GRCh38 / hg38 using the Bowtie alignment tool (43). Lastly, miRNA / piRNA read counts and associated UMIs were aggregated and calculated from the mapping results using miRBase V21(44) and piRNABank, respectively. Following the pre-processing steps, the raw count UMI data were filtered, normalized, and analyzed using the BioConductor package edgeR (45-47) in the statistical computing environment, R (48). Briefly, raw UMI counts were filtered to remove low expressors using a log counts per million (log-CPM) cutoff threshold of log2(10 / (median library size in millions) + 2 / (mean library size in millions)) (49). A total of 559 cartilage smRNAs were identified; 463 were retained after filtering out low abundance smRNAs. Filtered UMI counts were then used to calculate normalization factors using the trimmed mean of M-values (TMM) method (50). For differential analysis, we used a generalized linear model (GLM) quasi-negative binomial regression (QLF- test) accounting for within sample comparisons with an a priori significance threshold of p<0.05. QLF-tests were performed for between tissue types (ankle, knee, and hip) and between disease conditions (non-OA and OA). Pathway analyses of miRNA were conducted using the miRNA Enrichment Analysis and Annotation (miEAA) tool (51). mRNA sequencing Messenger RNA sequencing of total cartilage RNA of human lower limb joints was performed by BGI Genomics using the DNBSEQ platform with pair end reads of 100 bp length; a mean 2.23 G bases per sample were generated resulting in a total of 14,371 genes identified. The quality control procedure step was performed on the raw sequencing reads to filter out reads of low quality, reads with adaptor sequences, and reads with high levels of N base. After quality control, the filtered clean reads were aligned to the reference genome (GRCh38.p13) using HISAT (Hierarchical Indexing for Spliced Alignment of Transcripts). We used Bowtie2 to map the clean reads to the reference genes, then used RSEM to calculate the gene expression level of each sample. The differential gene expression analysis, pathway classification analysis, pathway enrichment analysis, and gene set enrichment analysis were conducted using the Dr. Tom Data visualization system (BGI Genomics). Integrated analysis of smRNA and mRNA gene expression by STRING analysis To elucidate the gene networks associated with regenerative smRNAs, we analyzed the interactions between 69 regenerative smRNAs and gene networks in the same human ankle and hip cartilages. We 1) identified the unique target mRNAs based on significant Pearson correlation (|r| > 0.6 and p < 0.01) between log transformed smRNAs and mRNA levels; 2) conducted STRING (Search Tool for the Retrieval of Interacting Genes) analysis to identify the potential gene interaction networks; 3) conducted MCL (Markov Clustering) analysis with inflation parameter 1.5 to identify gene network clusters; 4) conducted functional enrichment analysis with false discover rate ≤ 0.01 and minimum strength ≥ to 0.01 to identify significant pathways. cDNA synthesis and gene expression quantification by real-time PCR (qPCR) Expression of genes targeted by miR-21 and key cartilage genes were quantified by real-time quantitative PCR. Cartilage RNA, isolated as described above, underwent reverse transcription using QuantiTect Reverse Transcription kit (Qiagen) per the manufacturer’s instructions. Primers for ACAN, COL2A1, MMP13 and housekeeping YWHAZ and ACTB were purchased from IDT (ACAN-F: GTGCCTATCAGGACAAGGTCT (SEQ ID NO: 423), ACAN-R: GATGCCTTTCACCAC-GACTTC (SEQ ID NO: 425); COL2A1-F: TGAGGGCGCGGTAGAGACCC(SEQ ID NO: 426), COL2A1-R: TGCACACAGCTGC- CAGCCTC (SEQ ID NO: 427); MMP13-F: ATCCCTTGATGCCATTACCAG (SEQ ID NO: 428), MMP13-R: AATACGGTTGGGA-AGTTCTGG (SEQ ID NO: 429); YWHAZ-F: CTGAGGTTGCAGCTGGTGATGACA (SEQ ID NO: 430), YWHAZ-R: AGCAGGCT- TTCTCAGGGGAGTTCA (SEQ ID NO: 431); ACTB-F: GGATCAGCAAGCAGGAGT ATG (SEQ ID NO: 432), ACTB-R: AGAAAGGGTGTAACGCAACTAA (SEQ ID NO: 433)). Quantitative PCR was performed with the QuantiTect SYBR Green PCR kit and QuantStudio™ 6 PCR System (Applied Biosystems) per the manufacturer’s instructions. In C28 / I2 experiments, particularly under OA stress conditions, we observed statistically significant variation in ACTB (marked reduction) whereas YWHAZ remained stable. Therefore, we chose to normalize all gene expression data to YWHAZ. Transduction of miR-21 via lentivirus in the chondrocyte C28 / I2 cell line To evaluate the effects of miR-21 on chondrocyte C28 / I2 cells (Research Resource Identifier (RRID) CVCL_0187), we used lentiviral vectors. Chondrocyte C28 / I2 cells were grown in DMEM / F12 medium (Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12) supplemented with GlutaMAX™, 10% fetal bovine serum, and 1% of Antibiotic-Antimycotic (10,000 units / mL of penicillin, 10,000 µg / mL of streptomycin, and 25 µg / mL of Gibco Amphotericin B). Cells were plated onto Costar 12 well plates (Corning, Kennebunk, ME) at 1 x 105cells / well for 24 hours, then transduced with lentiviral particles – miR-21 with GFP as the reporter, or scrambled control RNA sequence with GFP – at a multiplicity of infection (MOI) of 16 in FBS-free DMEM / F12 medium. Immediately after adding the lentiviral particles, the plate was subjected to the ‘spinfection’ procedure, i.e. spinning for 1 hour at 800g at room temperature to increase transduction efficiency. After 2 days, puromycin 0.5 μg / ml was added to the culture medium to select stably transduced cells. After another 2 days, transduced cells were treated with clinically relevant concentration of LPS (10 ng / ml) from E. coli, Serotype R515 (Enzo Life Sciences), and ultra-low molecular weight (ULMW, 7.5 kDa) HA fragments (10 µg / ml) (R&D Systems) to simulate OA as previously described (52). After 24 hours, cell viability was measured using PrestoBlue (ThermoFisher) as previously described (53), and total RNA from transduced cells was collected for further use. These experiments were duplicated six times. Transduction of miR-21 via adeno-associated virus (AAV) in human primary cartilage explants To evaluate the effects of miR-21 on cartilage explants, we used AAV serotype 2 vectors. We freshly isolated full-thickness cartilage explants from non-lesioned areas of human knee articular cartilage, obtained as surgical waste at the time of total joint replacement for OA. They were washed with saline to remove residual blood and synovial fluid on the surface; any residual solution was removed with a sterile gauze. AAV particles expressing human miR-21 with GFP as the reporter, or scrambled control RNA sequence with GFP, were added to the surface of each explant (1E+10 AAV particles in 100 µl serum-reduced Opti-MEM medium). After 24 hours, the medium was removed and DMEM / F12 medium with 10 % FBS added. Culture media were collected every 3 days for further analysis. Transduced cartilage explants were collected at Day 14 and Day 28 and stored at -80°C until further analysis. Cartilage explants from a total of five different donors were analyzed. Immunohistochemical staining of cartilage explants Reporter GFP within cartilage explants was detected by immunohistochemistry. Frozen cartilage explants were embedded in Tissue-Tek O.C.T. (Sakura, Alphen aan den Rijn, The Netherlands) for horizontal cryosectioning at 10µm thickness. Prior to staining, the sections were treated with 1% bovine serum albumin and 5% goat serum in saline solution at 37°C, then treated with 4% paraformaldehyde for 15 mins. Anti-GFP antibody (eBioscience, 14-6674-82) was diluted with 0.25% permeable buffer, 1% bovine serum albumin, and 5% goat serum in saline at 4°C overnight. Saline was used to wash the sections, after which anti-mouse