PHB production in methylotrophs with reduced phaz activity

Abstract

Methods for the production of poly-3-hydroxybutyrate (PHB) in methanotrophic bacteria are disclosed. The methods involve genetic deletion of the PhaZ and / or PhaZ2 enzymes (or orthologues thereof), or reduction of their catalytic activity. The methods are particularly suited to methanotrophic species such as M. parvus, M. rosea, M. trichosporium. Related methods, uses, and products are also disclosed.

Description

[0001] PHB PRODUCTION

[0002] Technical Field

[0003] The present invention relates to improved methods for the production of poly-3- hydroxybutyrate (PHB) in methanotrophic bacteria, and related methods and products.

[0004] Introduction

[0005] Methane (CH4) is the second most abundant greenhouse gas (GHG) produced by human activity with a global warming potential up to 105 times higher than CO2 over a 20-year period. Methane is emitted from a variety of anthropogenic and non-anthropogenic sources including wetlands, natural gas exploration sites and landfill sites. High quality biogas from Anaerobic Digester (AD) and landfill sites is currently economically used for energy production. However, biogas with low methane content is often flared with the aforementioned environmental impact. To improve incentive for biogas capture, new technologies for utilisation of the gas need to be explored.

[0006] As the only known biological sink for atmospheric methane, methane-oxidizing bacteria are largely responsible for balancing methane flux in the environment through oxidation of methane for a source of carbon and energy. The use of methanotrophs to produce platform chemicals, single cell protein or biopolymers has high economic potential.

[0007] Biopolymer production has received renewed societal and industrial interest with reports of petrochemical, non-biodegradable plastics polluting the environment and earth’s oceans. Typically, plastic compounds cannot be degraded by microorganisms. Rather they disintegrate into ever smaller fragments called microplastics. Microplastics have been found throughout the marine ecosystem and pose possible adverse effects on ecological and human health. Poly-3 -hydroxybutyrate (PHB) is a short-chained polyhydroxyalkanoate (PHA) with mechanical properties comparable to isotactic polypropylene (PP) and polyethylene (PE), with the advantage that it is biodegradable in all natural environments including oceans. PHB is produced by type II methanotrophs during nutrient limitation and it serves as a source of reducing equivalents. Therefore, the utilisation of PHB producing methanotrophic organisms grown on comparably cheap or waste sources of methane such as AD or landfills could represent a consolidated solution to two major environmental problems from anthropogenic activity. However, the current bottleneck for biologically producing PHB from methane or methanol is the low yield in the bacteria chassis, which naturally can only accumulate around 5-20% w / w PHB and will degrade PHB simultaneously. Reported PHB yields from methanotrophs range from a few per cent of cell dry weight to around 30% (w / w) in certain optimized conditions.

[0008] Therefore, there is a need for an improved method of production of polyhydroxyalkanoates such as PHB.

[0009] Summary of the Invention

[0010] According to a first aspect of the present invention, there is provided a genetically engineered methanotrophic bacterium, wherein the genetically engineered methanotrophic bacterium is capable of PHB synthesis, and is engineered to reduce or knockout expression of phaZ and / or phaZ2 genes, or orthologues thereof.

[0011] Advantageously, the present invention identifies that methanotrophs that are capable of PHB synthesis can be genetically engineered to significantly increase yields of PHB whilst maintaining viability. PhaZ and PhaZ2 are enzymes that have been found in methanotrophs, such as Methylococcus spp., with roles in the PHB cycle. The PHB cycle is crucial for the storage of carbon and energy, where the PHB can accumulate as intracellular granules in the presence of excess carbon and a limitation of other nutrients like nitrogen and phosphorus. The PHB cycle acts as a survival mechanism for bacteria, enabling them to manage energy and carbon availability in response to environmental changes. It has been surprisingly found that PhaZ and PhaZ2 have a role in methanotrophs and that methanotrophic cells remain viable upon knockout of the genes encoding PhaZ and PhaZ2. Furthermore, PHB production is significantly increased in the modified cells. Three example genetically modified strains were constructed, a. phaZ (PHB depolymerase) deletion strain, a phaZ2 (Internal PHB depolymerase) deletion strain, and a double deletion strain of both phaZ and phaZ2. Not only were all the strains capable of mutagenesis and remained viable, the phaZ KO strain has been shown to produce a significantly higher PHB production, with 42.6% w / w PHB, the phaZ2 KO strain produces a still higher level of PHB of 47.8% w / w, and surprisingly the double KO strain produces a substantial 61.9% w / w PHB, compared to wildtype 21.1% w / w PHB. Further advantageously, if the methanotroph uses methane (such as anthropogenic methane) as its sole or, at least, main carbon source for metabolism, the genetically engineered methanotrophic bacterium of the invention herein offers the dual environmental advantage of reducing greenhouse gas levels, and producing PHB for biodegradable plastic (bioplastic), in one process.

