Biosynthesis method for efficiently producing aromatic unnatural amino acids and site-specifically modified recombinant proteins, engineered strain, and use thereof

By introducing genes for threonine aldolase, threonine deaminase, and transaminase into engineered strains, a whole-cell catalytic pathway was constructed to synthesize aromatic non-natural amino acids and achieve site-specific modification. This solves the problems of complex synthesis pathways and low yields in existing technologies, achieving efficient production and cost reduction. It is suitable for protein function regulation and industrial applications with diverse functional groups.

WO2026077378A1PCT designated stage Publication Date: 2026-04-16SHANGHAI INSTITUTE OF MATERIA MEDICA CHINESE ACADEMY OF SCIENCES
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/126453
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-10
Filing Date
2025-10-09
Publication Date
2026-04-16

AI Technical Summary

Technical Problem

Existing technologies for the biosynthesis of non-natural amino acids are complex, have low yields, and require expensive precursor small molecules, making it difficult to achieve efficient and concise synthesis. Furthermore, the synthesis of aromatic non-natural amino acids used in genetic code expansion is limited and cannot meet the needs of large-scale production of recombinant proteins.

Method used

By introducing genes for threonine aldolase, threonine deaminase, and transaminase into engineered strains, a whole-cell catalytic pathway was constructed. Using aromatic aldehydes as substrates, aromatic non-natural amino acids were synthesized through a cascade reaction. Mutated aminoacyl-tRNA synthetase and target recombinant proteins were expressed in E. coli to achieve site-directed modification.

Benefits of technology

It enables the efficient production of aromatic non-natural amino acids and site-directed modified recombinant proteins, improves synthesis efficiency and reduces costs, expands the synthesis range, and is suitable for protein function regulation and industrial applications with diverse functional groups.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025126453-FTAPPB-I100001
    Figure PCTCN2025126453-FTAPPB-I100001
  • Figure PCTCN2025126453-FTAPPB-I100002
    Figure PCTCN2025126453-FTAPPB-I100002
  • Figure PCTCN2025126453-FTAPPB-I100003
    Figure PCTCN2025126453-FTAPPB-I100003
Patent Text Reader

Abstract

Provided in the present invention are a biosynthesis method for efficiently producing aromatic unnatural amino acids and site-specifically modified recombinant proteins, an engineered strain, and use thereof. Specifically, the present invention provides an engineered bacterium. Genes of exogenous enzymes, threonine aldolase and threonine deaminase, are introduced into the engineered bacterium, and the engineered bacterium expresses both the threonine aldolase and the threonine deaminase. The engineered bacterium of the present invention enables efficient synthesis of aromatic unnatural amino acids by means of whole-cell catalysis or fermentation transformation. The synthetic route of the present invention can be synergistically coupled with gene codon extension technology in the same engineered bacterium for efficient expression of recombinant target proteins site-specifically modified with aromatic unnatural amino acids.
Need to check novelty before this filing date? Find Prior Art

Description

Biosynthetic methods, engineered strains, and applications for the efficient production of aromatic non-natural amino acids and site-directed modified recombinant proteins Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a biosynthetic method for the efficient production of aromatic non-natural amino acids and site-modified recombinant proteins, engineered strains, and their applications. Background Technology

[0002] Proteins participate in almost all biological processes in the body, including cytoskeleton formation, signal transduction, anabolic metabolism, transcriptional regulation, and substance transport. Their structure and function are determined by the arrangement and combination of 20 natural amino acids and the interactions between their side chains. However, the types and properties of non-natural amino acids far exceed those of natural amino acids, yet their utilization rate in proteins is very low. The development of genetic code expansion technology has greatly expanded the structure and function of novel proteins. This technology utilizes exogenous aminoacyl-tRNA synthetase / tRNA pairs (aaRS / tRNA) orthogonal to the host, and with the help of special codons (such as stop codons and tetracodons), encodes non-natural amino acids at specific sites on the target protein, successfully achieving site-directed protein modification.

[0003] Aromatic non-natural amino acids, as crucial raw materials for genetic code expansion technology, play a key role in the development of antibody-drug conjugates or novel vaccines, as well as in the regulation of protein functions such as covalent cross-linking, metal chelation, and post-translational modifications. These functionally diverse proteins can serve as highly efficient diagnostic tools or therapeutic agents in research on tumors and immune system diseases. In the field of enzyme engineering, the introduction of aromatic non-natural amino acids containing diverse functional groups through genetic code expansion can effectively improve the catalytic activity, thermal stability, and stereoselectivity of enzymes, or introduce novel catalytic functions into artificial enzyme design.

[0004] Currently, genetic code expansion technology almost entirely relies on the addition of non-natural amino acids to the culture medium, both internally and externally. However, many L-type chiral pure non-natural amino acids are expensive or require complex chemical synthesis pathways. Furthermore, some non-natural amino acids cannot be efficiently transported from in vitro to intracellular environments, thus limiting the large-scale production of such recombinant proteins. In recent years, researchers have attempted to use metabolic engineering to de novo synthesize some aromatic non-natural amino acids and apply them in situ within cells for genetic code expansion. For example, Han Xiao et al. utilized various metabolic pathways of E. coli, combined with heterologously expressed transaminases, phenylalanine hydroxylases, or tyrosine sulfotransferases, to synthesize 4-aminophenylalanine, hydroxytryptophan, and sulfonated tyrosine for small molecule conjugation with antibodies, fluorescent labeling, or tumor cell detection. However, such methods can only synthesize single types of non-natural amino acids and cannot yield amino acids containing other functional groups. In contrast, the strategy of overexpressing certain key synthases to catalyze the conversion of inexpensive small molecule precursor compounds into target non-natural amino acids has effectively expanded the scope of synthesis. However, there are few reports on the in-situ synthesis and insertion into target proteins of aromatic non-natural amino acids, which are the most widely used in genetic code expansion. Only Jae-Eun Jung et al. used overexpressed transaminases to synthesize corresponding phenylalanine derivatives and insert them into target proteins in situ using phenylpyruvate derivatives as precursors. This strategy still faces the problem that phenylpyruvate precursors are expensive and difficult to obtain.

[0005] Therefore, although the strategy of combining the biosynthesis of non-natural amino acids with genetic code expansion has achieved some success, many problems still exist: the substrate range is narrow and the types of amino acids synthesized are limited; the existing biosynthetic pathways are complex and the yield of non-natural amino acids is low, which is insufficient for downstream target protein synthesis, i.e., there is a lack of efficient and concise synthetic routes; many precursor small molecule raw materials are expensive or still require chemical synthesis, resulting in low industrial application value.

[0006] Therefore, there is an urgent need in this field to develop a new method to obtain high yields of recombinant proteins with site-directed modification of non-natural amino acids. Summary of the Invention

[0007] This invention provides a novel method for obtaining high-yield recombinant proteins with site-directed modification of non-natural amino acids.

[0008] In a first aspect of the invention, an engineered bacterium is provided, wherein genes for one or more exogenous enzymes selected from the group consisting of threonine aldolase, threonine deaminase, and transaminase are introduced into the engineered bacterium; and the engineered bacterium simultaneously expresses threonine aldolase, threonine deaminase, and transaminase.

[0009] In another preferred embodiment, when one exogenous enzyme is introduced, the other two enzymes are endogenous enzymes of the engineered bacteria; when two exogenous enzymes are introduced, the other enzyme is an endogenous enzyme of the engineered bacteria.

[0010] In another preferred embodiment, the starting strain of the engineered bacteria is a prokaryote or a eukaryote.

[0011] In another preferred embodiment, the starting strain of the engineered bacteria is selected from the group consisting of yeast, Pichia pastoris, Escherichia coli, Bacillus subtilis, Aspergillus niger, or combinations thereof.

[0012] In another preferred embodiment, the starting strain of the engineered bacteria is Escherichia coli.

[0013] In another preferred embodiment, the Escherichia coli is E. coli BL21(DE3), E. coli MG1655(DE3), or E. coli RARE(DE3).

[0014] In another preferred embodiment, the Escherichia coli is E. coli RARE(DE3).

[0015] In another preferred embodiment, the E. coli RARE(DE3) is obtained by modifying the E. coli MG1655(DE3) genome, the modification including knocking out the following aldehyde and ketone reduction-related genes: ΔdkgB, ΔyeaE, Δ(yqhC-dkgA), ΔyahK, and ΔyjgB.

[0016] In another preferred embodiment, when the starting strain of the engineered bacteria is Escherichia coli, the engineered bacteria are introduced and express the following exogenous enzyme genes: threonine aldolase and threonine deaminase, and express the following endogenous enzyme gene: transaminase.

[0017] In another preferred embodiment, the threonine aldolase is selected from the group consisting of:

[0018] PpLTA, whose nucleotide sequence is shown in SEQ ID NO.1;

[0019] LmLTA, whose nucleotide sequence is shown in SEQ ID NO.2;

[0020] NmLTA, whose nucleotide sequence is shown in SEQ ID NO.3;

[0021] CsLTA, whose nucleotide sequence is shown in SEQ ID NO.4;

[0022] Or a combination thereof.

[0023] In another preferred embodiment, the nucleotide sequence of the threonine aldolase is shown as selected from the group consisting of: SEQ ID NO.1 (PpLTA sequence), SEQ ID NO.2 (LmLTA sequence), SEQ ID NO.3 (NmLTA sequence), SEQ ID NO.4 (CsLTA sequence), or combinations thereof.

[0024] In another preferred embodiment, the nucleotide sequence of the threonine deaminase is shown in SEQ ID NO.5.

[0025] In another preferred embodiment, the transaminase is a transaminase derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO.6.

[0026] In another preferred embodiment, the engineered bacteria are grown at 37°C to the logarithmic growth phase (OD). 600 =0.8~1.0) through induced expression.

[0027] In another preferred embodiment, the induced expression conditions are as follows:

[0028] The induction temperature is 16–37°C, preferably 18–30°C;

[0029] The amount of IPTG inducer added is 0.1-1 mM to a final concentration, preferably 0.5-1 mM;

[0030] The induction time is 6 to 8 hours, preferably 8 to 12 hours.

[0031] In another preferred embodiment, the method for preparing the engineered bacteria includes: inserting the gene of one or more exogenous enzymes selected from the group consisting of: threonine aldolase, threonine deaminase, and transaminase into an expression vector to obtain a recombinant vector; then transforming the recombinant vector into a starting strain and culturing and screening to obtain engineered bacteria that produce aromatic non-natural amino acids.

[0032] In another preferred embodiment, the expression vector is pACYCDuet-1 or pCDFDuet-1.

[0033] In another preferred embodiment, the nucleotide sequence of the expression vector is shown in SEQ ID NO.7.

[0034] In a second aspect of the invention, a whole-cell catalyst is provided, the whole-cell catalyst containing the engineered bacteria described in the first aspect of the invention.

[0035] In a third aspect of the invention, the use of engineered bacteria as described in the first aspect of the invention or whole-cell catalysts as described in the second aspect of the invention is provided for the synthesis of aromatic non-natural amino acids.

