Antitumor reagents for increasing sensitivity of malignant tumor cells to chemotherapy and immunotherapy

Targeting the NCOR2 gene with siRNA molecules addresses drug resistance in malignant tumors by increasing their sensitivity to chemotherapy and immunotherapy, improving treatment efficacy.

WO2026080581A1PCT designated stage Publication Date: 2026-04-16TAIPEI MEDICAL UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/050022
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-11
Filing Date
2025-10-08
Publication Date
2026-04-16

AI Technical Summary

Technical Problem

Malignant tumor cells develop drug resistance due to epigenetic changes, limiting the efficacy of chemotherapeutic and immunotherapeutic agents, necessitating a strategy to inhibit cancer-associated gene expression effectively.

Method used

Utilizing polynucleotides, specifically siRNA molecules targeting the NCOR2 gene, to inhibit its expression and enhance the sensitivity of malignant tumors to chemotherapy and immunotherapy.

Benefits of technology

The siRNA molecules effectively increase the sensitivity of malignant tumors to treatment by degrading NCOR2 transcripts, thereby enhancing the effectiveness of anti-tumor therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025050022_16042026_PF_FP_ABST
    Figure US2025050022_16042026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to anti-tumor reagents for increasing the sensitivities of solid tumor cells to death stimuli induced by immunotherapy reagents, chemotherapy reagents, immune cell therapy, or radiation therapy. Said anti-tumor reagents suitable for use in the invention are selected from the group comprising a) a polynucleotide complementary to the transcript of the nuclear corepressor 2 gene with a nucleotide sequence shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO: 5 that can induce the sufficient and the specific degradation and / or reduce the amount of the transcript of the nuclear corepressor 2 gene, or a derivative thereof, or b) a polynucleotide with a nucleotide sequence which comprises a contiguous segment having at least 70%, at least 80%, or at least 90% sequence identity to the polynucleotide set forth in a) when optimally aligned, or a derivative thereof. A preferred embodiment includes the delivery of said polynucleotide to said solid tumor cells with a nanoparticle, such as lipid nanoparticle, liposome, micelle, virosome, nucleic acid complex, extracellular vesicle, and exosome.
Need to check novelty before this filing date? Find Prior Art

Description

ANTITUMOR REAGENTS FOR INCREASING SENSITIVITY OF MALIGNANT TUMOR CELLS TO CHEMOTHERAPY AND IMMUNOTHERAPYFIELD OF THE INVENTION

[0001] The present disclosure relates to the field of cancer treatment. Particularly, the present disclosure provides polynucleotides silencing the transcripts of nuclear co-repressor 2 (NCOR2) and then- uses in enhancing cancer cells to cytotoxic reagents, such as chemotherapy and immunotherapy reagents.BACKGROUND OF THE INVENTION

[0002] Mammalian cells have developed chromatin-mediated strategies to fine-tune their responses to external stress to protect themselves from excessive inflammatory signaling, which would otherwise cause cell death and deleterious tissue damage. For instance, inflammatory cells like macrophages develop tolerance to sustained toll-like receptor stimulation through the action of the nuclear factor kappa-light- chain enhancer of activated B cells (NF-kB) repressosome. Similarly, macrophages can transcriptionally repress IRF7 to minimize potentially deleterious sequelae of the antiviral response. Given that tissue or tumor development is associated with global changes in the chromatin state, it follows that their vulnerability to external death stimuli is likely to be also governed by chromatin-regulatory mechanisms, which can be translated into multi-gene expression alterations that have a cumulative impact on cellular death sensitivity. Consistent with this emerging paradigm, histone deacetylase (HD AC) inhibitors or DNA demethylation agents can sensitize multidrug-resistant (MDR) tumor cells to death stimuli and are being tested in clinical trials as potential anti-tumor agents.

[0003] Drug resistance refers to progressive disease of the malignant tumors that occur at doses associated with manageable toxicity of the drug. Drug resistance of tumor cells significantly limits the efficacy of antineoplastic agents and is the major contributing factor to the therapeutic failure of human malignancies.

[0004] Epigenetic changes are heritable changes in gene expression that do not involve an alteration in the DNA sequence, which commonly involve changes in the patterns of modifications of DNA and histones, including methylation, acetylation, and phosphorylation, as well as in the architecture of the chromatin conformation. Disruptions of the epigenetic regulation of chromatin structure, function, and gene expression lead to the dysregulated of cell growth and differentiation and cancer. Consistent with this view, there is now circumstantial evidence supporting the epigenetic progenitor model in favor of the classical clonal genetic model of cancer. Epigenetic alterations, such as global DNA hypomethylation and chromatin hyperacetylation, are found at very early stages of tumorigenesis. On the other hand, hypermethylation and chromatin hypoacetylation on selective promoters are common strategies that tumors use to silenceselective tumor-suppressor genes, such as retinoblastoma 1 (RBI), pl6 (CDKN2A), von Hippel-Lindau tumor suppressor (VHL), and MutL protein homolog 1 (MLH1).

[0005] Epigenetic changes alter the expression of many genes. They may lead to a higher and faster phenotypic plasticity, through which tumor cells can adapt to new environments, such as cytotoxic drug therapy, than genetic changes. Consistent with this possibility, increasing evidence suggests that epigenetic changes in malignant tumor cells may be a crucial driving force behind the acquisition of drug resistance (Br. J. Cancer 94: 1087-1092 (2006)). For instance, methylation of CpG islands in genes involved in DNA repair, including BRCA1, GSTP1, and MGMT, was associated with increased response to chemotherapy in human ovarian cancers (Cancer Res. 65:8961-8967 (2005); N. Engl. J. Med. 343: 1350-1354 (2000)). In contrast, methylation and epigenetic inactivation of the proapoptotic gene APAF1 is common in metastatic melanoma and confer resistance to conventional chemotherapy (Nature 409:207-211 (2001)). Similarly, a subset of patients with ovarian cancer acquired methylation of the DNA mismatch repair protein hMLHl during chemotherapy, which was associated with poor overall survival (Clin. Cancer Res. 10:4420-4426 (2004)).

[0006] Accordingly, a strategy for efficiently inhibiting cancer-associated gene expression to treat cancer still needs to be developed.Summary of the Invention

[0007] The present disclosure relates to polynucleotides and methods of inhibiting the expression of the NCOR2 gene to increase the sensitivity of malignant tumors to treatment, particularly those pertaining to chemotherapeutic and immunotherapeutic agents.

[0008] The present disclosure provides a polynucleotide comprising a nucleotide sequence complementary to the mRNA of the NCOR2 gene with a nucleotide sequence shown in SEQ ID NO: 1 ; or b) a nucleotide sequence comprising a contiguous segment having at least 70%, at least 80%, or at least 90% sequence identity to the nucleotide sequence complementary to SEQ ID NO: 1. In one embodiment, the complementarity is substantial complementarity. In some embodiments, the complementarity is at least 80%, such as about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0009] In some embodiments, the polynucleotides, as recited herein, are short RNA sequences capable of inducing the RNA interference (RNAi) effect on the NCOR2 gene. Examples of short RNA sequences include, but are not limited to, small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), or double-stranded RNA (dsRNA).

[0010] An embodiment of the polynucleotide of the present disclosure is a siRNA molecule, wherein said siRNA molecule comprises (a) a duplex region and (b) either no overhang regions or at least one overhang region, wherein each overhang region contains six or fewer nucleotides, wherein the duplexregion consists of a sense region and an antisense region, wherein said sense region and said antisense region together form said duplex region and said antisense region and said sense region each 15-30 nucleotides in length and said antisense region comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 1, 2 or 4.

[0011] In some embodiments, the siRNA molecule, as recited herein, has the antisense region, and the sense region is each 15-25, 15-20, or 15-18 bases in length.

[0012] In one embodiment, the antisense strand of a siRNA contains an overhang of 1 to 10 nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, at either the 3'-end or the 5'-end. Similarly, in another embodiment, the sense strand of the siRNA includes an overhang of 1 to 10 nucleotides at the 3'-end or 5'- end. Additionally, in a further embodiment, one or more nucleotides within the overhang are substituted with nucleoside thiophosphates.

[0013] The term "antisense strand" refers to the strand of a siRNA or a double-stranded RNA (dsRNA), that contains a region largely complementary to a target sequence or a sense strand, for example, NCOR2 mRNA

[0014] In some embodiments, the siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of said double-stranded siRNA molecule is between 15 and 30 nucleotides in length; and (b) one strand of said siRNA molecule comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 1, 2, or 4.

[0015] In some embodiments, the siRNA molecule recited herein comprises a sense strand and an antisense strand, wherein said sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from SEQ ID NO: 2, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from SEQ ID NO: 3.

[0016] In some embodiments, the siRNA molecule recited herein comprises a sense strand and an antisense strand, wherein said sense strand comprises at least 15 contiguous nucleotides from SEQ ID NO: 2, and said antisense strand comprises at least 15 contiguous nucleotides from SEQ ID NO: 3.

[0017] In a specific embodiment, the siRNA molecule comprises a sense strand and an antisense strand, wherein said sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and said antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3.

[0018] In some embodiments, the siRNA molecule recited herein comprises a sense strand and an antisense strand forming another double-stranded RNA dimer, wherein said sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from SEQ ID NO: 4, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from SEQ ID NO: 5.

[0019] In some embodiments, the siRNA molecule recited herein comprises a sense strand and an antisense strand forming another double-stranded RNA dimer, wherein said sense strand comprises at least 15 contiguous nucleotides from SEQ ID NO: 4, and said antisense strand comprises at least 15 contiguous nucleotides from SEQ ID NO: 5.

[0020] In a specific embodiment, the siRNA molecule comprises a sense strand and an antisense strand, wherein said sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and said antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 5.

[0021] In some embodiments, the siRNA molecule has at least one overhang region or no overhang region.

[0022] In some embodiments, the siRNA molecule has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 overhang regions.

[0023] In some embodiments, the one or two of the sense strand and the antisense strand can be further modified as modified siRNA. Examples of the modified nucleotide include, but are not limited to, a 2’-O- methyl modified nucleotide, a 2’-fluorophoramidate, a 3 ’-terminal deoxy-thymine nucleotide, a non-natural base comprising a nucleotide, a nucleotide comprising a 5’phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative and a dodecanoic acid bisacrylamide group.

[0024] In some further embodiments, the modified siRNA comprises 10% to about 30% of the nucleotides in the double-stranded region comprising 2'-O-methyl (2'OMe) nucleotides, comprises 2'OMe nucleotides on both strands of the modified siRNA.

[0025] The present disclosure provides a pool of siRNA molecules, wherein said pool comprises one or more of the first siRNA molecule or a modified siRNA molecule thereof, the second siRNA molecule or a modified siRNA molecule thereof, and the third siRNA molecule or a modified siRNA molecule thereof, wherein said first siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of said double-stranded siRNA molecule is between 15 and 30 nucleotides in length; and (b) one strand of said siRNA molecule comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 1 ; said second siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of said double-stranded siRNA molecule is between 15 and 30 nucleotides in length; and (b) one strand of said siRNA molecule comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 2; said third siRNA molecule is a chemically synthesized double stranded siRNA molecule, wherein: (a) each strand of said double-stranded siRNA molecule is between 15 and 30 nucleotides in length; and (b) one strand of said siRNA molecule comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 4.

[0026] In some embodiments, the siRNA molecules in the pool comprise one or more of the second siRNA molecule or a modified siRNA molecule thereof, the third siRNA molecule or a modified siRNA molecule thereof, and the fourth siRNA molecule or a modified siRNA molecule thereof.

[0027] In some embodiments, the siRNA molecules in the pool comprise a sense strand and an antisense strand forming another double-stranded RNA dimer, wherein said sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from SEQ ID NO: 2 or 4, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from SEQ ID NO: 3 or 5.