[0012] The methanotrophic bacterium

[0013] The methanotrophic bacterium may be a Gram -negative bacterium. The methanotrophic bacterium may be a type I methanotroph, such as a bacterium of the Methylococcaceae family, or a type II methanotroph, such as a bacterium of the Methylocystaceae family.

[0014] The methanotrophic bacterium may be of the Methylococcaceae family, such as those belonging to the genera Methylococcus , Methylocaldum, Methylogaea, Methyloparacoccus , Methylohacter, Methylosphaera, Methylomonas ,

[0015] Methylomicrohium, Methylosarcina, Methylosoma, Methylovulum, Methylomarinum. The methanotrophic bacterium may be of the Methylococcus spp., such as a M. capsulatus strain. The methanotrophic bacterium may be a M. capsulatus strain, such as M. capsulatus strain (Bath), M. capsulatus (Texas) or M. capsulatus (Aberdeen).

[0016] The methanotrophic bacterium may be of the Methylocystaceae family, such as those belonging to the genera Alhihacter, Chenggangzhangella, Hansschlegelia, Methylocystis, Methylocella, Methyloferula, Methylocapsa, Methylopila, or Methylosinus . The methanotrophic bacterium may belong o Methylocystis spp., such as a A / . hryophila, M. echinoides, M. heyeri, M. hirsuta, M. iwaonis, M. parvus (also known as M. parva), M. rosea, M. silviterrae, or M. suflitae strain. The methanotrophic bacterium may be a A / . parvus strain, such as ACM 3309, ATCC 35066, BRCS2, IMET 10483, NCIMB 11129, OBBP, OBBP ACM3309, UNIQEM 38, or VKM B-2129 . The methanotrophic bacterium may be a M. rosea strain, such as BRCS 1. The methanotrophic bacterium may comprise Methylocystis rosea N91, also known as DSM 17261T or ATCC BAA-1196T. In a preferred embodiment, the methanotrophic bacterium may be M. rosea BRCS1 or M. parvus BRCS2, as described in the publication Rumah et al. , “Isolation and characterisation of Methylocystis spp. for poly-3- hydroxybutyrate production using waste methane feedstocks”, AMB Expr 11 :6 (2021), doi: 10.1186 / s 13568-020-01159-4, including the supplementary information thereto, which are both herein incorporated by reference. In one embodiment, the methanotrophic bacterium is M. rosea BRCS 1. In one preferred embodiment, the methanotrophic bacterium is M. parvus BRCS2. In one preferred embodiment, the methanotrophic bacterium is a Methylocystis spp.

[0017] In another embodiment, the methanotrophic bacterium may comprise Methylosinus spp. The methanotrophic bacterium may be M. trichosporium. In one embodiment, the methanotrophic bacterium is Methylosinus trichosporium OB3b.

[0018] In one embodiment, there is provided a genetically engineered M. parvus that has been engineered to reduce or knockout expression of PhaZ and / or PhaZ2. In another embodiment, there is provided a genetically engineered M. parvus BRCS2 that has been engineered to reduce or knockout expression of PhaZ and / or PhaZ2. In another embodiment, there is provided a genetically engineered M. parvus BRCS2 that has been engineered to knockout expression of PhaZ and PhaZ2.

[0019] In one embodiment, there is provided a genetically engineered M. trichosporium that has been engineered to reduce or knockout expression of PhaZA and / or PhaZB. The skilled person understands that / j / zaZA / PhaZA and / j / zaZH / PhaZB (for example, in M. trichosporium OB3b) are orthologous genes / proteins respectively to the phaZ / V aZ and / 2 / ?aZ2 / PhaZ2 genes / proteins (for example, from M. parvus BRCS2). In another embodiment, there is provided a genetically engineered M. trichosporium OB3b that has been engineered to reduce or knockout expression of PhaZA and / or PhaZB. In another embodiment, there is provided a genetically engineered M. trichosporium OB3b that has been engineered to knockout expression of PhaZA and PhaZB.