[0036] In another preferred embodiment, the aromatic non-natural amino acid comprises the compound shown in formula (1).

[0037] Among them, ring A is selected from C6 to C6. 10 Aryl, 5-12 membered heteroaryl or heterocyclic group, wherein each heteroaryl or heterocyclic group independently comprises 1-4 lower group ring atoms: N, O, S;

[0038] The substituents R on ring A are each independently selected from the following group: hydrogen, deuterium, halogen, nitro, hydroxyl, mercapto, amino, carboxyl, cyano, acyl, sulfonyl, aminoacyl, aminosulfonyl, borate, alkenyl, alkynyl, trifluoromethyl, trifluoromethoxy, C1-C6 alkyl, O-C1-C6 alkyl, NH-C1-C6 alkyl, S-C1-C6 alkyl, and C1-C6 alkyl, C1-C6 alkoxy, NH-C1-C6 alkyl, S-C1-C6 alkyl containing substituents, C3-C8 saturated or unsaturated carbocyclic groups, 3-8 membered saturated or unsaturated heterocyclic groups, C6-C8 aryl, 5-8 membered heteroaryl. The substituents may be located at the ortho, meta, or para positions, or may coexist in any 2-3 different positions.

[0039] m is an integer between 0 and 3, and n is an integer between 1 and 4, i.e., C1 to C4;

[0040] The carbon atom at * has an S-type configuration.

[0041] In another preferred embodiment, when R is a substituent containing a C2 to C6 alkyl group, it has the general formula shown in formula (2):

[0042] Among them, G 1 Each atom is independently selected from the following group: C, N, O, S;

[0043] x is an integer between 2 and 5, i.e., C2 to C5;

[0044] G 2 Each group is independently selected from the following groups: H, halogen, nitro, hydroxyl, mercapto, amino, carboxyl, cyano, acyl, sulfonyl, aminoacyl, aminosulfonyl, borate, alkenyl, alkynyl, O-C1~C6 alkyl, NH-C1~C6 alkyl, S-C1~C6 alkyl, C3~C8 saturated or unsaturated carbocyclic group, 3~8 membered saturated or unsaturated heterocyclic group, C6~C8 aryl, 5~8 membered heteroaryl.

[0045] In another preferred embodiment, when R is an acyl group, it has the general formula shown in equation (3):

[0046] Among them, G 3The substituent is independently selected from the following group: C1-C6 alkyl groups and C1-C6 alkyl groups substituted with halogen, nitro, hydroxyl, mercapto, amino, cyano, acyl, or borate; C6-C8 aryl groups, 5-8 heteroaryl groups and C6-C8 aryl groups, 5-8 heteroaryl groups substituted with halogen, nitro, hydroxyl, mercapto, amino, cyano, borate, trifluoromethyl, or trifluoromethoxy, wherein the substituent may be located at the ortho, meta, or para position, or may coexist at any 2-3 different positions.

[0047] In a fourth aspect of the present invention, a method for producing aromatic non-natural amino acids is provided, the method comprising: using aromatic aldehydes as substrates, and employing engineered bacteria as described in the first aspect of the present invention for whole-cell catalytic or fermentation transformation to obtain the aromatic non-natural amino acids, wherein the aromatic non-natural amino acids are as shown in formula (1):

[0048] Among them, ring A is selected from C6 to C6. 10 Aryl, 5-12 membered heteroaryl or heterocyclic group, wherein each heteroaryl or heterocyclic group independently comprises 1-4 lower group ring atoms: N, O, S;

[0049] The substituents R on ring A are each independently selected from the following group: hydrogen, deuterium, halogen, nitro, hydroxyl, mercapto, amino, carboxyl, cyano, acyl, sulfonyl, aminoacyl, aminosulfonyl, borate, alkenyl, alkynyl, trifluoromethyl, trifluoromethoxy, C1-C6 alkyl, O-C1-C6 alkyl, NH-C1-C6 alkyl, S-C1-C6 alkyl, and C1-C6 alkyl, C1-C6 alkoxy, NH-C1-C6 alkyl, S-C1-C6 alkyl containing substituents, C3-C8 saturated or unsaturated carbocyclic groups, 3-8 membered saturated or unsaturated heterocyclic groups, C6-C8 aryl, 5-8 membered heteroaryl. The substituents may be located at the ortho, meta, or para positions, or may coexist in any 2-3 different positions.

[0050] m is an integer between 0 and 3, and n is an integer between 1 and 4, i.e., C1 to C4;

[0051] The carbon atom at * has an S-type configuration.

[0052] In another preferred embodiment, the method uses aromatic aldehydes or aromatic aldehydes as starting materials, and obtains the target product, aromatic non-natural amino acids, by co-expressing threonine aldolase, threonine deaminase and transaminase in the engineered bacteria to form a cascade pathway, and by whole-cell catalysis or fermentation transformation.

[0053] In another preferred embodiment, the aromatic aldehyde is selected from any of the following aromatic aldehydes, or a combination thereof:

[0054] In another preferred embodiment, the reaction system also includes a cosubstrate and a cofactor.

[0055] In another preferred embodiment, the cofactor is pyridoxal 5'-phosphate (PLP).

[0056] In another preferred embodiment, the co-substrate comprises: glycine (Gly) and L -Glutamic acid ( L -Glu).

[0057] In another preferred embodiment, the whole-cell catalytic reaction system further includes a co-solvent.

[0058] In another preferred embodiment, the co-solvent is an organic solvent.

[0059] In another preferred embodiment, the cosolvent is selected from the group consisting of dimethyl sulfoxide, methanol, ethanol, isopropanol, or combinations thereof.

[0060] In another preferred embodiment, the cosolvent is dimethyl sulfoxide.

[0061] In another preferred embodiment, the co-solvent accounts for 5 to 25% of the total volume of the reaction system.

[0062] In another preferred embodiment, the reaction system further includes a catalyst.

[0063] In another preferred embodiment, during whole-cell catalysis, the reaction buffer in the reaction system is a phosphate buffer, Tris-HCl buffer, ammonium acetate buffer, or HEPES-NaOH buffer; preferably, it is a phosphate buffer.

[0064] In another preferred embodiment, the concentration of aromatic aldehyde in the reaction system is 0.5–200 mM.

[0065] In another preferred embodiment, the concentration of aromatic aldehydes during whole-cell catalysis is 10–35 mM.

[0066] In another preferred embodiment, the concentration of aromatic aldehydes during fermentation conversion is 0.5–5 mM.

[0067] In another preferred embodiment, the PLP concentration is 0.01–1 mM, preferably 0.01–0.2 nM.

[0068] In another preferred embodiment, the Gly concentration is 10 mM to 500 mM.

[0069] In another preferred embodiment, the Gly concentration is 60–180 mM during whole-cell catalysis.

[0070] In another preferred embodiment, the Gly concentration is 30–100 nM during fermentation conversion.

[0071] In another preferred embodiment, the L - The concentration of Glu is 10-250 nM.

[0072] In another preferred embodiment, during whole-cell catalysis, the... L - The concentration of Glu is 60–200 nM.

[0073] In another preferred embodiment, during fermentation and conversion, it is not necessary to add the aforementioned substance to the reaction system. L -Glu.

[0074] In another preferred embodiment, the reaction is carried out at 20–37°C, preferably 25–30°C.

[0075] In another preferred embodiment, during fermentation conversion, the engineered bacteria are grown at 37°C to the logarithmic growth phase (OD). 600 =0.8~1.0) through induced expression and biosynthesis.

[0076] In another preferred embodiment, the induced expression conditions are as follows:

[0077] The induction temperature is 16–37°C, preferably 18–30°C;

[0078] The amount of IPTG inducer added is 0.1-1 mM to a final concentration, preferably 0.5-1 mM;

[0079] The induction time is 6 to 8 hours, preferably 8 to 12 hours.

[0080] In another preferred embodiment, the reaction pathway of whole-cell catalysis and / or fermentation transformation is to obtain the compound of formula (1) under the catalysis of a three-enzyme cascade:

[0081] The catalyst is selected from threonine aldolases (LTAs), threonine deaminases (TDs), and transaminases (TyrB); and the reaction includes a co-substrate and a cofactor.

[0082] In a preferred embodiment of the present invention, a method for biosynthesizing compounds of formula (1) or pharmaceutically acceptable salts thereof as described in the first aspect of the present invention is provided. The method uses aromatic aldehydes as starting materials and obtains the target product, aromatic non-natural amino acids, by co-expressing exogenous threonine aldolase and threonine deaminase in Escherichia coli and combining them with their own transaminase to form a cascade pathway, using whole-cell catalysis or fermentation.

[0083] The engineered bacteria are introduced with genes for one or more exogenous enzymes selected from the group consisting of threonine aldolase, threonine deaminase, and transaminase; and the threonine aldolase, threonine deaminase, and transaminase are co-expressed in the engineered bacteria.

[0084] In another preferred embodiment, the threonine aldolase, threonine deaminase, and transaminase are not secreted into the extracellular space of the engineered bacteria.

[0085] In another preferred embodiment, the aromatic aldehyde enters the engineered bacteria to react, and the compound of formula (1) generated after the reaction is secreted into the extracellular space of the engineered bacteria.

[0086] In another preferred embodiment, when the engineered bacteria is Escherichia coli, the Escherichia coli contains endogenous transaminases, and exogenous threonine aldolase and threonine deaminase are introduced and expressed in the Escherichia coli.

[0087] In another preferred embodiment, the threonine aldolase and threonine deaminase are co-expressed using a single plasmid with a dual cloning site, or expressed separately using two different plasmids.

[0088] In another preferred embodiment, the threonine aldolase and threonine deaminase are co-expressed using a single plasmid with a dual cloning site.

[0089] In another preferred embodiment, the threonine aldolase and threonine deaminase are co-expressed using pACYCDuet-1 or pCDFDuet-1 as vectors.

[0090] In another preferred embodiment, when R is a substituent containing a C2 to C6 alkyl group, it has the general formula shown in formula (2):

[0091] Among them, G 1 Each atom is independently selected from the following group: C, N, O, S;

[0092] x is an integer between 2 and 5, i.e., C2 to C5;

[0093] G 2 Each group is independently selected from the following groups: H, halogen, nitro, hydroxyl, mercapto, amino, carboxyl, cyano, acyl, sulfonyl, aminoacyl, aminosulfonyl, borate, alkenyl, alkynyl, O-C1~C6 alkyl, NH-C1~C6 alkyl, S-C1~C6 alkyl, C3~C8 saturated or unsaturated carbocyclic group, 3~8 membered saturated or unsaturated heterocyclic group, C6~C8 aryl, 5~8 membered heteroaryl.

[0094] In another preferred embodiment, when R is an acyl group, it has the general formula shown in equation (3):

[0095] Among them, G3 The substituent is independently selected from the following group: C1-C6 alkyl groups and C1-C6 alkyl groups substituted with halogen, nitro, hydroxyl, mercapto, amino, cyano, acyl, or borate; C6-C8 aryl groups, 5-8 heteroaryl groups and C6-C8 aryl groups, 5-8 heteroaryl groups substituted with halogen, nitro, hydroxyl, mercapto, amino, cyano, borate, trifluoromethyl, or trifluoromethoxy, wherein the substituent may be located at the ortho, meta, or para position, or may coexist at any 2-3 different positions.