[0028] In some embodiments, the siRNA molecules in the pool comprise a sense strand and an antisense strand forming another double-stranded RNA dimer, wherein said sense strand comprises at least 15 contiguous nucleotides from SEQ ID NO: 2 or 4, and said antisense strand comprises at least 15 contiguous nucleotides from SEQ ID NO: 3 or 5.

[0029] In a further embodiment, the siRNA molecule in the pool comprises a sense strand and an antisense strand, wherein said sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and said antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3.

[0030] In a further embodiment, the siRNA molecule in the pool comprises a sense strand and an antisense strand, wherein said sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and said antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 5.

[0031] The present disclosure provides a pharmaceutical composition comprising at least one of the polynucleotides or siRNA recited herein and a pharmaceutical carrier, diluent, and / or adjuvant.

[0032] The present disclosure provides a nanoparticle comprising the polynucleotide recited herein or siRNA or any mixture thereof and lipid nanoparticle (LNPs), liposome, micelle, virosome, or nucleic acid complex.

[0033] The present disclosure provides a method of inhibiting expression of a NCOR2 gene in a cell, the method comprising contacting the cell with a polynucleotide or siRNA recited herein, the pool of siRNA molecules recited herein, or the pharmaceutical composition of the polynucleotide or siRNA recited herein, thereby inhibiting expression of the NCOR2 gene in the cell.

[0034] The present disclosure provides a method of selective inhibition of NCOR2 transcripts in a cell, the method comprising contacting the cell with a polynucleotide or siRNA recited herein, the pool of siRNA molecules recited herein, or the pharmaceutical composition of the polynucleotide or siRNA recited herein, thereby selectively degrading NCOR2 transcripts in the cell.

[0035] In some embodiments, the subject recited herein is a human. More preferably, the subject has a NCOR2-associated disorder.

[0036] The present disclosure also provides a method for inhibiting growth, loco-regional spreading, and distant metastasis of a malignant tumor and / or treating a solid tumor and / or cancer metastasis in a subject, comprises administrating a polynucleotide or siRNA recited herein or any mixture thereof, the poolof siRNA molecules recited herein, the pharmaceutical composition recited herein or the nanoparticle recited herein to the subject.

[0037] The present disclosure also provides a method for increasing the sensitivity of a solid tumor to anti-tumor therapies and / or treating a solid tumor and / or tumor metastasis in a subject ccomprises administrating a polynucleotide or siRNA recited herein or any mixture thereof, the pool of siRNA molecules recited herein, the pharmaceutical composition recited herein or the nanoparticle recited herein to the subject.

[0038] In some embodiments, the anti-tumor therapies comprise immunotherapy, chemotherapy, immune cell therapy, radiation therapy, therapy using biological agents such as antibodies or their derivatives, virus-mediated gene therapy, oncolytic virus therapy, DNA vaccine, oligonucleotide therapy such as small interfering RNA, antisense RNA or microRNA, mRNA therapy, cell therapy such as cytotoxic T cells, chimeric antigen receptor T cells, nature killer cells, and macrophages, or any agent that aims at reducing the growth or the viability of a malignant tumor cell, or any combination thereo.

[0039] In some embodiment, determining said sensitivity of a solid tumor comprises assessing the number, size, or volume of said tumor lesions comprising visual, radiological, and / or pathological examination of said malignant tumor before and at various time points during and after treatment with said anti-tumor therapies.

[0040] In some embodiments, a solid tumor is sensitive to said anti-tumor therapies if the number, size, or volume of said tumor lesions during and / or after said anti-tumor therapies is significantly less than that of said tumor lesions before said anti-tumor therapies.

[0041] In some embodiments, the cancer is hepatocellular carcinoma (HCC), colorectal cancer (CRC), melanoma, malignant melanoma, skin cancer, gastric cancer, urinary bladder cancer, breast cancer, lung cancer, non-small-cell lung carcinoma (NSCLC), small cell lung cancer (SCLC), pancreatic cancer, pancreatic ductal adenocarcinoma (PDAC), head-and-neck cancer, or glioma.

[0042] In some embodiments, the polynucleotide, siRNA, the pharmaceutical composition, the pool or the nanoparticle is delivered systematically to a subject through parenteral or enteral routes or delivered to said malignant tumor by direct local injections or applications.Brief Description of the Drawings

[0043] Figure 1 shows a 50% effective dose (ED50) value of the gene-silencing effect of the NCOR2- targeted siRNA (siNCOR2) mediated by the transduction of siNCOR2.1045-1063 or siNCOR2.1369- 1387 in HCT-116 human colorectal cancer (CRC), SNU-449 human hepatocellular carcinoma (HCC), CT26.CL25 mouse CRC, Hepal -6 mouse HCC cells, and B 16 / F 10 mouse melanoma cells. The ED50 value was calculated using the nonlinear regression analysis in GraphPad PRISM version 9.9.0 (GraphPad Software, San Diego, CA, USA).

[0044] Figure 2 shows a 50% effective dose (ED50) value of the gene-silencing effect of the chemically modified NCOR2-targeted siRNA (siNCOR2) mediated by the transduction of siNCOR2.ml045-1063 or siNCOR2.ml369-1387 in HCT-116 human colorectal cancer (CRC), Hep3B human hepatocellular carcinoma (HCC), CT26.CL25 mouse CRC cells, and B16 / F10 mouse melanoma cells. The ED50 value was calculated using the nonlinear regression analysis in GraphPad PRISM version 9.9.0 (GraphPad Software, San Diego, CA, USA).

[0045] Figure 3 includes a molecular model by which NCOR2 attenuates a death signal amplification network, leading to innate treatment resistance in epithelial tissues or tumors. In tissues or tumors with low NCOR2 expression (top), cytotoxic stimuli or chemotherapy activate NF-kB, FOXO3A, STAT1 , and c-Jun, which switches on a death module using IRF1 and FOXO3A as hubs, thereby engaging the extrinsic cell death machinery including effector proteins such as TNF-Related Apoptosis-Inducing Ligand (TRAIL), caspases, and other programmed cell death (PCD) mediators to enhance cell killing significantly. In tissues or tumors with high NCOR2 expression (bottom), this death module is switched off due to treatment- induced NCOR2 nuclear translocation, resulting in chromatin-remodeling-mediated silencing of the effector genes. While this mechanism protects normal mammary glands from death, it can also impede the efficiency of tumor treatment.

[0046] Figure 4 includes several panels relating to the effect of NCOR2-targeted siRNA (siNCOR2) on the sensitivity of human cancer cells to cytotoxic stresses. (A) shows the percent cell death in HCT-116 human colorectal cancer cells, SNU-449 or Hep3B hepatocellular carcinoma cells that were treated with the 1:1 mixture of siNCOR2.1045-1063 and siNCOR2.1369-1387 (siNCOR2 mixture) or a non-target control siRNA (siNT) and then exposed to increasing concentrations of the death ligand TNF-Related Apoptosis-Inducing ligand (TRAIL) (n = 6 independent experiments). *P < 0.05; ***P < 0.001 versus siNT. (B) shows the percent cell death of HCT-116 cells treated with the 1:1 mixture of siNCOR2.1045- 1063 and siNCOR2.1369-1387 or non-target control siRNA (siNT) and then exposed to increasing concentrations of the chemotherapeutic agent cisplatin or SN-38 (n = 6 independent experiments). ***P < 0.001 versus siNT.

[0047] Figure 5 includes several panels relating to the effect of NCOR2-targeted siRNA (siNCOR2) on the sensitivity of human and mouse cancer cells to immunological stimuli. (A) shows the percent cell death in HT-29 human colorectal cancer cells treated with the 1:1 mixture of siNCOR2.1045- 1063 and siNCOR2.1369-1387 (siNCOR2 mixture) or a non-target control siRNA (siNT) and then exposed to increasing concentrations of recombinant human interferon-gamma (INFG) (n = 6 independent experiments). ***P < 0.001 versus siNT. (B) shows the percent cell death in CT26.CL25 mouse colorectal cancer cells, Hepal-6 mouse hepatocellular carcinoma cells, or B16 / F10 mouse melanoma cells treatedwith the siNC0R2 mixtures or siNT and then exposed to increasing concentrations of recombinant mouse interferon-gamma (mIFNG) (n = 6 independent experiments). ***P < 0.001 versus siNT.Detailed Description of the Invention

[0048] Unless stated otherwise, the following terms and phrases have the meanings as provided.

[0049] The term "ribonucleotide" and the phrase "ribonucleic acid" (RNA), refer to a modified or unmodified nucleotide or polynucleotide comprising at least one ribonucleotide unit. A ribonucleotide unit comprises a hydroxyl group attached to the 2' position of a ribosyl moiety that has a nitrogenous base attached in N-glycosidic linkage at the 1 ' position of a ribosyl moiety and a moiety that either allows for linkage to another nucleotide or precludes linkage.

[0050] As used herein, the term "interfering RNA" or "RNAi" or "interfering RNA sequence" refers to double-stranded RNA (i.e., duplex RNA) that targets (i.e., silences, reduces, or inhibits) expression of a target gene (i.e., by mediating the degradation of mRNAs which are complementary to the sequence of the interfering RNA) when the interfering RNA is in the same cell as the target gene. Interfering RNA thus refers to the double-stranded RNA formed by two complementary strands or by a single, self- complementary strand. Specifically, RNAi molecule refers to shRNA, siRNA or dsRNA as disclosed herein. Small hairpin RNA (shRNA) is an RNA sequence that forms a rigid hairpin turn that can be used to silence gene expression by RNA interference. shRNA can be delivered to target cells using DNA plasmids, viral vectors or bacterial vectors. Small interfering RNA (siRNA) is a class of double-stranded RNA molecules, which includes duplexes of two separate strands and single strands that can form hairpin structures comprising a duplex region. siRNAs are short (generally about 18-30 base pairs in length). The two strands that form the duplex structure can either be different segments of a single larger RNA molecule or separate RNA molecules. When the two strands are part of the same larger molecule, connected by a continuous chain of nucleotides linking the 3 ’-end of one strand to the 5 ’-end of the other strand within the duplex, this connecting segment is known as a “hairpin loop.” A hairpin loop contains at least one unpaired nucleotide. In certain embodiments, the hairpin loop includes at least 4, 5, 6, 7, 8, 9, 10, 20, 23, or more unpaired nucleotides or nucleotides that do not target the dsRNA’ s intended site. In other embodiments, the hairpin loop consists of 10 or fewer nucleotides. In some cases, it contains 8 or fewer unpaired nucleotides. Additional embodiments specify the hairpin loop as having between 4 and 10 unpaired nucleotides, or between 4 and 8 nucleotides. siRNA can be used to silence gene expression by RNA interference. Furthermore, siRNAs can vary in length and contain varying degrees of complementarity to their target mRNA in the antisense strand. Some, but not all, siRNA have unpaired overhanging bases on the 5' or 3' end of the sense strand and / or the antisense strand.

[0051] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide made up of a chain of nucleotides represented by the sequence using standard nucleotide nomenclature. The letters "G," "C," "A," "T," and "U" generally denote nucleotides containing guanine, cytosine, adenine, thymine, and uracil bases, respectively, whether in modified or unmodified forms. Additionally, it is understood that the terms "ribonucleotide" or "nucleotide" also encompass modified nucleotides, as described further below, as well as surrogate replacement moieties.

[0052] As used herein, the term "overhang" refers to one or more unpaired nucleotides that extend beyond the duplex region of an siRNA or a double-stranded RNA (dsRNA). For instance, a nucleotide overhang occurs when the 3'-end of one strand in a siRNA or dsRNA extends past the 5'-end of the complementary strand, or vice versa. A siRNA or dsRNA may contain an overhang consisting of at least one nucleotide, or alternatively, at least two, three, four, five, or more nucleotides. The nucleotide overhang can include or be composed of nucleotide or nucleoside analogs, including deoxynucleotides or deoxynucleosides. Overhangs may be present on the sense strand, the antisense strand, or both. Additionally, the nucleotide(s) forming the overhang can be located at the 5'-end, the 3'-end, or at both ends of either the sense or antisense strand of the dsRNA.