[0020] The methanotrophic bacterium may comprise a 16S rRNA gene that shows at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, at least 99.9%, at least 99.99%, or more (such as 100%), genetic similarity to at least one 16S rRNA gene of Methylocystis spp.

[0021] The methanotrophic bacterium may naturally express one or more methane monooxygenase (MMO) proteins, which catalyse the conversion of methane into methanol. For example, the MMO proteins may be endogenous. The methanotrophic bacterium may be genetically engineered to express at least one MMO. The MMO expressed in the methanotrophic bacterium may be a soluble MMO (sMMO) or a particulate MMO (pMMO). The MMO may be encoded by a sequence comprising or consisting of the sequences of any of SEQ ID NOs: 1-10. The methanotrophic bacterium may also express (i.e. naturally, or by genetic engineering) other enzymes that allow the further metabolic conversion of methanol into a substrate for the PHB cycle. The said substrates may comprise any of acetoacetic acid, acetate, acetyl-CoA, acetoacetyl- CoA, 3-hydroxybutyryl-CoA. The skilled person will recognise that, if required, the methanotrophic bacterium may be engineered to express the enzymes of the PHB metabolic pathway that are required for the methanotrophic bacterium to convert a supply of methane, or methanol, or of any of the said substrates, into (ultimately) PHB.

[0022] The bioplastic

[0023] In some embodiments, genetic engineering of the methanotrophic bacterium according to the invention herein may result in production of bioplastic in the methanotrophic bacterium. In some embodiments, genetic engineering of the methanotrophic bacterium according to the invention herein may result in accumulation of poly-3 -hydroxybutyrate (PHB), also referred to generically as polyhydroxybutyrate, wherein the PHB may be according to the following formula: , may be any integer other than zero.

[0024] The stereocentre of the PHB may have a defined chirality in either its R- or S- configuration, that is to say the PHB may be optically pure, or substantially optically pure. In other embodiments, the PHB may comprise or consist of a mixture of R- and S- enantiomeric monomers, i.e. a racemic mixture.

[0025] In some embodiments, the PHB may be synthesised from precursor monomers comprising 3-hydroxybutyrate, wherein the 3-hydroxybutyrate may be according to the following formula: In some embodiments, the PHB may comprise or consist of free 3 -hydroxybutyrate monomers.

[0026] The stereocentre of the 3 -hydroxybutyrate monomers and / or of the bioplastic derived therefrom may have a defined chirality, that is to say the 3 -hydroxybutyrate monomers and / or of the bioplastic derived therefrom may be optically pure, or substantially optically pure, in either their R- or S- configuration. In other embodiments, the 3- hydroxybutyrate monomers and / or of the bioplastic derived therefrom may comprise, consist of, or be derived from, a mixture of R- and S- enantiomeric monomers, i.e. a racemic mixture.

[0027] The average molecular weight of produced PHB molecules may be about 100-5,000 kDa. In some embodiments, the average molecular weight of produced PHB molecules may be about 100-3,000 kDa. Preferably, the average molecular weight of produced PHB molecules may be about 2,000-5,000 kDa.

[0028] Other Aspects

[0029] According to another aspect of the present invention, there is provided a methanotrophic bacterium, wherein the methanotrophic bacterium is capable of PHB synthesis, and wherein the methanotrophic bacterium has reduced expression or no functional expression of PhaZ and / or PhaZ2.

[0030] In one embodiment, the expression of phaZ and / or phaZ2 is silenced, for example by siRNA. In another embodiment, the phaZ and / or phaZ2 genes are knocked out. In another embodiment, the phaZ and / or phaZ2 sequences may be mutated such that they are non-functional (i.e. their respective protein products cannot act as a PHB depolymerase). In another embodiment, the phaZ and / or phaZ2 sequences may be mutated such that their respective protein products have reduced PHB depolymerase activity.

[0031] The person skilled in the art will know what residues of the PhaZ and / or PhaZ2 proteins to mutate to obtain non-functional proteins, or proteins with reduced PHB depolymerase activity, for example by consulting the publication Knoll et al. , ‘The PHA Depolymerase Engineering Database: A systematic analysis tool for the diverse family of polyhydroxyalkanoate (PHA) depolymerases’, BMC Bioinformatics 10, 89 (2009), doi: 10. 1186 / 1471-2105-10-89, herein incorporated by reference.

