Affinity-binder-based assay compositions and methods
The method of proximity ligation of capture oligonucleotides to analytes in aptamer complexes addresses the challenge of variable protein concentrations, enabling efficient and cost-effective analyte detection in aptamer-based assays.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-02
AI Technical Summary
Existing aptamer-based assays face challenges in accurately identifying and quantifying analytes due to variations in protein concentrations within and between biological samples, making it difficult to establish a useful detection range for multiplexed assays.
A method involving proximity ligation of capture oligonucleotides to analytes through aptamer complexes, allowing for a single capture step and direct detection without secondary steps, using stochastic attachment to amino acids for redundancy and tolerance across different analytes.
Facilitates efficient, streamlined analyte detection and reduces assay costs by eliminating additional capture steps and enabling automation, while providing accurate identification and quantification of analytes through sequencing.
Smart Images

Figure US2025048675_02042026_PF_FP_ABST
Abstract
Description
AFFINITY-BINDER-BASED ASSAY COMPOSITIONS AND METHODSCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority to and the benefit of U.S. Provisional Application No. 63 / 701,213 filed September 30, 2024, the disclosure of which is hereby incorporated by reference in its entirety herein.REFERENCE TO ELECTRONIC SEQUENCE LISTING
[0002] The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on September 23, 2025, is named “ILUM0192PCT SEQUENCE LISTING.xml” and is 19,363 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.BACKGROUND
[0003] The disclosed technology relates generally to analyte detection and / or identification techniques used in conjunction with an affinity -binder assay, such as an aptamer-based assay. In particular, the technology disclosed relates to analyte modification techniques that can be used in conjunction with aptamer capture to uniquely identify captured analytes.
[0004] The subject matter discussed in this section should not be assumed to be prior art merely as a result of its mention in this section. Similarly, a problem mentioned in this section or associated with the subject matter provided as background should not be assumed to have been previously recognized in the prior art. The subject matter in this section merely represents different approaches, which in and of themselves can also correspond to implementations of the claimed technology.
[0005] Protein expression patterns help define a cell’s identity and state. RNA transcripts are often used as a surrogate for protein expression, but the relationship between abundance ofproteins and mRNA is not one-to-one. There are differences caused by RNA regulation and / or protein regulation, such as posttranscriptional, translational, protein degradation and RNA regulation. Therefore, direct nucleic acid sequencing of RNA transcripts may not provide an accurate estimation of protein expression.
[0006] Aptamers are single stranded nucleic acid molecules that bind to molecular targets, such as proteins, with high affinity and specificity. Advancements in aptamer selection and design include Systematic Evolution of Ligands by Exponential enrichment (SELEX). In SELEX, high affinity aptamers for different analytes of interest can be isolated from a combinatorial library, permitting high throughput characterization of aptamer-target binding and multiplexed assays for analytes in a complex biological sample. Upon aptamer binding to an analyte target, the binding event can be detected to characterize the presence and concentration of various analytes in the biological sample. However, because protein or other analyte concentrations can vary to a high degree within and / or between different biological samples, identifying a useful detection range for a multiplexed aptamer-based assay is difficult.BRIEF DESCRIPTION
[0007] In one embodiment, the present disclosure provides a method of analyte detection. The method includes contacting analytes of sample with a plurality of aptamers to form analyteaptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes. The method also includes contacting the analyte-aptamer complexes with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte- aptamer-capture oligonucleotide complexes. The method further includes ligating an end of the aptamer to an end of an individual capture oligonucleotide within an individual analyteaptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides. The method also includes detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
[0008] In one embodiment, the present disclosure provides a method of analyte detection, contacting analytes of sample with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-capture oligonucleotide complexes. The method also includes contacting the analyte-capture oligonucleotide complexes with a plurality of aptamers to form analyte-aptamer-complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes contacting the analyte-aptamer complexes. The method further includes ligating an end of the aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides. The method also includes detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
[0009] In one embodiment, the present disclosure provides a composition including a plurality of analytes of a sample bound to a respective plurality of aptamers to form analyteaptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes, and wherein the analytes comprise capture oligonucleotides cross-linked to one or more amino acids of each individual analyte such that an individual analyte-aptamer complex comprises one or more capture oligonucleotides.
[0010] In one embodiment, the present disclosure provides a protein capture complex including a solid surface. The protein capture complex also includes a plurality of aptamers comprising a tag and capable of being coupled to the solid surface via a surface binding moiety, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes. The protein capture complex further includes a plurality of different analytes coupled to a plurality of capture oligonucleotides, wherein the capture oligonucleotide when in close proximity to the tag on the aptamer is capable of being linked.
[0011] In one embodiment, the present disclosure provides a method of preparing a protein capture complex. The method includes providing an aptamer including a surface bindingmoiety. The method also includes providing an analyte coupled to a capture oligonucleotide and adding a ligating agent, wherein when the aptamer is bound to the analyte in close proximity to the capture oligonucleotide, an end of the aptamer and an end of the capture oligonucleotide are ligated.
[0012] In one embodiment, the present disclosure provides a method of analyte detection. The method includes contacting analytes of sample with a plurality of affinity binders to form analyte-affinity binder complexes, wherein individual affinity binders of the plurality of the affinity binders have a specific affinity for respective different analytes of the analytes. The method also includes contacting the analyte-affinity binder complexes with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-affinity binder-capture oligonucleotide complexes. The method further includes ligating an end of the affinity binder to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that affinity binders of the analyte-affinity binder-capture oligonucleotide complexes are ligated to respective capture oligonucleotides. The method also includes detecting the analytes of the sample based on sequences of a portion of the ligated affinity binders and capture oligonucleotides.
[0013] In one embodiment, the present disclosure provides a method of analyte detection. The method includes modifying analytes of a sample with functional groups that specifically interact with a subset of amino acids of the analytes to link the functional groups to only the subset of amino acids of the analytes. The method also includes providing capture oligonucleotides that react with the functional groups to link the capture oligonucleotides to the subset of amino acids to form analyte-capture oligonucleotide complexes. The method further includes contacting analyte-capture oligonucleotide complexes with a plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes, to form analyte-aptamer-capture oligonucleotide complexes. The method also includes ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides. The method further includes detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
[0014] In one embodiment, the present disclosure provides a method of analyte detection. The method includes contacting analytes of sample with a plurality of aptamers to form analyteaptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes. The method also includes modifying analytes of the analyte-aptamer complexes with functional groups that specifically interact with a subset of amino acids of the analytes to link the functional groups to only the subset of amino acids of the analytes. The method further includes providing functionalized capture oligonucleotides that react with the functional groups to link the capture oligonucleotides to the subset of amino acids to form analyte-aptamer-capture oligonucleotide complexes. The method also includes ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides. The method further includes detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.BRIEF DESCRIPTION OF THE DRAWINGS
[0015] These and other features, aspects, and advantages of the disclosed embodiments will become better understood when the following detailed description is read with reference to the accompanying drawings in which like characters represent like parts throughout the drawings, wherein:
[0016] FIG. l is a flow diagram of a method for analyte detection using stochastic attachment of oligonucleotide(s) to analytes, in accordance with aspects of the present disclosure;
[0017] FIG. 2 is an example analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure;
[0018] FIG. 3 is an example analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure;
[0019] FIG. 4 is a schematic illustration of example different aptamers and example different capture oligonucleotide(s), in accordance with aspects of the present disclosure;
[0020] FIG. 5 is a schematic illustration of an example aptamer ligated to a capture oligonucleotide(s)to form a contiguous amplification template, in accordance with aspects of the present disclosure;
[0021] FIG. 6 is a schematic illustration of example aptamer arrangements including identification sequences and primer, in accordance with aspects of the present disclosure;
[0022] FIG. 7 is a schematic illustration of an example capture oligonucleotide(s)arrangement, in accordance with aspects of the present disclosure;
[0023] FIG. 8 is a schematic illustration of amplification using a ligated aptamer-capture oligonucleotide(s) as template to generate a library for sequencing, in accordance with aspects of the present disclosure;
[0024] FIG. 9 shows attachment of capture oligonucleotides to available cysteines on an analyte, in accordance with aspects of the present disclosure;
[0025] FIG. 10 shows attachment of capture oligonucleotides to different analytes via crosslinking to available amino acids in the analytes, in accordance with aspects of the present disclosure;
[0026] FIG. 11 shows attachment of a mixture of capture oligonucleotides to different analytes via cross-linking to available amino acids in the analytes, in accordance with aspects of the present disclosure;
[0027] FIG. 12 is an example analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure;
[0028] FIG. 13 shows an example sequencing workflow using an analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure;
[0029] FIG. 14 shows an exemplary graph illustrating quantification of small panels using an example analyte detection workflow, in accordance with aspects of the present disclosure;
[0030] FIG. 15 is an example analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure;
[0031] FIG. 16 is a schematic illustration of a reactive handle, in accordance with aspects of the present disclosure;
[0032] FIG. 17 is an example analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure;
[0033] FIG. 18 is a schematic diagram of a sequencing device for acquiring sequencing data for identification of sequences and / or index sequences, in accordance with aspects of the present disclosure;
[0034] FIG. 19 is a schematic illustration of analytes labeled with the reactive handle of FIG. 16, in accordance with aspects of the present disclosure;
[0035] FIG. 20 is a schematic illustration of analytes labeled with the reactive handle of FIG. 16, in accordance with aspects of the present disclosure;
[0036] FIG. 21 is a schematic illustration of analytes labeled with the reactive handle of FIG. 16, in accordance with aspects of the present disclosure; and
[0037] FIG. 22 is a schematic illustration showing gel electrophoresis of the analytes labeled with reactive handles of FIG. 21, in accordance with aspects of the present disclosure.DETAILED DESCRIPTION
[0038] The following discussion is presented to enable any person skilled in the art to make and use the technology disclosed, and is provided in the context of a particular application and its requirements. Various modifications to the disclosed implementations will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other implementations and applications without departing from the spirit and scope of the technology disclosed. Thus, the technology disclosed is not intended to be limited to the implementations shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.
[0039] Aptamers are short single stranded nucleic acid molecules (ssDNA or ssRNA) that can bind to their specific target molecules with high affinity. Accordingly, aptamers can be used for multi omic applications, such as proteome characterization of a sample in a high-throughput manner. In some cases, an aptamer-based assay may be performed using two separate beadbased captures. Accordingly, some aptamer-based assays are performed using a two-step capture and separation.
[0040] Disclosed herein are techniques that employ chemistry attachment with proximity ligation (CAPL) for next generation sequencing for affinity-based proteomics. In general, aptamers may be provided to capture cognate targets (e.g., analytes, target proteins, sample proteins, sample) in solution. Rather than using two separate capture steps, the disclosed techniques may use proximity ligation in conjunction with aptamer-analyte complex formation such that a detectable oligonucleotide(s) is generated as a result of the proximity ligation. As a result, in certain embodiments, the disclosed aptamer-based assays may use a single capture step using immobilized or surface-associated aptamers. The ligation products may be ready for detection (e.g., sequencing) without a secondary capture step. Accordingly, the techniques described herein facilitate automation improvements, enable a streamlined process, eliminate steps in existing workflows, and decrease assay costs.
[0041] In an embodiment, the analytes in an aptamer-based assay may be associated with (e.g., cross-linked or covalently bound to) capture oligonucleotide(s) to facilitate detection of analyte-aptamer complexes. Analyte attachment may include complex formation between a capture oligonucleotide and the analyte in a manner links the capture oligonucleotides to one or more amino acid types (and not other amino acid types) of the analytes. Because the pool of analytes can be a complex mixture of different proteins (including some that are covered by the assay and, in certain cases, some proteins that are not assayed), the particular amino acid locations that the capture oligonucleotides are attached to the analytes may be uncharacterized, e.g., non-specific or stochastic. Nonetheless, with sufficient coverage of the analytes with attached capture oligonucleotides, the proximity -based ligation can occur for most or all of the analytes of interest. By way of example, if the capture oligonucleotides include a functional group that can react with only one amino acid type, such as lysine, a cross-linking or binding reaction can be conducted under conditions to facilitate cross-linking of a capture oligonucleotide to available lysines in the pool of analytes. Each respective analyte type may have a different amino acid sequence and, thus, different numbers and positions of lysines. Accordingly, some analytes may have 30 or more attachment sites while other analytes may have 5 or fewer or even none. Further, all available attachment sites may not be cross-linked, depending on the structure of the protein and whether the attachment site is positioned to accept the capture oligonucleotide (e.g., is not interior-facing or sterically hindered). However, the proximity-based ligation can successfully occur via ligation of only one capture oligonucleotide to an aptamer bound to the analyte, even in a case where the cross-linking does not occur at all available attachment sites, which provides redundancy and tolerance for different assay conditions. Thus, as provided herein, the attachment may include an attachment (e.g., binding, linking, cross-linking) to a specific amino acid type but in a manner that is undefined or uncharacterized with respect to the number and position of attached potential amino acid targets for a particular analyte and / or analyte pool.
[0042] Proximity ligation of capture oligonucleotides to aptamers occurs in the presence of analyte-aptamer complex formation. Therefore, generation and detection of proximity ligation products may serve as a proxy detection for analytes in a sample of interest. As disclosedherein, the capture oligonucleotide and an affinity binder, such as aptamers, antibodies, etc., may, when ligated form a reporter probe that is detectable only in the ligated form but that is not detected, or provides a negative result, when no successful ligation occurs. In one example, the capture oligonucleotide(s) includes a first primer binding region that is rendered amplifiable upon ligation to a second primer binding region present on the aptamer using primers specific to those primer regions. For example, the disclosed aptamers may include a non-binding region that, in embodiments, does not participate in analyte binding and that includes the second primer region. When an individual analyte is complexed with an individual aptamer, the non-binding region of the aptamer is positioned in sufficient proximity to a capture oligonucleotide(s) to permit proximity ligation. After ligation, a ligated oligonucleotide(s) (e.g., ligated nucleic acid product) is formed in which one end of the ligated oligonucleotide(s) may be immobilized on a solid surface (e.g., a capture bead). The ligated oligonucleotide(s) immobilized on the solid surface includes the analyte-binding region as well as the first primer binding region, an aptamer identification sequence, and a second primer binding region. The ligated oligonucleotide(s) may be amplified and / or sequenced to identify analytes present in the sample. Aptamers with no corresponding analytes present in the sample will not be brought into close proximity to any capture oligonucleotide(s). Therefore, no second primer binding region will be ligated to the aptamer if unbound to analyte. Accordingly, any aptamer identification sequence associated with unbound aptamers will not be amplified and will not be present in any sequencing results from downstream detection steps.
[0043] With the foregoing in mind, FIG. 1 is a flow diagram of a method 10 for analyte detection in affinity binder-based assays as disclosed herein using stochastic attachment of capture oligonucleotide(s) to analytes. The method 10 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the method 10 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the blocks of the method 10 may be omitted. It should be noted that affinity-binder and aptamers may be used interchangeably.
[0044] At block 12 of the method 10, capture oligonucleotide(s) may be attached to sample analytes. For example, the capture oligonucleotide(s) may include a functional group (e.g., a cross-linking moiety, a functional group) that may associate with (e.g., cross-link or covalently bind to) one or more types of amino acids present in the analyte based on the type of functional group. By way of example, the functional group may include oxaziridine, which can bind to available methionine residues of the sample analytes. Accordingly, the capture oligonucleotide(s) may be modified with a particular functional group to select for a specific functional group-amino acid interaction.
[0045] In general, the association of the capture oligonucleotide(s) to the sample analytes is driven by interactions (e.g., cross-linking, covalent interactions) between the functional groups of the capture oligonucleotide(s) and the amino acids of the sample analytes that are available for modification. For example, available amino acids may be amino acids positioned generally towards an exterior structure of the analyte. However, it should be understood that analytes may have complex structures (folds, sheets, loops), and available amino acids may include amino acids positioned within a cavity or loop.
[0046] In certain embodiments, the capture oligonucleotide(s) may be universal or conserved, such that the pool of analytes in a sample are coupled to capture oligonucleotide(s) having a same sequence. The capture oligonucleotide(s), as described herein, may be used with various types of sample analytes (e.g., proteins) to modify these analytes to carry nucleotide sequences that facilitate subsequent detection steps. In this way, the capture oligonucleotide(s) may randomly associate to any available amino acid on the surface of the sample analyte based on the functional group at the end of the capture oligonucleotide(s). While the binding of the capture oligonucleotide(s) to an amino acid residue is a specific interaction mediated via the type of functional group, the association of capture oligonucleotide(s) to a sample analyte is a stochastic process that is variable depending on the structure and / or type of amino acid resides present within a sample analyte. Accordingly, this association process may be uncharacterized and will occur in a manner that is agnostic to what type of protein it is (e.g., albumin, cytokines, kinases, etc.). For example, the attachment mayinclude coupling of capture oligonucleotide(s) to different positions or amino acids such that the analyte has a sufficient capture nucleotide modification coverage for proximity-based ligation. It should be understood that the modification may include one or more different amino acid types, such that adequate coverage of different analytes having respective different amino acid sequences can be achieved.
[0047] In certain embodiments, the method 10 may occur in different stages. In some embodiment, one or more capture oligonucleotide(s) may associate with a sample to form a capture oligonucleotide-aptamer complex (e.g., capture oligonucleotide-affinity binder complex). The capture oligonucleotide(s)-aptamer complex may subsequently contact aptamers to form the aptamer-analyte-capture oligonucleotide(s) complex. In some embodiments, aptamers may bind to a sample to form an aptamer-analyte complex. The aptamer-analyte complex may contact capture oligonucleotides(s), wherein the capture oligonucleotide(s) may associate with the aptamer-analyte complex to form the aptameranalyte-capture oligonucleotide(s) complex (e.g., affinity binder-analyte-capture oligonucleotide(s) complex. In other words, the capture oligonucleotides can be described herein as a “protein agnostic” or “non-protein specific” binding moiety that is able to associate with multiple proteins regardless of the type of protein or their activity, and as discussed more herein, may label different proteins at different amounts depending on the sequence of the proteins and the type of interaction mediating the binding moiety of this element.
[0048] The modified analytes having associated capture oligonucleotide(s), when bound to respective aptamers, are brought together such that proximity-based ligation occurs between one of the analyte’s capture oligonucleotide(s) and the bound aptamer. For example, at block 14 of the method 10, the analyte-attached capture oligonucleotide(s) may be ligated to the analyte-bound aptamer to form the ligated oligonucleotide. In general, a portion of the aptamer may include an analyte-binding region that exhibits a high affinity for an analyte of interest, which permits the formation of an aptamer-analyte complex. In some embodiments, the aptamer may associate (i.e., bind via the analyte-binding region) with the sample analyte prior to modification of the analytes via the non-specific or stochastic attachment of the captureoligonucleotide(s). Alternatively, the aptamer may associate (i.e., bind via the analyte-binding region) with the sample analyte after the attachment of the capture oligonucleotide(s) to the sample analytes. Accordingly, when the sample analyte is complexed with an individual aptamer, the non-binding region of the aptamer is positioned in sufficient proximity to a capture oligonucleotide(s) to enable proximity ligation.