[0096] In another preferred embodiment, the nucleotide sequence of the threonine aldolase is selected from the group consisting of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, or combinations thereof.

[0097] In another preferred embodiment, the nucleotide sequence of the threonine deaminase is shown in SEQ ID NO.5.

[0098] In another preferred embodiment, the nucleotide sequence of the transaminase is shown in SEQ ID NO.6.

[0099] In another preferred embodiment, the threonine aldolase, threonine deaminase, and transaminase have an amino acid sequence obtained by substituting, deleting, or inserting one or more amino acids within the range of maintaining enzyme activity.

[0100] In another preferred embodiment, the compounds of formula (1) include the following specific compounds:

[0101] In a fifth aspect of the invention, a second engineered bacterium for producing a target recombinant protein is provided, wherein the second engineered bacterium incorporates and expresses the following genes into the engineered bacterium described in the first aspect of the invention:

[0102] (1) A mutated aminoacyl-tRNA synthetase (aaRS) gene and a corresponding tRNA gene, wherein the mutated aminoacyl-tRNA synthetase is capable of recognizing the aromatic non-natural amino acids described in the third or fourth aspect of the present invention and assembling them into the tRNA.

[0103] The codon for the aromatic non-natural amino acid is TAG;

[0104] (2) The target recombinant protein gene, wherein the target recombinant protein gene is based on the original target protein gene, and a codon at a specific site is mutated to the stop codon TAG; and

[0105] Optionally, (3) purify the tag.

[0106] In another preferred embodiment, the tRNA can transport the aromatic non-natural amino acid to a specific site on the target recombinant protein during translation.

[0107] In another preferred embodiment, the codons for the aromatic non-natural amino acids may also be other triplet or quadruple codons. In yet another preferred embodiment, the target recombinant protein gene is modified by mutating the codons at specific sites of the original target protein gene to other triplet or quadruple codons.

[0108] In another preferred embodiment, the position of the stop codon TAG is the modification position of the aromatic non-natural amino acid.

[0109] In another preferred embodiment, the mutant aminoacyl-tRNA synthetase is a mutant of aminoacyl-tRNA synthetase selected from the group consisting of MmPylRS, MbPylRS, MjTyrRS, or a combination thereof.

[0110] In another preferred embodiment, the purification tag includes a His6 tag.

[0111] In another preferred embodiment, the target protein has at least 50% or higher similarity to existing proteins such as therapeutic or diagnostic proteins or peptide drugs, antibodies, industrial enzymes, and fragments thereof, which contain one or more non-natural amino acids.

[0112] In another preferred embodiment, the starting strain of the engineered bacteria is a prokaryote or a eukaryote.

[0113] In another preferred embodiment, the starting strain of the engineered bacteria is selected from the group consisting of: Escherichia coli, yeast, Pichia pastoris, Bacillus subtilis, Aspergillus niger, or combinations thereof.

[0114] In another preferred embodiment, the starting strain of the second engineered bacterium is Escherichia coli, which simultaneously expresses threonine aldolase, threonine deaminase and transaminase, mutated aminoacyl-tRNA synthetase (aaRS) and its corresponding tRNA, and the target recombinant protein;

[0115] The threonine aldolase and threonine deaminase are introduced and expressed from exogenous genes, while the transaminase is an endogenous enzyme of the Escherichia coli itself.

[0116] In another preferred embodiment, the starting strain of the engineered bacteria is E. coli RARE(DE3).

[0117] In another preferred embodiment, the engineered bacteria are co-expressed using three different plasmids: threonine aldolase and threonine deaminase, a mutated aminoacyl-tRNA synthetase and its corresponding tRNA, and the target recombinant protein with a TAG mutation.

[0118] In another preferred embodiment, the target recombinant protein with the TAG mutation refers to the target recombinant protein gene having a specific site codon mutated to the stop codon TAG, based on the original target protein gene.

[0119] In another preferred embodiment, the threonine aldolase and threonine deaminase are co-expressed on a single plasmid with a dual cloning site, preferably pACYCDuet-1; the mutated aminoacyl-tRNA synthetase and its corresponding tRNA are expressed on the pCDF plasmid or the pUltra plasmid; and the target recombinant protein with the TAG mutation is expressed on the pET22b plasmid.

[0120] In another preferred embodiment, the protein is within its activity range, and the vector is replaced to obtain a combination of three plasmids with different replicons and resistance.

[0121] In another preferred embodiment, the target recombinant protein includes an enzyme.

[0122] In another preferred embodiment, the enzyme includes: novel enzymes modified with aromatic non-natural amino acids containing diverse groups as required in the field of enzyme engineering, and artificial enzymes in which aromatic non-natural amino acids containing catalytic groups are introduced into a protein backbone (such as LmrR, QacR, CgmR, etc.) that does not have catalytic function.

[0123] In another preferred embodiment, the novel enzyme and / or artificial enzyme is used for one or more of the following purposes:

[0124] (a) Enhance enzyme catalytic activity;

[0125] (b) Improve enzyme thermal stability;

[0126] (c) Improve enzyme stereoselectivity;

[0127] (d) Acquire entirely new catalytic functions.

[0128] In a sixth aspect of the invention, a method for producing a recombinant protein with site-directed insertion of an aromatic non-natural amino acid is provided, comprising the steps of:

[0129] (a) The second engineered bacteria described in the fifth aspect of the present invention is cultured under suitable culturing conditions to obtain a culture; and

[0130] (b) Isolate the recombinant protein from the culture.

[0131] In another preferred embodiment, the culture conditions are as follows: the second engineered bacteria are grown to the logarithmic phase (OD600 = 0.8-1.0) in a medium containing triple antibiotics at 37°C, and then induced for expression and fermentation transformation. The induction temperature is 25-30°C, the amount of IPTG added as the inducer is 0.5-1 mM, the amount of aromatic aldehyde substrate added is 1-5 mM, the amount of cofactor PLP added is 0.01-0.2 mM, the amount of Gly added is 30-100 mM, and the induction time is 20-24 h.

[0132] In another preferred embodiment, the recombinant protein includes a target recombinant protein containing one or more non-natural amino acid site-directed modifications, the target recombinant protein including target recombinant proteins linked to different coupling agents, and the coupling agent being a drug molecule, a fluorescent molecule, or PEG.

[0133] In another preferred embodiment, the target recombinant protein linked to different coupling agents is used for one or more purposes selected from the group consisting of:

[0134] (a) Fluorescent imaging agent;

[0135] (b) Therapeutic drugs.

[0136] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0137] Figure 1 shows the biosynthetic pathway of aromatic non-natural amino acids constructed according to an embodiment of the present invention.

[0138] Figure 2 shows the plasmid map constructed in an embodiment of the present invention for co-expressing threonine aldolase and threonine deaminase.

[0139] Figure 3 shows the expression of threonine aldolase and threonine deaminase in the engineered strain prepared for the synthesis of aromatic non-natural amino acids in an embodiment of the present invention.

[0140] Figures 4a-b show the reaction verification and reaction progress curves of the whole-cell catalytic synthesis of aromatic non-natural amino acids using this cascade pathway in an embodiment of the present invention.

[0141] Figures 5a-e show the optimization results of whole-cell catalytic reaction conditions in the embodiments of the present invention.

[0142] Figure 6 shows an embodiment of the present invention demonstrating the reaction verification of Escherichia coli fermentation to produce aromatic non-natural amino acids using this cascade pathway.

[0143] Figures 7a-b show the substrate screening results for the fermentation production of aromatic non-natural amino acids by Escherichia coli.

[0144] Figure 8 shows the pCDF-MmpIFRS-tRNA constructed in an embodiment of the present invention. Pyl and pUltra-pBoFRS-tRNA Tyr Plasmid map.

[0145] Figure 9 shows the pET22b-sfGFP(Y151TAG) plasmid constructed in an embodiment of the present invention.

[0146] Figure 10 shows the effect of different reaction components on the detection of cell fluorescence levels.

[0147] Figure 11 shows the detection of cell fluorescence levels of the engineered strain constructed in this invention expressing sfGFP containing aromatic non-natural amino acids.

[0148] Figures 12A-12B show the SDS-PAGE and corresponding protein spectra of sfGFP containing different aromatic non-natural amino acids expressed in the embodiments of the present invention.

[0149] Figure 13 shows the plasmid maps of pET22b-Herceptin-scFV, pET22b-Herceptin-Fab, and pET22b-LmrR constructed in the embodiments of the present invention.

[0150] Figure 14 shows the SDS-PAGE and corresponding protein spectra of each recombinant protein of 4-N3-Phe synthesized by site-directed insertion biosynthesis. Detailed Implementation

[0151] Through extensive and in-depth research, the inventors have, for the first time, designed and constructed engineered bacteria for producing aromatic non-natural amino acids, as well as a method for producing aromatic non-natural amino acids using these engineered bacteria. Furthermore, this invention also constructs a mutant aminoacyl-tRNA synthetase for genetic code expansion and its corresponding tRNA expression plasmid, an expression plasmid for a target recombinant protein containing a TAG mutation (e.g., sfGFP), and a co-expression plasmid of threonine aldolase and threonine deaminase, and transforms these into *E. coli* containing endogenous transaminases to form a second engineered strain. The results show that this second engineered strain can be used to synthesize recombinant proteins modified with aromatic non-natural amino acids, with high production efficiency and low cost. Based on these findings, this invention was completed.

[0152] the term

[0153] To facilitate a clearer understanding of this disclosure, certain terms are first defined. As used herein, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.

[0154] As used in this article, the term "halogen" refers to fluorine (F), chlorine (Cl), bromine (Br), and iodine (I).

[0155] As used herein, the term "alkyl" refers to a straight-chain or branched saturated hydrocarbon group, such as C1 to C6 alkyl, which refers to a straight-chain or branched saturated hydrocarbon group containing 1 to 6 carbon atoms. The alkyl group includes, but is not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl, etc.

[0156] As used herein, the term "alkenyl" refers to a hydrocarbon group, whether straight or branched, containing one or more C-C double bonds, which can be located at any position on the hydrocarbon group, including but not limited to vinyl, propenyl, butenyl, etc.

[0157] As used herein, the term "alkynyl" refers to a straight-chain or branched hydrocarbon group containing one or more C-C triple bonds, which can be located at any position on the hydrocarbon group, including but not limited to ethynyl, 1-propynyl, etc.

[0158] As used herein, the term "acyl" refers to a group formed by the connection of a straight or branched saturated or unsaturated hydrocarbon group to a carbonyl group, preferably an alkyl acyl or a substituted alkyl acyl, including but not limited to formyl, acetyl, propionyl, etc.

[0159] As used in this article, the term "C6~C" 10 "Aryl" refers to a monocyclic or fused-ring aromatic cyclic hydrocarbon group containing 6 to 10 carbon atoms and no heteroatoms, such as phenyl or naphthyl.