[0053] As used herein, the term "complementary nucleotide sequence" refers to complementary RNA that is complementary to a region of the mRNA transcript of the target mutant gene (i.e., the "corresponding nucleotide sequence" of the target gene).

[0054] As used herein, an excipient is an inactive ingredient in a pharmaceutical composition. Examples of excipients include fillers or diluents, surfactants, binders, glidants, lubricants, disintegrants, and the like.

[0055] As used herein, the term "substantial identity" refers to a sequence that hybridizes to a reference sequence under stringent conditions or to a sequence with a specified percent identity over a specified region of a reference sequence.

[0056] As used herein, and unless otherwise specified, the term "complementary," when referring to a first nucleotide sequence in relation to a second nucleotide sequence, denotes the capacity of an oligonucleotide or polynucleotide containing the first sequence to hybridize and form a duplex structure under specific conditions with an oligonucleotide or polynucleotide containing the second sequence, as understood by those skilled in the art. Examples of such conditions include stringent parameters such as 400 mM NaCl, 40 mM PIPES at pH 6.4, 1 mM EDTA, and incubation at 50°C or 70°C for 12-16 hours, followed by washing (see, for example, Molecular Cloning: A Laboratory Manual, Sambrook et al., 1989, Cold Spring Harbor Laboratory Press).

[0057] The terms "complementary," "fully complementary," and "substantially complementary" as used herein refer to the base pairing between the sense strand and the antisense strand of a siRNA or dsRNA.

[0058] As used herein, the phrase " stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology — Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assay" (1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization.

[0059] As used herein, the terms "substantially identical" or "substantial identity," in the context of two or more nucleic acids, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same (i.e., at least about 60%, preferably 65%, 70%, 75%, preferably 80%, 85%, 90%, or 95% identity over a specified region), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. This definition, when the context indicates, also refers analogously to the complement of a sequence. Preferably, the substantial identity exists over a region that is at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 nucleotides in length.

[0060] The term "transfection" refers to a process by which agents are introduced into a cell.

[0061] The phrase "inhibiting expression of a target gene" refers to the ability of an siRNA molecule of the present invention to silence, reduce, or inhibit the expression of a target gene. To examine the extent of gene silencing, a test sample (e.g., a biological sample from an organism of interest expressing the target gene or a sample of cells in culture expressing the target gene) is contacted with a siRNA that silences, reduces, or inhibits expression of the target gene. The expression of the target gene in the test sample is compared to the expression of the target gene in a control sample that is not in contact with the siRNA. Control samples are assigned a value of 100%. Silencing, inhibition, or reduction of expression of a target gene is achieved when the value of test the test sample relative to the control sample is about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 10%. Suitable assays include, e.g., examination of protein or mRNA levels using techniques known to one of ordinary skill suchas dot blots, Northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays known to one of ordinary skill.

[0062] The terms "treatment" and "treating" comprise therapeutic treatment of patients having already developed said condition, particularly in manifest form. Therapeutic treatment may be symptomatic treatment in order to relieve the symptoms of the specific indication or causal treatment in order to reverse or partially reverse the conditions of the indication or to stop or slow down the progression of the disease. Thus, the compositions and methods of the present invention may be used, for instance, as therapeutic treatment over a period of time, as well as for chronic therapy.

[0063] The terms "prophylactically treating," "preventively treating," and "preventing" are used interchangeably and comprise treatment of patients at risk of developing a condition mentioned herein before, thus reducing said risk.

[0064] As used herein, the term "NCOR2-associated disease" or "NCOR2-associated disorder" includes any disease or disorder that would benefit from reduction in the expression and / or activity of NCOR2.

[0065] Nuclear Receptor Corepressor 2 ("NCOR2") (gene symbol: NCOR2; NCBI Ref Seq #NM_006312; UniGene ID Hs.137510) is an epigenetic regulator that mediates transcriptional repression by recruiting and activating histone deacetylases (HDACs) (Annu. Rev. Physiol. 66:315-360 (2004)). NCOR2 exists in a large protein complex comprising GPS2 (G-protein pathway suppressor 2), which mediates inhibition of the JNK pathway, TBL-1 (transducin 0-like protein 1) and TBL-R1, which serve as E3 ligases, and HDAC3, which exhibits histone deacetylase activities. Interestingly, the purified NCOR2- HDAC3 complex possesses deacetylase activity, whereas HDAC3 alone does not function as an HDAC, suggesting that NCOR2 serves as the activator of the HDAC3 enzymatic activity (Mol. Cell. Biol. 21:6091-6101 (2001)). Biochemistry studies have further shown that a distinct deacetylase activation domain (DAD) of NCOR2 is required for the activation of the otherwise inert HDAC3 (Proc. Natl. Acad. Sci. USA 102:6009-6014 (2005)).

[0066] The NCOR2-dependent death-attenuating mechanism may function as a double-edged sword in epithelial biology. It protects normal tissues from injuries elicited by external stress while causing therapeutic resistance if retained in malignant tissues. Consistently, the expression level of endogenous NCOR2 correlates with chemotherapy resistance in breast cancer, with those tumors with higher NCOR2 expression having higher likelihoods of treatment unresponsiveness. Functional inhibition of NCOR2 involving the genetic silencing of HDAC3, the overexpression of a functionally deficient NCOR2 mutant, NCOR2 (K449A), or the transduction of an NCOR2 fragment termed "Decoy of NCOR2" capable of inhibiting the interaction of NCOR2 with HDAC3, rendered tumor cells tremendously sensitive to deathstimuli. Therefore, targeting the NC0R2 epigenetic death attenuator may hold great promise for overcoming innate therapy resistance in cancers or other types of malignant tumors.

[0067] In one aspect, the present disclosure provides a polynucleotide, comprising a nucleotide sequence complementary to the mRNA of the NCOR2 gene with a nucleotide sequence shown in SEQ ID NO: 1 ; b) a nucleotide sequence comprising a contiguous segment having at least 70%, at least 80%, or at least 90% sequence identity to the polynucleotide set forth in a).

[0068] The polynucleotide of the present disclosure can be an RNAi molecule such as small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (rniRNA), double-stranded RNA (dsRNA), or antisense oligonucleotide (ASO), or any derivatives thereof, that is complimentary to the coding or the noncoding region of the mRNA of the NCOR2 gene (SEQ ID NO:1) and thereby induces the specific degradation or reduce the amount thereof.

[0069] Particularly, the polynucleotide of the present disclosure is a siRNA of about 15-60, 15-50, 15- 50, or 15-40 (duplex) nucleotides in length, more typically about 15-30 or 15-25 (duplex) nucleotides in length, and is preferably about 20-24, 21-22, or 21-23 (duplex) nucleotides in length (e.g., each complementary sequence of the double-stranded siRNA is about 15-60, 15-50, 15-50, 15-40, 15-30, or 15- 25 nucleotides in length, preferably about 20-24, 21-22, or 21-23 nucleotides in length, and the doublestranded siRNA is about 15-60, 15-50, 15-50, 15-40, 15-30, 15-25, or 19-25 base pairs in length, preferably about 20-24, 21-22, or 21-23 base pairs in length). siRNA duplexes may comprise 3' overhangs of about 1 to about 4 nucleotides, preferably 2 to about 3 nucleotides and 5' phosphate termini. Examples of siRNA include, without limitation, a double-stranded polynucleotide molecule assembled from two separate oligonucleotides, wherein one strand is the sense strand and the other is the complementary antisense strand; a double-stranded polynucleotide molecule assembled from a single oligonucleotide, where the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker; a double-stranded polynucleotide molecule with a hairpin secondary structure having self-complementary sense and antisense regions; and a circular single-stranded polynucleotide molecule with two or more loop structures and a stem having self-complementary sense and antisense regions, where the circular polynucleotide can be processed in vivo or in vitro to generate an active double-stranded siRNA molecule.

[0070] In one embodiment of the present disclosure, the siRNA can be double-stranded and comprise at least one blunt end. For example, the siRNA can be a siRNA wherein both ends are blunt-ended; a siRNA wherein one end is blunt-ended, and the other end comprises a 5* 2 nucleotide overhang; a siRNA wherein one end is blunt-ended, and the other end comprises a 3' 2 nucleotide overhang; and / or a combination thereof. Alternatively, in this embodiment, the siRNA introduced into the cell can be double-stranded and comprise a 5' 2 nucleotide overhang at each end. In a particular embodiment, an overhang can comprise from about one nucleotide to about five nucleotides. In another embodiment, the siRNA can be double-stranded and comprise at least two overhangs. An overhang can comprise from about one nucleotide to about five nucleotides. In a particular embodiment, at least two overhangs comprise two nucleotides. In this embodiment of the invention, the siRNA can be a siRNA wherein both 3' ends comprise a 2-nucleotide overhang; a siRNA wherein one end comprises a 3' 2 nucleotide overhang and the other end comprises a 5' 2 nucleotide overhang; and / or a combination thereof.

[0071] The siRNA may be modified to contain backbone residues or linkages that are synthetic, naturally occurring, and non-naturally occurring to form analogs, which have similar binding properties as the reference nucleic acid and are metabolized like the reference nucleotides. The siRNA may be modified according to a process known in general knowledge, and the modification includes the replacement or addition of one or more atoms or groups in one or more nucleotide bases. Some examples of types of modifications that can comprise nucleotides that are modified concerning the base moieties include, but are not limited to, alkylated, halogenated, thiolated, aminated, amidated, or acetylated bases, individually or in combination. Certain examples include, for example, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1 -methylinosine, 3 -methyluridine, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6- methylguanine, N,N,-dimethyladenine, 5 -methylcytidine, 5-methyluridine and other nucleotides having a modification at the 5 position, 1 -methyladenosine, 2-methyladenosine, 3-methylcytidine, 5-(2- amino)propyl uridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza-adenosine, 6-azouridine, 6-azocytidine, 6-azothymidine, 5-methyl-2- thiouridine, other thio bases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, any O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, phenyl and modified phenyl groups such as aminophenol or 2,4,6- trimethoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. Further specific examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2'-O-methyl ribonucleotides, and peptide-nucleic acids. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues.

[0072] Chemical modification of the siRNA comprises attaching a conjugate to the siRNA molecule. The conjugate can be attached at the 5' and / or 3'-end of the sense and / or antisense strand of the siRNA via a covalent attachment such as, e.g., a biodegradable linker. The conjugate can also be attached to the siRNA e.g. through a carbamate or other linking group. In certain instances, the conjugate is a molecule that facilitates the siRNA delivery into a cell. Examples of conjugate molecules suitable for attachment to a siRNA include, without limitation, steroids such as cholesterol, glycols such as polyethylene glycol (PEG), human serum albumin (HSA), fatty acids, carotenoids, terpenes, bile acids, folates (e.g., folic acid, folate analogs and derivatives thereof), sugars (e.g., galactose, galactosamine, N-acetyl galactosamine, glucose, mannose, fructose, fucose, etc.), phospholipids, peptides, ligands for cellular receptors capable of mediating cellular uptake, and combinations thereof.

[0073] The siRNA can be chemically synthesized or encoded by a plasmid (e.g., transcribed as sequences that automatically fold into duplexes with hairpin loops). siRNA can also be generated by cleavage of longer dsRNA (e.g., dsRNA greater than about 25 nucleotides in length) with the E. coli RNase III or Dicer. These enzymes process the dsRNA into biologically active siRNA.

[0074] Substantial identity refers to a sequence that hybridizes to a reference sequence under stringent conditions or to a sequence with a specified percent identity over a specified region of a reference sequence.

[0075] For sequence comparison, typically, one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted.

[0076] A preferred example of algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms. BLAST and BLAST 2.0 are used with the parameters recited herein to determine the percent sequence identity for the nucleic acids and proteins of the present invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih, gov / ).