[0049] At block 16 of the method 10, the ligated oligonucleotide(s) is provided for a detection assay, e.g., a sequencing reaction. For example, the ligated oligonucleotide(s) may be formed such that one end of the ligated oligonucleotide(s) may be immobilized on a solid surface (e.g., a capture bead). After proximity-based ligation, the ligated oligonucleotide(s) immobilized on the solid surface includes the analyte-binding region as well as the first primer binding region, an aptamer identification sequence, and a second primer binding region. The ligated oligonucleotide(s) may be amplified and / or sequenced to identify analytes present in the sample. In certain cases, by providing a detectable moiety as part of a ligation product that is attached to a surface, detection may occur directly on the surface. Thus, the disclosed workflow may not only eliminate additional surface-based capture steps, but also in embodiments may provide an aptamer-based assay in which analyte capture and detection may occur all on one surface or within a single reaction vessel.
[0050] By way of example. FIG. 2 is an example analyte detection workflow 50 with analyte modification. The workflow 50 may include a sample 52, wherein the sample 52 may include one or more sample analytes, e.g., protein(s) 54. It should be understood that the single illustrated protein(s) 54 is by way of example, and the illustrated workflow may apply to the pool of analytes present in the sample. Furthermore, it should be noted that the example workflow 50 shown in FIG. 2 is not limiting, and the workflow 50 may include additional or fewer steps than those illustrated. Further, the workflow 50 may include steps that are performed in an alternative order to that illustrated. That is, certain steps may be performed before, after, or concurrently to / with another respective step. The illustrated one-bead capture may initiate by contacting aptamer(s) 56 with the protein(s) 54 under conditions that permit formation of analyte-aptamer complexes 61. The aptamer(s) 56 may include one or more non-binding regions 59 and an analyte-binding region 57, wherein the analyte-binding region 57 exhibits a high affinity for the protein(s) 54. Accordingly, the analyte-binding region 57 of the aptamer(s) 56 may enable the formation of an aptamer-analyte complex 61. In some embodiments, a portion, e.g., an end, of the aptamer(s) 56 may be modified to include a tag (e.g., biotin tag). This enables the addition of solid support(s) 58 (e.g., capture bead, biotin binding supports / beads, protein-coated supports / beads) to the solution to select for the aptamer-analyte complex. It should be noted that the biotin binding protein may include avidin, streptavidin, neutravidin, an anti-biotin antibody, a biotin receptor, and / or a biotin-binding enzyme. In some embodiments, the biotin-binding enzyme comprises biotinidase or biotin holocarboxylase synthetase. For example, a biotin binding protein (e.g., streptavidin) coated bead may bind to the portion of the aptamer(s) 56 including a biotin tag. In this way, protein(s) 54 not associated with aptamer(s) 56 may be removed via a washing step. However, in some embodiments, the aptamer(s) 56 may be pre-associated with the solid support(s) 58 before contact with the analytes. As such, the aptamer-analyte complex 61 may or may not include the solid support(s) 58.
[0051] Subsequently, capture oligonucleotide(s) 60 (e.g., protein-labeling oligonucleotide(s)) may associate with the aptamer-analyte complex 61 to form an aptamer-analyte-capture oligonucleotide complex 63. For example, a portion (e.g. one end) of the capture oligonucleotide(s) 60 may be modified to include a functional group to facilitate an interaction (e g., cross-linking, covalent interactions) with amino acid(s) of the protein(s) 54. In this way, the capture oligonucleotide(s) 60 may associate with the protein(s) 54, which is mediated by the interaction between the functional group and the amino acid on the surface of the protein(s) 54. It should be noted that one or more, two or more, or three or more capture oligonucleotide(s) 60 may associate with one protein(s) 54 such that each individual capture protein(s) 54 is associated with one or more capture oligonucleotide(s) 60. In some embodiments, it should be noted that the capture oligonucleotide(s) 60 and aptamer(s) 56 may contact the protein(s) 54 co-currently.
[0052] The analyte modification with the capture oligonucleotide(s) 60 may be performed on the pool of protein(s) 54 present in the sample 52. Thus, in embodiments, the capture oligonucleotide(s) 60 may all have a same sequence relative to one another, even when associated with different protein(s) 54. However, each individual aptamer(s) 56 specific for an individual analyte (e.g., protein(s) 54) has a unique sequence analyte-binding region 57 relative to other aptamer(s) 56. As further described herein, the aptamer(s) 56 may, in embodiments, include the non-binding region 59 with aptamer identification sequences that do not directly interact with the protein(s) 54 but that are uniquely identifying for the aptamer identity. The non-binding region 59 may additionally include one or more conserved regions, such as a primer binding region or an adapter (e g., sequencing adapter), that are conserved between different aptamers.
[0053] Once the protein(s) 54 is complexed with the aptamer(s) 56 and the capture oligonucleotide(s) 60, a non-binding region of the aptamer(s) 56 may be positioned in sufficient proximity to a portion of the capture oligonucleotide(s) 60 to permit covalent linking (e.g., proximity ligation) using a ligating agent. For example, ligase 62 may be added, wherein a synthetic adenine (A) tail (e.g., 5’ App, 5-App) may be added to the 5’ end of the capture oligonucleotide(s) 60 to facilitate ligation 62 (e.g., covalent linking) using an enzyme (e.g., Thermostable 5'App DNA / RNA Ligase) reaction with the non-binding region of the aptamer(s) 56. The A-tail may be added before or after complex formation. For example, the capture oligonucleotide(s) 60 may, in an embodiment, be provided with pre-modified A tails. In another embodiment, A tailing may occur after formation of the aptamer-analyte complexes 61. It should be noted that covalent linking of the capture oligonucleotide(s) 60 to the aptamer(s) 56 is not limited to ligation. In some embodiments, proximity-based covalent linking of the capture oligonucleotide(s) 60 to the aptamer(s) 56 may be performed using enzymatic ligation, chemical ligation (e g., cross-linking, click chemistry (e.g., strained ring opening molecules)), or proximity extension. Techniques for click chemistry as disclosed in US20210381040A1, hereby incorporated by reference in its entirety, may be used as ligation techniques (e g., chemical ligation) to ligate the aptamer(s) 56 and the capture oligonucleotide(s) 60 herein in conjunction with or instead of the enzymatic ligation discussedherein. Accordingly, ligating an end of the capture oligonucleotide(s) 60 to the aptamer(s) 56 generates ligated oligonucleotide(s) 64 (e.g., ligated nucleic acid product), wherein the ligated oligonucleotide(s) 64 may be formed in a way such that one end of may be immobilized on the solid support(s) 58. As such, the isolated, immobilized ligated oligonucleotide(s) 64 includes the analyte-binding region 57, the non-binding region 59, and the capture oligonucleotide(s) 60. As discussed, the capture oligonucleotide(s) 60 may have a conserved sequence. Thus, the ligated oligonucleotide(s) 64 may be partially variable and partially conserved.
[0054] The ligated oligonucleotide(s) 64 associated with the solid support may be isolated / separated by via one or more techniques. In an embodiment, the solid support(s) 58 is a magnetic bead, and the beads may be magnetically pulled down and washed to separate unbound elements from the bead and associated ligated oligonucleotide(s) 64.
[0055] In certain embodiments, the protein(s) 54 may be removed prior to subsequent detection steps. For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitate degradation of the protein(s) 54. In other embodiments, heat, chemical degradation, or may be used for the degradation of the sample protein(s) 54. In some embodiments, the ligated oligonucleotide(s) 64 may be cleaved from the sample protein(s) 54 via chemical or enzymatic means. However, in certain embodiments, no protein treatment or removal is performed, and downstream detection steps may occur with the protein(s) 54 complexed with the aptamer 56. The ligated oligonucleotide(s) 64 may be amplified and / or sequenced to identify analytes present in the sample.
[0056] With the foregoing in mind, FIG. 3 is an example analyte detection workflow 100 with analyte modification. It should be noted that the workflow 100 may employ similar steps as described in FIG. 2. Furthermore, it should be noted that the example workflow 100 shown in FIG. 3 is not limiting, and the workflow 100 may include additional or fewer steps than those illustrated. Further, the workflow 100 may include steps that are performed in an alternative order to that illustrated. That is, certain steps may be performed before, after, or concurrently to / with another respective step.
[0057] The workflow 100 may include the sample 52, wherein the sample 52 may include one or more sample analytes (e.g., protein(s) 54. As indicated in FIG. 2, the single illustrated protein(s) 54 is by way of example, and the illustrated workflow may apply to the pool of analytes present in the sample. The illustrated one-bead capture step may begin by contacting the capture oligonucleotide(s) 60 (e.g., protein-labeling oligonucleotide(s) with the protein(s) 54 under conditions such that the capture oligonucleotide(s) 60 may associate with the analyte complex, thereby forming an analyte-capture oligonucleotide complex 65. In general, the interaction between the capture oligonucleotide(s) 60 and the protein(s) 54 may be mediated by the interaction between the functional group of the capture oligonucleotide(s) 60 and the amino acid on the surface of the protein(s) 54. It should be noted that one or more, two or more, or three or more capture oligonucleotide(s) 60 may associate with the protein(s) 54.
[0058] Subsequently, the aptamer(s) 56 may be provided to permit interaction with analytecapture oligonucleotide complex 65, thereby forming the aptamer-analyte-capture oligonucleotide complex 63. In general, the analyte-binding region of the aptamer(s) 56 permits interaction with the analyte-capture oligonucleotide complex 65 and enables the formation of an aptamer-analyte-capture oligonucleotide complex 63. In some embodiments, a portion (e.g., an end) of the aptamer(s) 56 may be modified to include a tag (e.g., biotin tag). This enables the addition of solid support(s) 58 (e.g., capture bead (e.g., streptavidin-coated beads)) to the solution to select (e.g., isolate) for the aptamer-analyte-capture oligonucleotide(s)complex 63. For example, a streptavidin coated bead may bind to the portion of the aptamer(s) 56 including a biotin tag, thereby enabling the removal of the protein(s) 54 not associated with aptamer(s) 56 via a washing step. It should be noted that in some embodiments, the aptamer(s) 56 may be pre-associated with the solid support(s) 58 before contact with the analytes. As such, the aptamer-analyte-capture oligonucleotide complex 63 may or may not include the solid support(s) 58.
[0059] As indicated in FIG. 2, the analyte modification with the capture oligonucleotide(s) 60 may be performed on the pool of protein(s) 54 present in the sample 52. Thus, in embodiments, the capture oligonucleotide(s) 60 may all have a same sequence relative to one another, evenwhen associated with different protein(s) 54. However, each individual aptamer(s) 56 specific for an individual analyte (e.g., protein(s) 54) has a unique sequence analyte-binding region 57 relative to other aptamer(s) 56. As further described herein, the aptamer(s) 56 may, in embodiments, include the non-binding region 59 with aptamer identification sequences that do not directly interact with the protein(s) 54 but that are uniquely identifying for the aptamer identity. The non-binding region 59 may additionally include one or more conserved regions, such as a primer binding region or a sequencing adapter, that are conserved between different aptamer(s) 56.
[0060] Accordingly, once the protein(s) 54 is complexed with the aptamer(s) 56 and the capture oligonucleotide(s) 60, a non-binding region of the aptamer(s) 56 may be positioned in sufficient proximity to a portion of the capture oligonucleotide(s) 60 to permit covalent linking (e g., proximity ligation 62) using a ligase 62 to form the ligated oligonucleotide(s) 64 as described in FIG. 2. Chemical ligation may additionally or alternatively be used to form the ligated oligonucleotide(s) 64. A synthetic adenine (A) may be added to the 5’ end of the capture oligonucleotide(s) 60 to facilitate ligation 62 (e.g., covalent linking) using an enzyme (e.g., Thermostable 5'App DNA / RNA Ligase) reaction with the non-binding region of the aptamer(s) 56. The 5’ end may be modified before or after complex formation. For example, the capture oligonucleotide(s) 60 may, in an embodiment, be provided with pre-modified adenine. It should be noted that covalent linking of the capture oligonucleotide(s) 60 to the aptamer(s) 56 is not limited to ligation. In some embodiments, proximity-based covalent linking of the capture oligonucleotide(s) 60 to the aptamer(s) 56 may be performed using chemical ligation, click chemistry, or proximity extension.
[0061] It should be noted that the ligated oligonucleotide(s) 64 may be immobilized via the solid support(s) 58, and as such, the ligated oligonucleotide(s) 64 may be isolated using techniques as described in FIG. 2. As such, the isolated, immobilized ligated oligonucleotide(s) 64 includes the analyte-binding region 57, the non-binding region 59, and the capture oligonucleotide(s) 60. As discussed, the capture oligonucleotide(s) 60 may have aconserved sequence. Thus, the ligated oligonucleotide(s) 64 may be partially variable and partially conserved.
[0062] The association of the capture oligonucleotide(s) 60 to the protein(s) 54 can occur prior to or concurrently with the addition of the aptamer(s) 56 to the protein(s) 54 or after the addition of the aptamer(s) 56 to the protein(s) 54. In this way, the techniques described herein advantageously enable a one-step capture step by leveraging different techniques to capture analytes and form the ligated oligonucleotide(s) 64.
[0063] With the preceding in mind, FIG. 4. is a schematic illustration of example different aptamer(s) 56 and example different capture oligonucleotide(s) 60. The illustrated examples show different arrangements of conserved and / or variable regions that may be present. The structure of the aptamer(s) 56 may include the analyte-binding region 57 and the non-binding region 59 (e.g., universal primer 1 70 and aptamer identification (ID) sequence 72). Three examples of the aptamer(s) 56 are illustrated (e.g., aptamer(s) 56a, aptamer(s) 56b, aptamer(s) 56c (or collectively 56a-c)). In general, each individual aptamer(s) 56a-c is specific to an individual protein(s) 54 (as illustrated in FIGs. 2 and 3) via the analyte-binding region 57 (e.g., analyte-binding region a 57a, analyte-binding region b 57b, analyte-binding region c 57c, or collectively, analyte-binding region 57a-c). In general, the analyte-binding region 57 exhibits high affinity for a specific protein(s) 54 in a sample 52. Accordingly, each aptamer(s) 56a-c may associate (e.g., bind) with its respective different protein(s) 54 via the analyte-binding region a-c 56a-c to form the complex (e.g., analyte-aptamer complex and / or analyte-aptamer- capture oligonucleotide complex. Thus, each of the analyte-binding regions 57 may have different nucleotide sequences relative to one another. In the illustrated example, the different aptamer(s) 56 may be part of an aptamer-based assay as discussed herein. It should be understood that an aptamer-based assay may include one or more different aptamers (e.g., with respective different analyte-binding regions 57), and the illustrated three aptamer(s) 56 are by way of example. An aptamer-based assay may include at least 10 different aptamers, at least 50 different aptamers, at least 100 different aptamers, at least 1000 different aptamers, at least5000 different aptamers, at least 100,000 different aptamers, or at least 1,000,000 different aptamers, in embodiments.
[0064] The non-binding region 59 of the aptamer(s) 56 does not bind to the protein(s) 54 and / or does not significantly impact binding affinity of the analyte-binding region 57, and as such, the sequence of the non-binding region 59 may be selected to avoid interaction with the protein(s) 54. The non-binding region 59 may be used as a proxy for detection of the aptamer(s) 56 binding to a respective protein(s) 54. Accordingly, the non-binding region 59 may include a bar code or aptamer identification (ID) sequence 72 (e.g., aptamer a ID 72a, aptamer b ID 72b, aptamer c ID 72c, or collectively aptamer ID sequence 72) to detect an aptamer-analyte interaction. Each aptamer ID sequence 72 is selected to be uniquely associated with an individual aptamer(s) 56. Accordingly, the non-binding region 59 can include a bar code or aptamer ID sequence 72 that is unique to the individual aptamer(s) 56. Thus, different aptamers 56 are associated with respective different aptamer ID sequences 72 that are all different from one another and are uniquely identifying. In an embodiment, uniquely identifying sequences are uniquely identifying while accounting for barcode errors (e.g., a 1-2 nucleotide sequence error) during sequencing. Further, the aptamer ID sequence 72 may be designed such that the aptamer ID sequence 72 is different from the aptamer sequence. In an embodiment, the identification sequence may be 10-50 bases in length.
[0065] To facilitate detection, the non-binding region 59 may also include the universal primer region 1 70. Universal primer 1 70 region is conserved throughout the aptamer(s) 56. In this way, the amplification may be used as preparation of a sequencing library for sequencing using a single universal primer that binds to the universal primer 1 region 70.
[0066] The capture oligonucleotide(s) 60 may include a sample ID sequence 74 (e.g., sample ID sequence 74 a, sample ID sequence 74 b, sample ID sequence 74 c, or collectively sample ID sequence 74 a-c), a universal primer 2 76, and a functional group (e.g., cross-linking moiety) (e.g., functional group 80, functional group 82, functional group 84). Accordingly, three examples of capture oligonucleotide(s) 60 are illustrated (e.g., capture oligonucleotide(s) 60a, capture oligonucleotide(s) 60b, capture oligonucleotide(s) 60c (or collectively captureoligonucleotide(s) 60a-c)). However, it should be illustrated that more or fewer functional groups may be present. The sample ID sequence 74 may be a sequence that is associated with one particular sample 52 (see FIG. 2) and that is present on all capture oligonucleotides 60 used in conjunction with the particular sample 52. It should be noted that the sample ID sequence 74 enables pooling multiple samples on a flow cell at once. Different samples 52 may be associated with different sample ID sequences 74.
[0067] In the illustrated example, the capture oligonucleotide(s) 60 all have an identical sequence to one another (e.g., are conserved), and differ only by their functional group 80, functional group 82, and functional group 84. In general, one portion (e.g., an end) of the capture oligonucleotide(s) 60a-c may be attached to the functional group. For a particular sample 52, capture oligonucleotide(s) 60a-c may include a unique functional group to facilitate an interaction with an available amino acid of the protein(s) 54. For example, the capture oligonucleotide(s) 60a may be functionalized with functional group 80, which may be an oxaziridine group that can selectively bind to available methionine groups of the protein(s) 54. In another example, the capture oligonucleotide(s) 60b may include functional group 82, which may be a succinyl group that can selectively bind to available lysine groups of the protein(s) 54. In the following example, the capture oligonucleotide(s) 60c may include functional group 84, which may be a maleimide group that can selectively bind to available cysteine groups of the protein(s) 54. However, these functional groups are disclosed by way of example, and other functional groups are also contemplated (see FIG. 7). In short, the functional group 80, functional group 82, and functional group 84 may be chosen to mediate the interaction between the functional group of the capture oligonucleotide(s) 60 and the amino acids of the protein(s) 54 in a manner that is non-specific to particular locations on the proteins 54 relative to one another but that, depending on the functional group 80, functional group 82, and functional group 84, targets a particular amino acid.
[0068] The sample ID sequence 74 a-74c does not bind to the protein(s) 54, and as such, the sequence of the sample ID sequence 74 a-74c is selected to avoid interaction with the protein(s) 54. The sample ID sequence 74 a-74c may be used as a proxy for detection of captureoligonucleotide(s) 60 covalently linking with the aptamer(s) 56. Accordingly, the sample ID sequence 74 a-74c may include a bar code or identification sequence (e.g., sample ID sequence 74 a, sample ID sequence 74 b, sample ID sequence 74 c) to detect the ligated oligonucleotide(s) 64 upon ligation with the aptamer(s) 56.