[0160] As used herein, the term "5-12-membered heteroaryl" refers to a 5-12-membered aromatic cyclic hydrocarbon group containing 1-4 N, O, and S atoms, with the remaining atoms being carbon atoms, including monocyclic, bicyclic, or fused rings, examples of which include, but are not limited to, pyrroleyl, triazolyl, thiadiazolyl, tetrazolyl, imidazolyl, pyrazolyl, isothiazolyl, thiazolyl, isoxazolyl, oxazolyl, oxadiazolyl, furazolyl, furanyl, thiophenyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, and triazinyl.

[0161] As used herein, the term “pharmaceutical acceptable” means that these compounds, materials, compositions, and / or dosage forms, when used in contact with human and animal tissues with reliable medical judgment, do not cause undue toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0162] As used herein, the term "pharmaceutically acceptable salt" refers to the salt form corresponding to the compounds of this invention, prepared from compounds with specific substituents obtainable by this invention by contacting them with a relatively non-toxic acid or base. When a compound contains a relatively acidic group, a base addition salt can be obtained by contacting the neutral form of such a compound with a sufficient amount of base in solution. Pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amine, or magnesium salts, etc. When a compound contains a relatively basic group, an acid addition salt can be obtained by contacting the neutral form of such a compound with a sufficient amount of acid in solution. Pharmaceutically acceptable acid addition salts include inorganic acid salts and organic acid salts. Inorganic acids include hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, bicarbonate, phosphoric acid, monohydrogen phosphate, dihydrogen phosphate, sulfuric acid, hydrogen sulfate, etc.; organic acids include acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, octanoic acid, lactic acid, mandelic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, tartaric acid, methanesulfonic acid, etc. The compounds of the present invention contain basic and acidic functional groups, and can thus be converted into any acid or base addition salt.

[0163] As used in this article, the term "genetic code extension technology" originates from the technique of inserting artificially synthesized non-natural amino acids into proteins, first proposed by Peter Schultz's team in 2001 (Science, 2001, 292(5516):498-500). The key to this technology is to alter the original biological function of special codons, such as stop codons or rare codons, transforming them into codons used to encode non-natural amino acids, rather than terminating translation or encoding natural amino acids. This allows for the site-specific insertion of various non-natural amino acids into target proteins. By utilizing the functional groups on these non-natural amino acids that possess special physical, chemical properties, or biological activities, such as carbonyl, alkynyl, and azido groups, new functions are endowed into the proteins. To date, more than 300 non-natural amino acids have been able to be inserted into various proteins at specific sites.

[0164] As used in this article, the term "whole-cell catalysis" refers to the process of using a complete organism, namely a microbial cell, as a catalyst for chemical transformation. This catalytic system essentially uses enzymes expressed within the cell to catalyze the reaction, but it eliminates the cumbersome enzyme purification process. Secondly, this technology utilizes the in vivo coenzyme circulation system, requiring almost no additional expensive coenzymes, thus greatly reducing production costs.

[0165] As used in this article, the term "fermentation transformation" refers to a series of chemical transformations using growing microbial cells. This process is divided into two parts: the cell growth stage and the microbial transformation stage. This process occurs when *E. coli* grows to the OD... 600 When the concentration is 0.8–1.0, the substrate solution and all reaction components are added, along with an inducer. The process of cell growth, enzyme expression, and substrate transformation is carried out simultaneously in a shake flask.

[0166] As used in this article, the term "recombinant protein" refers to a protein obtained using recombinant DNA technology. This involves first obtaining the target gene through gene cloning or chemical synthesis, then linking it to a suitable expression vector, transferring the vector into a specific host cell, such as E. coli, yeast, or animal cells, and then using the host cell's genetic system to express a protein with a specific function.

[0167] The engineered bacteria of the present invention

[0168] The present invention provides an engineered bacterium, wherein the engineered bacterium is introduced with genes of one or more exogenous enzymes selected from the group consisting of threonine aldolase, threonine deaminase, and transaminase; and the engineered bacterium simultaneously expresses threonine aldolase, threonine deaminase, and transaminase.

[0169] In a preferred embodiment, the present invention provides an engineered bacterium, the starting strain of which is Escherichia coli, and the engineered bacterium is incorporating the genes of the following exogenous enzymes: threonine aldolase and threonine deaminase; and the engineered bacterium simultaneously expresses threonine aldolase, threonine deaminase and transaminase.

[0170] In another preferred embodiment, the Escherichia coli is E. coli RARE(DE3).

[0171] In another preferred embodiment, the nucleotide sequence of the threonine aldolase is shown as selected from the group consisting of: SEQ ID NO.1 (PpLTA sequence), SEQ ID NO.2 (LmLTA sequence), SEQ ID NO.3 (NmLTA sequence), SEQ ID NO.4 (CsLTA sequence), or combinations thereof.

[0172] In another preferred embodiment, the nucleotide sequence of the threonine deaminase is shown in SEQ ID NO.5.

[0173] In another preferred embodiment, the transaminase is a transaminase derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO.6.

[0174] The present invention also provides a second engineered bacterium, which incorporates and expresses the following genes into the engineered bacterium described in the first aspect of the present invention:

[0175] (1) A mutated aminoacyl-tRNA synthetase (aaRS) gene and a corresponding tRNA gene, wherein the mutated aminoacyl-tRNA synthetase is capable of recognizing the aromatic non-natural amino acids described in the third or fourth aspect of the present invention and assembling them into the tRNA.

[0176] The codon for the aromatic non-natural amino acid is TAG;

[0177] (2) The target recombinant protein gene, wherein the target recombinant protein gene is based on the original target protein gene, and a codon at a specific site is mutated to the stop codon TAG; and

[0178] Optionally, (3) purify the tag.

[0179] In a preferred embodiment, the engineered bacteria is Escherichia coli, preferably E. coli RARE(DE3).

[0180] In another preferred embodiment, the position of the stop codon TAG is the modification position of the aromatic non-natural amino acid.

[0181] In another preferred embodiment, the mutant aminoacyl-tRNA synthetase is a mutant of aminoacyl-tRNA synthetase selected from the group consisting of MmPylRS, MbPylRS, MjTyrRS, or a combination thereof.

[0182] In another preferred embodiment, the target recombinant protein includes an enzyme.

[0183] In another preferred embodiment, the enzyme includes: novel enzymes modified with aromatic non-natural amino acids containing diverse groups as required in the field of enzyme engineering, and artificial enzymes in which aromatic non-natural amino acids containing catalytic groups are introduced into a protein backbone (such as LmrR, QacR, CgmR, etc.) that does not have catalytic function.

[0184] Methods for producing recombinant proteins with site-directed insertion of aromatic non-natural amino acids

[0185] This invention provides a method for producing recombinant proteins with site-directed insertion of aromatic non-natural amino acids, comprising the following steps:

[0186] (a) The second engineered bacterium of the present invention is cultured under suitable culture conditions to obtain a culture; and

[0187] (b) Isolate the recombinant protein from the culture.

[0188] In another preferred embodiment, the culture conditions are as follows: the second engineered bacteria are grown to the logarithmic phase (OD600 = 0.8-1.0) in a medium containing triple antibiotics at 37°C, and then induced for expression and fermentation transformation. The induction temperature is 25-30°C, the amount of IPTG added as the inducer is 0.5-1 mM, the amount of aromatic aldehyde substrate added is 1-5 mM, the amount of cofactor PLP added is 0.01-0.2 mM, the amount of Gly added is 30-100 mM, and the induction time is 20-24 h.

[0189] In another preferred embodiment, the recombinant protein includes a target recombinant protein containing one or more non-natural amino acid site-directed modifications, the target recombinant protein including target recombinant proteins linked to different coupling agents, and the coupling agent being a drug molecule, a fluorescent molecule, or PEG.

[0190] The main advantages of this invention include:

[0191] (a) This invention constructs and provides a novel synthetic route for synthesizing chiral pure aromatic non-natural amino acids by using inexpensive and readily available aromatic aldehydes as starting materials and through a cascade catalysis of engineered bacteria co-expressing threonine aldolase, threonine deaminase and transaminase.

[0192] (b) The present invention uses the engineered bacteria of the present invention for whole-cell catalysis and fermentation transformation to synthesize a variety of non-natural amino acids.

[0193] (c) This invention integrates cascade reaction and genetic code expansion technology within the same engineered bacteria, enabling the aforementioned non-natural amino acids to be directly inserted into specific sites of the target protein, thereby constructing a cell factory for the production of recombinant proteins from the synthesis of aromatic non-natural amino acids to the site-specific modification of non-natural amino acids, and obtaining recombinant proteins with various site-specific modifications.

[0194] (d) The engineered strain of the present invention uses aromatic aldehydes as raw materials, eliminating the need to use expensive chiral non-natural amino acids to produce the target protein, which greatly improves production efficiency and reduces production costs.

[0195] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0196] The main reagents and consumables used in the embodiments of this invention are as follows:

[0197] In the specific embodiments of this invention, all primer synthesis and gene sequencing were performed by GENEWIZ. The primer sequences and corresponding nucleotide sequences of the proteins used are listed in the sequence listing. In the embodiments, the amino acid sequences were codon optimization and gene sequence synthesis were performed by GENEWIZ, and the optimized DNA sequences were cloned into vectors pET28a or pET22b, or cloned by the inventors into the desired target vector. The cloned plasmid sequences are also listed in the sequence listing. The competent cells of the expression strain E. coli BL21(DE3) were purchased from Shanghai Bioengineering Co., Ltd., and the E. coli RARE(DE3) strain was kindly provided by Professor Yuan Jifeng of Xiamen University and purchased by Addgene.

[0198] The antibiotics used in this invention (kanamycin Kan, ampicillin Amp, chloramphenicol Cm, streptomycin Sm), the culture medium components Tryptone, Yeast extract, NaCl, agar, and the protein expression inducer isopropyl β- D - Glucosinolate (IPTG), supercompetent cell preparation kit, 96-well plates were purchased from Shanghai Bioengineering Co., Ltd.; homologous recombinase (ClonExpress II One Step Cloning Kit), DNA polymerase (2×Phanta Max Master Mix, 2×Rapid Taq Master Mix), T4 ligase (5min Universal Ligation Mix), agarose gel extraction kit, nucleic acid dyes were purchased from Nanjing Novizan Biotechnology Co., Ltd.; plasmid extraction kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; restriction endonucleases (DpnI, NdeI, XhoI, etc.), DNA marker was purchased from Takara Ltd.; protein marker, PAGE gel rapid preparation kit was purchased from Shanghai Yamei Biotechnology Co., Ltd.; aromatic aldehyde substrates, Glycol, and other components in the reaction components were also purchased. L -Glu and some aromatic non-natural amino acid product standards were purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd.; cofactor pyridoxal phosphate (PLP) was purchased from J&K.