[0077] Once a potential siRNA sequence has been identified, the sequence can be analyzed using various criteria known in the art. One of ordinary skill will appreciate that sequences with one or more of the foregoing characteristics may be selected for further analysis and testing as potential siRNA sequences. siRNA sequences complementary to the siRNA target sites may also be designed.

[0078] The polynucleotide of the present disclosure is operatively linked to a control sequence or gene promoters that direct the expression of said polynucleotide in a particular tissue and / or type of cell. Such control sequences are well known within the art and can be constructed by any of a variety of manner known to one of ordinary skill.

[0079] Methods suitable for use in the disclosure to determine the expression of the ACTL6A mRNA comprise an assay selected from the group consisting of Northern blotting, reverse transcription polymerase chain reaction (PCR), RNase protection assay, cDNA or oligonucleotide microarray analysis, nucleotide sequencing, or the probe-based digital mRNA profiling technology such as the NanoString nCounter gene expression system (Geiss, Bumgamer et al. 2008).

[0080] Methods suitable for use in the present disclosure to determine the expression of the NCOR2 protein comprise an assay selected from the group consisting of Western blotting, ELISA, immunoprecipitation, glutathione-S-transferase fusion protein pull-down, fluorescence anisotropy, fluorescence polarization, fluorescence resonance energy transfer, analytical ultracentrifiigation, surface plasmon resonance, and isothermal titration calorimetry.

[0081] In one embodiment, the present disclosure provides a pool or kit of at least one siRNAs, preferably in the form of a kit or therapeutic reagent, wherein one strand of each of the siRNAs, the sense strand comprises a sequence that is substantially similar to a sequence within a target mRNA. The opposite, the antisense strand, will preferably comprise a sequence substantially complementary to that of the target mRNA. More preferably, one strand of each siRNA will comprise a sequence identical to a sequence contained in the target mRNA. Most preferably, each siRNA will be 15-25, 15-20, or 15-18 base pairs in length, and one strand of each siRNA will be 100% complementary to a portion of the target mRNA. By increasing the number of siRNAs directed to a particular target using a pool or kit, one would be able to increase the likelihood that at least one siRNA with satisfactory functionality will be included as well as to benefit from additive or synergistic effects. Further, when two or more siRNAs directed against a single gene do not have satisfactory levels of functionality alone, combined can satisfactorily promote degradation of the target messenger RNA and successfully inhibit translation.

[0082] The siRNA duplexes within the aforementioned pools or kit of siRNAs may correspond to overlapping sequences within a particular mRNA or non-overlapping sequences of the mRNA. However, they should preferably correspond to non-overlapping sequences. Moreover, each siRNA may be selected randomly, or one or more of the siRNA may be selected according to the criteria discussed above for maximizing the effectiveness of siRNA

[0083] In an embodiment of the present disclosure, an anti-tumor reagent or composition can be delivered to a cell, a malignant tumor or a subject by direct transfection or transfection and expression via an expression vector. Appropriate expression vectors include mammalian expression vectors and viralvectors, into which a polynucleotide encoding a sensitizing reagent with the appropriate regulatory sequences, including a promoter, to result in the expression of said sensitizing reagent in a cell or a malignant tumor. Suitable promoters can be constitutive or development-specific promoters. Transfection delivery can be achieved by liposomal transfection reagents known in the art (e.g., Xtreme transfection reagent, Roche, Alameda, CA; Lipofectamine formulations, Invitrogen, Carlsbad, CA). Delivery is mediated by cationic liposomes, and direct delivery is efficient. Another possible delivery mode is targeting using antibodies to surface markers for the target cells.

[0084] For transfection, a composition comprising one or more nucleic acid molecules (within or without vectors) can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and / or can be present in pharmaceutically acceptable formulations. Methods for the delivery of nucleic acid molecules are described, for example, in Gilmore, et al., Curr Drug Delivery (2006) 3:147-5 and Patil, et al., AAPS Journal (2005) 7:E61-E77, each of which are incorporated herein by reference. Delivery of siRNA molecules is also described in several U.S. Patent Publications, including, for example, 2006 / 0019912; 2006 / 0014289; 2005 / 0239687; 2005 / 0222064; and 2004 / 0204377, the disclosures of each of which are hereby incorporated herein by reference. Nucleic acid molecules can be administered to cells by a variety of methods known to one of ordinary skill, including, but not restricted to, encapsulation in liposomes, by iontophoresis, by electroporation, or by incorporation into other vehicles, including biodegradable polymers, hydrogels, cyclodextrins (see, for example Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074; Wang et al., International PCT publication Nos. WO 03 / 47518 and WO 03 / 46185), poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for example U.S. Pat. No. 6,447,796 and US Patent Application Publication No. 2002 / 130430), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, International PCT Publication No. WO 00 / 53722). In another embodiment, the nucleic acid molecules of the present disclosure can also be formulated or complexed with polyethyleneimine and derivatives thereof, such as polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine- polyethyleneglycol-tri-N-acetylgalactosamine (PEI-PEG-triGAL) derivatives.

[0085] Examples of liposomal transfection reagents of use with this invention include, for example: CellFectin, 1:1.5 (M / M) liposome formulation of the cationic lipid N,NI,NII,NIII-tetramethyl- N,NI,NII,NIII-tetrapalmit-y-spermine and dioleoyl phosphatidylethanolamine (DOPE) (GIBCO BRL); Cytofectin GSV, 2: 1 (M / M) liposome formulation of a cationic lipid and DOPE (Glen Research); DOTAP (N-[l-(2,3-dioleoyloxy)-N,N,N-tri-methyl-ammoniummethylsulfate) (Boehringer Manheim); Lipofectamine, 3:1 (M / M) liposome formulation of the polycationic lipid DOSPA and the neutral lipid DOPE (GIBCO BRL); and (5) siPORT (Ambion); HiPerfect (Qiagen); X-treme GENE (Roche); RNAicarrier (Epoch Biolabs) and TransPass (New England Biolabs).

[0086] Many types of human solid cancers, such as breast cancer, non-small-cell lung carcinoma (NSCLC), PDAC, the scirrhous subtype of gastric adenocarcinoma, and the "stem / serrated / mesenchymal (SSM)" molecular subtype of colorectal cancer (CRC), are characterized by a pronounced stromal reaction termed "the desmoplastic response" (Minamoto, Ooi et al. 1988, Liotta and Kohn 2001, Orimo, Gupta et al. 2005, Kamoub, Dash et al. 2007, Shiao and Coussens 2010, Isella, Terrasi et al. 2015), which constitutes a major obstacle for the efficient transport of cancer therapeutics into the tumor. Recently, two nanoparticle- formulated chemotherapy, including albumin-bound paclitaxel (nab-paclitaxel) and liposome-encapsulated irinotecan, have been shown to extend the survival of patients with advanced PDAC. Both reagents could significantly increase the levels of the chemotherapeutic agents in the treated tumors (Wang-Gillam et al., Lancet, 2016 Feb 6;387(10018):545-557), suggesting that nanoparticle formulation is a clinically validated approach to improve the treatment efficacy of desmoplastic cancers. In liver disease, parenterally administration of a lipid nanoparticle (LNP)-formulated siRNA specific for transthyretin (Patisiran, Alnylam Pharmaceuticals, MA, USA) has been shown to reduce up to 86.8% of transthyretin produced by the liver in patients with hereditary transthyretin-mediated amyloidosis and thus became the first clinically approved RNAi drug (Adams, Gonzalez-Duarte et al. 2018). Moreover, nanoparticle-delivered siRNA therapy, such as cyclodextrin polymer-based nanoparticles carrying siRNA targeting ribonucleotide reductase M2 (RRM2) and lipid nanoparticles carrying siRNA targeting VEGF-A and kinesin spindle protein (KSP), have shown promising pharmacodynamics and tolerability and anti-tumor efficacy in some of the treated patients in phase 1 clinical trials. Moreover, the systemic delivery of siRNA targeting tumordriving genes such as BCR-ABL has also showed significant therapeutic efficacy in a murine orthotopic model of hepatocellular carcinoma (HCC) (Tabemero et al., Cancer Discov, 2013 Apr;3(4):406-17). As opposed to microRNA, siRNA silences only one mRNA target and therefore its genetic and biological effect is highly specific and associated with less off-target effects as exemplified by the recent approval of the first-in-class liposomal siRNA targeting transthyretin in patients with hereditary amyloidosis (Adams, Gonzalez-Duarte et al. 2018). In complex multigenic diseases such as human malignancies, the implementation of siRNA-based therapy requires the identification of "driver" genes that serve as the key regulators of the disease pathology.

[0087] Therapeutic gene delivery into tumor cells or malignant tissues can be achieved using nonviral vehicles, such as lipid-based and polymeric materials (Pirollo, Xu et al. 2000, Schroeder, Heller et al. 2011). For instance, a tumor-targeting immunoliposome nanocomplex termed scL, in which the therapeutic molecule payload is encapsulated within a cationic liposome with its surface decorated with an antitransferrin receptor (TfR) single-chain antibody fragment, has been designed to target tumor cells via the TfR highly expressed on their surface. A series of studies have demonstrated that the scL nanocomplex can specifically deliver various payloads, including plasmid DNA, siRNA, and small molecules, to bothprimary and metastatic tumor cells and even cancer stem cells both in vitro and in vivo. Systemic administration of the p53 plasmid DNA encapsulated with the scL immunoliposome nanoparticle termed TfRscFv-Lip p53 or "SGT-53" have been shown to induce tumor-specific expression of the exogenous p53 and thereby enhance the efficacy of chemo- and radio-therapy in various pre-clinical models of human tumors such as breast cancer, malignant glioma, head-and neck cancer, and pancreatic cancer. Importantly, the clinical applicability of the SGT-53 has been shown in a recent phase 1 clinical trial, which revealed well tolerance of the study participants at the therapeutic doses tested. Significantly, PCR analysis of the tumor tissues revealed the clear presence of the exogenous p53 transgene, lending a solid support to the scL nanoparticles as a valid systemic delivery vehicle to effectively deliver the therapeutic gene to human tumors.

[0088] A lipid nanoparticle (LNP) suitable for in vivo delivery of oligonucleotides such as siRNA to tumor tissues has been generated with a rational-design approach by AlCana Technologies (Vancouver, BC)(Jayaraman, Ansell et al. 2012, Adams, Gonzalez-Duarte et al. 2018). Said LNP formulation consists of four lipid components, including the ionizable cationic amino lipid DLin-MC3-DMA, which complexes with siRNA, the amphipathic phospholipid distearoyl-phophatidylcholine (DSPC), cholesterol and a coat lipid poly(ethylene glycol) lipid l,2-dimyristoyl-rac-glycerol-methoxy(poly(ethylene glycol)) (DMG-PEG) mixed at the molar ratio of 50: 10:38.5: 1.5. The particle size of the DLin-MC3-DMA LNP is in the range of 70-90 nm (Jayaraman, Ansell et al. 2012), which is associated with an extended circulation times and permit its leakage into the tumor tissues through the leaky endothelial fenestrations (with estimated pore sizes of 380-780 nm), a phenomenon known as the "enhanced permeability and retention (EPR)" effect (Jain and Stylianopoulos 2010, Agarwal and Roy 2013).

[0089] The DLin-MC3-DMA-based LNP formation has been used in the first FDA-approved siRNA drug patisiran (Onpattro) developed by Alnylam Pharmaceuticals. It has also been used for systemic delivery of siRNA targeting tumor-driving genes such as BCR-ABL, VEGF-A, and kinesin spindle protein (KSP), which showed significant therapeutic efficacy in a mouse model of chronic myeloid leukemia (CML) or a murine orthotopic model of hepatocellular carcinoma (HCC). Systemic delivery of siRNA encapsulated using the DLin-MC3-DMA-based LNP is safe and generally well-tolerated in phase I clinical trials, except for some infusion-related reactions and transient proinflammatory cytokine induction (Tabemero, Shapiro et al. 2013).