[0032] According to another aspect of the present invention, there is provided the use of the methanotrophic bacterium according to the invention for the production of PHB, and optionally the consumption of methane or methanol.

[0033] The methane may be a methane-comprising gas, or pure methane. The methanol may be supplemented in the growth medium.

[0034] According to another aspect of the present invention, there is provided a method of production of PHB, the method comprising the step of culturing a genetically engineered methanotrophic bacterium, wherein the genetically engineered methanotrophic bacterium is capable of PHB synthesis, and is engineered to reduce or knockout expression of phaZ and / or phaZ2 genes, wherein PHB is produced by the methanotrophic bacterium during the culture.

[0035] According to another aspect of the present invention, there is provided a method of production of PHB in a methanotroph, comprising the step of culturing a genetically engineered methanotrophic bacterium according to the invention herein, wherein PHB is produced by the methanotrophic bacterium during the culture.

[0036] The uses herein and methods of production of PHB may comprise culturing the methanotrophic bacterium with methane or methanol, optionally wherein the methane or methanol is the main carbon and / or source for the methanotrophic bacterium. In one embodiment, the methods of the invention further comprise cycling at least once between the steps of culturing the methanotroph in a nitrogen-containing growth medium and culturing the methanotroph in a nitrogen-free growth medium in the presence of methane gas or methanol.

[0037] According to another aspect of the present invention, there is provided a method of increasing the production of PHB in a methanotroph, the method comprising the step of genetically engineering the methanotroph to express reduced levels of PhaZ and / or PhaZ2, or to express PhaZ and / or PhaZ2 having reduced PHB depolymerase activity. The genes to be engineered

[0038] Some embodiments comprise the genetic engineering of the phaZ gene, for example comprising the M. parvus BRCS2 phaZ gene sequence according to SEQ ID NO: 28. Some embodiments comprise knocking out the phaZ gene. Some embodiments comprise knocking in a modified version of the phaZ gene, which encodes either a lower- expressing PhaZ, or a PhaZ with reduced PHB depolymerase activity.

[0039] Some embodiments comprise the genetic engineering of the phaZ2 gene, for example comprising the M. parvus BRCS2 phaZ2 gene sequence according to SEQ ID NO: 29. Some embodiments comprise knocking out the phaZ2 gene. Some embodiments comprise knocking in a modified version of the phaZ2 gene, which encodes either a lower-expressing PhaZ2, or a PhaZ2 with reduced PHB depolymerase activity.

[0040] Some embodiments comprise the genetic engineering of the phaZ and phaZ2 genes. Some preferred embodiments comprise knocking out the phaZ and phaZ2 genes. Some embodiments comprise knocking in modified versions of the phaZ and / or phaZ2 genes, encoding either lower-expressing PhaZ and / or PhaZ2 respectively, or PhaZ and / or PhaZ2 with reduced PHB depolymerase activity respectively.

[0041] The person skilled in the art will easily recognise that the genetic engineering of genes other than phaZ and phaZ2 may allow the methanotrophic bacterium to produce (and optionally accumulate) PHA bioplastic(s) other than PHB. By way of non-limiting example, targeting the polyhydroxyvalerate (PHV) cycle may allow the production (and optionally accumulation) of PHV copolymer, for example by targeting PHV depolymerases. Alternatively or additionally, PHV production (and optionally accumulation) may be achieved in the methanotrophic bacterium by targeting depolymerases that act on the PHV building monomer, 3-hydroxyvaleric acid, such as may be incorporated in PHV, or in poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), polymers. Therefore, some embodiments, which comprise the genetic engineering of the phaZ and / or phaZ2 genes, further comprise the genetic engineering (such as knocking out) of genes encoding enzymes with PHV depolymerase activity, and / or enzymes with PHBV depolymerase activity, thereby enabling the production (and optionally accumulation) and both PHB and PHV in the methanotrophic bacterium. Genetic engineering of the methanotroph

[0042] In one embodiment, the methanotroph of the methods of the invention is genetically engineered, for example using a CRISPR / Cas9-based genetic engineering system.