[0199] Luria-Bertani (LB) medium contains 10 g / L of tryptone. -1 NaCl 10 g·L -1 5g / L yeast powder -1 Before sterilizing the solid culture medium, add 1.5–2 g / 100 mL of agar to the bottle and autoclave at 121°C for 20 min. The concentration of the Kan stock solution used is 50 mg / mL. -1 The concentration of Amp stock solution is 100 mg / mL. -1The concentration of the mother liquor (Cm) is 35 mg·mL. -1 The concentration of Sm mother liquor is 50 mg·mL. -1 Dissolve in sterile ddH2O, filter and dispense into 1.5mL EP tubes, store at -20℃, and add 1‰ antibiotic to the culture medium before use.

[0200] The IPTG stock solution was prepared with sterile water at a concentration of 1M, filtered, and dispensed into 1.5mL EP tubes. It was stored at -20℃. During induction of expression, the IPTG stock solution was added to the culture medium at a final concentration of 0.5-1mM.

[0201] SDS-PAGE solution: Protein electrophoresis buffer containing 1 g / L SDS. -1 Tris 6.06 g·L -1 Gly 14.4 g·L -1 Dissolve in deionized water and adjust pH to 8.3; Coomassie Brilliant Blue R-250 staining solution contains 2 g / L Coomassie Brilliant Blue R-250. -1 Dissolve in a mixture of 800 mL ethanol and 200 mL acetic acid; prepare the decolorizing solution according to the ratio of deionized water: ethanol: acetic acid = 5:4:1; all reagents required for gel preparation are from the Yake One-Step PAGE Gel Rapid Preparation Kit (12.5%), prepared according to the instructions.

[0202] Agarose gel electrophoresis 50×TAE buffer contains Tris 242 g·L -1 EDTA 18.612 g·L -1 Acetic acid 57.1 mL·L -1 After mixing, adjust the pH to 8.3 and dilute with deionized water to 1× for use; for 1% agarose gel, add 1% (w / V) agarose to 1× TAE solution, heat to dissolve until clear, add 10000× nucleic acid dye at 1μL / 10mL, cool and solidify before loading onto electrophoresis.

[0203] The biosynthetic pathway of aromatic non-natural amino acids constructed in the embodiments of the present invention is shown in Figure 1.

[0204] Example 1: Construction of a co-expression plasmid of threonine aldolase and threonine deaminase for cascade catalysis

[0205] To construct the cascade pathway for the synthesis of aromatic non-natural amino acids as shown in Figure 1, it is necessary to heterologously co-express threonine aldolase and threonine deaminase in *E. coli*. First, the threonine deaminase RpTD was cloned. Using the pET28a-RpTD plasmid synthesized by GENEWIZ and the empty vector pACYCDuet-1 (SEQ ID NO.7) as templates, double digestion with NdeⅠ and XhoⅠ was performed. The reaction system is as follows:

[0206] Table 1. Double enzyme digestion reaction system (20 μL)

[0207] The system was reacted in a PCR instrument at 37℃ for 2 h. After enzyme digestion, the samples were subjected to nucleic acid electrophoresis at 140V for 30 min. The RpTD fragment with NdeⅠ and XhoⅠ restriction sites at both ends and the linearized pACYCDuet-1 plasmid were recovered and stored at -20℃ for later use.

[0208] The recovered products after double enzyme digestion were ligated with T4 ligase according to the following system:

[0209] Table 2. T4 ligase reaction system (10 μL)

[0210] The T4 ligation system was reacted at 25℃ for 5 min. The ligation product was transformed into E. coli BL21(DE3) competent cells by chemical transformation. After culturing at 37℃ for 12 h, transformants were picked and colony verification PCR was performed using Duet-2-F / R. Single clones with correct DNA fragment size were selected for culture, and plasmids were extracted and sequenced for verification. This step ligated the RpTD gene to the MCS-2 of the pACYC plasmid.

[0211] The Duet-2-F / R is shown below:

[0212] Duet-2-F:TTGTACACGGCGCATAATCG(SEQ ID NO.8);

[0213] Duet-2-R: CTAGTTATTGCTCAGCGGTGG (SEQ ID NO. 9).

[0214] The colony PCR reaction system and reaction procedure are as follows:

[0215] Table 3. Single colony PCR validation reaction system (20 μL)

[0216] Table 4. Single Colony PCR Validation Reaction Procedure

[0217] Next, using pACYC-RpTD as a plasmid linearization template, the target gene was amplified using plasmids pET28a-PpLTA, pET28a-LmLTA, pET28a-NmLTA, and pET28a-CsLTA (synthesized by GENEWIZ) linked with different threonine aldolases (LTAs). All four threonine aldolases can be used in this invention. The plasmid was linearized using primer pA-Rp-line-F / R, and the target gene was obtained using the corresponding amplification primers LTAs-F / R (lowercase letters indicate homologous sequences) for each LTA, thus obtaining a linearized vector with homologous sequences and the target gene. 1 μL of DpnI was added to the PCR reaction system to digest the template plasmid, and digestion was carried out at 37℃ for 2 h. The digestion product was recovered after nucleic acid electrophoresis and stored at -20℃.

[0218] The amplification primers are shown in Table 5 below.

[0219] Table 5 Amplification Primer Sequences

[0220] The PCR amplification reaction system and reaction procedure are shown in Table 6-7 below:

[0221] Table 6 PCR amplification reaction system (40 μL)

[0222] Table 7 PCR Amplification Reaction Procedure

[0223] The obtained linearized vector and target gene were subjected to homologous recombination according to the system shown in Table 8 below.

[0224] Table 8. Homologous recombination reaction system (20 μL)

[0225] The reaction was carried out at 37℃ for 30 min. 10 μL of the sample was then chemically transformed into E. coli BL21(DE3) competent cells. After culturing at 37℃ for 12 h, transformants were picked and verified by single colony PCR as described in Tables 3 and 4 using Duet-1-F / R. Single clones with correct band size were selected for culture, and plasmids were extracted and sequenced for verification. This step ligated the LTAs gene to the MCS-1 of the pACYC plasmid, thus obtaining the LTAs and RpTD co-expression plasmid pACYC-LTAs-RpTD.

[0226] Duet-1-F / R are shown in SEQ ID NO.20 and SEQ ID NO.21, respectively.

[0227] Figure 2 shows a map of four different plasmids co-expressing threonine aldolase and threonine deaminase. The four plasmids shown in the figure use p15A as the origin of replication, are chloramphenicol resistant, and express two target gene segments using two t7 promoters respectively. The original 6×His tag of MCS-1 was removed during plasmid PCR linearization. The plasmid sequences are shown in SEQ ID NO.22–SEQ ID NO.25.

[0228] Example 2: Construction of recombinant strains for cascade catalytic synthesis of aromatic non-natural amino acids

[0229] In this embodiment, three different E. coli strains were used as host cells. The competent cells were prepared using a supercompetent cell preparation kit, and the competent cells were prepared according to the instructions accompanying the kit.

[0230] The four plasmids co-expressing the four LTAs with RpTD were transformed into three types of competent *E. coli* cells: BL21(DE3), MG1655(DE3), and RARE(DE3). The RARE(DE3) strain was derived from the *E. coli* MG1655(DE3) genome, with six aldehyde and ketone reduction-related genes (ΔdkgB, ΔyeaE, Δ(yqhC-dkgA), ΔyahK, ΔyjgB) knocked out to block metabolic pathways and stabilize aromatic aldehydes. Single colonies cultured overnight on plates were transferred to liquid LB medium containing chloramphenicol and incubated overnight at 37°C and 220 rpm.

[0231] Preparation of freeze-dried bacteria: The overnight cultured bacterial solution was transferred to fresh liquid LB medium at an inoculation rate of 1%, and cultured at 37°C and 220 rpm until OD500 was reached. 600 The concentration of IPTG was 0.8–1.0, with a final concentration of 0.5 mM added. Expression was induced at 18°C ​​and 180 rpm for 20 h. After induction, the bacterial cells were collected by centrifugation at 4°C and 9000 rpm. The bacterial pellet was washed 2–3 times with PBS and resuspended, then lyophilized to obtain the whole-cell catalyst of the exogenous LTAs, RpTD, and endogenous E. coli TyrB triple enzyme cascade. Figure 3 shows the expression of the four LTAs and RpTD detected in the supernatant after bacterial cell lysis. SDS-PAGE showed clear bands of the four LTAs (39 kDa) and RpTD (34 kDa), proving successful expression in the recombinant bacteria.

[0232] Example 3: Optimization of the reaction and product detection for the whole-cell catalytic synthesis of aromatic non-natural amino acids.

[0233] LTAs, RpTD, and TyrB are all pyridoxal phosphate (PLP)-dependent enzymes. During bacterial growth and protein expression, the PLP produced in the culture medium is already bound to the enzyme's active site, sufficient to catalyze the O2 cascade reaction; therefore, no exogenous PLP needs to be added to the whole-cell reaction buffer. The co-substrate for LTAs is Gly, and for TyrB... L -Glu, both of which catalyze reversible reactions, therefore an excess of the co-substrate is required to drive the reaction forward. This example first verifies the feasibility of this cascade pathway in whole-cell catalysis. Using E. coli BL21(DE3) lyophilized bacteria transformed with plasmid pACYC-PpLTA-RpTD as a catalyst, and 1 mM of 4-I-benzaldehyde and 4-Me-benzaldehyde as substrates, the reactions were carried out according to the following reaction system:

[0234] Table 9. Whole-cell catalytic reaction validation system (1 mL)

[0235] The reaction was carried out at room temperature. The reaction progress over time was monitored by taking samples at intervals; specifically, the peak areas of products 4-I-Phe and 4-Me-Phe were detected using UPLC-MS. A standard curve of product concentration versus peak area was then plotted using product standards, and the product concentration at each time point was calculated to determine the conversion rate. Detection method: 40 μL of reaction solution was diluted with 160 μL of 50% methanol, mixed well, and centrifuged to collect the supernatant. UPLC-MS detection conditions: Wavelength: 210 nm; Column: ACQUITY BEH C18 (2.1×50mm, 1.7μm); mobile phase: water (0.1% formic acid) / acetonitrile (0.1% formic acid); gradient: 5–95%; acquisition time: 4.5 min; flow rate: 0.8 mL / min; column temperature: 40℃; injection: 2 μL. Figure 4a shows the UPLC-MS detection results, and Figure 4b shows the reaction progress curve. The conversion rate of substrate 4-I-benzaldehyde reached 96% after 6 h, and the conversion rate of 4-Me-benzaldehyde was 64%, demonstrating the feasibility of this pathway.