[0069] To facilitate detection, the capture oligonucleotide(s) 60 may also include the universal primer region 2 76 that flanks the identification e.g., sample ID sequence 74 a, sample ID sequence 74 b, sample ID sequence 74 c) such that amplification of the ligated oligonucleotide(s) 64 using primers will amplify the identification sequence (e.g., sample ID sequence 74 a, sample ID sequence 74 b, sample ID sequence 74 c) of the respective capture oligonucleotide(s) 60. The sequence of the universal primer 2 76 region may be conserved in the capture oligonucleotide(s) 60 relative to one another. It should be noted that universal primer 1 70 and universal primer 2 76 are adapter sequences and may range from about 12 to about 100 nucleotides.
[0070] In some embodiments, the sequence arrangement of the capture oligonucleotide(s) 60 may include a linker sequence 67. The linker sequence may be a short or long linker to facilitate ligation between the aptamer(s) 56 and capture oligonucleotide(s) 60. For example, linkers may include nucleotide linkers, polyethylene glycol (PEG) linkers, poly T bases, poly A bases, etc. In one embodiment, linker sequence 67 including nucleotide bases may range from about 1 to about 30 nucleotides. In another embodiment, linker sequences 67 including PEG linkers may be about 25 carbons long. It should be noted that the linker sequence 67 is compatible with the functional group 80.
[0071] With the foregoing in mind, FIG. 5 is a schematic illustration of an example aptamer ligated to a capture oligonucleotide(s) 60 to form a contiguous amplification template. In the illustrated example, the contiguous amplification template is the ligated oligonucleotide(s) 64 of FIGs. 2 and 3. It should be noted that the relative arrangement of the functional group 80 and analyte-binding region a 57a can be exchanged, such that the functional group 80 may be 5’ or 3’ relative to the analyte-binding region a 57a. Furthermore, it should be noted that while the solid support(s) 58 of FIGs. 2 and 3 is not illustrated, formation of the ligatedoligonucleotide(s) 64 may occur such that one end (e.g., a portion of the aptamer(s) 56 is immobilized to the solid support(s) 58, thereby rendering the ligated oligonucleotide(s) 64 immobilized. Accordingly, detection of the ligated oligonucleotide(s) 64 may begin with the addition of primers that are complementary to the universal primer 1 70 and universal primer 2 76 to generate amplification product 101.
[0072] In the illustrated example, the ligated oligonucleotide(s) 64 includes the universal primer 1 70 and universal primer 2 76 that flank the aptamer a ID 72a and sample ID sequence 74a a such that amplification of the universal primer 1 70 and universal primer 2 76 regions using primers 102, 104 generates the amplification product 101. In some embodiments, the universal primer 2 may flank the linker sequence 67. It should be noted that this technique does not sequence the analyte-binding region a 57a.
[0073] FIGS. 6-9 show different embodiments of amplification techniques and / or ligation techniques and corresponding arrangements of the aptamer(s) 56 and the capture oligonucleotide(s) 60 that can be used to conform the generated amplification products 101 into inputs for sequencing library preparation or, in embodiments, into a sequencing library. Accordingly, the disclosed embodiments may, in embodiments, provide an advantage of incorporating one or more sequencing library preparation steps into the detection of the analyte-aptamer interactions. Further, the disclosed embodiments may permit certain steps of sequencing library preparation to be omitted or combined, thus increasing detection efficiency.
[0074] FIG. 6 is a schematic illustration of example aptamer(s) 56 arrangements including identification sequences and primer of FIGs. 4-5. It should be understood that these are by way of example, and any of the disclosed arrangements may be used in conjunction with disclosed techniques. As described above, the aptamer(s) 56 arrangement may include the analytebinding region 57 and the non-binding region 59 (e.g., universal primer 1 70 (e.g., A14) and aptamer ID sequence 72). Accordingly, it should be noted that the relative arrangement of the analyte-binding region 57 and aptamer ID sequence 72 can be exchanged, such that the analyte-binding region 57 may be 5’ or 3 ’ relative to the aptamer ID sequence 72. Furthermore, it should be noted that the universal primer 1 70 is conserved between different aptamer(s) 56.
[0075] In the illustrated example, the aptamer(s) 56 can include a minimum sequence of just the analyte-binding region 57 and the non-binding region 59 (e.g., universal primer 1 70 and aptamer ID sequence 72). The aptamer(s) 56 may include the analyte-binding region 57 at the 5’ end and the aptamer ID sequence 72 at the 3’ end of the sequence. Furthermore, the 3’ end of the aptamer(s) 56 sequence may include a free 3’ hydroxyl group (e.g., 3’OH) to facilitate ligation to the capture oligonucleotide(s) 60.
[0076] In certain embodiments, the non-binding region 59 may include some or all of a sequencing adapter sequence, e.g., sequencing adapters as disclosed herein. For example, universal primer 1 region 70 may be a sequence compatible with an Illumina sequencing platform, such as A14 or its complement.
[0077] In some embodiments, the aptamer(s) 56 may include an affinity tag (e.g., biotin tag 110). For example, the aptamer(s) 56 may have a free aldehyde at the 5’ end that can be converted to biotin. In the illustrated example, aptamer(s) 56d exhibits a biotin tag 110 at the 5’ end of the aptamer(s) 56 sequence. Accordingly, it should be noted that aptamer(s) 56 and aptamer(s) 56d may be used interchangeably. While the biotin tag 110 facilitates isolation of analyte-aptamer complexes 63 after the aptamer(s) 56 binds to the protein(s) 54 with the analyte-binding region 57, it should be noted that the biotin tag 110 may be photocleavable and can be removed.
[0078] Due to the wide, dynamic range of proteins in many biological samples, various methods may be employed, alone or in combination, to compress the dynamic range of reporters by leveraging the aptamer(s) 56 sequence. In one embodiment, a sample dilution may be performed, wherein a sample 52 is divided into multiple, diluted pools. Each pool may be incubated with a subset of the aptamer(s) 56. The pools may be subsequently combined for additional processing. This method advantageously reduces the overall protein(s) 54 concentration in each pool, thereby enabling better detection of low abundance protein(s) 54.
[0079] In another embodiment, “dummy” aptamers may be used in the one-bead capture step to selectively deplete high-abundance analytes. As referred to herein, the “dummy” aptamersrefer to aptamers(s) 56 without the affinity tag, e.g., biotin tag 110, as illustrated in FIG. 6. Accordingly, a mixture of aptamers may be produced, wherein the mixture of aptamers may include aptamer(s) 56d with the biotin tag 110 (e.g., standard aptamers) and aptamer(s) 56 lacking the biotin tag (e.g., dummy aptamers). The mixture of aptamers may contact various protein(s) 54 and form complexes (e.g., analyte-aptamer complexes) via the analyte-binding region 57 to a respective protein(s) 54 in solution. Subsequently, the solid supports 58 of FIGs. 2 and 3 may be provided. In this way, only the standard aptamers (e.g., aptamer(s) 56d) bind to the solid supports 58 (e.g., streptavidin-coated beads), after which they are captured and subsequently sequenced. In this way, the addition of dummy aptamers (e.g., aptamer(s) 56d) advantageously reduces the overall bead requirement and enables a lower-cost assay. Techniques for dynamic range compression as disclosed in WO2023196528A1, hereby incorporated by reference in its entirety herein, may be used in conjunction with the aptamerbased assays herein. The ration of the dummy aptamers to the tagged or standard aptamers may be adjusted based on the abundance of a particular analyte. Low abundance analytes may not have any dummy aptamers, while high abundance analytes may have ratios of dummy standard aptamers of 1 : 1 or 2: 1 or more.
[0080] In some embodiments, dummy aptamers may also be generated by modifying the end of the sequence needed for ligation and amplification. For example, aptamer(s) 56d (or aptamer(s) 56) may be modified such that the aptamers are generated with and without the 3’ sequence (e.g., free 3’ hydroxyl group) that permits covalent interaction with the capture oligonucleotide(s) 60. In this way, the techniques described herein enable dynamic range compression of reporters.
[0081] FIG. 7 is a schematic illustration of an example capture oligonucleotide(s) 60 arrangement. It should be understood that these are by way of example, and any of the disclosed arrangements may be used in conjunction with disclosed techniques. As described above, the capture oligonucleotide(s) 60 arrangement may include the sample ID sequence 74, the universal primer 2 76, the functional group, and the A-tail 150 (e g., synthetic adenine 5’ (A) tail). It should be noted that the relative arrangement of the A-tail 150 and the functionalgroup can be exchanged, such that the A-tail may be 5’ or 3’ relative to the functional group. Furthermore, it should be noted that the universal primer 2 76 is conserved between capture oligonucleotide(s) 60.
[0082] In some embodiments, the capture oligonucleotide(s) 60 can include a minimum sequence of just the sample identification (ID) sequence 74, the universal primer 76, and the functional group 151 (e.g., functional group 80, functional group 82, functional group 84). In the illustrated example, the capture oligonucleotide(s) 60 can include a minimum sequence of just the sample ID sequence 74, the universal primer 76, the functional group 151, and the A- tail 150. For example, the capture oligonucleotide(s) 60 may, in an embodiment, be provided to protein(s) 54 with pre-modified A-tail 150. In another embodiment, A tailing may occur after the capture oligonucleotide(s) 60 associates with a protein(s) 54 in a stochastic manner as discussed herein. In the illustrated example, the A-tail 150 is added to the 5’ end of the capture oligonucleotide(s) 60 to facilitate ligation 62 (e.g., covalent linking) using an enzyme (e.g., Thermostable 5'App DNA / RNA Ligase) reaction with the non-binding region of the aptamer(s) 56 (or aptamer(s) 56d) to form the ligated oligonucleotide(s) 64.
[0083] The functional group 151 permits association of the capture oligonucleotide(s) 60 to the protein(s) 54. Accordingly, the functional group 151 may be chosen to permit a particular interaction between the functional group and one or more amino acids of the protein(s) 54. For example, the functional group 151 may be an oxaziridine group such that the capture oligonucleotide(s) 60 can bind to available methionine groups of the protein(s) 54. Additional modifications of the functional group 151 include, but are not limited to, succinyl groups (e.g., binds to available lysine groups), (N-hydroxysuccinimide) NHS ester (e.g., binds to available lysine groups), pyridinium (e.g., binds to available lysine groups), maleimide groups (e g., binds to available cysteine groups), methylene prryolone (e.g., binds to available cysteine groups), sulfone pyridinium (e.g., binds to available cysteine groups), pyridinium (e.g., binds to available cysteine groups), chlorooxime (e.g., binds to available cysteine groups), cyclohexenone groups (e.g., binds to histidine groups), glyoxal groups or guanidinium groups (e.g., binds to arginine groups), or carbodiimide (e.g., l-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC)) groups (e.g., binds to aspartic acid groups and glutamic acid groups). Furthermore, it should be noted that the functional group 151 retains functionality under biological conditions (e.g., pH ~7) to ensure protein(s) 54 integrity during the process. Accordingly, the functional group 151 may be chosen to permit the interaction between the functional group 151 of the capture oligonucleotide(s) 60 and any of the amino acids associated with protein(s) 54. It should be noted that the capture oligonucleotide(s) 60 may be relatively fast to cross-link with the amino acids associated with protein(s) 54 in solution. Additional examples of amino acids that may be modified may include, but are not limited to, tyrosine residues, tryptophan residues, and the like. It should be noted that examples provided herein are meant to be non-limiting. Any suitable amino acids may be modified using conjugation chemistry reactions as known to one of ordinary skill in the art, examples of which may be found in “Residue-Specific Peptide Modification: A Chemist’s Guide” by Justine N. DeGruyter, Lara R. Malins, and Phil S. Baran, published by Biochemistry, 2017, 56, 3863- 3873, which is hereby incorporated by reference in its entirety.
[0084] By way of example, FIG. 8 is a schematic illustration of amplification using a ligated aptamer-capture oligonucleotides (e.g., ligated oligonucleotide(s) 64) as template to generate a library for sequencing. It should be understood that these are by way of example, and any of the disclosed arrangements may be used in conjunction with disclosed techniques. In the illustrated example, the contiguous amplification template is the ligated oligonucleotide(s) 64 of FIGs. 2 and 3. It should be noted that the relative arrangement of the functional group 151 and the biotin tag 110 can be exchanged, such that the functional group 151 may be 5’ or 3’ relative to the biotin tag 110. Furthermore, it should be noted that while the solid support(s) 58 of FIGs. 2 and 3 is not illustrated, formation of the ligated oligonucleotide(s) 64 may occur such that one end (e.g., a portion of the aptamer(s) 56 is immobilized to the solid support(s) 58, thereby rendering the ligated oligonucleotide(s) 64 immobilized. For example, the solid support(s) 58 may be bound to the biotin tag 110 (e.g., via a streptavidin-biotin interaction) at the 5’ end of the ligated oligonucleotide(s) 64 sequence.
[0085] In general, the ligated oligonucleotide(s) 64 may include regions that are partially variable and conserved to facilitate amplification. Accordingly, detection of the ligated oligonucleotide(s) 64 may begin with the addition of primers 102 and 104 that are complementary to the conserved regions of the ligated oligonucleotide(s) 64 (e.g., universal primer 1 70 and universal primer 2 76). In the illustrated example, the ligated oligonucleotide(s) 64 includes the universal primer 1 70 and universal primer 2 76 that flank the aptamer ID sequence 72 and sample ID sequence 74 such that amplification of the universal primer 1 70 and universal primer 2 76 regions using primers 102, 104 generates the amplification product 101.
[0086] FIGs. 9-11 illustrate attachment of capture oligonucleotides to analytes. It should be noted that while the illustrated embodiments depict the protein agnostic attachment of capture oligonucleotides to the analytes, in some embodiments, aptamers may be bound to the analytes as well, which may also affect the attachment process of the capture oligonucleotide to the analytes. By way of example, FIG. 9 shows attachment of capture oligonucleotides to an analyte via cross-linking to available cysteines in the analyte. In the illustrated example, protein(s) 54a is an individual analyte that exhibits various amino acids on its surface (e.g., alanine, cysteine, glycine, methionine, lysine). Interaction (e.g., association) between the capture oligonucleotide(s) 60a and protein(s) 54a may be mediated by modification of a portion of the capture oligonucleotide(s) 60a. For example, an end of the capture oligonucleotide(s) 60a may include functional group 84, wherein functional group 84 is a maleimide group that binds to cysteine. This permits the capture oligonucleotide(s) 60a to associate with available cysteine residues on the protein(s) 54a. In the illustrated example, two capture oligonucleotide(s) 60a interact (e.g., cross link, covalently bind) to two available cysteine residues. It should be noted that two or more capture oligonucleotide(s) 60 may bind to an individual protein(s) 54.
[0087] With the foregoing in mind, FIG. 10 shows attachment of capture oligonucleotides to different analytes via cross-linking to available amino acids in the analytes. In general, a sample 52 may include various analytes (e.g., protein(s) 54) that differentiate in their structure.In the illustrated example, protein(s) 54b and protein(s) 54c represent two different analytes within a sample 52. In particular, protein(s) 54b exhibits amino acid residues that are different relative to protein(s) 54c. Accordingly, capture oligonucleotide(s) 60 may be provided to permit association with protein(s) 54b and protein(s) 54c. In the foregoing example, a portion (e.g., an end) of the capture oligonucleotide(s) 60 may be modified with functional group 80, wherein the functional group 80 is an oxaziridine group that binds to methionine. Accordingly, capture oligonucleotide(s) 60b may associate with methionine residues on protein(s) 54b and 54c. It should be noted that although the structures of protein(s) 54b and 54c are inherently different in their structure, attachment of the capture oligonucleotide(s) 60b is facilitated by the interaction between the methionine residues on protein(s) 54b and 54c and the functional group 80. As such, the location and the number of capture oligonucleotide(s) 60b that attach to one or more protein(s) 54 (e.g., protein(s) 54b and 54c) is random as it is dependent on various factors (e.g., number of amino acid residues available, location of amino acids, supramolecular chemistry such as forces (e.g., intermolecular forces, electrostatics, steric hindrance)). Accordingly, a variety of protein(s) 54 may be attached to the capture oligonucleotide(s) 60b within a sample 52 provided that an individual protein exhibits methionine residues to interact with the functional group 80 (e.g., oxaziridine).
[0088] With the preceding in mind, FIG. 11 shows attachment of a mixture of capture oligonucleotides to different analytes via cross-linking to available amino acids in the analytes. In general, a sample 52 may include various analytes (e.g., protein(s) 54) that differentiate in their structure. In the illustrated example, protein(s) 54d and protein(s) 54e represent two different analytes within a sample 52. In particular, protein(s) 54d exhibits amino acid residues that are different relative to protein(s) 54e. Accordingly, a mixture of capture oligonucleotide(s) 60 may be provided to permit association with protein(s) 54d and protein(s) 54e. For example, the mixture may include the capture oligonucleotide(s) 60a with functional group 84, wherein functional group 84 is a maleimide group that binds to cysteine residues. The mixture may also include the capture oligonucleotide(s) 60b with functional group 80, wherein functional group 80 is an oxaziridine group that binds to methionine residues. The mixture may further include capture oligonucleotide(s) 60c with functional group 82, whereinfunctional group 82 is a succinyl group that binds to lysine residues. The mixture may also include capture oligonucleotide(s) 60d with functional group 80a, wherein functional group 80a is a carbodiimide group (e.g., EDC) that binds to aspartic acid. Accordingly, the mixture of capture oligonucleotide(s) 60 may be provided to the sample 52 such that the capture oligonucleotide(s) 60a, capture oligonucleotide(s) 60b, capture oligonucleotide(s) 60c, and capture oligonucleotide(s) 60d can attach to their respective amino acid on protein(s) 54d and protein(s) 54e via their respective functional groups. In the illustrated examples, capture oligonucleotide(s) 60 attach to protein(s) 54d and protein(s) 54e via the interaction functional groups (e.g., cross-linking, covalent) to their respective amino acid residues. In this way, providing a mixture of capture oligonucleotide(s) 60 advantageously enables sampling of a variety of analytes within a sample. Furthermore, this increases the likelihood of detecting an aptamer-analyte complex as contacting analytes to a mixture of capture oligonucleotide(s) 60 allows a variety of functional group-amino acid interactions to be probed.
[0089] FIG. 12 shows an example sequencing workflow 200 using an analyte detection workflow with analyte modification, in accordance with aspects of the present disclosure. The workflow 200 may include a sample 52, wherein the sample 52 may include one or more sample analytes, e.g., protein(s) 54. It should be understood that the single illustrated protein(s) 54 is by way of example, and the illustrated workflow may apply to the pool of analytes present in the sample to facilitate pooling samples together. Furthermore, it should be noted that the example workflow 200 shown in FIG. 12 is not limiting, and the workflow 200 may include additional or fewer steps than those illustrated. Further, the workflow 200 may include steps that are performed in an alternative order to that illustrated. That is, certain steps may be performed before, after, or concurrently to / with another respective step.