[0090] A polynucleotide or siRNA or an oligonucleotide can be encapsulated by an LNP by mixing siRNA or oligonucleotides dissolved in 10 mM citrate buffer (pH 3.0) with an LNP in dissolved ethanol using a microfluidic instrument such as the NanoAssemblr system (Precision Nanosystems, Vancouver, BC, Canada) at a flow rate of 0.5 ml / min and a flow rate ratio of 1 :3 (lipid: siRNA = 0.125 ml / min:0.375 ml / rnin). Syringe pumps (Harvard Apparatus, MA, USA) can control the flow rate. The resulting LNP / siRNAmixture solution is then dialyzed against phosphate-buffered saline using Spectra / Por 4 dialysis membranes (Spectrum Laboratories, Rancho Dominguez, CA, USA). The LNP-encapsulated siRNA solution was then concentrated by ultrafiltration using an Amicon Ultra- 15 unit (MWCO 50 kDa, Merch Millipore, Burlington, MA, USA). The size (number-weighted mean diameter) and ^-potential of the LNPs were measured by a Zetasizer Nano ZS ZEN3600 instrument (Malvern Instruments, Worcestershire, UK). The encapsulation efficiency and total siRNA concentration were measured using the Quanti-iT RiboGreen RNA Reagent and Kit (Invitrogen, Waltham, MA, USA).

[0091] For gene therapy vectors, the dosage to be administered may depend to a large extent on the condition and size of the subject being treated as well as the therapeutic formulation, frequency of treatment, and the route of administration. Regimens for continuing therapy, including dose, formulation, and frequency, may be guided by the initial response and clinical judgment. The parenteral route of injection into the blood vessel or interstitial space of tissue may be preferred. However, other parenteral routes, such as inhalation of an aerosol formulation, may be required in specific administration. In some protocols, a formulation comprising the gene and gene delivery system in an aqueous carrier is injected into tissue in appropriate amounts.

[0092] The present disclosure also recites methods for reducing or inhibiting NCOR2 expression in a cell by using a polynucleotide or siRNA or a pool, composition or nanoparticle comprising the polynucleotide or siRNA as disclosed. These methods involve contacting the cell with a polynucleotide or siRNA as recited herein and maintaining the cell for a sufficient period to achieve degradation of the NCOR2 gene mRNA transcript, thereby suppressing NCOR2 gene expression within the cell.

[0093] Subjects that would benefit from a reduction or inhibition of NCOR2 gene expression are those having a NCOR2-associated disease. For example, the disease can be cancer or metastasis cancer. Examples include, but are not limited to, hepatocellular carcinoma (HCC), colorectal cancer (CRC), melanoma, malignant melanoma, skin cancer, gastric cancer, urinary bladder cancer, breast cancer, lung cancer, non- small-cell lung carcinoma (NSCLC), small cell lung cancer (SCLC), pancreatic cancer, pancreatic ductal adenocarcinoma (PDAC), head-and-neck cancer, and glioma.

[0094] The present disclosure also provides a method for inhibiting growth, loco-regional spreading, and distant metastasis of a malignant cancer and / or treating a solid cancer and / or cancer metastasis in a subject, comprises administrating a polynucleotide or siRNA recited herein or any mixture thereof, the pool of siRNA molecules recited herein, the pharmaceutical composition recited herein or the nanoparticle recited herein to the subject.

[0095] The present disclosure also provides a method for increasing the sensitivity of a solid tumor to anti-tumor therapies and / or treating a solid tumor and / or tumor metastasis in a subject comprises administrating a polynucleotide or siRNA recited herein or any mixture thereof, the pool of siRNAmolecules recited herein, the pharmaceutical composition recited herein or the nanoparticle recited herein to the subject. The sensitivity of a solid tumor can be determined by for example, assessing the number, size, or volume of said tumor lesions comprising visual, radiological, and / or pathological examination of said malignant tumor before and at various time points during and after treatment with said anti-tumor therapies. A solid tumor is sensitive to said anti-tumor therapies if for example, the number, size, or volume of said tumor lesions during and / or after said anti-tumor therapies is significantly less than that of said tumor lesions before said anti-tumor therapies.

[0096] The anti-tumor therapies comprise immunotherapy, chemotherapy, immune cell therapy, radiation therapy, therapy using biological agents such as antibodies or their derivatives, virus-mediated gene therapy, oncolytic virus therapy, DNA vaccine, oligonucleotide therapy such as small interfering RNA, antisense RNA or microRNA, mRNA therapy, cell therapy such as cytotoxic T cells, chimeric antigen receptor T cells, nature killer cells, and macrophages, or any agent that aims at reducing the growth or the viability of a malignant tumor cell, or any combination thereo.