immunoglobulin antibody was added (eBioscience, 50-4010-82) for 1 hour at room temperature. The cell nucleus was counter-stained with 300 nM DAPI stain solution. Biochemical analyses in cell culture media In cartilage explant culture media, we quantified sulfated glycosaminoglycans (sGAGs), reflecting catabolism of cartilage proteoglycan, using the Blyscan™ sGAG Assay (BioVendor); we also quantified catabolism of cartilage type II collagen using the CartiLaps® (CTX-II) EIA kit (IDS). Cytokines, including IL-1β, IL-2, IL-6, and IL-10 in culture media, were measured by immunoassays (MSD, Rockville, USA) according to the manufacturer’s instructions. Statistical Analysis In addition to the integrated smRNA / mRNA analyses described above, we performed Spearman correlation analyses to assess the relationship between smRNA expression and protein anabolic indices. The smRNAs with a p-value <0.05 from correlation analysis were considered indicative of potential regenerative activity. For the in vitro chondrocyte cell line assays, we conducted a two-way ANOVA to evaluate the independent and interactive effects of miR-21 transduction and OA-like stress. For the in vitro cartilage explant assays, we performed linear regression analyses separately for the control and miR-21 transduction groups. We then compared the slopes of the regression lines to determine the differential effects of miR-21 on cartilage explant responses. References 1. E. C. Holman, et al., Microarray analysis of microRNA expression during axolotl limb regeneration. Plos One 7, e41804 (2012). 2. B. L. King, V. P. Yin, A Conserved MicroRNA Regulatory Circuit Is Differentially Controlled during Limb / Appendage Regeneration. PLoS One 11, e0157106 (2016). 3. V. P. Yin, et al., Fgf-dependent depletion of microRNA-133 promotes appendage regeneration in zebrafish. Genes Dev 22, 728-733 (2008). 4. E. D. Hutchins, et al, Differential expression of conserved and novel microRNAs during tail regeneration in the lizard Anolis carolinensis. BMC Genomics 17, 339 (2016). 5. C. M. Illingworth, Trapped fingers and amputated finger tips in children. J Pediatr Surg 9, 853-858 (1974). 6. D. Payzin-Dogru, J. L. Whited, An integrative framework for salamander and mouse limb regeneration. The International journal of developmental biology 62, 393-402 (2018). 7. K. Nozaka, et al, Effectiveness of distal tibial osteotomy with distraction arthroplasty in varus ankle osteoarthritis. BMC Musculoskelet Disord 21, 31 (2020). 8. M. P. Jansen, et al, Changes in Cartilage Thickness and Denuded Bone Area after Knee Joint Distraction and High Tibial Osteotomy-Post-Hoc Analyses of Two Randomized Controlled Trials. J Clin Med 10, (2021). 9. M. P. Jansen, et al, Knee Joint Distraction Compared with High Tibial Osteotomy and Total Knee Arthroplasty: Two-Year Clinical, Radiographic, and Biochemical Marker Outcomes of Two Randomized Controlled Trials. Cartilage 12, 181-191 (2021). 10. C. G. Boer, et al, Deciphering osteoarthritis genetics across 826,690 individuals from 9 populations. Cell 184, 4784-4818.e4717 (2021). 11. V. B. Kraus, et al, Predictive validity of biochemical biomarkers in knee osteoarthritis: data from the FNIH OA Biomarkers Consortium. Ann Rheum Dis 76, 186-195 (2017). 12. V. B. Kraus, M. A. Karsdal, Osteoarthritis: Current Molecular Biomarkers and the Way Forward. Calcif Tissue Int 109, 329-338 (2021). 13. K. Heinemeier, et al, Radiocarbon dating of human articular cartilage shows minimal collagen turnover after maturity in both healthy and osteoarthritic tissue Osteoarthritis and cartilage 24, S146 (2016). 14. Q. Yao, et al, Osteoarthritis: pathogenic signaling pathways and therapeutic targets. Signal Transduct Target Ther 8, 56 (2023). 15. J. Chahla, et al, Intra-Articular Cellular Therapy for Osteoarthritis and Focal Cartilage Defects of the Knee: A Systematic Review of the Literature and Study Quality Analysis. J Bone Joint Surg Am 98, 1511-1521 (2016). 