[0090] The illustrated one-bead capture step may begin with similar steps as described in FIGs. 2 and 3 by contacting aptamer(s) 56 and capture oligonucleotide(s) 60 with the protein(s) 54 under conditions that permit formation of analyte-aptamer-capture oligonucleotide complexes 63. The aptamer(s) 56 may include one or more non-binding regions 59 and an analyte-binding region 57, wherein the analyte-binding region 57 exhibits a high affinity forthe protein(s) 54. Accordingly, the analyte-binding region 57 of the aptamer(s) 56 may enable the formation of an aptamer-analyte complex. In some embodiments, a portion, e.g., an end, of the aptamer(s) 56 may be modified to include the biotin tag 110 to permit interaction between solid support(s) 58 and the biotin tag 110. Accordingly, it should be noted that while the solid support(s) 58 is not depicted in the illustrated example, in some embodiments, the biotin tag 110 may be bound to the solid support(s) to facilitate removal of protein(s) 54 not associated with aptamer(s) 56 via a washing step. Relatedly, the capture oligonucleotide(s) 60 may include the functional group 151 (e.g., functional group 80, functional group 82, functional group 84) to permit attachment of the capture oligonucleotide(s) 60 the protein(s) 54. It should be noted that one or more, two or more, or three or more capture oligonucleotide(s) 60 may associate with one protein(s) 54 such that each individual capture protein(s) 54 is associated with one or more capture oligonucleotide(s) 60. Furthermore, it should be noted that the workflow 200 may be adapted to a flow cell.
[0091] In some embodiments, non-specific oligonucleotide blockers 202 may be provided to the analyte-aptamer-capture oligonucleotide complexes 63. In general, the non-specific oligonucleotide blockers 202 reduce background from aptamer(s) 56 binding to non-cognate proteins.
[0092] In some embodiments, capture oligonucleotide(s) 60 may be provided in excess amounts to the analytes in solution. Accordingly, quenchers 204 may be provided to the analyte-aptamer-capture oligonucleotide complexes 63 in solution to bind to the capture oligonucleotide(s) 60 that are unbound (i.e., did not undergo attachment to the protein(s) 54), which may facilitate pooling samples together. For example, the quenchers 204 may include free amino acids (e.g., lysine, methionine, cysteine) that bind to the functional group 151 of the capture oligonucleotide(s) 60, thereby preventing the capture oligonucleotide(s) 60 to undergo attachment with analytes in solution. Accordingly, the addition of quenchers 204 reduces the risk of cross contamination prior to pooling samples 52. It should be noted that the quenchers 204 are optional and may be utilized depending on the type of workflow.
[0093] One or more samples 52 may be pooled after the addition of the quenchers 204 and analyte modification with the capture oligonucleotide(s) 60 may be performed on the pool of protein(s) 54 present in the sample 52. Once the protein(s) 54 is complexed with the aptamer(s) 56 and the capture oligonucleotide(s) 60, a non-binding region of the aptamer(s) 56 may be positioned in sufficient proximity to a portion of the capture oligonucleotide(s) 60 to permit covalent linking (e.g., proximity ligation) using a ligase 62 as described in FIGs. 2 and 3. A synthetic adenine (A) tail (e.g., 5’ App) may be added to the 5’ end of the capture oligonucleotide(s) 60 to facilitate ligation 62 (e.g., covalent linking) using an enzyme (e.g., Thermostable 5'App DNA / RNA Ligase) reaction with the non-binding region of the aptamer(s) 56. The A-tail may be added before or after complex formation. For example, the capture oligonucleotide(s) 60 may, in an embodiment, be provided with pre-modified A tails. In another embodiment, A tailing may occur after formation of the aptamer-analyte-capture oligonucleotide complexes 63. While the illustrated example shows ligation, it should be noted that covalent linking of the capture oligonucleotide(s) 60 to the aptamer(s) 56 is not limited to ligation. In some embodiments, proximity-based covalent linking of the capture oligonucleotide(s) 60 to the aptamer(s) 56 may be performed using click chemistry or proximity extension. Accordingly, ligating an end of the capture oligonucleotide(s) 60 to the aptamer(s) 56 generates ligated oligonucleotide(s) 64 (e.g., ligated nucleic acid product), wherein the ligated oligonucleotide(s) 64 may be formed in a way such that one end of may be immobilized on the solid support(s) 58 and attached to the protein(s) 54. As such, the isolated, immobilized ligated oligonucleotide(s) 64 includes the analyte-binding region 57, the non-binding region 59, and the capture oligonucleotide(s) 60 (e.g., sample ID sequence 74, the universal primer 76, and the functional group 151). In particular, it should be noted that each capture oligonucleotide(s) 60 includes a unique sample ID sequence 74 to facilitate detection of the analyte-aptamer complex. Furthermore, the capture oligonucleotide(s) 60 may have a conserved sequence (e.g., universal primer 76). Thus, the ligated oligonucleotide(s) 64 may be partially variable and partially conserved.
[0094] In some embodiments, quenchers 204 may be provided after the formation of the ligated oligonucleotide(s) 64. For example, once the protein(s) 54 is complexed with theaptamer(s) 56 and the capture oligonucleotide(s) 60, a non-binding region of the aptamer(s) 56 may be positioned in sufficient proximity to a portion of the capture oligonucleotide(s) 60 to permit covalent linking (e.g., proximity ligation) to form the ligated oligonucleotide(s) 64. One or more samples may be pooled and quenchers 204 may be added to bind to the capture oligonucleotide(s) 60 that are unbound (i.e., did not undergo attachment to the protein(s) 54). In this way, the quenchers 204 may be added at various stages during a workflow.
[0095] The ligated oligonucleotide(s) 64 associated with the solid support(s) 58 and protein(s) 54 may be isolated / separated by one or more techniques. In an embodiment, the solid support(s) 58 is a magnetic bead, and the beads may be magnetically pulled down and washed to separate unbound elements from the bead and associated ligated oligonucleotide(s) 64. In certain embodiments, the protein(s) 54 may be removed prior to subsequent detection steps. For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitate degradation of the protein(s) 54. In other embodiments, heat, chemical degradation, or may be used for the degradation of the sample protein(s).
[0096] The ligated oligonucleotide(s) 64 may be amplified and / or sequenced to identify analytes present in the sample. For example, on-bead index polymerase chain reaction (PCR) techniques may be used for ligated oligonucleotide(s) 64 immobilized on the solid support(s) 58 for amplification and downstream sequencing to identify the individual aptamer(s) 56 that bound to the individual protein(s) 54 in solution.
[0097] With the preceding in mind, FIG. 13 shows an example sequencing workflow 250 using an analyte detection workflow with analyte modification. In the illustrated workflow, index sequencing techniques may be used to allow multiple libraries to be pooled and sequenced together, thereby enabling detection of aptamer-analyte interactions. As described in FIGs. 2 and 3, the workflow 250 may include a sample 52, wherein the sample 52 may include one or more sample analytes, e.g., protein(s) 54. It should be understood that the single illustrated protein(s) 54 is by way of example, and the illustrated workflow may apply to the pool of analytes present in the sample. The illustrated one-bead capture step may begin by contacting aptamer(s) 56 with the protein(s) 54 under conditions that permit formation ofanalyte-aptamer complexes 61. The aptamer(s) 56 may include one or more non-binding regions 59 and an analyte-binding region 57, wherein the analyte-binding region 57 exhibits a high affinity for the protein(s) 54. Furthermore, it should be noted that the example workflow 250 shown in FIG. 13 is not limiting, and the workflow 250 may include additional or fewer steps than those illustrated. Further, the workflow 250 may include steps that are performed in an alternative order to that illustrated. That is, certain steps may be performed before, after, or concurrently to / with another respective step.
[0098] Accordingly, the analyte-binding region 57 of the aptamer(s) 56 may enable the formation of an aptamer-analyte complex 61. In some embodiments, a portion, e.g., an end, of the aptamer(s) 56 may be modified to include a tag (e.g., biotin tag 110). This enables the addition of solid support(s) 58 (e.g., capture bead (e.g., streptavidin-coated beads)) to the solution to select for the aptamer-analyte complex. For example, a streptavidin coated bead may bind to the portion of the aptamer(s) 56 including a biotin tag. In this way, protein(s) 54 not associated with aptamer(s) 56 may be removed via a washing step. However, in some embodiments, the aptamer(s) 56 may be pre-associated with the solid support(s) 58 before contact with the analytes. As such, the aptamer-analyte complex 61 may or may not include the solid support(s) 58.
[0099] Subsequently, capture oligonucleotide(s) 60e (e.g., protein-labeling oligonucleotide(s)) may associate with the aptamer-analyte complex 61 to form an aptameranalyte-capture oligonucleotide complex 63. In general, the capture oligonucleotide(s) 60e may include the sample ID sequence 74, the universal primer 2 76, the functional group 151. For example, a portion (e.g. one end) of the capture oligonucleotide(s) 60e may be modified to include a functional group 151 to facilitate an interaction (e.g., cross-linking, covalent interactions) with amino acid(s) of the protein(s) 54. In the illustrated example, a portion of the sequence of the capture oligonucleotide(s) 60e may be modified to include an index sequence 252. It should be noted that the relative arrangement of the index sequence 252 and functional group 151 can be exchanged, such that the functional group 151 may be 5’ or 3’relative to the index sequence 252. In this way, modification of the capture oligonucleotide(s) 60e such that it includes the index sequence 252 permits samples to be indexed early.
[0100] Accordingly, the analyte modification with the capture oligonucleotide(s) 60e may be performed on the pool of protein(s) 54 present in the sample 52. Thus, in embodiments, the capture oligonucleotide(s) 60 may all have a same sequence relative to one another, even when associated with different protein(s) 54. The samples 52 may be pooled and loaded into a flow cell 254.
[0101] As described in FIGs. 2 and 3, protein(s) 54 not associated with aptamer(s) 56 may be removed via a washing step. For example, a portion, e.g., an end, of the aptamer(s) 56 may be modified to include a tag (e.g., biotin tag), which enables the addition of solid support(s) 58 (e.g., capture bead (e.g., streptavidin-coated beads)) to the solution to select for the aptameranalyte complex. A streptavidin coated bead may bind to the portion of the aptamer(s) 56 including a biotin tag and select for the aptamer-analyte-capture oligonucleotide complex 63. The aptamer-analyte-capture oligonucleotide complex 63 may remain immobilized on the solid support(s) 58. In some embodiments, the aptamer(s) 56 may be pre-associated with the solid support(s) 58 before contact with the analytes. As such, the aptamer-analyte-capture oligonucleotide complex 63 may or may not include the solid support(s) 58.
[0102] The aptamer-analyte-capture oligonucleotide complex 63 may be subsequently challenged. For example, a non-specific aptamer or compound may be provided to reduce any non-specific interactions between aptamers and proteins.
[0103] Once the protein(s) 54 is complexed with the aptamer(s) 56 and the capture oligonucleotide(s) 60e, a non-binding region of the aptamer(s) 56 may be positioned in sufficient proximity to a portion of the capture oligonucleotide(s) 60e to permit covalent linking (e.g., proximity ligation) to form a ligated oligonucleotide 64a and a ligated oligonucleotide 64b. As described above, an A tail may be added to the 5’ end of the capture oligonucleotide(s) 60e to facilitate ligation using an enzyme (e.g., Thermostable 5'App DNA / RNA Ligase) reaction with the non-binding region of the aptamer(s) 56. It should benoted that covalent linking of the capture oligonucleotide(s) 60e is not limited to ligation and other techniques such as proximity-based extension or click chemistry may also be used. Furthermore, it should be noted that the index sequences 252 is unique to ligated oligonucleotide 64 (or capture oligonucleotide(s) 60). Accordingly, the ligated oligonucleotide 64a may include an index sequence 252a that is different from the index sequence 252b within the ligated oligonucleotide 64b.
[0104] The protein(s) 54 may be removed prior to subsequent detection steps (e.g., clustering and sequencing). For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitate degradation of the protein(s) 54. In other embodiments, heat, chemical degradation, or may be used for the degradation of the sample protein(s). The ligated oligonucleotide 64a and ligated oligonucleotide 64b may be amplified to generate amplification product 101a and amplification product 101b and undergo clustering and sequencing using the sequencing device 500 for detection. In general, the workflow 250 reduces complexity by focusing on a targeted panel and requires no additional equipment. The disclosed techniques described herein may reduce complexity by eliminating capture steps in proteomic detection and by combining the protein capture and reporter formation steps.
[0105] The techniques described herein also provide additional advantages such as automation improvements, facilitating a more streamlined process, and decreasing assay costs. The CAPL assay, as described herein, may be performed without a thermal magnetic shaker (TMS) and an ultraviolet-visible (UV) station, thereby allowing miniaturization of the assay into a 384-well format. For example, “dummy” aptamers may be used to facilitate the miniaturization of the assay by reducing the number of streptavidin beads needed for capturing target analytes as described above in FIG. 6. While standard aptamers with biotin tags will be used for capturing analytes, the presence of the “dummy” aptamers that lack the biotin tag enables a significant decrease in the overall bead requirement and translates to a more streamlined and potentially lower-cost assay format. Furthermore, the CAPL assay enables the use of desktop sequencers, which can target hundreds to thousands of proteins, instead of 10,000+ in discovery, which can be seen below in FIG. 14.
[0106] By way of example, FIG. 14 shows an exemplary graph illustrating quantification of small panels using an example analyte detection workflow of FIG. 13. The methods described herein enable about 100 to about 1000 protein panels with about a 3-hour workflow.
[0107] FIG. 15 is an example analyte detection workflow 300 with analyte modification. FIG. 16 is a schematic illustration of a reactive handle 310 that can be used to modify analytes as provided herein to link analytes to capture oligonucleotides. To facilitate discussion, FIGS. 15 and 16 will be discussed concurrently below. It should be noted that the example workflow 300 shown in FIG. 15 is not limiting, and the workflow 300 may include additional or fewer steps than those illustrated. Further, the workflow 300 may include steps that are performed in an alternative order to that illustrated. That is, certain steps may be performed before, after, or concurrently to / with another respective step.
[0108] The workflow 300 may include a sample 52 which may include one or more sample analytes (e.g., protein(s) 54). It should be understood that the single illustrated protein(s) 54 is by way of example, and the illustrated workflow may apply to the pool of different analytes present in the sample 52. In the illustrated example, the protein(s) 54 is an individual analyte that exhibits various amino acids (e.g., amino acid 302, amino acid 304, amino acid 306, or collectively amino acids 302) on its surface (e.g., alanine, cysteine, glycine, methionine, lysine). It should be noted that in the illustrated diagram, amino acid 302, amino acid 304, and amino acid 306 represent different types of amino acids. In any case, a reactive handle 310 may be provided to the protein(s) 54 to permit interaction between the reactive handle 310 and form labeled proteins 305, as demonstrated in FIG. 15 at step 301.
[0109] In general, the reactive handle 310 (e.g., reactive handle 316, reactive handle 318, or collectively reactive handle 310) is one or more molecules (e.g., functional groups) molecule that exhibits a protein reactive group 312 (e.g., protein reactive group 320, protein reactive group 322, or collectively, protein reactive group 312) and an oligomer reactive group 314. As described herein, the protein reactive group 312 is a functional group that is capable of interacting with a corresponding amino acid 302 on the surface of the protein(s) 54. That is, the protein reactive group 312 may interact (e.g., bind, bond, cross-link) to available aminoacids 302 residues that are reactive to the protein reactive groups 312. At step 301, a variety of a reactive handles 310 are provided (e.g., reactive handle 312, reactive handle 316, reactive handle 318) in the reaction environment. Each reactive handle 310 may have a different protein reactive group 312 that is a unique protein reactive group that can selectively bind to a corresponding amino acid 302 residue. For example, reactive handle 310 may include protein reactive group 312 that may interact with amino acid 306, reactive handle 316 may include protein reactive group 320 that may interact with amino acid 302, and reactive handle 318 may include protein reactive group 322 that may interact with amino acid 306. It should be noted that the location and the number of capture reactive handles 310 that attach to one or more amino acids 302 of the protein(s) 54 via the protein reactive group 312 is random as it is dependent on various factors (e.g., number of amino acid residues available, location of amino acids, supramolecular chemistry such as forces (e.g., intermolecular forces, electrostatics, steric hindrance)). It should be understood that, in certain cases, structures of the disclosed protein reactive group 312 and the oligomer reactive group 314 may be exchanged. That is, the disclosed examples or structures of the protein reactive group 312 may be present on the universal oligonucleotides 330 while the oligo reactive group 314 may instead be present on the proteins. Further, in some cases the protein reactive group 312 and the oligomer reactive group 314 may have a same structure capable of cross-linking or reactive with one another to form a bond.
[0110] Examples of the protein reactive groups 312 are shown in FIG. 16. For example, the protein reactive group 312 may be a NHS ester group 340 (e.g., binds to lysine residues), sulfonyl acrylate group 342 (e.g., binds to lysine residues), pyridinium group 344 (e.g., binds to lysine residues), sulfone pyridinium group 346 (e.g., binds to cysteine residues), chlorooxime group 348 (e.g., binds to cysteine residues), oxaziridine group 350 (e.g., binds to methionine groups). It should be noted that a pool of reactive handles 310 with a variety of protein reactive groups 312 may be provided to a pool of analytes to target various amino acid 302 residues on the proteins 54. In any case, interaction (e.g., association) between the reactive handle 310 and amino acids 302 of the protein(s) 54 may be mediated by modification via the protein reactive group 312.
[0111] At step 303, universal oligomer(s) 330 may be provided. In the illustrated diagram, the universal oligomer 330 includes a universal (conserved) sequence 334. For example, the universal sequence 334 may be an adapter sequence compatible with an Illumina sequencing platform, (e.g., A14, Bl 5, or its complement). In certain embodiments, the universal oligomer 330 may also include a linker 311 (e.g., polyethylene glycol (PEG) linker) in between the complementary end 332 and the universal sequence 334. It should be noted that the linker 311 is optional. In the illustrated diagram, the universal sequence 334 is a B 15 sequence that is conserved between all oligomers 330. The universal oligomer(s) 330 also includes a complementary end 332. The complementary end 332 may react (e.g., interact, bind) with the oligomer reactive group 314 of the reactive handle 310 to form capture oligonucleotide(s) 351 (e.g., capture oligonucleotide(s) 60). In general, the oligomer reactive group 314 may be a functional group that is capable of interacting (e.g., binding or reacting) with the complementary end 332 of the universal oligomer 330. In the illustrated diagram, each reactive handle 312 may have the same oligomer reactive group 314, thereby enabling the use of the universal oligomer(s) 330. Examples of the oligomer reactive group 314 of the reactive handles 310 are illustrated in FIG. 16, which include, but are not limited to, tetrazine group 352, trans-cyclooctene (TCO) group 354, ester group 356, disulfide group 358, alkyne group 360. Preferably, the oligomer reactive groups 314 may be tetrazine group 352, trans- cyclooctene (TCO) group 354, and ester group 356. It should be noted that one or more oligomer reactive groups 314 may be utilized as part of the reactive handle 310. For example, a reactive handle 310 may include a tetrazine group 352 and a TCO group 354.