[0097] When the subject is a mammal, such as a human, the polynucleotide, siRNA, pool, pharmaceutical composition or nanoparticles recited herein can be delivered by any method known in the field, including but not limited to oral, intraperitoneal, or parenteral routes. Parenteral administration may include intracranial (e.g., intraventricular, intraparenchymal, or intrathecal), intravenous, intramuscular, intravitreal, subcutaneous, transdermal, airway (aerosol), nasal, rectal, or topical (including buccal and sublingual) delivery.Sequence ListingSEQ ID NO: 1 sets out the mRNA sequence of the human NCOR2 gene, transcript variant 1 (NCBI Reference Sequence: NM 006312.5).GCCGGCGCCCTAGGAGGCGGCGGCGGGAGGATCGCGTCCCGACCCGAGGCCGGGCCTGCTG CGCGCCCCCAGCCCGATCGGCACCGCCACTTGCCTGAGCGCCCCGGCGGCCCGAGCGCGCCC CAAGCCCGGGCGCCACCGCTGCCACCTCCGCGAGGTCTCCCTGAGTCTTTGAGGACACAGCC TCGCTGGAGGCAGTTTCTGGTGCCAGTGACGGGGTGGCCCGTGAGCTGATGACGAGGACTG GCTTTTAATCCTTGGTGGTGATTAAGAGAAAGCTTATTGGGGCCTGGGAGCAGCTCCCCGCC GACCCCCACCACCATGTCGGGATCCACACAGCCTGTGGCACAGACGTGGAGGGCCACTGAG CCCCGCTACCCGCCCCACAGCCTTTCCTACCCAGTGCAGATCGCCCGGACGCACACGGACGT CGGGCTCCTGGAGTACCAGCACCACTCCCGCGACTATGCCTCCCACCTGTCGCCCGGCTCCA TCATCCAGCCCCAGCGGCGGAGGCCCTCCCTGCTGTCTGAGTTCCAGCCCGGGAATGAACGGTCCCAGGAGCTCCACCTGCGGCCAGAGTCCCACTCATACCTGCCCGAGCTGGGGAAGTCAGAGATGGAGTTCATTGAAAGCAAGCGCCCTCGGCTAGAGCTGCTGCCTGACCCCCTGCTGCGACCGTCACCCCTGCTGGCCACGGGCCAGCCTGCGGGATCTGAAGACCTCACCAAGGACCGTAGCCTGACGGGCAAGCTGGAACCGGTGTCTCCCCCCAGCCCCCCGCACACTGACCCTGAGCTGGAGCTGGTGCCGCCACGGCTGTCCAAGGAGGAGCTGATCCAGAACATGGACCGCGTGGACCGAGAGATCACCATGGTAGAGCAGCAGATCTCTAAGCTGAAGAAGAAGCAGCAACAGCTGGAGGAGGAGGCTGCCAAGCCGCCCGAGCCTGAGAAGCCCGTGTCACCGCCGCCCATCGAGTCGAAGCACCGCAGCCTGGTGCAGATCATCTACGACGAGAACCGGAAGAAGGCTGAAGCTGCACATCGGATTCTGGAAGGCCTGGGGCCCCAGGTGGAGCTGCCGCTGTACAACCAGCCCTCCGACACCCGGCAGTATCATGAGAACATCAAAATAAACCAGGCGATGCGGAAGAAGCTAATCTTGTACTTCAAGAGGAGGAATCACGCTCGGAAACAATGGGAGCAGAAGTTCTGCCAGCGCTATGACCAGCTCATGGAGGCCTGGGAGAAGAAGGTGGAGCGCATCGAGAACAACCCCCGGCGGCGGGCCAAGGAGAGCAAGGTGCGCGAGTACTACGAGAAGCAGTTCCCTGAGATCCGCAAGCAGCGCGAGCTGCAGGAGCGCATGCAGAGCAGGGTGGGCCAGCGGGGCAGTGGGCTGTCCATGTCGGCCGCCCGCAGCGAGCACGAGGTGTCAGAGATCATCGATGGCCTCTCAGAGCAGGAGAACCTGGAGAAGCAGATGCGCCAGCTGGCCGTGATCCCGCCCATGCTGTACGACGCTGACCAGCAGCGCATCAAGTTCATCAACATGAACGGGCTTATGGCCGACCCCATGAAGGTGTACAAAGACCGCCAGGTCATGAACATGTGGAGTGAGCAGGAGAAGGAGACCTTCCGGGAGAAGTTCATGCAGCATCCCAAGAACTTTGGCCTGATCGCATCATTCCTGGAGAGGAAGACAGTGGCTGAGTGCGTCCTCTATTACTACCTGACTAAGAAGAATGAGAACTATAAGAGCCTGGTGAGACGGAGCTATCGGCGCCGCGGCAAGAGCCAGCAGCAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCCATGCCCCGCAGCAGCCAGGAGGAGAAAGATGAGAAGGAGAAGGAAAAGGAGGCGGAGAAGGAGGAGGAGAAGCCGGAGGTGGAGAACGACAAGGAAGACCTCCTCAAGGAGAAGACAGACGACACCTCAGGGGAGGACAACGACGAGAAGGAGGCTGTGGCCTCCAAAGGCCGCAAAACTGCCAACAGCCAGGGAAGACGCAAAGGCCGCATCACCCGCTCAATGGCTAATGAGGCCAACAGCGAGGAGGCCATCACCCCCCAGCAGAGCGCCGAGCTGGCCTCCATGGAGCTGAATGAGAGTTCTCGCTGGACAGAAGAAGAAATGGAAACAGCCAAGAAAGGTCTCCTGGAACACGGCCGCAACTGGTCGGCCATCGCCCGGATGGTGGGCTCCAAGACTGTGTCGCAGTGTAAGAACTTCTACTTCAACTACAAGAAGAGGCAGAACCTCGATGAGATCTTGCAGCAGCACAAGCTGAAGATGGAGAAGGAGAGGAACGCGCGGAGGAAGAAGAAGAAAGCGCCGGCGGCGGCCAGCGAGGAGGCTGCATTCCCGCCCGTGGTGGAGGATGAGGAGATGGAGGCGTCGGGCGTGAGCGGAAATGAGGAGGAGATGGTGGAGGAGGCTGAAGCCTTACATGCCTCTGGGAATGAGGTGCCCAGAGGGGAATGCAGTGGCCCAGCCACTGTCAACAACAGCTCAGACACCGAGAGCATCCCCTCTCCTCACACTGAGGCCGCCAAGGACACAGGGCAGAATGGGCCCAAGCCCCCAGCCACCCTGGGCGCCGACGGGCCACCCCCAGGGCCACCCACCCCACCACCGGAGGACATCCCGGCCCCCACTGAGCCCACCCCGGCCTCTGAAGCCACCGGAGCCCCTACGCCCCCACCAGCACCCCCATCGCCCTCTGCACCTCCTCCTGTGGTCCCCAAGGAGGAGAAGGAGGAGGAGACCGCAGCAGCGCCCCCAGTGGAGGAGGGGGAGGAGCAGAAGCCCCCCGCGGCTGAGGAGCTGGCAGTGGACACAGGGAAGGCCGAGGAGCCCGTCAAGAGCGAGTGCACGGAGGAAGCCGAGGAGGGGCCGGCCAAGGGCAAGGACGCGGAGGCCGCTGAGGCCACGGCCGAGGGGGCGCTCAAGGCAGAGAAGAAGGAGGGCGGGAGCGGCAGGGCCACCACAGCCAAGAGCTCGGGCGCCCCCCAGGACAGCGACTCCAGTGCTACCTGCAGTGCAGACGAGGTGGATGAGGCCGAGGGCGGCGACAAGAACCGGCTGCTGTCCCCAAGGCCCAGCCTCCTCACCCCGACTGGCGACCCCCGGGCCAATGCCTCACCCCAGAAGCCACTGGACCTGAAGCAGCTGAAGCAGCGAGCGGCTGCCATCCCCCCCATCCAGGTCACCAAAGTCCATGAGCCCCCCCGGGAGGACGCAGCTCCCACCAAGCCAGCTCCCCCAGCCCCACCGCCACCGCAAAACCTGCAGCCGGAGAGCGACGCCCCTCAGCAGCCTGGCAGCAGCCCCCGGGGCAAGAGCAGGAGCCCGGCACCCCCCGCCGACAAGGAGGCCTTCGCAGCCGAGGCCCAGAAGCTGCCTGGGGACCCCCCTTGCTGGACTTCCGGCCTGCCCTTCCCCGTGCCCCCCCGTGAGGTGATCAAGGCCTCCCCGCATGCCCCGGACCCCTCAGCCTTCTCCTACGCTCCACCTGGTCACCCACTGCCCCTGGGCCTCCATGACACTGCCCGGCCCGTCCTGCCGCGCCCACCCACCATCTCCAACCCGCCTCCCCTCATCTCCTCTGCCAAGCACCCCAGCGTCCTCGAGAGGCAAATAGGTGCCATCTCCCAAGGAATGTCGGTCCAGCTCCACGTCCCGTACTCAGAGCATGCCAAGGCCCCGGTGGGCCCTGTCACCATGGGGCTGCCCCTGCCCATGGACCCCAAAAAGCTGGCACCCTTCAGCGGAGTGAAGCAGGAGCAGCTGTCCCCACGGGGCCAGGCTGGGCCACCGGAGAGCCTGGGGGTGCCCACAGCCCAGGAGGCGTCCGTGCTGAGAGGGACAGCTCTGGGCTCAGTTCCGGGCGGAAGCATCACCAAAGGCATTCCCAGCACACGGGTGCCCTCGGACAGCGCCATCACATACCGCGGCTCCATCACCCACGGCACGCCAGCTGACGTCCTGTACAAGGGCACCATCACCAGGATCATCGGCGAGGACAGCCCGAGTCGCTTGGACCGCGGCCGGGAGGACAGCCTGCCCAAGGGCCACGTCATCTACGAAGGCAAGAAGGGCCACGTCTTGTCCTATGAGGGTGGCATGTCTGTGACCCAGTGCTCCAAGGAGGACGGCAGAAGCAGCTCAGGACCCCCCCATGAGACGGCCGCCCCCAAGCGCACCTATGACATGATGGAGGGCCGCGTGGGCAGAGCCATCTCCTCAGCCAGCATCGAAGGTCTCATGGGCCGTGCCATCCCGCCGGAGCGACACAGCCCCCACCACCTCAAAGAGCAGCACCACATCCGCGGGTCCATCACACAAGGGATCCCTCGGTCCTACGTGGAGGCACAGGAGGACTACCTGCGTCGGGAGGCCAAGCTCCTAAAGCGGGAGGGCACGCCTCCGCCCCCACCGCCCTCACGGGACCTGACCGAGGCCTACAAGACGCAGGCCCTGGGCCCCCTGAAGCTGAAGCCGGCCCATGAGGGCCTGGTGGCCACGGTGAAGGAGGCGGGCCGCTCCATCCATGAGATCCCGCGCGAGGAGCTGCGGCACACGCCCGAGCTGCCCCTGGCCCCGCGGCCGCTCAAGGAGGGCTCCATCACGCAGGGCACCCCGCTCAAGTACGACACCGGCGCGTCCACCACTGGCTCCAAAAAGCACGACGTACGCTCCCTCATCGGCAGCCCCGGCCGGACGTTCCCACCCGTGCACCCGCTGGATGTGATGGCCGACGCCCGGGCACTGGAACGTGCCTGCTACGAGGAGAGCCTGAAGAGCCGGCCAGGGACCGCCAGCAGCTCGGGGGGCTCCATTGCGCGCGGCGCCCCGGTCATTGTGCCTGAGCTGGGTAAGCCGCGGCAGAGCCCCCTGACCTATGAGGACCACGGGGCACCCTTTGCCGGCCACCTCCCACGAGGTTCGCCCGTGACCACGCGGGAGCCCACGCCGCGCCTGCAGGAGGGCAGCCTTTCGTCCAGCAAGGCATCCCAGGACCGAAAGCTGACGTCGACGCCTCGTGAGATCGCCAAGTCCCCGCACAGCACCGTGCCCGAGCACCACCCACACCCCATCTCGCCCTATGAGCACCTGCTTCGGGGCGTGAGTGGCGTGGACCTGTATCGCAGCCACATCCCCCTGGCCTTCGACCCCACCTCCATACCCCGCGGCATCCCTCTGGACGCAGCCGCTGCCTACTACCTGCCCCGACACCTGGCCCCCAACCCCACCTACCCGCACCTGTACCCACCCTACCTCATCCGCGGCTACCCCGACACGGCGGCGCTGGAGAACCGGCAGACCATCATCAATGACTACATCACCTCGCAGCAGATGCACCACAACGCGGCCACCGCCATGGCCCAGCGAGCTGATATGCTGAGGGGCCTCTCGCCCCGCGAGTCCTCGCTGGCACTCAACTACGCTGCGGGTCCCCGAGGCATCATCGACCTGTCCCAAGTGCCACACCTGCCTGTGCTCGTGCCCCCGACACCAGGCACCCCAGCCACCGCCATGGACCGCCTTGCCTACCTCCCCACCGCGCCCCAGCCCTTCAGCAGCCGCCACAGCAGCTCCCCACTCTCCCCAGGAGGTCCAACACACTTGACAAAACCAACCACCACGTCCTCGTCCGAGCGGGAGCGAGACCGGGATCGAGAGCGGGACCGGGATCGGGAGCGGGAAAAGTCCATCCTCACGTCCACCACGACGGTGGAGCACGCACCCATCTGGAGACCTGGTACAGAGCAGAGCAGCGGCAGCAGCGGCGGGGGTGGGGGCAGCAGCAGCCGCCCCGCCTCCCACTCCCATGCCCACCAGCACTCGCCCATCTCCCCTCGGACCCAGGATGCCCTCCAGCAGAGACCCAGTGTGCTTCACAACACAGGCATGAAGGGTATCATCACCGCTGTGGAGCCCAGCACGCCCACGGTCCTGAGGTCCACCTCCACCTCCTCACCCGTTCGCCCGGCTGCCACATTCCCACCTGCCACCCACTGCCCACTGGGCGGCACCCTCGATGGGGTCTACCCTACCCTCATGGAGCCCGTCTTGCTGCCCAAGGAGGCCCCCCGGGTCGCCCGGCCAGAGCGGCCCCGAGCAGACACCGGCCATGCCTTCCTCGCCAAGCCCCCAGCCCGCTCCGGGCTGGAGCCCGCCTCCTCCCCCAGCAAGGGCTCGGAGCCCCGGCCCCTAGTGCCTCCTGTCTCTGGCCACGCCACCATCGCCCGCACCCCTGCGAAGAACCTCGCACCTCACCACGCCAGCCCGGACCCGCCGGCGCCACCTGCCTCGGCCTCGGACCCGCACCGGGAAAAGACTCAAAGTAAACCCTTTTCCATCCAGGAACTGGAACTCCGTTCTCTGGGTTACCACGGCAGCAGCTACAGCCCCGAAGGGGTGGAGCCCGTCAGCCCTGTGAGCTCACCCAGTCTGACCCACGACAAGGGGCTCCCCAAGCACCTGGAAGAGCTCGACAAGAGCCACCTGGAGGGGGAGCTGCGGCCCAAGCAGCCAGGCCCCGTGAAGCTTGGCGGGGAGGCCGCCCACCTCCCACACCTGCGGCCGCTGCCTGAGAGCCAGCCCTCGTCCAGCCCGCTGCTCCAGACCGCCCCAGGGGTCAAAGGTCACCAGCGGGTGGTCACCCTGGCCCAGCACATCAGTGAGGTCATCACACAGGACTACACCCGGCACCACCCACAGCAGCTCAGCGCACCCCTGCCCGCCCCCCTCTACTCCTTCCCTGGGGCCAGCTGCCCCGTCCTGGACCTCCGCCGCCCACCCAGTGACCTCTACCTCCCGCCCCCGGACCATGGTGCCCCGGCCCGTGGCTCCCCCCACAGCGAAGGGGGCAAGAGGTCTCCAGAGCCAAACAAGACGTCGGTCTTGGGTGGTGGTGAGGACGGTATTGAACCTGTGTCCCCACCGGAGGGCATGACGGAGCCAGGGCACTCCCGGAGTGCTGTGTACCCGCTGCTGTACCGGGATGGGGAACAGACGGAGCCCAGCAGGATGGGCTCCAAGTCTCCAGGCAACACCAGCCAGCCGCCAGCCTTCTTCAGCAAGCTGACCGAGAGCAACTCCGCCATGGTCAAGTCCAAGAAGCAAGAGATCAACAAGAAGCTGAACACCCACAACCGGAATGAGCCTGAATACAATATCAGCCAGCCTGGGACGGAGATCTTCAATATGCCCGCCATCACCGGAACAGGCCTTATGACCTATAGAAGCCAGGCGGTGCAGGAACATGCCAGCACCAACATGGGGCTGGAGGCCATAATTAGAAAGGCACTCATGGGTAAATATGACCAGTGGGAAGAGTCCCCGCCGCTCAGCGCCAATGCTTTTAACCCTCTGAATGCCAGTGCCAGCCTGCCCGCTGCTATGCCCATAACCGCTGCTGACGGACGGAGTGACCACACACTCACCTCGCCAGGTGGCGGCGGGAAGGCCAAGGTCTCTGGCAGACCCAGCAGCCGAAAAGCCAAGTCCCCGGCCCCGGGCCTGGCATCTGGGGACCGGCCACCCTCTGTCTCCTCAGTGCACTCGGAGGGAGACTGCAACCGCCGGACGCCGCTCACCAACCGCGTGTGGGAGGACAGGCCCTCGTCCGCAGGTTCCACGCCATTCCCCTACAACCCCCTGATCATGCGGCTGCAGGCGGGTGTCATGGCTTCCCCACCCCCACCGGGCCTCCCCGCGGGCAGCGGGCCCCTCGCTGGCCCCCACCACGCCTGGGACGAGGAGCCCAAGCCACTGCTCTGCTCGCAGTACGAGACACTCTCCGACAGCGAGTGACTCAGAACAGGGCGGGGGGGGGGGCGGTGTCAGGTCCCAGCGAGCCACAGGAACGGCCCTGCAGGAGCAGGGCGGCTGCCGACTCCCCCAACCAAGGAAGGAGCCCCTGAGTCCGCCTGCGCCTCCATCCATCTGTCCGTCCAGAGCCGGCATCCTTGCCTGTCTAAAGCCTTAACTAAGACTCCCGCCCCGGGCTGGCCCTGTGCAGACCTTACTCAGGGGATGTTTACCTGGTGCTCGGGAAGGGAGGGGAAGGGGCCGGGGAGGGGGCACGGCAGGCGTGTGGCAGCCACACGCAGGCGGCCAGGGCGGCCAGGGACCCAAAGCAGGATGACCACGCACCTCCACGCCACTGCCTCCCCCGAATGCATTTGGAACCAAAGTCTAAACTGAGCTCGCAGCCCCCGCGCCCTCCCTCCGCCTCCCATCCCGCTTAGCGCTCTGGACAGATGGACGCAGGCCCTGTCCAGCCCCCAGTGCGCTCGTTCCGGTCCCCACAGACTGCCCCAGCCAACGAGATTGCTGGAAACCAAGTCAGGCCAGGTGGGCGGACAAAAGGGCCAGGTGCGGCCTGGGGGGAACGGATGCTCCGAGGACTGGACTGTTTTTTTCACACATCGTTGCCGCAGCGGTGGGAAGGAAAGGCAGATGTAAATGATGTGTTGGTTTACAGGGTATATTTTTGATACCTTCAATGAATTAATTCAGATGTTTTACGCAAGGAAGGACTTACCCAGTATTACTGCTGCTGTGCTTTTGATCTCTGCTTACCGTTCAAGAGGCGTGTGCAGGCCGACAGTCGGTGACCCCATCACTCGCAGGACCAAGGGGGCGGGGACTGCTGGCTCACGCCCCGCTGTGTCCTCCCTCCCTCCCTTCCTTGGGCAGAATGAATTCGATGCGTATTCTGTGGCCGCCATCTGCGCAGGGTGGTGGTATTCTGTCATTTACACACGTCGTTCTAATTAAAAAGCGAATTATACTCCAGTTASEQ ID NO: 2 sets out the nucleotide sequence of the sense strand of the NCOR2-targeted siNCOR2.1045- 1063, corresponding to nucleotide 1045 to nucleotide 1063 of NCOR2 transcript variant 1.GCUGAAGAAGAAGCAGCAASEQ ID NO: 3 sets out the nucleotide sequence of the antisense strand of the NCOR2-targeted siNCOR2. 1045-1063, which is reverse complementary to the sense strand shown in SEQ ID NO: 2.UUGCUGCUUCUUCUUCAGCSEQ ID NO: 4 sets out the nucleotide sequence of the sense strand of the NCOR2-targeted siNCOR2.1369- 1387, corresponding to nucleotide 1369 to nucleotide 1387 of NCOR2 transcript variant 1.GCGCUAUGACCAGCUCAUGSEQ ID NO: 5 sets out the nucleotide sequence of the antisense strand of the NCOR2-targeted siNCOR2. 1369-1387, which is reverse complementary to the sense strand shown in SEQ ID NO: 4.CAUGAGCUGGUCAUAGCGCEXAMPLES