[0236] Next, we will discuss the dosage of lyophilized bacteria, substrate, Gly, and... L - The Glu concentration was optimized, and the catalytic efficiency of different LTAs in the cascade reaction was compared. Optimization scheme: First, the catalyst dosage and substrate concentration were optimized. Different substrate concentration gradients were set in a 1 mL reaction system, with each gradient using 5 mg / mL. -1 and 10 mg·mL -1Using BL21 / pACYC-PpLTA-RpTD lyophilized bacteria as a catalyst, a total of 12 reactions were conducted, each containing 3 parallel experiments. Optimization of Gly concentration was performed by conducting reactions at different Gly concentrations, with 3 parallel experiments set up for each group. L - The Glu concentration optimization method was the same as for Gly. Except for the variables, all other conditions were kept consistent, with a reaction time of 12 h at room temperature. PpLTA in the cascade pathway was replaced with three other LTAs, and samples were taken at 6 h and 12 h of reaction to compare the catalytic efficiency under different LTAs. Figures 5a-d show the optimization process of the whole-cell catalytic reaction conditions, and the following optimal reaction conditions were finally obtained:

[0237] 10 mg·mL -1 Freeze-dried bacteria BL21(DE3) / pACYC-PpLTA-RpTD, 25 mM aromatic aldehyde substrate, 125 mM (5 times substrate concentration) Gly, 187.5 mM (7.5 times substrate concentration) L -Glu, the substrate stock solution was dissolved in DMSO, and the final concentration of DMSO added to the reaction system was 10%. The reaction was carried out in phosphate buffer at pH 7.5 for 12 h at room temperature. Under these conditions, the reaction progress curve of product concentration versus time was plotted using 3-Cl-benzaldehyde as the substrate, as shown in Figure 5e. The conversion rate of the obtained product 3-Cl-Phe was 97%.

[0238] Example 4: Purification and Characterization of Some Rare Aromatic Non-Natural Amino Acids

[0239] After determining the optimal reaction conditions for whole-cell catalysis in Example 3, this example scales up the reaction system to 50 mL to prepare some commercially unavailable rare aromatic non-natural amino acids. Due to the low yield of product F8 and the high price of the corresponding benzaldehyde substrate, the substrate concentration was adjusted to 5 mM to maximize substrate conversion, resulting in a yield of 67.5%.

[0240] Product purification: Centrifuge the reaction solution after the reaction is complete and collect the supernatant. Then, use a rapid preparative liquid chromatography column. The product was purified by gradient elution using an acetonitrile / water system (aqueous phase containing 0.1% formic acid). The fraction containing the product was collected, and the solvent was removed by rotary evaporation. The yield was calculated after weighing the product. The yield calculation formula is: Product yield = m / M × 100%, where m is the actual mass of the obtained product, and M is the theoretical mass of the product.

[0241] Take a small amount of the purified product and add approximately 600 μL of deuterated water or deuterated methanol. For some compounds, NaOH may be added to aid dissolution. Centrifuge and collect the supernatant.1 HNMR, 13 CNMR and fluorine-containing compounds 19 FNMR spectroscopy was used to identify the compound structure, combined with high-resolution mass spectrometry and other techniques. The compound characterization data are shown in Table 10.

[0242] Table 10 Yields and Product Characterization of Whole-Cell Catalytic Preparation of Rare Aromatic Non-Natural Amino Acids

[0243] Example 5: Verification of the reaction for the fermentation and synthesis of aromatic non-natural amino acids by Escherichia coli.

[0244] The plasmids co-expressing PpLTA and RpTD constructed in Example 1 were transformed into three types of competent E. coli cells: BL21(DE3), MG1655(DE3), and RARE(DE3). The overnight culture was transferred to chloramphenicol-containing liquid LB medium at a 1% inoculum and cultured at 37°C and 220 rpm for 2 hours to allow OD to develop. 600 The concentration was 0.8–1.0. IPTG was added to a final concentration of 0.5 mM and the temperature was lowered to 30 °C to induce expression. Simultaneously, the following reaction components were added to convert the aromatic aldehyde substrate:

[0245] Table 11 Reaction system for the fermentation and synthesis of aromatic non-natural amino acids by Escherichia coli

[0246] In this implementation example, the third step of the transamination reaction utilizes the medium... L -Glu and other amino acids were reacted without the addition of exogenous ammonia donors. After the reaction was carried out at 30°C for 12 h, the reaction was detected by UPLC-MS using the same method as in Example 3, and the reaction efficiency of three different Escherichia coli hosts was compared.

[0247] As shown in Figure 6, the transformation effects of E. coli BL21(DE3) and MG1655(DE3) as engineered strains were not ideal. Because microbial fermentation involves cell growth, protein expression, and metabolism, the host metabolizes some aromatic aldehyde substrates, with particularly severe loss of 4-Me-benzaldehyde substrate. In contrast, the RARE(DE3) host selected in this invention, due to the knockout of genes related to aldehyde and ketone reduction, produced significantly higher amounts of the products 4-I-Phe and 4-Me-Phe than the other two groups.

[0248] Example 6: Screening of substrates for the fermentation and synthesis of aromatic non-natural amino acids by Escherichia coli

[0249] The substrate profiles of reactions catalyzed by four E. coli strains co-expressing LTAs and RpTD for different aromatic aldehyde substrates were screened to further improve the synthetic efficiency of cascade pathways and expand the substrate range. The reactions were carried out in 96-well plates.

[0250] (1) Take 500 μL of chloramphenicol-containing liquid LB plate, inoculate 10 μL of overnight cultured bacterial solution into the well plate, and shake on a plate shaker at 37°C and 800 rpm for 2 hours until OD. 600 It ranges from 0.8 to 1.0.

[0251] (2) Take 150 μL of 1M IPTG and add it to 25 mL of liquid LB medium containing chloramphenicol to obtain IPTG stock solution. Add 50 μL of stock solution to a 96-well plate.

[0252] (3) Simultaneously, 2M Gly and 1mM PLP solutions were premixed at a ratio of 5:4, and 27 μL of the premix was dispensed into each well. 0.05M aromatic aldehyde substrate stock solution was dissolved in DMSO, and 12 μL of the stock solution was added to each well, with three replicates per substrate. The mixture was then incubated at 30°C and 800 rpm for 12 h. (4) Samples were taken and analyzed according to the method in Example 3. The product ESI [M+H] was searched using the SIM mode of UPLC-MS. + Molecular weight and product peak area are converted into concentration using the corresponding standard curve, and conversion rate is calculated.

[0253] The substrate screening results are shown in Figure 7. More than half of the substrates achieved a conversion rate of over 50%. Meta-substituted compounds generally showed good reaction performance, while para-substituted substrates (such as those with halogen, alkynyl, or azido groups) and some heterocyclic and fused-ring substrates also exhibited good conversion efficiencies. Among the four threonine aldolases, CsLTA showed the highest conversion rate in cascade catalysis. Figure 7a shows the substrate spectra screened in the embodiments of this invention, with substrates achieving a conversion rate of over 50% marked in green. Figure 7b shows the corresponding conversion rates.

[0254] Example 7: Construction of aminoacyl-tRNA synthetase / tRNA expression plasmid for genetic code expansion

[0255] In order to insert aromatic non-natural amino acids corresponding to substrates with high conversion rates in the substrate screening examples into proteins, this invention selected different mutants of three aminoacyl-tRNA synthases, MmPylRS, MbPylRS and MjTyrRS, to insert different non-natural amino acids.

[0256] First, GENEWIZ was commissioned to synthesize aminoacyl-tRNA synthetase genes with different mutation sites and clone them into the vector pET28a. These included the MmpIFRS mutant gene with L305M / Y306L / L309S / N346S / C348M mutation sites; the MbPylHRS mutant gene with L270I / Y271F / L274G / C313F / Y349F mutation sites; the MjpAzFRS mutant gene with Y32T / E107N / D158P / I159L / L162Q / D286R mutation sites; the MjpBoFRS mutant gene with Y32S / L65A / H70M / D158S / L162E mutation sites; and the MjNaRS mutant gene with Y32L / D158P / I159A / L162Q / A167V mutation sites. pCDF-MmPylRS(2A)-tRNA carrying the N346A / C348A double mutant MmPylRS(2A) gene Pyl Using (SEQ ID NO.26) as a template for plasmid linearization, the pyrrolidone-lysyl-tRNA synthetase gene was replaced using homologous recombination technology; simultaneously, pUltra-MjpCNFRS-tRNA was used. Tyr (SEQ ID NO.27) is another linearized template for plasmids, and the tyrosine-tRNA synthetase gene in it is replaced using homologous recombination technology.

[0257] Using the primers described below, corresponding aminoacyl-tRNA synthetase mutant gene fragments (lowercase letters indicate homologous sequences) were amplified from the pET28a plasmid containing the genes of each aminoacyl-tRNA synthetase mutant. The plasmids were then linearized using primers pCDF-line-F / R and pUltra-line-F / R, resulting in the target gene fragments containing homologous sequences and a linearized vector devoid of aminoacyl-tRNA synthetase. The template plasmid was then digested with DpnI, recovered by nucleic acid electrophoresis, and its concentration was determined. The linearized vector and target gene underwent homologous recombination and transformation. Subsequently, single-colony PCR was performed on the two constructed plasmids using primers pCDF-F / R and pUltra-F / R, respectively. Single clones with correct band sizes were selected for culture, and plasmids were extracted and sequenced for verification. Since the PCR and homologous recombination operations are consistent with those in Example 1, they will not be repeated in this and subsequent examples.

[0258] The PCR amplification primers used in this example are as follows:

[0259] pIFRS-F: aagaggagaaattaaccATGGATAAAAAGCCTCTGAACACT (SEQ ID NO. 28)

[0260] pIFRS-R:agctcagctaattaagcTTACAGGTTAGTAGAAATACCATTG(SEQ ID NO.29)

[0261] PylHRS-F:aagaggagaaattaaccATGGATAAGAAGCCGCTGGAT(SEQ ID NO.30)

[0262] PylHRS-R:agctcagctaattaagcTTACAGGTTGGTAGAGATACCGT(SEQ ID NO.31)

[0263] pCDF-line-F:GCTTAATTAGCTGAGCTTGGAC(SEQ ID NO.32)

[0264] pCDF-line-R:GGTTAATTTCTCCTCTTTAATG(SEQ ID NO.33)

[0265] pAzFRS / NaRS-F:caaaggaggtgcggccgcATGGACGAGTTCGAAATGATT(SEQ ID NO.34)

[0266] pAzFRS / NaRS-R:cgtttaaacgcggccgcTTACAGACGTTTGCGAATTGG(SEQ ID NO.35)

[0267] pBoF:caaaggaggtgcggccgcATGGATGAATTTGAAATGATT(SEQ ID NO.36)

[0268] pBoF:cgtttaaacgcggccgcTTACAGGCGTTTGCGAATCGG(SEQ ID NO.37)

[0269] pUltra-line-F:GCGGCCGCGTTTAAACGGTCTC(SEQ ID NO.38)

[0270] pUltra-line-R:GCGGCCGCACCTCCTTTGTGA(SEQ ID NO.39)

[0271] The PCR test is not available:

[0272] pCDF-F:ACCACCCTGAATTGACTCTCT(SEQ ID NO.40)

[0273] pCDF-R:TAGGGGTTCCGCGCACATTT (SEQ ID NO.41)

[0274] pUltra-F:GTTTTGCGCCATTCGATGGTG (SEQ ID NO.42)

[0275] pUltra-R:TCTGTTTTTATCAGACCGCTTC (SEQ ID NO.43)

[0276] The five aminoacyl-tRNA synthases and their corresponding tRNA plasmid sequences constructed in this embodiment are shown in SEQ ID NO.44 to SEQ ID NO.48. Figure 8 shows the pCDF-MmpIFRS-tRNA constructed in this embodiment. Pyl and pUltra-MjpAzFRS-tRNA Tyr The diagram illustrates two types of plasmids. Both plasmids use CloDF13 as the origin of replication. The pCDF plasmid is kanamycin resistant and contains the t5 promoter; the pUltra plasmid is streptomycin resistant and contains the tac promoter. Both can be induced by IPTG to express aminoacyl-tRNA synthetase. Pyl and tRNA Tyr The expression boxes all use compositional promoters and terminators.