[0112] In certain embodiments, the protein reactive group 314 may also act as the oligomer reactive group 314. That is, a molecule selected as the protein reactive group 314 may include functional groups that can react with the complementary end 332 of the universal oligomer 330. It should be noted that any functional group of the protein reactive groups 314 and / or oligomer reactive group 314 as known to one of ordinary skill in the art may be utilized to permit further reactions with the complementary end 332 of the universal oligomer 330. For example, while sulfonyl acrylate groups 342 may be utilized to bind to lysine residues of protein(s) 54, the alkene group 343 of the sulfonyl acrylate group 342 may be utilized to reactwith the complementary end 332 of the universal oligomer 330, which is described further below in FIG. 19. In any case, the reactive handle 310 may include at least one or more molecules that are capable of reacting with both an amino acid residue of a protein(s) 54 and the universal oligomer 330. It should be noted the reactive handle 310 may be designed to include any one of the molecules (as shown in FIG. 16) and selected to act as the protein reactive group 312 and / or the oligomer reactive group 314. That is, the illustrated examples provided for protein reactive groups 312 may be interchangeable and utilized as the oligomer reactive group 314, and vice versa.
[0113] In certain embodiments, the reactive handles 310 may include linkers 311. FIG. 16 illustrates various examples where the reactive handles 310 may be modified to include a linker 311. The linker 311 may reside between the protein reactive group 312 and the oligomer reactive 314. In other embodiments, the linker 311 may reside on one or both terminal ends of the reactive handle 310. Additionally and / or alternatively, linkers 311 residing on one or both terminal ends of the reactive handle may exhibit additional functional groups capable of binding (e.g., cross-linking, covalently binding) to one or more amino acid residues. In other embodiments, a reactive handle 310 including linkers 311 on one terminal end of the reactive handle 310 may be utilized to perform pegylation between one or more amino acid residues of the protein(s) 54. Thus, in certain embodiments, the protein reactive group 312 may be a linker 311 such as a (PEG) polymer (e.g., polymer of ethylene glycol monomers) ranging from about 1 to about 20 ethylene glycol monomer units, such as about 2 to 18 monomer units, about 4 to about 16 monomer units, about 6 to about 14 monomer units, about 8 to about 12 monomer units, such as about 1, about 2, about 4, about 6, about 8, about 10, about 12, about 14, about 16, about 18, or about 20. In other embodiments, the linker 311 may be a hydrocarbon chain. It should be noted that any suitable linker 311 (e.g., available from BroadPharm, US) may be utilized as part of the reactive handle 310.
[0114] In certain embodiments, the linker 311 may be any suitable polymeric molecule (e g., PEG, hydrocarbon chains) that may include monomer units ranging from about 1 to about 20, about 1 to about 15, about 1 to about 10, about 2 to about 8, about 4 to about 8, suchas about 1, about 2, about 4, about 6, about 8, about 10, about 12, about 14, about 16, about 18, or about 20.
[0115] In FIG. 15, the oligomer reactive groups 314 of the reactive handles 310 may bind to or react with the complementary end 332 of the universal oligomer(s) 330 to generate the capture oligonucleotide(s) 351 on the protein(s) 54 (e.g., analyte-capture oligonucleotide(s) complex 65). Subsequently, at step 307, aptamer(s) 56 may be provided to permit interaction with the analyte-capture oligonucleotide complex 65 to form aptamer-analyte-capture oligonucleotide complex 63.
[0116] In this way, analyte detection may proceed with the resulting aptamer-analyte- capture oligonucleotide complexes 63, as described in FIGS. 2-3. For example, a non-binding region of the aptamer(s) 56 may be positioned in sufficient proximity to a portion of the capture oligonucleotide(s) 351 to permit covalent linking (e.g., proximity ligation 62) using a ligase 62 to form the ligated oligonucleotide(s) 64, as described in FIGS. 2 and 3. In any case, the analyte detection workflow 300 may be utilized as part of any of the disclosed techniques described herein. It should be noted analyte modification may be performed in any suitable order. That is, a workflow may include providing aptamer(s) 56 to a sample 54 of protein(s) 56, after which the reactive handles 310 and / or universal oligomer 330 (e.g., capture oligonucleotide(s) 351 / 60) may be provided to permit ligation and form analyte-capture oligonucleotide(s) complex 65.
[0117] The complementary end 332 of the universal oligomer(s) 330 may be a modified oligomer having an amino deoxynucleotide (e.g., amine group), such as those available from GeneLink™. The modification may be a 5'-, 3’-, or internal amino dA, dC, dG, and / or dT with an active amino group (NH2). In one example, the active amino group may be coupled to a 5’ phosphate group, e.g., via a carbon linker C(n).
[0118] In a specific example, amino linker C6 can be used to incorporate an active primary amino group with a six-carbon linker onto the 5'-end or 3-end of an oligonucleotide. This amino group (e.g., complementary end 332) on the oligomer 330 can then be conjugated to anNHS activated ligand present on the modified analyte 54 to link the universal oligomer(s) 330 to analytes functionalized with reactive handles 310. In one example, the amino group is separated from the 5'-end nucleotide base by a 6-carbon spacer arm to reduce steric interaction. The presence of the amine group as the complementary end 332 on the universal oligomer(s) 330 permits reaction with a variety of different ligands for affinity, reporter or protein moi eties (as NHS esters or isothiocyanates). Examples include biotin, digoxigenin, and fluorescent dyes or quenchers, magnetic beads and enzymes (for example, alkaline phosphatase). Additional examples of the complementary end 332 may include, but are not limited to, azide groups and alkyne groups such that click chemistry may be performed between the reactive handle 310 and the universal oligomer 330. In certain embodiments, the complementary end 332 may be any one of the examples of molecules illustrated of the reactive handles 310.
[0119] FIG. 17 is an example analyte detection workflow 400 with analyte modification. In certain embodiments, capture oligonucleotide(s) 60 may be utilized to label several subpopulations of recombinant protein 410 at known concentrations to generate standard curves to facilitate quantification of analytes in a sample. It should be noted that the example workflow 400 shown in FIG. 17 is not limiting, and the workflow 400 may include additional or fewer steps than those illustrated. Further, the workflow 400 may include steps that are performed in an alternative order to that illustrated. That is, certain steps may be performed before, after, or concurrently to / with another respective step. It should be noted that the terms “capture oligonucleotide(s) 60” and “concentration-specific tags 401” may be used interchangeably.
[0120] At step 402 of the workflow 400, recombinant proteins 410 are labeled (e.g., spikedin) with concentration-specific tags 401 (e.g., capture oligonucleotide(s) 60 / protein labeling oligonucleotides). A portion (e.g. one end) of the concentration-specific tags 401 may be modified to include a functional group 403 to facilitate an interaction (e.g., cross-linking, covalent interactions) with amino acid(s) (e.g., amino acid residues, post-translational modifications (PTMS)) of the recombinant protein 410. In this way, the concentration-specific tags 401 may associate with the recombinant proteins 410, which is mediated by the interactionbetween the functional group 403 and the amino acid on the surface of the recombinant protein 410. It should be noted that one or more, two or more, or three or more concentration-specific tags 401 may associate with one recombinant protein 410 such that each individual recombinant protein 410 is associated with one or more concentration-specific tags 401. In the illustrated diagram, known quantities of concentration-specific tags 401 may be provided to recombinant proteins 410 to generate pre-labeled proteins 405 at specific concentrations (e.g., low concentration pre-labeled proteins 404, medium concentration pre-labeled proteins 406, high concentration pre-labeled proteins 408, or collectively pre-labeled proteins 405).
[0121] At step 420, capture oligonucleotide(s) 60 are provided to a sample 52 including an unknown concentration of protein(s) 54 to form analyte-capture oligonucleotide complexes 65. Accordingly, at step 422, the pre-labeled proteins 405 may be combined (e.g., spiked-in) to the analyte-capture oligonucleotide(s) complexes 65 with aptamer (s) 56. For example, the aptamer(s) 56 may bind to the analyte-capture oligonucleotide complexes 65 to form aptameranalyte-capture oligonucleotide complex 63, and the aptamer(s) 56 may bind to the pre-labeled proteins 406 to form pre-labeled protein-aptamer complexes 424.
[0122] Subsequently, a non-binding region of the aptamer(s) 56 may be positioned in sufficient proximity to a portion of the capture oligonucleotide(s) 60 / concentration-specific tags 401 to permit covalent linking (e.g., proximity ligation) using a ligating agent, in a generally similar manner described in FIGS. 2 and 3 above. For example, ligase and / or other means of covalent linking may be utilized to ligate the capture oligonucleotide(s) 60 / concentration-specific tags 401 to the aptamer(s) 56 is not limited to ligation. Accordingly, ligating an end of the capture oligonucleotide(s) 60 / concentration-specific tags 401 to the aptamer(s) 56 generates ligated oligonucleotide(s) 64 (e.g., ligated nucleic acid product), wherein the ligated oligonucleotide(s) 64 may be formed in a way such that one end of may be immobilized on the solid support(s) 58 in a similar manner as FIGS. 2 and 3. Once formed, the ligated oligonucleotide(s) 64 may be isolated and / or the associated proteins (e.g., recombinant protein 410, protein(s) 54) may be removed using techniques as described inFIGS. 2 and 3. In any case, the ligated oligonucleotide(s) 64 may be amplified and / or sequenced to identify analytes present in the sample at step 426.
[0123] In the illustrated diagram, the sequenced data associated with the ligated oligonucleotide(s) 64 obtained from aptamer-analyte-capture oligonucleotide complex 63 and pre-labeled protein-aptamer complexes 424 may be used to generate standard counts 428 to determine relative abundance of the recombinant proteins associated with the concentrationspecific tags 401 and the proteins 54 associated with the capture oligonucleotide(s) 60 (from step 420). For example, the standard counts 428 may include counts corresponding to the low concentration pre-labeled proteins 404, medium concentration pre-labeled proteins 406, high concentration pre-labeled proteins 408, and the aptamer-analyte-capture oligonucleotide complex 63 (e.g., analyte-capture oligonucleotide(s) complexes 65). The standard counts 428 may be utilized to generate a standard curve, as demonstrated in step 426. Graph 432 represents a standard curve generated using the standard counts 428 (e.g., low concentration pre-labeled proteins 404, medium concentration pre-labeled proteins 406, high concentration pre-labeled proteins 408, and the aptamer-analyte-capture oligonucleotide complex 63), wherein the y- axis represents counts and the y-axis represents spike-in concentration (e.g., concentration of pre-labeled proteins 406). In the illustrated graph 432, the standard counts from 428 are plotted and a linear regression line 434 may be fitted to determine the concentration of the protein(s) 54 from step 420. Thus, workflow 400 facilitates quantification of proteins 54 in a sample using pre-labeled proteins 405. It should be noted that the disclosed techniques may be contemplated for quantification of other areas as well (e.g., PTS, sample indices, UMIs).
[0124] FIG. 18 is a schematic diagram of a sequencing device 500 that may be used in conjunction with the disclosed embodiments for aptamer detection as generally discussed herein. The sequencing device 500 comprises a computing device 504 and a sample handling or processing 502 for sequencing a genomic sample or other nucleic-acid polymer. In some versions, the sequencing device 500 analyzes nucleotide fragments or oligonucleotides extracted from genomic samples to generate nucleotide reads or other data utilizing computer implemented methods and systems either directly or indirectly on sequencing device 500.More particularly, the sequencing device 500 receives nucleotide- sample slides (e.g., flow cells comprising nucleotide fragments extracted or generated from samples and further copies and determines the nucleobase sequence of such nucleotide fragments. It should be understood that sequencing device (810) may represent a version of systems that are in an integrated device or separate or distributed systems.
[0125] In some versions, the sequencing device 500 utilizes SBS to sequence nucleotide fragments into nucleotide reads and determine nucleobase calls for the nucleotide reads. The sequencing device 500 may further store the nucleobase calls as part of base-call data that is formatted as a binary base call (BCL) file and send the BCL file to a local device and / or the server device(s). Sequencing device 500 may communicate the BCL file and / or other data to local device and / or client device via a network or directly (i.e., bypassing the network).
[0126] The sequence device 500 may be implemented according to any sequencing technique, such as those incorporating sequencing-by-synthesis methods described in U.S. Patent Publication Nos. 2007 / 0166705; 2006 / 0188901; 2006 / 0240439; 2006 / 0281109; 2005 / 0100900; U.S. Pat. No. 7,057,026; WO 05 / 065814; WO 06 / 064199; WO 07 / 010,251, the disclosures of which are incorporated herein by reference in their entireties. Alternatively, sequencing by ligation techniques may be used in the sequencing device 500. Such techniques use DNA ligase to incorporate oligonucleotides and identify the incorporation of such oligonucleotides and are described in U.S. Pat. No. 6,969,488; U.S. Pat. No. 6,172,218; and U.S. Pat. No. 6,306,597; the disclosures of which are incorporated herein by reference in their entireties. Some embodiments can utilize nanopore sequencing, whereby target nucleic acid strands, or nucleotides exonucleolytically removed from target nucleic acids, pass through a nanopore. As the target nucleic acids or nucleotides pass through the nanopore, each type of base can be identified by measuring fluctuations in the electrical conductance of the pore (U.S. Patent No. 7,001,792; Soni & Meller, Clin. Chem. 53, 1996-2001 (2007); Healy, Nanomed. 2, 459-481 (2007); and Cockroft, et al. J. Am. Chem. Soc. 130, 818-820 (2008), the disclosures of which are incorporated herein by reference in their entireties). Yet other embodiments include detection of a proton released upon incorporation of a nucleotide into an extensionproduct. For example, sequencing based on detection of released protons can use an electrical detector and associated techniques that are commercially available from Ion Torrent (Guilford, CT, a Life Technologies subsidiary) or sequencing methods and systems described in US 2009 / 0026082 Al; US 2009 / 0127589 Al; US 2010 / 0137143 Al; or US 2010 / 0282617 Al, each of which is incorporated herein by reference in its entirety. Particular embodiments can utilize methods involving the real-time monitoring of DNA polymerase activity. Nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and y-phosphate-labeled nucleotides, or with zeromode waveguides as described, for example, in Levene et al. Science 299, 682- 686 (2003); Lundquist et al. Opt. Lett. 33, 1026-1028 (2008); Korlach et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the disclosures of which are incorporated herein by reference in their entireties. Other suitable alternative techniques include, for example, fluorescent in situ sequencing (FISSEQ), and Massively Parallel Signature Sequencing (MPSS). In particular embodiments, the sequencing device 500 may be a HiSeq, MiSeq, or HiScanSQ from Illumina (La Jolla, CA). In other embodiment, the sequencing device 500 may be configured to operate using a CMOS sensor with nanowells fabricated over photodiodes such that DNA deposition is aligned one-to-one with each photodiode.
[0127] The sequencing device 500 may be “one-channel” a detection device, in which only two of four nucleotides are labeled and detectable for any given image. For example, thymine may have a permanent fluorescent label, while adenine uses the same fluorescent label in a detachable form. Guanine may be permanently dark, and cytosine may be initially dark but capable of having a label added during the cycle. Accordingly, each cycle may involve an initial image and a second image in which dye is cleaved from any adenines and added to any cytosines such that only thymine and adenine are detectable in the initial image but only thymine and cytosine are detectable in the second image. Any base that is dark through both images in guanine and any base that is detectable through both images is thymine. A base that is detectable in the first image but not the second is adenine, and a base that is not detectable in the first image but detectable in the second image is cytosine. By combining the informationfrom the initial image and the second image, all four bases are able to be discriminated using one channel.
[0128] In the depicted embodiment, the sequencing device 500 includes a separate sample processing device 502 and an associated computer 504. However, as noted, these may be implemented as a single device. Further, the associated computer 504 may be local to or networked or otherwise in communication with the sample processing device 502. In the depicted embodiment, the biological sample may be loaded into the sample processing device 502 on a sample substrate 510, e.g., a flow cell or slide, that is imaged to generate sequence data. For example, reagents that interact with the biological sample fluoresce at particular wavelengths in response to an excitation beam generated by an imager 512 and thereby return radiation for imaging. For instance, the fluorescent components may be generated by fluorescently tagged nucleic acids that hybridize to complementary molecules of the components or to fluorescently tagged nucleotides that are incorporated into an oligonucleotide using a polymerase. As will be appreciated by those skilled in the art, the wavelength at which the dyes of the sample are excited and the wavelength at which they fluoresce will depend upon the absorption and emission spectra of the specific dyes. Such returned radiation may propagate back through the directing optics. This retrobeam may generally be directed toward detection optics of the imager 512.
[0129] The imager detection optics may be based upon any suitable technology, and may be, for example, a charged coupled device (CCD) sensor that generates pixilated image data based upon photons impacting locations in the device. However, it will be understood that any of a variety of other detectors may also be used including, but not limited to, a detector array configured for time delay integration (TDI) operation, a complementary metal oxide semiconductor (CMOS) detector, an avalanche photodiode (APD) detector, a Geiger-mode photon counter, or any other suitable detector. TDI mode detection can be coupled with line scanning as described in U.S. Patent No. 7,329,860, which is incorporated herein by reference. Other useful detectors are described, for example, in the references provided previously herein in the context of various nucleic acid sequencing methodologies.
[0130] The imager 512 may be under processor control, e.g., via a processor 514, and the sample receiving device 502 may also include I / O controls 516, an internal bus 518, nonvolatile memory 520, RAM 522 and any other memory structure such that the memory is capable of storing executable instructions, and other suitable hardware components that may be similar to those described with regard to FIG. 31. Further, the associated computer 504 may also include a processor 524, I / O controls 526, communications circuity 527, and a memory architecture including RAM 528 and non-volatile memory 530, such that the memory architecture is capable of storing executable instructions 532. The hardware components may be linked by an internal bus, which may also link to the display 534. In embodiments in which the sequencing device 500 is implemented as an all-in-one device, certain redundant hardware elements may be eliminated.
[0131] The processor 514, 524 may be programmed to assign individual sequencing reads to a sample based on the associated index sequence or sequences according to the techniques provided herein. In particular embodiments, based on the image data acquired by the imager 512, the sequencing device 500 may be configured to generate sequencing data that includes base calls for each base of a sequencing read. Further, based on the image data, even for sequencing reads that are performed in series, the individual reads may be linked to the same location via the image data and, therefore, to the same template strand. In this manner, index sequencing reads may be associated with a sequencing read of an insert sequence before being assigned to a sample of origin. The processor 514, 524 may also be programmed to perform downstream analysis on the sequences corresponding to the inserts for a particular sample subsequent to assignment of sequencing reads to the sample.
[0132] In certain embodiments, the I / O controls 516, 526 may be configured to receive user inputs that automatically select sequencing parameters based on the aptamer(s) 56 and / or capture oligonucleotide(s) 60 and the associated sequence library preparation techniques. For example, in cases where custom primers or dark cycles are incorporated into the sequencing run, the sequencing device can select from preprogrammed operating instructions and / or receive user inputs to cause the sequencing device to operate according to the desired sequenceparameters. In an embodiment, the user input may be a selection of a sequence library preparation kit or reading a barcode or identifier of a sequence library preparation kit.