[0098] The following examples are given for illustrative purposes only and are not intended to be limiting unless otherwise specified. It should be appreciated by one of ordinary skill that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of invention and thus can be considered to constitute preferred modes for its practice. One of ordinary skill should appreciate that many changes can be made in the specific embodiments disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0099] Example 1 In silico and experimental screening of NCOR2-targeted siRNA (siNCORl)

[0100] To exploit NCOR2 as a therapeutic target in treating human cancers, we developed siRNA therapy to specifically inhibit the expression of NCOR2 (NCBI RefSeq: NM 006312.6) that can simultaneously target NCOR2 and its homologs across rodent and non-rodent species to permit the flexible selection of relevant species in preclinical animal toxicity tests. We first aligned the sequences of NCOR2across various species, including mouse (Mus musculus), pig (Sus scrofa), dog (Canis lupus), cynomolgus monkey (Macaca fascicularis), and human (Homo sapiens) using the CLUSTALW (https: / / www.genome.jp / tools-bin / clustalw). The human NC0R2 mRNA has a 63.9%, 69.6%, 59.4%, and 72.2% identity with that of mouse, pig, dog, and monkey paralogs, respectively. We aligned the mRNA sequences of the human, mouse, pig, and dog NC0R2 genes using the BLAST program of the National Center for Biotechnology Information (NCBI), thereby identifying 12 identical mRNA sub-segments with conserved sequences for longer than 25 nucleotides. We designed siRNAs based on the sequences of each sub-segment using the siRNA Selection Server at the Whitehead Institute for Biomedical Research (http: / / sima.wi.mit.edu / home.php) (Y uan, Latek et al. 2004, Frank-Kamenetsky, Grefhorst et al. 2008). We then applied the following criteria to select the candidate siRNAs: (1) a GC content of 40-60%, (2) a negative difference between the binding energies of the 5’ end sense strand and the 5’ end antisense strand (AAG) (Khvorova, Reynolds et al. 2003, Schwarz, Hutvagner et al. 2003), (3) the lack of known immunostimulatory motifs, including (5 ’ to 3 ’) “GUCCUUCAA”, and “UGUGU” (Judge, Sood et al. 2005, Fedorov, Anderson et al. 2006). Based on these criteria, we identified nine candidate NCOR2-targeted siRNAs (siNCOR2) that fulfill these selection criteria.

[0101] Next, we synthesized the double-stranded siRNA (Dharmacon) of the siRNA of the candidate siNCOR2. We transfected each of them into human kidney (fetal) 293T cells and HCT-116 human colorectal cancer (CRC) cells using Lipofectamine LTX Reagent (ThermoFisher Scientific). A non-target control siRNA (siNT; 5’-UGGUUUACAUGUCGACUAAUU-3’ (SEQ ID NO: 10); Dharmacon) was included as a negative control. We measured the transcript level of NCOR2 using quantitative real-time PCR (qRT-PCR) using the LightCycler FastStart DNA MASTERPLUS SYBR Green I Kit and the LightCycler System (Roche Diagnostics GmbH, Mannheim, Germany). Oligonucleotide primers were designed using Pnmer Bank (http: / / pga.mgh.harvard.edu / primerbank / index.html) and include the forward primer for human: TGCAGATCATCTACGACGAGA (SEQ ID NO: 11) and the reverse primer: TCCGCATCGCCTGGTTTATTT (SEQ ID NO: 12). For the mouse, the forward primer is AACACCACCCCCGTGACTA (SEQ ID NO: 13), and the reverse primer is CTGAGACCGTTCACTCCCA (SEQ ID NO: 14). Four NCOR2-targeted siRNAs (siNCOR2) ranked among the top four in their gene-silencing efficacy on NCOR2 in 293T and HCT-116 cells.

[0102] To ascertain the gene-silencing efficacy in different cancer cells, we transduced the four siNCOR2s in human cancer cell lines, including A549 cells (representing non-small cell lung cancer; NSCLC), HuH-1 cells (representing hepatocellular carcinoma; HCC), HCT-116 cells (representing colorectal cancer; CRC), and murine cancer cell lines, including LLC1 (representing NSCLC), CT26.CT25 (representing CRC), and Hepa 1-6 (representing HCC) cells. Two siNCOR2, including siNCOR2.1045-1063 and siNCOR2.1369-1387 (Table 1), ranked at the top with a satisfactory (> 75%) gene-silencing effect on NCOR2 across these different human and murine cancer cell lines (Table 2).

[0103] T able 1 The selected NCOR2-targeted siRNA (siNCOR2)

[0104] T able 2 The gene-silencing efficacy of the selected siNCOR2

[0105] We further determined the 50% effective dose (ED50) of the selected siNCOR2 regarding the gene-silencing effect on the transcription of NCOR2 in human and mouse cancer cells. The ED50 value was calculated using the nonlinear regression analysis in GraphPad PRISM version 9.9.0 (GraphPad Software,San Diego, CA, USA). As shown in Figure 1, siNCOR2.1045-1063 or siNCOR2.1369-1387 could inducea robust silencing effect on the NC0R2 mRNA in human and mouse cells with approximately equal potency. Specifically, the transduction of cells with siNCOR2.1045-1063 induced a gene-silencing effect on NCOR2 in HCT-116 human CRC cells with an ED50 of 0.01124 nM, and in SNU-449 human HCC cells with an ED50 of 0.01194 nM. siNCOR2.1045- 1063 induced a gene-silencing effect on mouse NCOR2 in CT26.CL25 mouse CRC cells with an ED50 of 0.01468 nM, Hepal-6 mouse HCC cells with an ED50 of 0.01117 nM, and B16 / F10 mouse melanoma cells with an ED50 of 0.01363 nM. Likewise, the transduction of cells with siNCOR2.1369-1387 induced a gene-silencing effect onNCOR2 in human HCT-116 cells and SNU-449 cells with an ED50 of 0.007662 nM and 0.00747 nM, respectively, and mouse CT26.CL25, Hepal-6 cells, or B16 / F10 cells with anED50 of 0.008751 nM, 0.01087 nM, and 0.01225 nM, respectively. These data indicate that the selected NCOR2-targeted siRNAs can efficiently silence the expression of NCOR2 in cancer cells of different species.

[0106] Unmodified siRNA is vulnerable to serum exo- and endo-nucleases, leading to a short half-life in serum, and can induce immune responses via interferons and proinflammatory cytokines. Therefore, several chemical modifications have been explored to improve siRNA's stability and render siRNA less immunogenic. To avoid potential immunogenicity of the siNCOR2 as selected above and to increase their stability in serum, we added the 2’-O-methylation modification at site UA or CA in the antisense strand and at all pyrimidine in the sense strand since the 2’-O-methylation modification of siRNA has been associated with less immune activation when administered systematically (Adami, Seth et al. 2011)To enhance the serum stability, we added two deoxy-thymidine 3’ overhangs with phosphorothioate linkage to the sense and antisense strands (Table 3).

[0107] T able 3 The chemical modifications of the selected siNCOR2Sequence ID Strand Partially modified sequence 5 ’-3’ siNCOR2.ml 045-1063 Antisense UUGCUGCUUCUUCUUmCAGCdT*dT(SEQ ID NO: 7) Sense GmCmUGAAGAAGAAGmCAGmCAAdT*dT(SEQ ID NO: 6) siNCOR2.ml369-1387 Antisense mCAUGAGCUGGUmCAmUAGCGCdT*dT(SEQ ID NO: 9) Sense GmCGmCmUAmUGAmCmCAGmCmUmCAmUGdT*dT(SEQ ID NO: 8) m, 2’-O-methyl RNA; *, phosphorothioate linkage.

[0108] To confirm that the chemically modified siNCOR2, as shown in Table 3, has a gene-silencing efficacy comparable to that of their unmodified counterparts, we determined the D50 of the chemicallymodified and unmodified siNCOR2s regarding the gene-silencing effect on the transcription of NCOR2 in human and mouse cancer cells. As shown in Figure 2, the chemically modified siNCOR2 could induce a robust silencing effect on the NCOR2 mRNA with approximately equal potency compared to the unmodified siNCOR2 in human and mouse cells. For instance, the transduction of cells with siNCOR2.ml045-1063 or siNCOR2.1369-1387 induced a gene-silencing effect on NCOR2 in HCT-116 human CRC cells with an ED50 of 0.008832 nM and 0.008815 nM, respectively. These data affirmed that the chemical modifications of siRNA did not affect the gene-silencing efficacy of siNCOR2.

[0109] Example 2 The effect of siNCOR2 on the sensitivities of cancer cells to cytotoxic stress

[0110] As described above, NCOR2 has recently been identified as a chromatin-based regulator that controls the vulnerability of epithelial cells or tumors to cytotoxic stimuli (Tsai, Huang et al. 2022). At the molecular level, NCOR2 interacts with the transcriptional factors interferon regulatory factor- 1 (IRF1), signal transducer and activator of transcription 1 (STAT1), and forkhead box 03 (FOXO3A), which together constitute a cytotoxic-stress-induced apoptotic signaling network in epithelial cells (Figure 3). Taking advantage of the insight gained from these molecular analyses, the inhibition of NCOR2 expression in tumor cells by treating them with NCOR2 -targeted siRNA may effectively enhance the sensitivity of malignant tumor cells to various cytotoxic stresses, including those elicited by the death ligand TNF- Related Apoptosis-Inducing ligand (TRAIL) or chemotherapeutic reagents.