16. N. A. Householder, et al, A Review of Recent Innovations in Cartilage Regeneration Strategies for the Treatment of Primary Osteoarthritis of the Knee: Intra-articular Injections. Orthop J Sports Med 11, 23259671231155950 (2023). 17. N. E. Robinson, A. B. Robinson, Prediction of protein deamidation rates from primary and three-dimensional structure. Proceedings of the National Academy of Sciences of the United States of America 98, 4367-4372 (2001). 18. P. A. Cloos, S. Christgau, Non-enzymatic covalent modifications of proteins: mechanisms, physiological consequences and clinical applications. [Review] [64 refs]. Matrix Biology 21, 39-52 (2002). 19. M. F. Hsueh, et al, Analysis of "old" proteins unmasks dynamic gradient of cartilage turnover in human limbs. Sci Adv 5, eaax3203 (2019). 20. J. R. Monaghan, et al, Gene expression patterns specific to the regenerating limb of the Mexican axolotl. Biol Open 1, 937-948 (2012). 21. M. F. Hsueh, et al, Anti-inflammatory effects of naproxen sodium on human osteoarthritis synovial fluid immune cells. Osteoarthritis Cartilage 28, 639-645 (2020). 22. D. T. Felson, Epidemiology of hip and knee osteoarthritis. Epidemiol Rev 10, 1-28 (1988). 23. M. A. M. Davies, et al, Prevalence of and Risk Factors for Total Hip and Knee Replacement in Retired National Football League Athletes. Am J Sports Med 47, 2863-2870 (2019). 24. R. L. Manno, et al, OARSI-OMERACT initiative: defining thresholds for symptomatic severity and structural changes in disease modifying osteoarthritis drug (DMOAD) clinical trials. Osteoarthritis Cartilage 20, 93-101 (2012). 25. K. E. Kuettner, A. A. Cole, Cartilage degeneration in different human joints. Osteoarthritis Cartilage 13, 93-103 (2005). 26. V. Kraus, "Preclinical and Early Osteoarthritis" in Rheumatology E-Book, M. Hochberg, A. Silman, J. Smolen, M. Weinblatt, W. MH, E. Gravallese, Eds. (Elsevier, Philadelphia, ed.7th, 2019), chap.187. 27. L. A. Salman, et al, Osteoarthritis: a narrative review of molecular approaches to disease management. Arthritis Res Ther 25, 27 (2023). 28. M. C. Vogg, Y. Wenger, B. Galliot, How Somatic Adult Tissues Develop Organizer Activity. Curr Top Dev Biol 116, 391-414 (2016). 29. K. Felekkis, M. Pieri, C. Papaneophytou, Exploring the Feasibility of Circulating miRNAs as Diagnostic and Prognostic Biomarkers in Osteoarthritis: Challenges and Opportunities. International journal of molecular sciences 24, (2023). 30. X. B. Wang, et al, MicroRNA-21-5p as a novel therapeutic target for osteoarthritis. Rheumatology (Oxford), (2019). 31. H. Zhu, X. et al, miR-21-5p protects IL-1β-induced human chondrocytes from degradation. J Orthop Surg Res 14, 118 (2019). 32. S. Ma, et al, MiR-21-5p regulates extracellular matrix degradation and angiogenesis in TMJOA by targeting Spry1. Arthritis Res Ther 22, 99 (2020). 33. R. M. Borzí, et al, Matrix metalloproteinase 13 loss associated with impaired extracellular matrix remodeling disrupts chondrocyte differentiation by concerted effects on multiple regulatory factors. Arthritis and rheumatism 62, 2370-2381 (2010). 34. J. Huang, L. et al, The microRNAs miR-204 and miR-211 maintain joint homeostasis and protect against osteoarthritis progression. Nature communications 10, 2876 (2019). 35. D. Kang, et al, Stress-activated miR-204 governs senescent phenotypes of chondrocytes to promote osteoarthritis development. Science translational medicine 11, (2019). 36. C. D. McCusker, D. M. Gardiner, Positional information is reprogrammed in blastema cells of the regenerating limb of the axolotl (Ambystoma mexicanum). PloS one 8, e77064 (2013). 37. D. M. Bryant, et al, Identification of regenerative roadblocks via repeat deployment of limb regeneration in axolotls. NPJ Regen Med 2, 30 (2017). 