[0043] The genetic engineering may be carried out by any genetic engineering method that is known or expected to be efficacious in methanotrophic bacterium, such as Methylocystis spp. In some embodiments, the genetic engineering may be carried out by markerexchange mutagenesis, by the cre-lox system, by the 5ac5-based deletion system, or by a targeted nuclease system such as CRISPR-Cas9 or equivalent systems. Preferably, the genetic engineering may be carried out by a “scarless” genetic engineering method i.e. a method that does not leave genetic markers (such as selection markers), or any other genetic elements, in the methanotrophic bacterium.

[0044] The genetic engineering may comprise or consist of genetic knock-out, genetic knock- in, or a combination thereof. The genetic engineering may comprise the addition, deletion or substitution of one or more nucleotides in the genome of the methanotrophic bacterium. The genetic engineering may comprise or consist of a single stranded cut (nick), or a double stranded break / cut (DSB). In some embodiments, the genetic engineering may involve genetic knock-out, for example by exploiting the methanotrophic bacterium’s own non-homologous end joining (NHEJ) genetic pathways. In some embodiments, the genetic engineering may involve genetic knock- in, for example by exploiting the methanotrophic bacterium’s own homology-directed repair (HDR) genetic pathways e.g. when providing a donor template molecule, such as nucleic acid.

[0045] The genetic engineering may be carried out following a strategy, including using plasmids, substantially as laid out in the publication Rumah et al. , “In Vivo Genome Editing in Type I and II Methanotrophs Using a CRISPR / Cas9 System”, ACS Synth. Bio. 2023, 12(2), 544-554, doi: 10.1021 / acssynbio.2c00554, including the supplementary information thereto, both herein incorporated by reference.

[0046] In some embodiments, a methanotrophic bacterium that does not produce PHB, or would otherwise produce low amounts of PHB, such as less than about 30% w / w PHB even in optimal conditions (e.g. a wild-type methanotrophic bacterium). Such bacteria may be genetically modified according to the invention herein so to achieve appreciable amounts of PHB production. For example, in one embodiment, a methanotrophic bacterium is genetically modified according to the invention herein by genetic knock- in or overexpression of at least one (for example, all) of the genes of PHB anabolism. In one embodiment, a methanotrophic bacterium is genetically modified by genetic knock-in or overexpression of at least one (for example, all) of the following genes: phaR, phbA, phbB, phaCl, phaC2, phaC3, phaC4, Phasin 1, Phasin 2, bdhA, acsA2, acsAl , and phbC. The one or more genes of PHB anabolism may be heterologous to the methanotrophic bacterium. The person skilled in the art will recognise that not all such genes will require high expression levels and, conversely, that low expression of any of these genes may not be sufficient to obtain appreciable amounts of PHB, and will be able to accordingly match a promoter of known (or predicted) expression levels to each gene that is knocked-in or overexpressed, without the exercise of inventive skills. In preferred embodiments comprising genetic knock-in of non-endogenous genes, the knock-in(s) take(s) place at genetic loci that are not essential for the methanotrophic bacterium’s metabolism. Overexpression of one or more genes of PHB anabolism may be achieved by the insertion of a recombinant promoter upstream of an endogenous gene. The one or more genes of PHB anabolism may be provided on a plasmid, or stably integrated into the genome of the methanotrophic bacterium. The genetic knock-in or overexpression may not comprise a PHB depolymerase, such as phaZ and / or phaZ2.

[0047] In embodiments wherein both phaZ and phaZ2 are genetically engineered, both genes may be targeted concurrently, such as by providing guide nucleic acid that allows a targeted nuclease to target both genes. Alternatively, one gene may be genetically engineered before the other, such as by i) genetically engineering phaZ, to obtain a culture of phaZ-mvAaxA methanotrophic bacteria, and ii) genetically engineering phaZ2 in the phaZ-mxAaxA methanotrophic bacterial culture, to obtain a phaZ-phaZ2 doubleengineered bacterial culture; or vice versa.