[0111] While designing the active pharmaceutical ingredient of siRNA drugs, we considered that ( 1 ) the siRNAs that target different fragments on the NCOR2 mRNA segments may obviate the potential variations in the knockdown efficacy caused by different chromatin conformations and (2) a siRNA mixture consists of each siRNA at an amount half of that in a single siRNA, whereby the potential toxicity, such as off-target silencing and immune-stimulatory effects, can be theoretically mitigated. The top-ranked siNCOR2 selected in Example 1, including siNCOR2.1045- 1063 and siNCOR2.1369- 1387, target segments 2 and 4 on the NCOR2 mRNA sequence and, therefore, meet the first criterion. We determined the 1:1 mixture of siNCOR2.1045-1063 and siNCOR2.1369- 1387 as the API of the NCOR2-targeted siRNA therapeutics in development.

[0112] We co-transduced HCT-116 human CRC cells, or SNU-449 or Hep3B human HCC cells with siNCOR2.1045-1063 and siNCOR2.1369-1387 at a ratio of 1:1 (designated herein as siNCOR2 mixture) at 100 nM for eight hours using the Lipofectamine LTX Reagent (ThermoFisher Scientific). Cells transduced with a non-target siRNA (siNT) were used as a control. Forty-eight hours following the initiation of transduction, the cells were exposed to increasing concentrations of the death ligand TRAIL. The percentage of viable cells was determined using the CellTiter-Glo 2.0 Assay (Promega) according to the manufacturer’s instructions.

[0113] As shown in Figure 4A, the transduction of HCT-116 cells with the siNCOR2 mixture could significantly reduce the viability of cells exposed to the TRAIL treatment, especially at the concentration range of 31.25-250 ng / ml, compared to those transduced with siNT. Of note, transducing the cells with the siNCOR2 mixture alone could significantly reduce HCT-116 cell viability to an average of 62.7% of that of siNT-treated cells, implicating the intrinsic effect of the NCOR2 knockdown on cancer cell viability. Similarly, the transduction with the siNCOR2 mixture rendered SNU449 or Hep3B human HCC cells significantly more sensitive to the TRAIL treatment across all the concentration levels tested.

[0114] Having demonstrated the effect of siNCOR2 transduction in enhancing the sensitivities of cancer cells to the TRAIL treatment, we then investigated the effect of siNCOR2 transduction on the sensitivities of HCT-116 cells to increasing concentrations of cisplatin or SN-38 (7-ethyl-10- hydroxycamptothecin; the active metabolite of irinotecan), which are standard chemotherapy agents used in the treatment of patients with CRC. We found that transduction with the siNCOR2 mixture could significantly enhance the cell-killing effect of cisplatin at a dose range of 1.65-6.6 pM, which covers the therapeutically relevant concentration of 3.3 pM (Fakih, Creaven et al. 2005) (Figure 4B). Likewise, the transduction with the siNCOR2 mixture could significantly enhance the cell-killing effect of SN-38 at the dose range of 12.5-200 nM, which covers the therapeutically relevant concentration of 50 nM (Jansen, Hulscher et al. 1998). This data supports the efficacy of knocking down NCOR2 expression by the siNCOR2 mixture in enhancing the sensitivity of human cancer cells to various death stimuli, including those induced by chemotherapy.

[0115] Example 3 The effect of siNCOR2 on the sensitivities of cancer cells to immunogenic stress

[0116] A previous study has demonstrated that the NCOR2 / HDAC3 epigenetic complex suppresses the IRF-1 and STAT- 1 -dependent transcription of immunogenic cytokines, interferon-gamma (IFN-gamma, IFNG), IFN-gamma pathway genes, and the immune checkpoint molecule programmed death ligand 1 (PDL1) (Tsai, Huang et al. 2022). Therefore, we tested whether the knockdown of NCOR2 expression by transducing cells with siNCOR2.1045-1063 and siNCOR2.1369-1387 can render cancer cells sensitive to the immunogenic death stimuli induced by IFN-gamma. To this end, we transduced HT-29 human CRC cells and SNU-449 HCC cells with the 1:1 mixture of siNCOR2.1045- 1063 and siNCOR2.1369- 1387 (siNCOR2 mixture), or a non-target siRNA (siNT) at 100 nM for eight hours using the Lipofectamine LTX Reagent (ThermoFisher Scientific). Forty-eight hours following the initiation of transduction, the cells were exposed to increasing concentrations of human recombinant IFN-gamma (PeproTech) for 48 hours. The percentage of viable cells was determined using the CellTiter-Glo 2.0 Assay (Promega) according to the manufacturer’s instructions.

[0117] As shown in Figure 5A, the transduction of HT-29 human CRC cells with the siNCOR2 mixture could significantly increase the percentage of cell death in the cells exposed to the recombinant human IFN-gamma treatment across a wide concentration range from 500 to 8000 lU / ml compared to those transduced with siNT.

[0118] To ascertain the efficacy of the NCOR2 knockdown in sensitizing mouse cancer cells to the immunological stimulus IFN-gamma, we repeated the above study in CT26.CL25 mouse CRC cells, Hepal-6 mouse HCC cells, B16 / F10 mouse melanoma cells. Briefly, mouse cancer cells were transduced with the 1:1 mixture of siNCOR2.1045-1063 and siNCOR2.1369-1387, or siNT, at 100 nM for eight hours using the Lipofectamine LTX Reagent (ThermoFisher Scientific). Forty-eight hours following the initiation of transduction, the cells were exposed to increasing concentrations of mouse recombinant IFN-gamma (m IFN-gamma; PeproTech) for 48 hours. The percentage of viable cells was determined using the CellTiter- Glo 2.0 Assay (Promega) according to the manufacturer’s instructions.

[0119] As shown in Figure 5B, the transduction with the siNCOR2 mixture could markedly sensitize CT26.CL25 mouse CRC cells were treated with mIFN-gamma across a wide concentration range of 250 to 4000 lU / ml, compared to those transduced with siNT. Similarly, the transduction with the siNCOR2 mixture significantly sensitized Hepal-6 mouse HCC and B16 / F10 mouse melanoma cells to the mlFN- gamma treatments. Together, these data support the efficacy of knocking down the NCOR2 expression by the selected siNCOR2 on the sensitivity of human cancer cells to immunogenic death stimuli.

Claims

ClaimsWhat is claimed is:

1. A polynucleotide comprising a nucleotide sequence complementary to the mRNA of the human NCOR2 gene with a nucleotide sequence shown in SEQ ID NO:1; or b) a nucleotide sequence comprising a contiguous segment having at least 70%, at least 80%, or at least 90% sequence identity to the nucleotide sequence complementary to SEQ ID NO: 1.

2. The polynucleotide of Claim 1, wherein the polynucleotide is siRNA, shRNA, or dsRNA.

3. The polynucleotide of any one of the preceding claims, wherein the polynucleotide is a siRNA molecule, wherein said siRNA molecule comprises (a) a duplex region; and (b) either no overhang regions or at least one overhang region, wherein each overhang region contains six or fewer nucleotides, wherein the duplex region consists of a sense region and an antisense region, wherein said sense region and said antisense region together form said duplex region and said antisense region and said sense region each 15-30 nucleotides in length and said antisense region comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 1.

4. The polynucleotide of any of the preceding claims, wherein the siRNA molecule has the antisense region and the sense region, are each 15-25 bases in length.

5. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of said double-stranded siRNA molecule is between 15 and 30 nucleotides in length; and (b) one strand of said siRNA molecule comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 1, 2 or 4.

6. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein said sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2 and said antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3.

7. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein said sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from SEQ ID NO: 2, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from SEQ ID NO: 3.

8. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein said sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4 and said antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 5.

9. The polynucleotide of any one of preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand forming another double-stranded RNA dimer, wherein said sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from SEQ ID NO: 4, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from SEQ ID NO: 5.

10. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule has at least one or no overhang region.

11. The polynucleotide of any one of the preceding claims, wherein one or two of the sense strand and the antisense strand can be further modified as modified siRNA.

12. The polynucleotide of any one of the preceding claims, wherein the modified nucleotide includes a 2’- O-methyl modified nucleotide, a 2’-fluorophoramidate, a 3 ’-terminal deoxy-thymine nucleotide, a nonnatural base comprising a nucleotide, a nucleotide comprising a 5’phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative and a dodecanoic acid bisacrylamide group.

13. The polynucleotide of any one of the preceding claims, wherein the modified siRNA comprises 10% to about 30% of the nucleotides in the double-stranded region comprise 2'-O-methyl (2'OMe) nucleotides, comprises 2'OMe nucleotides on both strands of the modified siRNA.

14. A pool of siRNA molecules, wherein said pool comprises one or more first siRNA molecule or a modified siRNA molecule thereof, second siRNA molecule or a modified siRNA molecule thereof, and third siRNA molecule or a modified siRNA molecule thereof, wherein said first siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of said double-stranded siRNA molecule is between 15 and 30 nucleotides in length; and (b) one strand of said siRNA molecule comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 1; said second siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of said double-stranded siRNA molecule is between 15 and 30 nucleotides in length; and (b) one strand of said siRNA molecule comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 2; and said third siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of said double-stranded siRNA molecule is between 15 and 30 nucleotides in length; and (b) one strand of said siRNA molecule comprises a sequence that is the complement of a sequence selected from SEQ ID NO: 4.

15. The pool of Claim 14, wherein said pool comprises one or more second siRNA molecules or a modified siRNA molecule thereof, and a third siRNA molecule or a modified siRNA molecule thereof.

16. The pool of Claim 14, wherein said pool comprises one or more a second siRNA molecule or a modified siRNA molecule thereof, and a third siRNA molecule or a modified siRNA molecule thereof; wherein the second siRNA molecule comprises a sense strand and an antisense strand, wherein said sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2 and said antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3; and the third siRNA molecule comprises a sense strand and an antisense strand, wherein said sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and said antisense strand comprises a nucleotide sequence set forth in SEQ ID NO: 5.

17. A pharmaceutical composition comprising a polynucleotide of any preceding claims and a pharmaceutical carrier, diluent, and / or adjuvant.

18. A nanoparticle comprising the polynucleotide of any preceding claims and lipid nanoparticle, liposome, micelle, virosome, nucleic acid complex, extracellular vesicle, exosome, and any mixture thereof.

19. A method for increasing the sensitivity of a solid tumor to anti-tumor therapies and / or treating a solid tumor and / or tumor metastasis in a subject comprises administrating the polynucleotide of any one of the preceding claims, the pool of any one of Claims 14, 15 or 16, the pharmaceutical composition of Claim 17 or the nanoparticle of Claim 18 to the subject.

20. The method of Claim 19, wherein solid tumor is colorectal cancer, hepatocellular carcinoma, malignant melanoma, skin cancer, gastric cancer, urinary bladder cancer, pancreatic cancer, breast cancer, lung cancer, head-and-neck cancer, and glioma.

21. The method of Claim 19, wherein said anti-tumor therapies comprise immunotherapy, chemotherapy, immune cell therapy, radiation therapy, therapy using biological agents such as antibodies or their derivatives, virus-mediated gene therapy, oncolytic virus therapy, DNA vaccine, oligonucleotide therapy such as small interfering RNA, antisense RNA or microRNA, mRNA therapy, cell therapy such as cytotoxic T cells, chimeric antigen receptor T cells, nature killer cells, and macrophages, or any agent that aims at reducing the growth or the viability of a malignant tumor cell, or any combination thereof.

22. The method of Claim 19, wherein determining said sensitivity of a solid tumor comprises assessing the number, size, or volume of said tumor lesions comprising visual, radiological, and / or pathologicalexamination of said malignant tumor before and at various time points during and after treatment with said anti-tumor therapies.

23. The method of Claim 19, wherein a solid tumor is sensitive to said anti-tumor therapies if the number, size, or volume of said tumor lesions during and / or after said anti-tumor therapies is significantly less than that of said tumor lesions before said anti-tumor therapies.

24. The method of Claim 19, wherein said polynucleotide, the pharmaceutical composition or the nanoparticle is delivered systematically to said individual or large animal through parenteral or enteral routes or delivered to said malignant tumor by direct local injections or applications.