38. C. K. Sen, S. Ghatak, miRNA control of tissue repair and regeneration. Am J Pathol 185, 2629-2640 (2015). 39. D. S. Hong, et al, Phase 1 study of MRX34, a liposomal miR-34a mimic, in patients with advanced solid tumours. Br J Cancer 122, 1630-1637 (2020). 40. S. Hayashi, et al, Epigenetic modification maintains intrinsic limb-cell identity in Xenopus limb bud regeneration. Dev Biol 406, 271-282 (2015). 41. H. K. Le Bleu, et al, Extraction of high-quality RNA from human articular cartilage. Anal Biochem 518, 134-138 (2017). 42. M. Martin, Cutadapt Removes Adapter Sequences From High-Throughput Sequencing Reads. EMBnet 17, (2011). 43. B. Langmead, et al, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25 (2009). 44. A. Kozomara, S. Griffiths-Jones, miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic acids research 42, D68-73 (2014). 45. Y. Chen, et al, From reads to genes to pathways: differential expression analysis of RNA- Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline. F1000Res 5, 1438 (2016). 46. D. J. McCarthy, Y. Chen, G. K. Smyth, Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic acids research 40, 4288-4297 (2012). 47. M. D. Robinson, D. J. McCarthy, G. K. Smyth, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140 (2010). 48. R. C. Team, R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. (2022). 49. Y. H. Chen, et al, CBX4 Regulates Replicative Senescence of WI-38 Fibroblasts. Oxid Med Cell Longev 2022, 5503575 (2022). 50. M. D. Robinson, A. Oshlack, A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol 11, R25 (2010). 51. F. Kern, et al, miEAA 2.0: integrating multi-species microRNA enrichment analysis and workflow management systems. Nucleic acids research 48, W521-w528 (2020). 52. M. F. Hsueh, et al, Anti-inflammatory effects of naproxen sodium on human osteoarthritis synovial fluid immune cells. Osteoarthritis Cartilage, (2020). 53. T. V. Stabler, et al, Chondroitin sulphate inhibits NF-kappaB activity induced by interaction of pathogenic and damage associated molecules. Osteoarthritis Cartilage 25, 166-174 (2017).
Claims
CLAIMS What is claimed:
1. A composition for cartilage regeneration comprising a polynucleotide selected from the group consisting of: (a) at least one of SEQ ID NOs: 1-36, 66, 67, 68 or a homolog thereof having at least 90% identity thereto; (b) an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65, 69 or a homolog thereof having at least 90% identity thereto; or (c) combinations of (a) and (b); and a pharmaceutically acceptable carrier.
2. The composition of claim 1, comprising (a) at least one of SEQ ID NO: 1, 11, 22, or 30; (b) an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37 or 41; or (c) combinations of (a) and (b).
3. The composition of any one of the preceding claims, wherein the polynucleotide is an RNA.
4. The composition of any one of the preceding claims, wherein the polynucleotide comprises at least one modified nucleotide.
5. The composition of any one of the preceding claims, further comprising a nanocarrier.
6. The composition of claim 5, wherein the nanocarrier is bound to or encompasses the polynucleotide.
7. The composition of claim 5 or 6, wherein the nanocarrier is selected from a lipid- based nanocarrier, a polymeric nanocarrier or an inorganic nanocarrier.
8. The composition of any one of claims 5-7, further comprising a cargo molecule.
9. The composition of claim 8, wherein the cargo molecule comprises a polynucleotide, a polypeptide, an active pharmaceutical ingredient or therapeutic agent.
10. A construct comprising a heterologous promoter operably connected to a polynucleotide encoding:(a) at least one of SEQ ID NOs: 1-36, 66, 67, 68 or a homolog thereof having at least 90% identity thereto; or (b) an antisense oligonucleotide complementary to at least a portion of at least one of SEQ ID NOs: 37-65, 69 or a homolog thereof having at least 90% identity thereto.