[0048] In embodiments comprising the genetic engineering of two or more genes of the methanotrophic bacterium, the said two or more genes may be genetically engineered concurrently, or alternatively at least one gene of the said two or more genes may be genetically engineered sequentially (i.e. before, or after, the other such gene(s)). The targeted nuclease

[0049] In some embodiments, the targeted nuclease may comprise or consist of a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a nucleic acid-guided nuclease such as a CRISPR-associated (Cas) nuclease. In some embodiments, the genetic engineering may be carried out by a nucleic acid guided- nuclease system comprising a Cas nuclease, such as Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (e.g. spCas9), CaslO, Casl2 (e.g. Casl2a i.e. Cpfl), Casl3 (e.g. Casl3a i.e. C2c2), any of the Cas proteins described in the publication Makarova et al., “Evolutionary classification of CRISPR-Cas systems: a burst of class 2 and derived variants”, Nat. Rev. Microbiol. 2020, 18(2):67-83, doi: 10.1038 / s41579-019-0299-x, herein incorporated by reference, orthologues thereof, or a combination thereof. In some preferred embodiments, the genetic engineering may be carried out by a nucleic acid- guided system comprising any of the following targeted nucleases: Cas9 (e.g. Streptococcus pyogenes Cas9 i.e. spCas9), Casl2 (e.g. Casl2a i.e. Cpfl), Casl3 (e.g. Casl3a i.e. C2c2), orthologues thereof, or a combination thereof. In the most preferred embodiments, the genetic engineering may be carried out with a Cas9 targeted nuclease, such as spCas9.

[0050] Modified versions of these targeted nucleases, such as single-aa mutants that have altered catalytic activity, may also be used to carry out the genetic engineering in some embodiments, e.g. high-fidelity Cas9 mutants such as R691A, as described in the publication Vakulskas et al., “A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells”, Nat. Med. 2018, vol. 24, 1216-1224, doi: 10.1038 / s41591 -018 - 0137-0; or Cas9-HF1, HypaCas9, and evoCas9, as described for example in the publication Skeens et al. , “High-fidelity, hyper-accurate, and evolved mutants rewire atomic-level communication in CRISPR-Cas9”, Sci. Adv. 2024, 10(10), doi: 10.1126 / sciadv.adll045; both references herein incorporated by reference. Minimal versions of these targeted nucleases, such as Casl3X and Casl3Y, may also be used to carry out the genetic engineering in some embodiments. The skilled person will be familiar with multiple other targeted nuclease options with which the invention may be worked substantially as laid out herein, without the exercise of inventive skills. The targeted nuclease may comprise or consist of subunits of different enzymes which, when delivered to the methanotrophic bacterium together (either concurrently or in succession), can carry out the genetic engineering substantially as described herein.

[0051] The targeted nuclease may be delivered to the methanotrophic bacterium by way of introducing into the methanotrophic bacterium a nucleic acid that encodes the targeted nuclease. The Cas9 may be encoded by nucleic acid comprising a sequence according to SEQ ID NO: 31.

[0052] ATGGATAAGAAATACTCAATAGGCTTAGATATCGGCACAAATAGCGTCGGAT GGGCGGTGATCACTGATGAATATAAGGTTCCGTCTAAAAAGTTCAAGGTTCTG GGAAATACAGACCGCCACAGTATCAAAAAAAATCTTATAGGGGCTCTTTTATT TGACAGTGGAGAGACAGCGGAAGCGACTCGTCTCAAACGGACAGCTCGTAGA AGGTATACACGTCGGAAGAATCGTATTTGTTATCTACAGGAGATTTTTTCAAA TGAGATGGCGAAAGTAGATGATAGTTTCTTTCATCGACTTGAAGAGTCTTTTT TGGTGGAAGAAGACAAGAAGCATGAACGTCATCCTATTTTTGGAAATATAGT AGATGAAGTTGCTTATCATGAGAAATATCCAACTATCTATCATCTGCGAAAAA AATTGGTAGATTCTACTGATAAAGCGGATTTGCGCTTAATCTATTTGGCCTTA GCGCATATGATTAAGTTTCGTGGTCATTTTTTGATTGAGGGAGATTTAAATCC TGATAATAGTGATGTGGACAAACTATTTATCCAGTTGGTACAAACCTACAATC AATTATTTGAAGAAAACCCTATTAACGCAAGTGGAGTAGATGCTAAAGCGAT TCTTTCTGCACGATTGAGTAAATCAAGACGATTAGAAAATCTCATTGCTCAGC TCCCCGGTGAGAAGAAAAATGGCTTATTTGGGAATCTCATTGCTTTGTCATTG GGTTTGACCCCTAATTTTAAATCAAATTTTGATTTGGCAGAAGATGCTAAATT ACAGCTTTCAAAAGATACTTACGATGATGATTTAGATAATTTATTGGCGCAAA TTGGAGATCAATATGCTGATTTGTTTTTGGCAGCTAAGAATTTATCAGATGCT ATTTTACTTTCAGATATCCTAAGAGTAAATACTGAAATAACTAAGGCTCCCCT ATCAGCTTCAATGATTAAACGCTACGATGAACATCATCAAGACTTGACTCTTT TAAAAGCTTTAGTTCGACAACAACTTCCAGAAAAGTATAAAGAAATCTTTTTT GATCAATCAAAAAACGGATATGCAGGTTATATTGATGGGGGAGCTAGCCAAG AAGAATTTTATAAATTTATCAAACCAATTTTAGAAAAAATGGATGGTACTGAG GAATTATTGGTGAAACTAAATCGTGAAGATTTGCTGCGCAAGCAACGGACCTT TGACAACGGCTCTATTCCCCATCAAATTCACTTGGGTGAGCTGCATGCTATTT TGAGAAGACAAGAAGACTTTTATCCATTTTTAAAAGACAATCGTGAGAAGAT TGAAAAAATCTTGACTTTTCGAATTCCTTATTATGTTGGTCCATTGGCGCGTGG CAATAGTCGTTTTGCATGGATGACTCGGAAGTCTGAAGAAACAATTACCCCAT