[0277] Example 8: Construction of sfGFP expression plasmid containing TAG mutation

[0278] This embodiment constructed an expression plasmid containing the TAG mutation sfGFP. The wild-type sfGFP gene was synthesized by GENEWIZ and cloned into the pET22b vector. The sequence of the plasmid pET22b-sfGFP is shown in SEQ ID NO.49. The pET22b-sfGFP plasmid was linearized by reverse PCR using primer Y151TAG-F / R (lowercase letters indicate homologous sequences, and mutation sites are indicated by underscores). The template plasmid was digested with DpnI, recovered by nucleic acid electrophoresis, and its concentration was detected. After homologous recombination and transformation, several single colonies of the linearized plasmid were directly picked for culture, and the plasmid was extracted for sequencing. The homologous recombination system is described below:

[0279] Table 12 Linearized pET22b-sfGFP homologous recombination system (20 μL)

[0280] Y151TAG-F:aacgtgtagattaccgcGGATAAACAGAAAAACGGCAT(SEQ ID NO.50)

[0281] Y151TAG-R: gcggtaatctacacgttATGGCTGTTAAAGTTATATTCC (SEQ ID NO.51)

[0282] In this implementation example, the plasmid pET22b-sfGFP(Y151TAG) was obtained. The plasmid map is shown in Figure 9. This plasmid uses pBR322 as the origin of replication, is ampicillin resistant, carries the t7 promoter, and expresses a 6×His tag at the C-terminus.

[0283] Example 9: Preparation of sfGFP expression strains modified with aromatic non-natural amino acids

[0284] The pET22b-sfGFP(Y151TAG) plasmid constructed in Example 8 was transformed into E. coli RARE(DE3), and the strain was prepared into competent cells using a supercompetent cell preparation kit. The threonine aldolase and threonine deaminase co-expression plasmid prepared in Example 1 and different plasmids used to express aminoacyl-tRNA synthetase / tRNA in Example 7 were co-transformed into E. coli RARE(DE3) / pET22b-sfGFP(Y151TAG) competent cells, and the resulting strains were selected using triple antibiotic plates (ampicillin, kanamycin / streptomycin, chloramphenicol) to obtain genetically engineered strains co-expressing the three plasmids.

[0285] Example 10: Expression and fluorescence detection of sfGFP modified with aromatic non-natural amino acids

[0286] Single colonies were picked and inoculated into LB broth containing three antibiotics. After overnight incubation, they were transferred at a 1% inoculation rate to LB broth containing the corresponding antibiotics and incubated at 37°C and 220 rpm for 2 hours until OD500. 600 The concentration of IPTG was 0.8–1.0. A final concentration of 1 mM was added to the culture medium, along with the reaction components listed in Table 11. The medium was then incubated at 30°C and 230 rpm for 24 h.

[0287] This embodiment first uses pACYC-PpLTA-RpTD and pCDF-MmpIFRS-tRNA. PylTaking the engineered strain obtained after co-transformation as an example, it expresses sfGFP containing 4-I-Phe modification to verify the feasibility of the engineered strain design. 1 mL of the bacterial culture after 24 h of cultivation as described above was taken, and the bacterial concentration was detected using a micro-ultraviolet spectrophotometer. Subsequently, the supernatant was discarded by centrifugation, and the bacterial pellet was washed twice with PBS. The cells were resuspended in 1 mL of PBS, and 200 μL of the resuspended solution was used to detect the fluorescence intensity of the cells using a microplate reader (Ex: 485 nm; Em: 528 nm). The fluorescence intensity / bacterial concentration (RFU / OD) was expressed as the ratio. 600 The value indicates the sfGFP expression intensity of the recombinant strain. Four negative controls (NG1, NG2, NG3, and NG4) were also set up to verify whether PLP and high concentrations of Gly in the reaction components affected sfGFP expression. The positive control (PG) was culture medium directly supplemented with 1 mM 4-I-Phe.

[0288] As shown in Figure 10, the fluorescence intensity of the experimental group (EG) after 24 hours of induction was much higher than that of the negative control group. The highest sfGFP expression level could only be achieved when the reaction component contained substrate, PLP and Gly at the same time. Adding a trace amount of PLP can accelerate the cascade reaction and thus promote protein expression.

[0289] Based on this, according to the results of substrate screening, some substrates with high conversion rates during fermentation were selected, and the threonine aldolase in the cascade pathway was replaced with CsLTA. Thus, pACYC-CsLTA-RpTD and different plasmids expressing aminoacyl-tRNA synthetase / tRNA were co-transformed to express sfGFP containing aromatic non-natural amino acids, and the above-mentioned cell fluorescence detection was performed.

[0290] As shown in Figure 11, most of the substrates selected in this embodiment exhibited fluorescence levels that were more than 70% of those of the positive control group with 1 mM non-natural amino acids added directly. In some experimental groups, the fluorescence was even higher than that of the positive control group, indicating that the engineered strain can be used to synthesize recombinant proteins modified with aromatic non-natural amino acids.

[0291] Example 11: Purification and Mass Spectrometry Validation of sfGFP Containing Aromatic Non-Natural Amino Acid Modification

[0292] Single colonies grown on triple-antibiotic plates were picked and cultured overnight in liquid LB medium containing the corresponding three antibiotics. Then, 1% inoculum was transferred to 1L of LB medium containing the corresponding antibiotics, and the cascade reaction and sfGFP (Y151TAG) protein expression were performed according to the same method as in Example 9. After expression, the bacterial cells were collected by centrifugation at 9000 rpm for 10 min at 4°C and stored at -20°C.

[0293] For protein purification, bacterial cells were resuspended in lysis buffer (25 mM Tris, pH 8.0, 250 mM NaCl), homogenized using an autoclave, and centrifuged at 18,000 rpm for 30 min at 4 °C. The supernatant was loaded three times onto a Ni-NTA Unionrose 6FF purification column pre-equilibrated with lysis buffer. Impurities were washed away with 60 mL of lysis buffer containing 50 mM imidazole, and sfGFP containing non-natural amino acids was eluted with lysis buffer containing 500 mM imidazole. The target protein solution was collected and dialyzed using dialysis buffer (50 mM Na₂HPO₄, pH 7.5, 50 mM NaCl). The dialyzed protein solution was aliquoted into 1.5 mL EP tubes, rapidly frozen in liquid nitrogen, and stored at -80 °C. The purified sfGFP was analyzed by SDS-PAGE and high-resolution proteomics to verify the successful insertion of non-natural amino acids into sfGFP. The required protein concentration for proteomics was 0.1 mg / mL. -1 .

[0294] Figures 12A-B show the SDS-PAGE and corresponding protein profiles of sfGFP containing different aromatic non-natural amino acids expressed in this embodiment, indicating that the engineered strain of the present invention successfully expressed recombinant proteins containing different aromatic non-natural amino acids.

[0295] Example 12: Expression, purification, and mass spectrometry verification of recombinant functional proteins derived from site-directed insertion biosynthesized aromatic non-natural amino acids.

[0296] Since Examples 7-10 successfully inserted various aromatic non-natural amino acids into the Y151 site of sfGFP, this example further expands the application scope of this engineered strain to recombinant functional proteins, including Herceptin-scFV and Herceptin-Fab, the most commonly used Anti-HER2 antibodies in tumor detection, and LmrR, the most commonly used protein backbone in artificial enzyme preparation.

[0297] Herceptin-scFV adds a StII signal peptide for intercellular transfer before the variable region of the light chain and connects the variable regions of the light and heavy chains via a linker. Herceptin-Fab adds a StII signal peptide before both the light and heavy chains. Both are expressed separately and then self-assemble intracellularly. The TAG mutation site is selected in the constant region of the light and heavy chains. The genes of these three proteins were synthesized by GENEWIZ and ligated into the pET22b plasmid, with a 6×His tag at the C-terminus. The pET22b-Herceptin-scFV, pET22b-Herceptin-Fab, and pET22b-LmrR plasmids are shown in Figure 13, with sequences shown in SEQ ID NO.52–SEQ ID NO.54. The LmrR gene had its M89 base sequence replaced with a TAG during synthesis.

[0298] Since disulfide bonds cannot exist stably inside cells, but can be stabilized in the intercellular matrix, the StII signal peptide is used to transfer intracellularly expressed proteins to the intercellular matrix for disulfide bond assembly, thereby obtaining correctly folded and assembled scFV and Fab.

[0299] The plasmid construction method in this embodiment is the same as in Example 8. The S9 and K42 sites of the scFV light chain variable region, the A121 site of the Fab heavy chain constant region, and the M89 site of LmrR (which has been replaced with TAG during gene synthesis and does not require mutation) were selected. The plasmid was linearized using reverse PCR with the following primers:

[0300] scFV-S9-F: cagagcccgtagagccTGAGCGCGAGCGTGGGCGAT (SEQ ID NO.55)

[0301] scFV-S9-R: ggctctacgggctctgCGTCATCTGAATATCCGCAT (SEQ ID NO.56)

[0302] scFV-K42-F: cgggctaggcgccgaaaCTGCTGATTTATAGCGCGAG (SEQ ID NO.57)

[0303] scFV-K42-R: tttcggcgcctagcccgGTTTCTGCTGATACCACGCCA (SEQ ID NO.58)

[0304] Fab-A121-F: ctcctcatagtccaccaAGGGCCCATCGGTCT (SEQ ID NO.59)

[0305] Fab-A121-R: tggtggactatgaggagACGGTGACCAGGGTT (SEQ ID NO.60)

[0306] Using pET22b-Herceptin-scFV and pET22b-Herceptin-Fab as linearization templates, respectively, PCR amplification was performed. The template plasmids were then digested with DpnI, and the amplification products were recovered. After homologous recombination and transformation according to the system described in Table 12, several single colonies were selected for culture, and plasmids were extracted and sequenced.

[0307] This implementation example yielded expression plasmids for several recombinant proteins with different mutation sites. The obtained plasmids were then combined with pACYC-CsLTA-RpTD and pUltra-MjpAzFRS-tRNA. Tyr The plasmid was co-transformed into E. coli RARE(DE3), and the strain was screened with three antibiotic plates (ampicillin, streptomycin, and chloramphenicol) to obtain an engineered strain capable of site-directed insertion of 4-N3-Phe into the recombinant protein for biosynthesis.