11. The construct of claim 10, wherein the construct comprises a lentiviral, retroviral or AAV vector.
12. A method of regenerating cartilage in a subject in need thereof, the method comprising, administering the composition of any one of claims 1-9 or the construct of any one of claims 10-11 to the subject to allow regeneration of cartilage in the subject.
13. The method of claim 12, wherein the composition is administered via injection into the affected tissue.
14. The method of claim 13, wherein the affected tissue is a synovial joint.
15. The method of claim 14, wherein the synovial joint is a hip, knee, ankle, shoulder, elbow, wrist, finger, temporomandibular or facet joint.
16. The method of any one of claims 13-15, wherein the subject in need is diagnosed with or suspected of having arthritis, cartilage tears, cartilage damage or is undergoing a surgery in or near a synovial joint.
17. The method of claim 16, wherein the arthritis comprises osteoarthritis or rheumatoid arthritis.
18. The method of any one of claims 13-17, wherein the composition is administered at least one time.
19. The method of claim 18, wherein the subject is diagnosed with or suspected of having arthritis and the composition is administered at least twice, or is formulated for sustained delivery.
20. A method of treating osteoarthritis in a subject in need thereof, the method comprising administering the composition of any one of claims 1-9 or the construct of any one of claims 10-11 to the subject to treat osteoarthritis.
21. The method of claim 20, wherein the composition is administered at least once or formulated for sustained delivery.
22. The method of claim 20 or 21, wherein the composition is administered directly into the arthritic joint.
23. The method of any one of claim 20-22, further comprising obtaining a biological sample from the subject and measuring the expression of at least one biomarker prior to administering the composition, wherein the biomarker is selected from the group consisting of: (a) CRAC1 (CRTAC1), CXCL7, CO8G, A2AP, A1BG, A2GL, AACT, ACTG, AMBP, APOB, APOE, B2MG, C1QC, C1R, C1RL, C4BPA, C4BPB, CD14, CD44, CERU, CFAB, CFAH, CFAI, CILP1, C1S, CNDP1, CO2, CO4B, CO5, CO6A3, CO8B, CO9, coll3, COMP, CTX1a, CTX1b, CTX2, CTXi, ECM1, FA12, FA5, FBLN1, FBLN3, FCGBP, FCN3, FETUA, FINC, GELS, HA, HABP2, haptoglobin, HEMO, HEP2, HGFA, HRG, hyaluronan, IC1, ITIH1, ITIH4, KNG1, LAMA2, LUM, LYAM1, MASP1, PCOC1, PGCA, PHLD, PLF4, PLMN, PRG4, RET4, SAMP, SHBG, TENX, TETN, THBG, TIMP1, TSP1, TSP4, VTDB, VTNC, ZA2G, ZPI, and any combination thereof; or (b) CSPG4, BGN, NRP1, CD109, VISG4, MARCO, CD163, LRP1, PTPRS, ANXA2, ANXA5, HSP90AB1, IL-11, IL-11RA, GP130, FN1, CD29, ITGA5, ICAM1, IL- 21, FGA, FGB, FGG, TLN1, AMBP and any combination; and comparing the level of at least one biomarker in the sample to a reference level of the biomarker and administering the composition if the biomarker is increased as compared to the reference.
24. The method of claim 23, wherein the biological sample comprises synovial fluid, chondrocytes, synoviocytes, blood, serum or plasma.
25. The method of claim 24, further comprising isolating extracellular vesicles from the synovial fluid, blood, serum or plasma prior to measuring the expression of at least one biomarker.
26. The method of any one of claims 20-25, wherein the osteoarthritis is osteoarthritis of the hip, knee, ankle, shoulder, elbow, wrist, finger, temporomandibular or facet joint.
27. The method of any one of claims 20-26, further comprising administering one or more second therapeutic agents to the subject with increased expression of any one of the biomarkers.
28. The method of claim 27, wherein the second therapeutic agent comprises an analgesic, a non-steroidal anti-inflammatory drug, steroid injection, surgery or combinations thereof.
Citation Information
Patent Citations
Compositions and methods for decreasing intraocular pressure
US20220273694A1
Allogeneic Cartilage Regeneration
US20240200072A1