[0133] In embodiments of the disclosed techniques, aptamer detection for a particular sample 52 may be based on a presence of the uniquely identifying aptamer ID sequence 72 for an individual aptamer(s) 56 and / or the uniquely identifying sample ID sequence 74 for the capture oligonucleotide(s) 60 sequencing data generated by the sequencing device 500. Accordingly, in an embodiment, the sequencing device 500 may perform analysis of sequence reads to identify one or more aptamer ID sequences 72 for a panel of aptamers. Based on the identified aptamers, a notification or report of positive aptamer identification may be generated. In an embodiment, the notification is provided on the display 534 or communicated via the communications circuitry 527 to a remote device or a cloud server.Examples
[0134] FIG. 19 is a schematic 600 illustration of analytes labeled with the reactive handle of FIG. 16. FIG. 20 is a schematic illustration of analytes labeled with the reactive handle of FIG. 16. To facilitate discussion, FIGS. 19 and 20 will be discussed concurrently. In the illustrated schematic illustration 600, protein labeling efficiency using the reactive handles 310 was evaluated via a reaction scheme 602, where protein(s) 54 were labeled with reactive handles 310 to form labeled proteins 305. In the illustrated scheme, bovine serum albumin (BSA) 604 was utilized as an example protein(s) 54. Lysine residues of BSA 604 were reacted with sulfonyl acrylate 342 (e.g., reactive handles 310, sulfonyl acrylate groups 342) in the presence of TrisHCl buffer at pH 8 at 37°C to generate acrylate-functionalized BSA 605 (e.g. labeled proteins 305). The reaction was allowed to run for 30 minutes, after which mass spectrometry was performed. Varying amounts (e.g., concentrations, equivalents) of sulfonyl acrylate 342 were tested to evaluate protein labeling efficiency. The resulting products (e.g., pre-labeled proteins 305) were detected using spectroscopic techniques at step 603 of the reaction scheme 602, the results of which are shown in panels 606 and 608 of FIG. 19.
[0135] Electrospray ionization-liquid chromatography mass spectrometry (ESI-LCMS) was performed to analyze the resulting products. Panel 606 is a mass spectrum that was acquired 30 minutes post-addition of sulfonyl acrylate 342 to the BSA 604. 10 equivalents of sulfonyl acrylate 342 were added relative to the amount of BSA 604. Panel 606 also includes a table 607 (e.g., Table 1 below) illustrating representative masses of detected proteins. For example, control BSA was detected, which exhibits a mass of about 66,426.92 Daltons (Da). Additionally, peaks representative of pre-labeled proteins (e.g., acrylate-functionalized BSA 605) were also detected. For example, panel 606 demonstrates that at 10 equivalents of sulfonyl acrylate 342, the binding of one acrylate group (e.g., BSA + 1 acrylate) was detected, as represented by the mass of 66,526.40 Da. It should be noted that the sulfonyl group of the sulfonyl acrylate group 342 is lost during the reaction and thus is not part of the resulting prelabeled protein 305 formed at step 603.Table 1 shows masses of labeled proteins with 10 equivalents of sulfonyl acrylate relative to BSA acquired at 30 minutes post-reaction.
[0136] Protein labeling efficiency was also evaluated at higher equivalents of sulfonyl acrylate 342, as shown in panel 608. In panel 608, 100 equivalents of sulfonyl acrylate 342 were reacted with BSA 604, and the mass spectrum was acquired 30 minutes post-addition of sulfonyl acrylate 342 to the BSA 604. Panel 608 also includes a table 609 (Table 2 below) illustrating representative masses of detected proteins. At 100 equivalents of sulfonyl acrylate 342, more binding events were detected. For example, protein complexes that exhibited two (mass of about 66,623.17 Da), three (mass of about 66,718.61 Da), four (mass of about 66,824.42 Da), five (mass of about 66,913.37 Da), and six acrylates (mass of about 67,014.96Da) were detected. In any case, these results demonstrate that proteins 54 may be labeled with about one to about six acrylates within 30 minutes with 100-fold acrylate reagents.Table 2 shows masses of labeled proteins with 100 equivalents of sulfonyl acrylate relative to BSA acquired at 30 minutes post-reaction.
[0137] Graph 610 of FIG. 19 demonstrates the effect of varying the amount of sulfonyl acrylate 342 relative to the amount of BSA 604 on the number of lysine modifications that occur on the BSA 604. Concentration and equivalents of sulfonyl acrylate 342 were varied relative to BSA 604. The protein labeling efficiency was tested at two different time points (e g., 30 minutes and 1 hour post reaction between BSA 604 and sulfonyl acrylate 342 (e.g., sulfonyl acrylate group)). The y-axis represents the number of modified residues, while the x- axis represents concentration / equivalents of sulfonyl acrylate 342 relative to BSA 604. Multiple replicates were performed at each concentration / equivalent that was evaluated. In general, graph 610 illustrates that increasing equivalents / concentration and / or time of sulfonyl acrylate 342 relative to BSA 604 promotes more binding of the acrylate to the BSA. For example, 0 to 20 lysine residue modifications were observed. Surprisingly, 0.01 (millimolar) mM of sulfonyl acrylate 342 (or 100 equivalents of sulfonyl acrylate 342 to BSA 604) at 1 hour demonstrated more lysine modifications when compared to other concentrations / equivalents — with the exception of 0.1 mM / 100 equivalent sulfonyl acrylate342 to BSA 604. In any case, these results demonstrate that the concentration of sulfonyl acrylate 342 may be tuned to promote sulfonyl acrylate 342 labeling of proteins 54.
[0138] The acrylate-functionalized BSA 605 were subsequently reacted with the universal oligomers 330. In the illustrated reaction scheme 602, the universal oligomers 330 include a universal sequence 334 (e.g., B15 sequence) and an amine (NH2) group as the complementary end 332. The amine end 332 reacts with the acrylate-functionalized BSA 605 to form analytecapture oligonucleotide complex 65 at step 611. The resulting analyte-capture oligonucleotide complexes 65 were detected using mass spectrometry, as shown in panel 612 of FIG. 20.
[0139] Panel 612 is a mass spectrum that was acquired 30 minutes post-reaction between 10 equivalents of the universal oligomer 330 relative to the acrylate-functionalized BSA 605. Panel 612 also includes a table 614 (Table 3 below) illustrating representative masses of detected proteins. For example, BSA with 4 acrylate groups was detected, which exhibited a mass of about 66,815.51. Additionally, peaks representative of analyte-capture oligonucleotide complexes 65 were also detected. For example, panel 606 demonstrates that at 10 equivalents of sulfonyl acrylate 342, analyte-capture oligonucleotide complexes 65 with 5 acrylates and one B15 sequence (e.g., universal oligomer 330) and analyte-capture oligonucleotide complexes 65 with 6 acrylates and one B15 sequence (e.g., universal oligomer 330) were detected. Thus, these results demonstrate that proteins 54 may be labeled with reactive handles 310 to attach universal oligomers 330, which may be subsequently utilized in CAPL techniques described herein for analyte detection.Table 3 shows masses of labeled proteins with 30 equivalents of sulfonyl acrylate relative to BSA acquired at 30 minutes post-reaction.
[0140] In certain embodiments, the relative concentration of reactive handles 310 (e.g., protein reactive groups 312) to proteins 54 may range from about 0.01 (millimolar) mM to about 1 mM, about 0.02 to about 0.9, about 0.03 to about 0.8, about 0.04 to about 0.7, about 0.05 to about 0.6, about 0.07 to about 0.5, about 0.08 to about 0.4, about 0.09 to about 0.3, about 0.1 to about 0.2, about 0.01 to about 0.5, about 0.05 to about 0.1, such as about 0.01, about 0.02, about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09, about 0.1, about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, or about 1.0 mM.
[0141] In certain embodiments, the relative equivalents of reactive handles 310 (e.g., protein reactive groups 312) to proteins 54 may range from about 1 to about 200, about 1 to 100, about 1 to about 90, about 1 to about 80, about 1 to about 70, about 1 to about 60, about 1 to about 50, about 1 to about 40, about 1 to about 30, about 1 to about 20, or about 1 to about 10.
[0142] In certain embodiments, the number of reactive handles 310 that may be functionalized onto the surface of a protein(s) 54 (e.g., amino acid residue modifications) may range from about 0 to about 20, such as about 2 to about 18, about 4 to about 16, about 6 to about 14, about 8 to about 12, or about 0, about 2, about 4, about 6, about 8, about 10, about 12, about 14, about 16, about 18, or about 20.
[0143] In certain embodiments, the number of universal oligomers 330 that may bind to the reactive handles 310 on proteins 54 may range from about 0 to about 10, such as about 1 to about 9, about 2 to about 8, about 3 to about 7, about 4 to about 6, or about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10.
[0144] FIG. 21 is a schematic illustration 700 of analytes labeled with the reactive handle of FIG. 16. In the illustrated diagram, protein(s) 54 were labeled with reactive handles 310 following via reaction scheme 702 to form labeled proteins 305. The illustrated oligomer conjugation and analyte labeling was performed using inverse electron demand Diels-Alder reaction (IEDDA) click chemistry.
[0145] At step 704, BSA 604 was utilized the as the example protein(s) 54. A reactive handle 310 was provided, which included an NHS ester group 340 as the protein reactive group 312 (e.g., capable of binding to lysine residues), a TCO group 354 as the oligomer reactive group 314, and a linker 311. The reactive handle 310 also includes linker 311 between the protein reactive group 312 and the oligomer reactive group 314. In the provided example, the linker 311 includes four PEG monomer units (e.g., PEG-4). The reactive handle 310 was provided to the BSA 604 in the presence of SB17T buffer, where the reaction proceeded at 27°C for 1 hour to generate labeled proteins 305.
[0146] At step 706, the labeled proteins 305 were filtered and buffer exchanged to remove unreacted reactive handles 310. Universal oligomers 330 were provided to the filtered labeled proteins 305 to permit reaction between the complementary end 332 with the oligomer reactive group 314, 354 of the labeled proteins 305 in the presence of phosphate-buffered saline (PBS) buffer at pH 7 at 27°C. The reaction was allowed to proceed for one hour. In the illustrated example, the complementary end 332 is an amino group that can react with the TCO group 354. The reaction between the complementary end 332 and TCO group 354 generates capture oligonucleotide(s) 351 (e.g., capture oligonucleotide(s) 60) and / or analyte-capture oligonucleotide complex 65. Analyte modification of the protein(s) 54 was determined by gel electrophoresis, the results of which are demonstrated in panel 710.
[0147] Panel 710 illustrates an image of a Coomassie stained BioRad SDS PAGE gel, where different equivalents (e.g., amounts) of reactive handles 310 and / or universal oligomers 330 were utilized to determine labeling efficiency of the protein(s) 54 to generate analytecapture oligonucleotide complex 65. Labeling efficiency was evaluated at varying amounts of the capture oligonucleotide(s) 351, 60 relative to the amount of BSA 604 (e.g., 0 equivalents,10 equivalents, 50 equivalents, or 100 equivalents). Accordingly, panel 710 illustrates that the surface exposed lysine residues of the BSA 604 were labeled with about 50 equivalents or less of the capture oligonucleotide(s) 351, 60 (e.g., reagents including reactive handles 310 and / or universal oligomers 330) to form analyte-capture oligonucleotide complex 65. For example, lane 712 is a reference lane, lane 714 represents 0 equivalents of the capture oligonucleotide(s) 351 (an example band representative of BSA 604), 60, lane 716 represents analyte-capture oligonucleotide complex 65 formed using 10 equivalents of the capture oligonucleotide(s) 351, lane 718 represents analyte-capture oligonucleotide complex 65 formed using 50 equivalents of the capture oligonucleotide(s) 351, and lane 720 represents analyte-capture oligonucleotide complex 65 formed using 100 equivalents represents of the capture oligonucleotide(s) 351.
[0148] Panel 722 is another example of analyte-capture oligonucleotide complex 65 labeled with a capture oligonucleotide(s) 351, 60. In the illustrated diagram, the capture oligonucleotide(s) 351, 60 exhibits a protein(s) 54 that is crosslinked to a reactive handle 310 that includes a linker 311 and a TCO group 354. The TCO group 354 acts as an oligomer reactive group 314 and reacts with the universal oligomer 330 via its complementary end 332, wherein the complementary end 332 is a tetrazine group 352. It should be noted that the universal oligomer 330 may include an optional linker 311 (e.g., 4 PEG units (PEG4), 8 PEG units (PEG8)) in between the complementary end 332 and universal sequence 334. The analyte-capture oligonucleotide complexes of panel 722 were detected using gel electrophoresis, the results of which are demonstrated in panel 724.
[0149] Panel 724 illustrates an image of a Coomassie stained BioRad SDS PAGE gel, where different equivalents (e.g., amounts) of reactive handles 310 and / or universal oligomers 330 were utilized to determine labeling efficiency of the protein(s) 54 to generate analytecapture oligonucleotide complex 65. The illustrated diagram shows an example band representative of BSA 604. Lane 726 is a reference lane, and lane 728 shows an example band representative of BSA 604 only. Labeled proteins 305 that include BSA 604 crosslinked with TCO groups 352 (BSA-TCO) were evaluated at 2 different equivalents (e g., 5 equivalents, 10 equivalents).
[0150] Lanes 730, 732, 734, 736, and 738 represent conditions where 5 equivalents of BSA 604 crosslinked with TCO group 354 were reacted with varying concentrations of universal oligomers 330 (with or without a PEG8 linker 311) and a tetrazine group 352 as a complementary end 332. Lanes 730 is a control lane showing bands representative of analytecapture oligonucleotide complexes 65 using 5 equivalents of BSA 604 crosslinked with TCO group 354. Lane 732 represents analyte-capture oligonucleotide complex 65 formed using 5 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 5 equivalents of a universal oligomer 330 including tetrazine group 352. Lane 734 represents analyte-capture oligonucleotide complexes 65 formed using 5 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 10 equivalents of a universal oligomer 330 including tetrazine group 352. Lane 736 represents analyte-capture oligonucleotide complexes 65 formed using 5 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 5 equivalents of a universal oligomer 330 including a PEG8 linker 311 and a tetrazine group 352. Lane 738 represents analyte-capture oligonucleotide complexes 65 formed using 5 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 10 equivalents of a universal oligomer 330 including a PEG8 linker 311 and a tetrazine group 352.
[0151] Lanes 740, 742, 744, 746, and 748 represent conditions where 10 equivalents of BSA 604 crosslinked with TCO group 354 were reacted with varying concentrations of universal oligomers 330 (with or without a PEG8 linker 311) and a tetrazine group 352 as a complementary end 332. Lanes 740 is a control lane showing bands representative of where 10 equivalents of BSA 604 crosslinked with TCO group 354. Lane 742 represents analytecapture oligonucleotide complex 65 formed using 10 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 10 equivalents of a universal oligomer 330 including tetrazine group 352. Lane 744 represents analyte-capture oligonucleotide complexes 65 formed using 10 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 20 equivalents of a universal oligomer 330 including tetrazine group 352. Lane 746 represents analyte-capture oligonucleotide complexes 65 formed using 10 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 10 equivalents of a universal oligomer 330 including a PEG8 linker 311 and a tetrazine group 352. Lane 748 represents analyte-capture oligonucleotide complexes65 formed using 10 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 20 equivalents of a universal oligomer 330 including a PEG8 linker 311 and a tetrazine group 352.
[0152] In general, panel 724 demonstrates that the analyte-capture oligonucleotide complex 65 may be formed under an hour. For example, lane 730 shows that BSAs 604 were labeled with at least one and at least two TCO groups 352, as represented by the +1 and +2 labels in the image, respectively. In the presence of the universal oligomer 330, For example, BSAs labeled with one, two, three, four, and five capture oligonucleotide(s) 351, 60 were detected, as represented by the +1, +2, +3, +4, and +5 labels in the image, respectively. Surprisingly, gel resolution and conjugation efficiency between the reactive handle 310 and the universal oligomer 330 was improved with the presence of the PEG8 linker 311. Furthermore, the results in panel 724 demonstrate that increasing concentrations (e.g., equivalents) of the universal oligomer 330 improves protein labeling.
[0153] FIG. 22 is a schematic illustration showing gel electrophoresis of the analytes labeled with reactive handles 310 of FIG. 21. Panel 750 illustrates an image of a Coomassie stained BioRad SDS PAGE gel, where different equivalents (e.g., amounts) of reactive handles 310 and / or universal oligomers 330 were utilized to determine labeling efficiency of the protein(s) 54. Lane 752 is a reference lane, lane 754 shows an example band representative of BSA 604 only, and lane 756 shows an example band representative of 50 equivalents of BSA 604 crosslinked with TCO group 354. In general, panel 750 illustrates that the protein(s) 54 may be labeled with greater than or equal to 20 capture oligonucleotides 351, 60. That is, increasing concentrations of the universal oligomers 330 and / or reactive handles 310 advantageously increases labeling efficiency of protein(s) 54 for a given sample 52.
[0154] Lanes 758, 760, 762, and 764 represent conditions where 50 equivalents of BSA 604 crosslinked with TCO group 354 were reacted with varying concentrations of universal oligomers 330 (without a PEG8 linker 311) and a tetrazine group 352 as a complementary end 332. Lane 758 represents analyte-capture oligonucleotide complexes 65 formed using 50 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 5 equivalents of auniversal oligomer 330 including tetrazine group 352. Lane 760 represents analyte-capture oligonucleotide complexes 65 formed using 50 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 10 equivalents of a universal oligomer 330 including tetrazine group 352. Lane 758 represents analyte-capture oligonucleotide complexes 65 formed using 50 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 20 equivalents of a universal oligomer 330 including tetrazine group 352. Lane 760 represents analyte-capture oligonucleotide complexes 65 formed using 50 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 30 equivalents of a universal oligomer 330 including tetrazine group 352.[00155J Lanes 766, 768, 770, and 772 represent conditions where 50 equivalents of BSA 604 crosslinked with TCO group 354 were reacted with varying concentrations of universal oligomers 330 (with a PEG8 linker 311) and a tetrazine group 352 as a complementary end 332. Lane 766 represents analyte-capture oligonucleotide complexes 65 formed using 50 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 5 equivalents of a universal oligomer 330 including PEG8 linker 311 and a tetrazine group 352. Lane 768 represents 50 analyte-capture oligonucleotide complexes 65 formed using equivalents of BSA 604 crosslinked with TCO group 354 reacted with 10 equivalents of a universal oligomer 330 including PEG8 linker 311 and a tetrazine group 352. Lane 758 represents analyte-capture oligonucleotide complexes 65 formed using 50 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 20 equivalents of a universal oligomer 330 including PEG8 linker 311 and a tetrazine group 352. Lane 760 represents analyte-capture oligonucleotide complexes 65 formed using 50 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 30 equivalents of a universal oligomer 330 including PEG8 linker 311 and a tetrazine group 352.
[0156] Panel 780 shows results of a kinetics experiment that evaluates the rate of oligomer conjugation and analyte labeling. In general, panel 780 is an image of a Coomassie stained BioRad SDS PAGE gel, where the rate of reaction between the labeled proteins 305 (e.g., BSA 604 conjugated with TCO group 354) and universal oligomers 330 (e.g., universal sequence 334 with tetrazine group 352 as the complementary end 332) was evaluated. In general, panel780 demonstrates that the disclosed embodiments advantageously enable fast kinetics with respect to labeling efficiency. For example, the click reaction may be performed within 15 minutes at equimolar amounts of BSA-TCO group 354 and universal oligomers 330. In any case, the results of panel 780 demonstrate that the fast reaction kinetics may advantageously facilitate workflow processes related to analyte detection.