[0308] Single colonies were picked and inoculated into liquid LB medium containing three antibiotics. After overnight incubation, the culture was transferred at a 1% inoculum and expanded. The culture was then carried out at 37°C and 220 rpm for 2 hours until OD reached. 600 The concentration was set at 0.8–1.0. IPTG was added to the culture medium to a final concentration of 1 mM, along with the reaction components: 1 mM 4-N3-benzaldehyde, 50 mM Gly, and 20 μM MPLP. The medium was incubated at 30°C and 230 rpm for 24 h. After expression was complete, the bacterial cells were collected, and protein purification and mass spectrometry verification were performed using the same method as in Example 11.

[0309] Figure 14 shows the SDS-PAGE and high-resolution proteomic spectra of various recombinant proteins of 4-N3-Phe synthesized by site-directed insertion, indicating that the engineered strains of the present invention can be used in the synthesis of a variety of functional proteins containing non-natural amino acids.

[0310] The protein synthesized in this embodiment, containing 4-N3-Phe site-directed modification, can react with groups such as DBCO, BCN, TCO, norbornene, and hydroxylamine to couple fluorescent molecules or drug molecules, thereby enabling its use in tumor cell imaging or targeted tumor therapy.

[0311] The site for the site-directed insertion of non-natural amino acids described in this invention is a site reported in the literature that does not affect protein structural stability or activity and is highly efficient in expanding the genetic code. The expression levels of the antibodies scFV and Fab, synthesized by the engineered strain of this invention and containing site-directed modification of aromatic non-natural amino acids, are approximately 1.5–2 mg / L, and the expression level of the artificial enzyme LmrR is approximately 8–9 mg / L. This strain exhibits high production efficiency of recombinant proteins and has potential for industrial application.

[0312] The sequence information of this invention is as follows:

[0313] Threonine aldolase PpLTA sequence:

[0314] Threonine aldolase LmLTA sequence:

[0315] Threonine aldolase NmLTA sequence:

[0316] Threonine aldolase CsLTA sequence:

[0317] Threonine deaminase RpTD sequence:

[0318] E. coli endogenous transaminase TyrB sequence:

[0319] plasmid pACYCDuet-1:

[0320] Primer Duet-2-F:

[0321] Primer Duet-2-R:

[0322] Primer pA-Rp-line-F:

[0323] Primer pA-Rp-line-R:

[0324] Primer PpLTA-F:

[0325] Primer PpLTA-R:

[0326] Primer LmLTA-F:

[0327] Primer LmLTA-R:

[0328] Primer NmLTA-F:

[0329] Primer NmLTA-R:

[0330] Primer NmLTA-F:

[0331] Primer NmLTA-R:

[0332] Primer Duet-1-F:

[0333] Primer Duet-1-R:

[0334] The plasmid pACYC-PpLTA-RpTD constructed in Implementation Example 1:

[0335] The plasmid pACYC-LmLTA-RpTD constructed in Implementation Example 1:

[0336] The plasmid pACYC-NmLTA-RpTD constructed in Implementation Example 1:

[0337] The plasmid pACYC-CsLTA-RpTD constructed in Implementation Example 1:

[0338] plasmid pCDF-MmPylRS(2A)-tRNA Pyl :

[0339] plasmid pUltra-MjpCNFRS-tRNA Tyr :

[0340] Primer pIFRS-F:

[0341] Primer pIFRS-R:

[0342] Primer PylHRS-F:

[0343] Primer PylHRS-R:

[0344] Primer pCDF-line-F:

[0345] Primer pCDF-line-R:

[0346] Primer pAzFRS / NaRS-F:

[0347] Primer pAzFRS / NaRS-R:

[0348] Primer pBoF-F:

[0349] Primer pBoF-R:

[0350] Primer pUltra-line-F:

[0351] Primer pUltra-line-R:

[0352] Primer pCDF-F:

[0353] Primer pCDF-R:

[0354] Primer pUltra-F:

[0355] Primer pUltra-R:

[0356] The plasmid pCDF-MmpIFRS-tRNA constructed in Example 7 Pyl :

[0357] The plasmid pCDF-MbPylHRS-tRNA constructed in Example 7 Pyl :

[0358] The plasmid pUltra-MjpAzFRS-tRNA constructed in Example 7 Tyr :

[0359] The plasmid pUltra-MjpBoFRS-tRNA constructed in Example 7 Tyr :

[0360] The plasmid pUltra-MjNaFRS-tRNA constructed in Example 7 Tyr :

[0361] plasmid pET22b-sfGFP:

[0362] Primer Y151TAG-F:

[0363] Primer Y151TAG-R:

[0364] plasmid pET22b-Herceptin-scFV:

[0365] plasmid pET22b-Herceptin-Fab:

[0366] plasmid pET22b-LmrR:

[0367] Primer scFV-S9-F:

[0368] Primer scFV-S9-R:

[0369] Primer scFV-K42-F:

[0370] Primer scFV-K42-R:

[0371] Primer Fab-A121-F:

[0372] Primer Fab-A121-R:

[0373] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. An engineered bacterium, characterized in that, The engineered bacteria are introduced with genes for one or more exogenous enzymes selected from the group consisting of threonine aldolase, threonine deaminase, and transaminase; and the engineered bacteria simultaneously express threonine aldolase, threonine deaminase, and transaminase.

2. The engineered bacteria as described in claim 1, characterized in that, The starting strain of the engineered bacteria is Escherichia coli, and the Escherichia coli is E. coli BL21(DE3), E. coli MG1655(DE3) or E. coli RARE(DE3); The E. coli RARE(DE3) is obtained by modifying the E. coli MG1655(DE3) genome, which includes knocking out the following aldehyde and ketone reduction-related genes: ΔdkgB, ΔyeaE, Δ(yqhC-dkgA), ΔyahK, and ΔyjgB.

3. The engineered bacteria as described in claim 2, characterized in that, The nucleotide sequence of the threonine aldolase is shown in the sequence selected from the group consisting of: SEQ ID NO.1 (PpLTA sequence), SEQ ID NO.2 (LmLTA sequence), SEQ ID NO.3 (NmLTA sequence), SEQ ID NO.4 (CsLTA sequence), or a combination thereof; the nucleotide sequence of the threonine deaminase is shown in SEQ ID NO.5; the transaminase is a transaminase derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO.

6.

4. A whole-cell catalyst, characterized in that, The whole-cell catalyst contains the engineered bacteria described in claim 1.

5. The use of the engineered bacteria as described in claim 1 or the whole-cell catalyst as described in claim 4, characterized in that, Used to synthesize aromatic non-natural amino acids.

6. A method for producing aromatic non-natural amino acids, characterized in that, The method includes: using aromatic aldehydes as substrates, and performing whole-cell catalytic or fermentation transformation using the engineered bacteria described in claim 1, thereby obtaining the aromatic non-natural amino acids, wherein the aromatic non-natural amino acids are as shown in formula (1): Among them, ring A is selected from C6 to C6. 10 Aryl, 5-12 membered heteroaryl or heterocyclic group, wherein each heteroaryl or heterocyclic group independently comprises 1-4 lower group ring atoms: N, O, S; The substituents R on ring A are each independently selected from the following group: hydrogen, deuterium, halogen, nitro, hydroxyl, mercapto, amino, carboxyl, cyano, acyl, sulfonyl, aminoacyl, aminosulfonyl, borate, alkenyl, alkynyl, trifluoromethyl, trifluoromethoxy, C1-C6 alkyl, O-C1-C6 alkyl, NH-C1-C6 alkyl, S-C1-C6 alkyl, and C1-C6 alkyl, C1-C6 alkoxy, NH-C1-C6 alkyl, S-C1-C6 alkyl containing substituents, C3-C8 saturated or unsaturated carbocyclic groups, 3-8 membered saturated or unsaturated heterocyclic groups, C6-C8 aryl, 5-8 membered heteroaryl. The substituents may be located at the ortho, meta, or para positions, or may coexist in any 2-3 different positions. m is an integer between 0 and 3, and n is an integer between 1 and 4, i.e., C1 to C4; The carbon atom at * has an S-type configuration.

7. The method of claim 6, wherein, The aromatic aldehyde is selected from any one of the following aromatic aldehydes, or a combination thereof:

8. The method as described in claim 6, characterized in that, When R is a C2-C6 alkyl containing substituent, it has the general formula as shown in formula (2): Among them, G 1 Each atom is independently selected from the following group: C, N, O, S; x is an integer between 2 and 5, i.e., C2 to C5; G 2 Each group is independently selected from the following groups: H, halogen, nitro, hydroxyl, mercapto, amino, carboxyl, cyano, acyl, sulfonyl, aminoacyl, aminosulfonyl, borate, alkenyl, alkynyl, O-C1~C6 alkyl, NH-C1~C6 alkyl, S-C1~C6 alkyl, C3~C8 saturated or unsaturated carbocyclic group, 3~8 membered saturated or unsaturated heterocyclic group, C6~C8 aryl, 5~8 membered heteroaryl; When R is an acyl group, it has the general formula shown in equation (3): Among them, G 3 The substituent is independently selected from the following group: C1-C6 alkyl groups and C1-C6 alkyl groups substituted with halogen, nitro, hydroxyl, mercapto, amino, cyano, acyl, or borate; C6-C8 aryl groups, 5-8 heteroaryl groups and C6-C8 aryl groups, 5-8 heteroaryl groups substituted with halogen, nitro, hydroxyl, mercapto, amino, cyano, borate, trifluoromethyl, or trifluoromethoxy, wherein the substituent may be located at the ortho, meta, or para position, or may coexist at any 2-3 different positions.

9. A second engineered bacterium for producing a target recombinant protein, characterized in that, The second engineered bacterium has the following genes introduced into and expressed in the engineered bacterium of claim 1: (1) A mutated aminoacyl-tRNA synthetase (aaRS) gene and a corresponding tRNA gene, wherein the mutated aminoacyl-tRNA synthetase is capable of recognizing the aromatic non-natural amino acids described in claim 6 and assembling them into the tRNA; The codon for the aromatic non-natural amino acid is TAG; (2) The target recombinant protein gene, wherein the target recombinant protein gene is based on the original target protein gene, and a codon at a specific site is mutated to the stop codon TAG; and Optionally, (3) purify the tag.

10. A method for producing recombinant proteins with site-directed insertion of aromatic non-natural amino acids, characterized in that, Including the following steps: (a) culturing the second engineered bacteria of claim 9 under conditions suitable for growth, thereby obtaining a culture; and (b) isolating the recombinant protein from the culture.

Citation Information

Patent Citations

  • Threonine-producing yeast

    CN110914434A

  • L-threonine aldolase mutant, gene and method for preparing L-syn-p-methylsulfonylphenylserine

    CN111139230A

  • Modified amino acid containing aryl thiophenol or aryl selenophenol, recombinant protein and biosynthesis method and application thereof

    CN114644581A

  • Strain for synthesizing salidroside through efficient biotransformation and application of strain

    CN115960811A

  • Threonine aldolase as well as preparation method and application thereof

    CN116254252A