[0157] In general, the kinetics of labeling efficiency was evaluated at various time points (e.g., 15 minutes, 30 minutes, 1 hour). Lane 790 is a reference lane, and lane 784 shows an example band representative of BSA 604 only. Lanes 784, 786, and 788 show the different time points where 20 equivalents of BSA 604 crosslinked with TCO group 354 were reacted 20 equivalents of universal oligomers 330 (without a PEG8 linker 311) and a tetrazine group 352 as a complementary end 332. Lane 784 represents analyte-capture oligonucleotide complexes 65 labeled within 15 minutes using 20 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 20 equivalents of a universal oligomer 330 including tetrazine group 352. Lane 786 represents analyte-capture oligonucleotide complexes 65 labeled within 30 minutes using 20 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 20 equivalents of a universal oligomer 330 including tetrazine group 352. Lane 784 represents analyte-capture oligonucleotide complexes 65 labeled within 60 minutes using 20 equivalents of BSA 604 crosslinked with TCO group 354 reacted with 20 equivalents of a universal oligomer 330 including tetrazine group 352.
[0158] In certain embodiments, the reaction between the protein(s) 54, reactive handles 310, and / or universal oligomer 330 may be performed at temperatures ranging from about 20 to about 40°C, about 22 to about 38°C, about 24 to about 36°C, about 26 to about 34°C, about 27 to about 37°C, about 28 to about 32°C, such as about 21, about 23, about 25, about 27, about 29, about 31, about 33, about 35, about 37, or about 39°C.
[0159] In certain embodiments, the reaction between the protein(s) 54, reactive handles 310, and / or universal oligomer 330 may be completed within a time frame ranging from about 1 minute (min) to about 1 hour, such as about 5 min to about 55 min, about 10 min to about 50 min, about 15 min to about 45 min, about 20 min to about 40 min, about 25 min to about35 min, about 5 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 35 minutes, about 40 minutes, about 45 minutes, about 50 minutes, about 55 minutes, or about 1 hour. In certain embodiments, the reaction between the protein(s) 54, reactive handles 310, and / or universal oligomer 330 may be completed in less 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, or about less than 10 minutes.
[0160] In certain embodiments, the capture oligonucleotide(s) 351, 60 including reactive handles 310 and universal oligomers 330 may range from about 0 equivalents to about 100 equivalents relative to an amount of protein(s) 54 present in a sample 54. For example, the capture oligonucleotide(s) 351, 60 may be present less than 100 equivalents, less than 75 equivalents, less than 50 equivalents, less than 25 equivalent, or range from about 10 to about 90, about 20 to about 80, about 30 to about 70, about 40 to about 60, such as about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 100 equivalents. In certain embodiments, the capture oligonucleotide(s) 351, 60 may be provided in excess amounts is at least 5x or at least lOx relative to the concentration of functional groups (e.g., reactive handles 310) in a reaction used to modify the analytes.
[0161] In certain embodiments, the labeled proteins (e.g., protein(s) 54 and reactive handle 310) may be present in amounts ranging from about 0 to about 100 equivalents relative to the universal oligomer 330, such as about 10 to about 90, about 20 to about 80, about 30 to about 70, about 40 to about 60, such as about 1, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, or about 100 equivalents.
[0162] In certain embodiments, the reactive handle 310 may be present in amounts ranging from about 0 to about 100 equivalents relative to the universal oligomer 330, such as about 10 to about 90, about 20 to about 80, about 30 to about 70, about 40 to about 60, such as about 1, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, or about 100 equivalents.
[0163] In certain embodiments, the universal oligomer 330 with or without the linker 311 may be present in relative to the labeled proteins (e.g., protein(s) 54 and reactive handle 310) in amounts ranging from about 0 to about 100 equivalents relative to the universal oligomer 330, such as about 10 to about 90, about 20 to about 80, about 30 to about 70, about 40 to about 60, such as about 1, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, or about 100 equivalents.In certain embodiments, the protein(s) 54 may be labeled with greater than about 1 capture oligonucleotide 351, 60 (e.g., reactive handles 310 with / without universal oligomer 330), greater than about 2, greater than about 3, greater than about 5, greater than about 10, greater than about 15, or greater than about 20. For example, protein(s) 54 may be labeled with capture oligonucleotide(s) 351, 60 ranging from about 1 to about 30, such as about 2 to about 28, about 4 to about 26, about 6 to about 24, about 8 to about 22, about 10 to about 20, about 12 to about 18, about 14 to about 16, about 1, about 3, about 5, about 7, about 9, about 11, about 13, about 15, about 17, about 19, about 21, about 23, about 25, about 27 or about 30.
[0164] In another aspect, the methods described herein are applicable to nanopore sequencing such as that described in U.S. Patent Publication No. 2015-0344945 and U.S. Patent Publication No. 2015 / 0152495, which are incorporated herein by reference in their entireties and for all purposes. In one embodiment, provided herein are methods of attaching a tether as described herein to a barrier comprising one or more nanopores. A “barrier” is intended to mean a structure that normally inhibits passage of molecules from one side of the barrier to the other side of the barrier. The molecules for which passage is inhibited can include, for example, ions or water-soluble molecules such as nucleic acids, proteins, nucleotides, and amino acids. A pore (e.g. a nanopore or plurality of nanopores as described herein) can be disposed within a barrier, and the aperture of the pore can permit passage of molecules from one side of the barrier to the other side of the barrier. Barriers include membranes of biological origin, and non-biological barriers such as solid-state membranes.
[0165] The tether can optionally comprise a polynucleotide sequence. The methods can include extending a tether by contacting the tether with a template independent polymerase as described herein, whereupon the template independent polymerase incorporates a terminal 3'- modified ddNTP comprising a 3 '-functional moiety capable of participating in a click chemistry reaction into the tether. The 3 '-functional moiety can be reacted with a 5 '-functional moiety located on the barrier comprising the one or more nanopores. In certain embodiments, the 5 '-functional moiety is attached to a moiety on the nanopore or the barrier adjacent to a nanopore. The moiety can be a molecule forming the barrier itself, e.g. a lipid or cholesterol in the instance of biological nanopores, or the solid support / polymer in the instance of non- biological nanopores. In one embodiment, the 3 '-functional moiety can be reacted with a cholesterol-containing tag for use in translocating a polynucleotide through a nanopore as described herein and provided in, for example, U.S. Patent Publication No. 2015 / 0152495, International Patent Publication No. W02015 / 081211, and International Patent Application No. PCT / US2014 / 067560, each of which is incorporated by reference herein in its entirety and for all purposes.
[0166] The term “analyte-binding region” may refer to an oligonucleotides (ssDNA or ssRNA) that will form a cognate target by binding to an analyte of interest. The “analytebinding region” may include one or more portions that permit binding of the analyte-binding region to the analyte. For example, the one or more portions may include an aptamer region that will bind to the analyte of interest with high affinity. It should be noted that the analytebinding region may include other sequences (e.g., identification sequences) to enable downstream sequencing and analysis.
[0167] The term “capture oligonucleotide(s)” may refer to single-stranded nucleic acid molecules.
[0168] As used herein, an aptamer may refer to a non-naturally occurring nucleic acid that has specific binding affinity for a target molecule. The binding of the aptamer to the target molecule can result in catalytically changing the target molecule, reacting with the target molecule in a way that modifies or alters the target molecule or the functional activity of thetarget molecule, covalently attaching to the target molecule (as in a suicide inhibitor), and facilitating the reaction between the target molecule and another molecule. In one embodiment, the target molecule is a three-dimensional chemical structure, other than a polynucleotide, that binds to the aptamer through a mechanism which is predominantly independent of Watson / Crick base pairing or triple helix binding. In an embodiment, the aptamer is not a nucleic acid having the known physiological function of being bound by the target molecule.
[0169] Aptamers include nucleic acids that are identified from a candidate mixture of nucleic acids. A specific binding affinity of an aptamer for its target may refer to aptamer binding to its target generally with a much higher degree of affinity than it binds to other, nontarget, components in a mixture or sample. Different aptamers may have either the same number or a different number of nucleotides. Aptamers may be DNA, RNA, or modified aptamers and may be single stranded, double stranded, or contain double stranded regions. The aptamers discussed herein can be used in any diagnostic, imaging, high throughput screening or target validation techniques or procedures or assays for which aptamers, oligonucleotides, antibodies and ligands, without limitation can be used.
[0170] In certain embodiments of the disclosure, the disclosed aptamer(s) 56 and / or capture oligonucleotide(s) 60 can include one or more conserved regions, such as a conserved primer region, e.g., a first conserved primer region and a second conserved primer region. A conserved region is conserved between at least some other aptamer of a set of aptamer(s) 56 (or capture oligonucleotide of a set of capture oligonucleotide(s) 60) such that the conserved region has an identical or similar nucleotide sequence as compared between the probes. For example, for a given capture oligonucleotide, all capture oligonucleotide(s) 60 can have a same first conserved primer region. Furthermore, for a given aptamer, all aptamer(s) 56 can have a same second conserved primer region. In this manner, primers based on the first conserved primer region and the second conserved primer region can be used to amplify any ligated oligonucleotides 64.
[0171] One or more probes as discussed herein may include an identification sequence that can include one or more nucleotide sequences that can be used to identify one or more specific aptamers. The identification sequence can be an artificial sequence. The identification sequence can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides. In some embodiments, the identification sequence comprises at least about 10, 20, 30, 40, 50, 60, 70 80, 90, 100 or more consecutive nucleotides. In some embodiments, at least a portion of the identification sequence in a probe is different.
[0172] One or more probes as discussed herein may include an affinity tag. Affinity tags can be useful for a variety of applications, for example the bulk separation of target nucleic acids hybridized to hybridization tags. As used herein, the term “affinity tag” or “tag sequence” and grammatical equivalents can refer to a component of a multi-component complex, wherein the components of the multi-component complex specifically interact with or bind to each other. For example, an affinity tag can include biotin or poly-His that can bind streptavidin or nickel, respectively. Other examples of multiple-component affinity tag complexes are listed, for example, U.S. Patent Application Pub. No. 2012 / 0208705, U.S. Patent Application Pub. No. 2012 / 0208724 and Int. Patent Application Pub. No. WO 2012 / 061832, each of which is incorporated by reference in its entirety.
[0173] The disclosed embodiments provide a different primers and probes. Probes and / or primers of the disclosed embodiments are designed to be complementary to a target sequence (either the target sequence of the sample or to other probe sequences), such that hybridization of the target sequence and the probes of the present invention occurs. As outlined below, this complementarity need not be perfect; there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. Thus, by “substantially complementary” herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions.
[0174] A variety of hybridization conditions may be used in the present invention, including high, moderate and low stringency conditions. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5- 10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g. 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g. greater than 50 nucleotides).
[0175] In certain embodiments, probe contacting steps may be run under stringency conditions which allows formation of the hybridization complex only in the presence of target. Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc. The size of the primer nucleic acid may vary, as will be appreciated by those in the art, in general varying from 5 to 500 nucleotides in length. Primers may be between 10 and 100, between 15 and 50, and from 10 to 35 depending on the use and amplification technique.
[0176] In some embodiments, the adapter may be ligated to reporter probes (e.g., affinity binders, aptamers, capture oligonucleotides). Any suitable adapter may be attached to a target polynucleotide, such as a reporter probe, via any suitable process, such as those discussed herein. The adapter can include a library-specific index tag sequence (e.g., i5, i7). The index tag sequence may be attached to the target polynucleotides from each library before the sample is immobilized for sequencing. The index tag is not itself formed by part of the target polynucleotide, but becomes part of the template for amplification. The index tag may be a synthetic sequence of nucleotides which is added to the target as part of the templatepreparation step. Accordingly, a library-specific index tag is a nucleic acid sequence tag which is attached to each of the target molecules of a particular library, the presence of which is indicative of or is used to identify the library from which the target molecules were isolated. Preferably, the index tag sequence is 20 nucleotides or less in length. For example, the index tag sequence may be 1-10 nucleotides or 4-6 nucleotides in length. A four nucleotide index tag gives a possibility of multiplexing 256 samples on the same array, a six base index tag enables 4,096 samples to be processed on the same array. The adapters may contain more than one index tag so that the multiplexing possibilities may be increased.
[0177] The adapters may include any other suitable sequence in addition to the index tag sequence. For example, the adapters may include universal extension primer sequences, which are typically located at the 5' or 3' end of the adapter and the resulting polynucleotide for sequencing. The universal extension primer sequences may hybridize to complementary primers bound to a surface of a solid substrate. The complementary primers include a free 3' end from which a polymerase or other suitable enzyme may add nucleotides to extend the sequence using the hybridized library polynucleotide as a template, resulting in a reverse strand of the library polynucleotide being coupled to the solid surface. Such extension may be part of a sequencing run or cluster amplification.
[0178] In some embodiments, the adapters include one or more universal sequencing primer sequences. The universal sequencing primer sequences may bind to sequencing primers to al, may include a “sequencing adapter” or “sequencing adapter site”, that is to say a region that comprises one or more sites that can hybridize to a primer. In some embodiments, a sequence can include at least a first primer site useful for amplification, sequencing, and the like.
[0179] After adapter incorporation, the disclosed reporter probes may be sequenced. In one example, the sequencing may be via Illumina’s sequencing-by-synthesis and reversible terminator-based sequencing chemistry. Illumina's sequencing technology relies on the attachment of fragmented genomic DNA to a planar, optically transparent surface on which oligonucleotide anchors are bound. Template DNA is end-repaired to generate 5'-phosphorylated blunt ends, and the polymerase activity of Klenow fragment is used to add a single A base to the 3' end of the blunt phosphorylated DNA fragments. This addition prepares the DNA fragments for ligation to oligonucleotide adapters, which have an overhang of a single T base at their 3' end to increase ligation efficiency. The adapter oligonucleotides are complementary to the flow-cell anchors. Under limiting-dilution conditions, adapter-modified, single-stranded template DNA is added to the flow cell and immobilized by hybridization to the anchors. Attached DNA fragments are extended and bridge amplified to create an ultra- high density sequencing flow cell with hundreds of millions of clusters, each containing '1,000 copies of the same template. In one embodiment, the randomly fragmented genomic DNA is amplified using PCR before it is subjected to cluster amplification. Alternatively, an amplification-free genomic library preparation is used, and the randomly fragmented genomic DNA is enriched using the cluster amplification alone. The templates are sequenced using a robust four-color DNA sequencing-by-synthesis technology that employs reversible terminators with removable fluorescent dyes. High-sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Sequences are aligned against a truth table or stored correlations between aptamer identity and identification sequences using specially developed data analysis pipeline software.
[0180] A non-binding region can include a minimum sequence of just the primer regions flanking the identification sequence to introduce an adapter sequence, such as examples of sequences, or their complements, for primer 1 and primer 2 used in Illumina® sequencing preparations, A14, Bl 5, during amplification. In other embodiments, universal capture primer sequences and / or sample index sequences can be incorporated into oligonucleotides generated from the reporter probes, such as via amplification and / or ligation and extension. Certain arrangements that include indexes may incorporate a custom or bridged primer during sequencing to accommodate the different indexes. Other embodiments may include custom options for sequencing libraries using single reads from surface P5 for example, or for adding dark sequencing by synthesis cycles where common sequences exist in adapter regions.
[0181] The adapter sequences A14-ME, ME, B15-ME, ME', A14, Bl 5, and ME are provided below:
[0182] A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1)
[0183] B 15-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 2)
[0184] ME': 5'-phos-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3)
[0185] A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 4)
[0186] Bl 5: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5)
[0187] ME: AGATGTGTATAAGAGACAG (SEQ ID NO. : 6)
[0188] The primer region or primer binding region can include a region having the sequence of a universal Illumina® capture primer or a region specifically hybridizing with a universal Illumina® capture primer. Universal Illumina® capture primers include, e.g., P5 5’- AATGATACGGCGACCACCGA-3’ ((SEQ ID NO: 7)) or P7 (5’- CAAGCAGAAGACGGCATACGA-3’ (SEQ ID NO: 8)), or fragments thereof. A region specifically hybridizing with a universal Illumina® capture primer can include, e.g., the reverse complement sequence of the Illumina® capture primer P5 ("anti-P5": 5’- TCGGTGGTCGCCGTATCATT-3’ (SEQ ID NO: 9) or P7 ("anti-P7": 5’- TCGTATGCCGTCTTCTGCTTG-3’ (SEQ ID NO: 10)), or fragments thereof.
[0189] A conserved primer region can additionally or alternatively include a region having the sequence of an Illumina® sequencing primer, or fragment thereof, or a region specifically hybridizing with an Illumina® sequencing primer, or fragment thereof. Illumina® sequencing primers include, e.g, SBS3 (5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ (SEQ ID NO: 11)) or SBS8 (5’-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3’ (SEQ ID NO: 12)). A regionspecifically hybridizing with an Illumina® sequencing primer, or fragment thereof, can include, e.g., the reverse complement sequence of the Illumina® sequencing primer SB S3 ("anti-SBS3": 5’-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3’ (SEQ ID NO: 13)) or SBS8("anti-SBS8":5’-AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG-3’ (SEQ ID NO: 14)), or fragments thereof. The incorporation of sequencing primer sequences in the reporter probes may be either directly or via subsequent amplification, ligation, or other sequencing library preparation steps.
[0190] In an embodiment, the sequencing may use Illumina® NGS primers. The following primers are shown by way of example.Read 1 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ (SEQ ID NO: 15)Read 2 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 16)Paired End Read 1 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 17)Paired End Read 2 5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT (SEQ ID NO: 18)Index 1 Read 5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (SEQ ID NO: 19)Index 2 Read 5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (SEQ ID NO: 20)
[0191] It should be understood that the index read primers may be designed to include the particular index sequence associated with a particular sample in an aptamer-based assay. Thus, the index primers may have a nucleotide region, shown as i5 or i7, that varies in sequence between different samples of a multiplexed sample. Other samples in the run can be prepared with primers that include their respective indexes. Accordingly, certain sequence reads maybe obtained with universal primers while other sequence reads are obtained with primers or a mix of primers that are specific to indexes of one or more samples in a multiplexed reaction.
[0192] In an embodiment, unique molecular identifiers (UMIs) may be incorporated onto the capture oligonucleotide(s) 60, e.g., via ligation. UMIs are short sequences used to uniquely tag each molecule in a sample library to provide error correction and reduce sequencing bias.
[0193] The term “affinity binder” may refer to a molecule that may associate (e.g., bind) to a sample analyte. Exemplary analytes include proteins (e.g., antibodies) or oligonucleotides (e g., aptamers).
[0194] The term “sample” herein may refer to a sample, typically derived from a biological fluid, cell, tissue, organ, or organism, comprising analytes or molecules if interest, such as proteins. Exemplary analytes include proteins, polypeptides, nucleic acids, carbohydrates, lipids, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies, affibodies, antibody mimics, viruses, pathogens, toxic substances, substrates, metabolites, transition state analogs, cofactors, inhibitors, drugs, dyes, nutrients, growth factors, cells, tissues, and any fragment or portion of any of the foregoing. In some embodiments, a target molecule is a protein.
[0195] A sample may include, but is not limited to sputum / oral fluid, amniotic fluid, blood, biological fluids, a blood fraction, or fine needle biopsy samples (e.g., surgical biopsy, fine needle biopsy, etc.), urine, peritoneal fluid, pleural fluid, and the like. Although the sample is often taken from a human subject (e.g., patient), the sample may be from any organism. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparing plasma from blood, diluting viscous fluids and so forth. Methods of pretreatment may also involve, but are not limited to, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatmentmethods are typically such that the nucleic acid(s) of interest remain in the test sample, sometimes at a concentration proportional to that in an untreated test sample (e.g., namely, a sample that is not subjected to any such pretreatment method(s). Such “treated” or “processed” samples are still considered to be biological “test” samples with respect to the methods described herein.
[0196] The term “about” or “approximately” may refer to ±0.1%, ±0.25%, ±0.5%, ±1%, ±2, ±5%, ±10%, or ±15%.
[0197] It is to be understood that the subject matter described herein is not limited in its application to the details of construction and the arrangement of components set forth in the description herein or illustrated in the drawings hereof. The subject matter described herein is capable of other implementations and of being practiced or of being carried out in various ways. Also, it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. As used herein, an element or step recited in the singular and proceeded with the word “a” or “an” should be understood as not excluding plural of said elements or steps, unless such exclusion is explicitly stated. Furthermore, references to “one example” are not intended to be interpreted as excluding the existence of additional examples that also incorporate the recited features. The use of “including,” “comprising,” or “having” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items. Furthermore, whenever a composition, a component, or a group of components is preceded with the transitional phrase “comprising,” it is understood that we also contemplate the same composition or group of elements with transitional phrases “consisting essentially of,” “consisting of,” “selected from the group of consisting of,” or “is” preceding the recitation of the composition, components, or components and vice versa.
[0198] This written description uses examples to enable any person skilled in the art to practice the disclosed embodiments, including making and using any devices or systems and performing any incorporated methods. The patentable scope is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intendedto be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.CLAUSES
[0199] The technology disclosed can be practiced as a composition, kit, system, method, or article of manufacture. One or more features of an implementation can be combined with the base implementation. Implementations that are not mutually exclusive are taught to be combinable. One or more features of an implementation can be combined with other implementations. This disclosure periodically reminds the user of these options. Omission from some implementations of recitations that repeat these options should not be taken as limiting the combinations taught in the preceding sections — these recitations are hereby incorporated forward by reference into each of the following implementations.
[0200] The following clauses may be combined or exchanged with one another.
[0201] Clause 1 is A method of analyte detection, comprising: contacting analytes of sample with a plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes; contacting the analyte-aptamer complexes with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-aptamer-capture oligonucleotide complexes; ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyteaptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
[0202] Clause 2 is a method of clause 1, wherein individual aptamers of the plurality of aptamers comprise biotin.
[0203] Clause 3 is a method of clause 1 or 2, wherein individual aptamers of the plurality of aptamers are immobilized on a substrate.
[0204] Clause 4 is method of any one of the preceding clauses, wherein an individual capture oligonucleotide comprises a functional group with a specific affinity to or reactivity with a subset of amino acids of the analytes and wherein the contacting causes the functional group to react with the amino acid of the subset to bind the functional group to the amino acid.
[0205] Clause 5 is a method of clause 4, wherein the functional group comprises oxaziridine, succinyl, or maleimide.
[0206] Clause 6 is a method of clause 4 or 5, wherein the functional group is coupled to a 3’ end or an internal nucleotide of the individual capture oligonucleotide.
[0207] Clause 7 is a method of any one of clauses of 4-6, wherein the 5’ end of the individual capture oligonucleotide is a 5-App.
[0208] Clause 8 is a method of any one of the preceding clauses, wherein the plurality of capture oligonucleotides has a same nucleotide sequence relative to one another.
[0209] Clause 9 is a method of clause 6, wherein the plurality of capture oligonucleotides comprises a mix of different functional groups, each different functional group having affinity to or reactivity with a different subset of amino acids.
[0210] Clause 10 is a method of any one of the preceding clauses, wherein the capture oligonucleotides are associated via covalent binding or cross-linking to one or more amino acids of individual target analytes.
[0211] Clause 11 is a method of any one of the preceding clauses, wherein the plurality of capture oligonucleotides binds to two or more subsets of amino acids.
[0212] Clause 12 is a method of any one of the preceding clauses, wherein the plurality of capture oligonucleotides binds to three or more subsets of amino acids.
[0213] Clause 13 is a method of any one of the preceding clauses, wherein the portion of the ligated aptamers and capture oligonucleotides comprises an identification sequence uniquely identifying for the respective aptamers.
[0214] Clause 14 is a method of any one of the preceding clauses, wherein the portion of the ligated aptamers and capture oligonucleotides comprises a linker sequence.
[0215] Clause 15 is a method of any one of the preceding clauses, comprising providing free nucleic acids to react with unbound capture oligonucleotides.
[0216] Clause 16 is a method of any one of the preceding clauses, comprising disassociating the analytes from the ligated aptamers and capture oligonucleotides.
[0217] Clause 17 is a method of any one of the preceding clauses, wherein the individual capture oligonucleotide comprises a sample identification sequence.
[0218] Clause 18 is a method of any one of the preceding clauses, wherein the individual capture oligonucleotide comprises a 5’ A tail.
[0219] Clause 19 is a method of any one of the preceding clauses, wherein an individual aptamer comprises a first primer region and the individual capture oligonucleotide comprises a second primer region.
[0220] Clause 20 is a method of any one of the preceding clauses, wherein detecting the analytes of the sample based on the sequences of the ligated aptamers and capture oligonucleotides comprises amplifying the ligated aptamers and capture oligonucleotides using the first primer region and the second primer region.
[0221] Clause 21 is a method of any one of the preceding clauses, wherein the sample is contacted with the plurality of aptamers and the plurality of capture oligonucleotides co- currently.
[0222] Clause 22 is a method of any one of the preceding clauses, wherein an individual aptamer comprises: an analyte binding region; the second primer region; and an aptamer identification sequence.
[0223] Clause 23 is a method of any one of the preceding clauses, wherein the second primer region is positioned between the analyte binding region and the identification sequence.
[0224] Clause 24 is a method of any of one of the preceding clauses, wherein the aptamer identification sequence is positioned at a 3’ end of the individual aptamer.
[0225] Clause 25 is a method of any one of the preceding clauses, wherein a primer amplifies the second primer region and the identification sequence.
[0226] Clause 26 is a method of analyte detection, comprising: contacting analytes of sample with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-capture oligonucleotide complexes; contacting the analyte-capture oligonucleotide complexes with a plurality of aptamers to form analyte-aptamer-capture oligonucleotide complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes contacting the analyte-aptamer complexes; ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
[0227] Clause 27 is a method of clause 26, wherein individual aptamers of the plurality of aptamers comprise biotin.
[0228] Clause 28 is a method of clause 26 or 27, wherein individual aptamers of the plurality of aptamers are immobilized on a substrate.
[0229] Clause 29 is a method of any one of the preceding clauses, wherein an individual capture oligonucleotide comprises a functional group with a specific affinity to or reactivity with a subset of amino acids of the analytes.
[0230] Clause 30 is a method of any one of the preceding clauses, wherein the functional group comprises oxaziridine, succinyl, or mal eimide.
[0231] Clause 31 is a composition, comprising: a plurality of analytes of a sample bound to a respective plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes, and wherein the analytes comprise capture oligonucleotides crosslinked to one or more amino acids of each individual analyte such that an individual analyteaptamer complex comprises one or more capture oligonucleotides.
[0232] Clause 32 is a protein capture complex comprising: a solid surface; a plurality of aptamers comprising a tag and capable of being coupled to the solid surface via a surface binding moiety, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes; and a plurality of different analytes coupled to a plurality of capture oligonucleotides, wherein a capture oligonucleotide when in close proximity to the tag on an aptamer is capable of being linked.
[0233] Clause 33 is a protein capture complex of clause 32, wherein the aptamer tag is linked to the capture oligonucleotide via ligation.
[0234] Clause 34 is a protein capture complex of clause 32 and 33, wherein the aptamer comprises an analyte binding region; wherein the tag comprises a primer binding sequence region; and an aptamer identification sequence.
[0235] Clause 35 is a protein capture complex of any one of clauses 32-34, wherein the surface binding moiety is biotin and the solid surface is biotinylated such that the plurality of aptamers binds via biotin to the solid surface.
[0236] Clause 36 is a method of preparing a protein capture complex, the method comprising: providing (a) an aptamer comprising a surface binding moiety, and (b) providing an analyte coupled to a capture oligonucleotide; and adding a ligating agent, wherein when the aptamer is bound to the analyte in close proximity to the capture oligonucleotide, an end of the aptamer and an end of the capture oligonucleotide are ligated.
[0237] Clause 37 is a method of clause 36, further comprising: contacting the mixture of aptamer and analyte with a solid surface capable of binding a surface binding moiety, wherein the surface binding moiety on the aptamer can bind to the solid surface.
[0238] Clause 38 is method of clause 36, wherein the aptamer is contacted with a solid surface capable of binding the surface binding moiety of the aptamer such that the aptamers are bound to the solid surface prior to being exposed to the analyte.
[0239] Clause 39 is a method of any one of clauses 36-38, wherein the analyte is conjugated to the capture moiety via an amino acid modification or binding moiety.
[0240] Clause 40 is a method of analyte detection, comprising: contacting analytes of sample with a plurality of affinity binders to form analyte-affinity binder complexes, wherein individual affinity binders of the plurality of the affinity binders have a specific affinity for respective different analytes of the analytes; contacting the analyte-affinity binder complexes with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-affinity binder-capture oligonucleotide complexes; ligating an end of the affinity binder to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that affinity binders of the analyte-affinity binder-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated affinity binders and capture oligonucleotides.
[0241] Clause 41 is a method of analyte detection, comprising: modifying analytes of a sample with functional groups that specifically interact with a subset of amino acids of theanalytes to link the functional groups to only the subset of amino acids of the analytes; providing capture oligonucleotides that react with the functional groups to link the capture oligonucleotides to the subset of amino acids to form analyte-capture oligonucleotide complexes; contacting analyte-capture oligonucleotide complexes with a plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes, to form analyte-aptamer-capture oligonucleotide complexes; ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
[0242] Clause 42 is a method of analyte detection, comprising: contacting analytes of sample with a plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes; modifying analytes of the analyte-aptamer complexes with functional groups that specifically interact with a subset of amino acids of the analytes to link the functional groups to only the subset of amino acids of the analytes; providing functionalized capture oligonucleotides that react with the functional groups to link the capture oligonucleotides to the subset of amino acids to form analyte-aptamer-capture oligonucleotide complexes; ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
[0243] Clause 43 is a method of claim 41 or 42, wherein the functionalized capture oligonucleotides are provided in an excess amount relative to the functional groups, optionally wherein the excess amount is at least 5x or at least lOx relative to the concentration of functional groups in a reaction used to modify the analytes.
Claims
CLAIMSWhat is claimed is:
1. A method of analyte detection, comprising: contacting analytes of sample with a plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes; contacting the analyte-aptamer complexes with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-aptamer-capture oligonucleotide complexes; ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
2. The method of claim 1, wherein individual aptamers of the plurality of aptamers comprise biotin.
3. The method of claim 1 or 2, wherein individual aptamers of the plurality of aptamers are immobilized on a substrate.
4. The method of any one of the preceding claims, wherein an individual capture oligonucleotide comprises a functional group with a specific affinity to or reactivity with a subset of amino acids of the analytes and wherein the contacting causes the functional group to react with the amino acid of the subset to bind the functional group to the amino acid.
5. The method of claim 4, wherein the functional group comprises oxaziridine, succinyl, or maleimide.
6. The method of claim 4 or 5, wherein the functional group is coupled to a 3’ end or an internal nucleotide of the individual capture oligonucleotide.
7. The method of any one of claims 4-6, wherein the 5’ end of the individual capture oligonucleotide is a 5-App.
8. The method of any one of the preceding claims, wherein the plurality of capture oligonucleotides has a same nucleotide sequence relative to one another.
9. The method of claim 6, wherein the plurality of capture oligonucleotides comprises a mix of different functional groups, each different functional group having affinity to or reactivity with a different subset of amino acids.
10. The method of any one of the preceding claims, wherein the capture oligonucleotides are associated via covalent binding or cross-linking to one or more amino acids of individual target analytes.
11. The method of any one of the preceding claims, wherein the plurality of capture oligonucleotides binds to two or more subsets of amino acids.
12. The method of any one of the preceding claims, wherein the plurality of capture oligonucleotides binds to three or more subsets of amino acids.
13. The method of any one of the preceding claims, wherein the portion of the ligated aptamers and capture oligonucleotides comprises an identification sequence uniquely identifying for the respective aptamers.
14. The method of any one of the preceding claims, wherein the portion of the ligated aptamers and capture oligonucleotides comprises a linker sequence.
15. The method of any one of the preceding claims, comprising providing free nucleic acids to react with unbound capture oligonucleotides.
16. The method of any one of the preceding claims, comprising disassociating the analytes from the ligated aptamers and capture oligonucleotides.
17. The method of any one of the preceding claims, wherein the individual capture oligonucleotide comprises a sample identification sequence.
18. The method of any one of the preceding claims, wherein the individual capture oligonucleotide comprises a 5’ A tail.
19. The method of any one of the preceding claims, wherein an individual aptamer comprises a first primer region and the individual capture oligonucleotide comprises a second primer region.
20. The method of any one of the preceding claims, wherein detecting the analytes of the sample based on the sequences of the ligated aptamers and capture oligonucleotides comprises amplifying the ligated aptamers and capture oligonucleotides using the first primer region and the second primer region.
21. The method of any one of the preceding claims, wherein the sample is contacted with the plurality of aptamers and the plurality of capture oligonucleotides co-currently.
22. The method of any one of the preceding claims, wherein an individual aptamer comprises: an analyte binding region;the second primer region; and an aptamer identification sequence.
23. The method of any one of the preceding claims, wherein the second primer region is positioned between the analyte binding region and the identification sequence.
24. The method of any of one of the preceding claims, wherein the aptamer identification sequence is positioned at a 3’ end of the individual aptamer.
25. The method of any one of the preceding claims, wherein a primer amplifies the second primer region and the identification sequence.
26. A method of analyte detection, comprising: contacting analytes of sample with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analytecapture oligonucleotide complexes; contacting the analyte-capture oligonucleotide complexes with a plurality of aptamers to form analyte-aptamer-capture oligonucleotide complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes contacting the analyte-aptamer complexes; ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
27. The method of claim 26, wherein individual aptamers of the plurality of aptamers comprise biotin.
28. The method of claim 26 or 27, wherein individual aptamers of the plurality of aptamers are immobilized on a substrate.
29. The method of any one of the preceding claims, wherein an individual capture oligonucleotide comprises a functional group with a specific affinity to or reactivity with a subset of amino acids of the analytes.
30. The method of any one of the preceding claims, wherein the functional group comprises oxaziridine, succinyl, or maleimide.
31. A composition, comprising: a plurality of analytes of a sample bound to a respective plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes, and wherein the analytes comprise capture oligonucleotides cross-linked to one or more amino acids of each individual analyte such that an individual analyte-aptamer complex comprises one or more capture oligonucleotides.
32. A protein capture complex comprising: a solid surface; a plurality of aptamers comprising a tag and capable of being coupled to the solid surface via a surface binding moiety, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes; and a plurality of different analytes coupled to a plurality of capture oligonucleotides, wherein a capture oligonucleotide when in close proximity to the tag on an aptamer is capable of being linked.
33. The protein capture complex of claim 32, wherein the aptamer tag is linked to the capture oligonucleotide via ligation.
34. The protein capture complex of claim 32 and 33, wherein the aptamer comprises an analyte binding region; wherein the tag comprises a primer binding sequence region; and an aptamer identification sequence.
35. The protein capture complex of any one of claims 32-34, wherein the surface binding moiety is biotin and the solid surface is biotinylated such that the plurality of aptamers binds via biotin to the solid surface.
36. A method of preparing a protein capture complex, the method comprising: providing(a) an aptamer comprising a surface binding moiety, and(b) providing an analyte coupled to a capture oligonucleotide; and adding a ligating agent, wherein when the aptamer is bound to the analyte in close proximity to the capture oligonucleotide, an end of the aptamer and an end of the capture oligonucleotide are ligated.
37. The method of claim 36, further comprising: contacting the mixture of aptamer and analyte with a solid surface capable of binding a surface binding moiety, wherein the surface binding moiety on the aptamer can bind to the solid surface.
38. The method of claim 36, wherein the aptamer is contacted with a solid surface capable of binding the surface binding moiety of the aptamer such that the aptamers are bound to the solid surface prior to being exposed to the analyte.
39. The method of any one of claims 36-38, wherein the analyte is conjugated to the capture moiety via an amino acid modification or binding moiety.
40. A method of analyte detection, comprising: contacting analytes of sample with a plurality of affinity binders to form analyteaffinity binder complexes, wherein individual affinity binders of the plurality of the affinity binders have a specific affinity for respective different analytes of the analytes; contacting the analyte-affinity binder complexes with a plurality of capture oligonucleotides to associate each individual analyte with one or more capture oligonucleotides to form analyte-affinity binder-capture oligonucleotide complexes; ligating an end of the affinity binder to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that affinity binders of the analyte-affinity binder-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated affinity binders and capture oligonucleotides.
41. A method of analyte detection, comprising: modifying analytes of a sample with functional groups that specifically interact with a subset of amino acids of the analytes to link the functional groups to only the subset of amino acids of the analytes; providing capture oligonucleotides that react with the functional groups to link the capture oligonucleotides to the subset of amino acids to form analyte-capture oligonucleotide complexes; contacting analyte-capture oligonucleotide complexes with a plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes, to form analyte-aptamer-capture oligonucleotide complexes;ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
42. A method of analyte detection, comprising: contacting analytes of sample with a plurality of aptamers to form analyte-aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes; modifying analytes of the analyte-aptamer complexes with functional groups that specifically interact with a subset of amino acids of the analytes to link the functional groups to only the subset of amino acids of the analytes; providing functionalized capture oligonucleotides that react with the functional groups to link the capture oligonucleotides to the subset of amino acids to form analyteaptamer-capture oligonucleotide complexes; ligating an end of an aptamer to an end of an individual capture oligonucleotide within an individual analyte-aptamer-capture oligonucleotide complex such that aptamers of the analyte-aptamer-capture oligonucleotide complexes are ligated to respective capture oligonucleotides; and detecting the analytes of the sample based on sequences of a portion of the ligated aptamers and capture oligonucleotides.
43. The method of claim 41 or 42, wherein the functionalized capture oligonucleotides are provided in an excess amount relative to the functional groups, optionally wherein the excess amount is at least 5x or at least lOx relative to the concentration of functional groups in a reaction used to modify the analytes.
Citation Information
Patent Citations
Method of nucleic acid amplification
US20050100900A1
Labelled nucleotides
US20060188901A1
Modified polymerases for improved incorporation of nucleotide analogues
US20060240439A1
Polymerases
US20060281109A1
Modified nucleotides
US20070166705A1