[0053] GGAATTTTGAAGAAGTTGTCGATAAAGGTGCTTCAGCTCAATCATTTATTGAA

[0054] CGCATGACAAACTTTGATAAAAATCTTCCAAATGAAAAAGTACTACCAAAAC

[0055] ATAGTTTGCTTTATGAGTATTTTACGGTTTATAACGAATTGACAAAGGTCAAA

[0056] TATGTTACTGAAGGAATGCGAAAACCAGCATTTCTTTCAGGTGAACAGAAGA

[0057] AAGCCATTGTTGATTTACTCTTCAAAACAAATCGAAAAGTAACCGTTAAGCAA

[0058] TTAAAAGAAGATTATTTCAAAAAAATAGAATGTTTTGATAGTGTTGAAATTTC

[0059] AGGAGTTGAAGATAGATTTAATGCTTCATTAGGTACCTACCATGATTTGCTAA

[0060] AAATTATTAAAGATAAAGATTTTTTGGATAATGAAGAAAATGAAGATATCTTA

[0061] GAGGATATTGTTTTAACATTGACCTTATTTGAAGATAGGGAGATGATTGAGGA

[0062] AAGACTTAAAACATATGCTCACCTCTTTGATGATAAGGTGATGAAACAGCTTA

[0063] AACGTCGCCGTTATACTGGTTGGGGACGTTTGTCTCGAAAATTGATTAATGGT

[0064] ATTAGGGATAAGCAATCTGGCAAAACAATATTAGATTTTTTGAAATCAGATGG

[0065] TTTTGCCAATCGCAATTTTATGCAGCTGATCCATGATGATAGTTTGACATTTAA

[0066] AGAAGACATTCAAAAAGCACAAGTGTCTGGACAAGGCGATAGTTTACATGAA

[0067] CATATTGCAAATTTAGCTGGTAGCCCTGCTATTAAAAAAGGTATTTTACAGAC

[0068] TGTAAAAGTTGTTGATGAATTGGTCAAAGTAATGGGGCGGCATAAGCCAGAA

[0069] AATATCGTTATTGAAATGGCACGTGAAAATCAGACAACTCAAAAGGGCCAGA

[0070] AAAATTCGCGAGAGCGTATGAAACGAATCGAAGAAGGTATCAAAGAATTAGG

[0071] AAGTCAGATTCTTAAAGAGCATCCTGTTGAAAATACTCAATTGCAAAATGAA

[0072] AAGCTCTATCTCTATTATCTCCAAAATGGAAGAGACATGTATGTGGACCAAGA

[0073] ATTAGATATTAATCGTTTAAGTGATTATGATGTCGATCACATTGTTCCACAAA

[0074] GTTTCCTTAAAGACGATTCAATAGACAATAAGGTCTTAACGCGTTCTGATAAA

[0075] AATCGTGGTAAATCGGATAACGTTCCAAGTGAAGAAGTAGTCAAAAAGATGA

[0076] AAAACTATTGGAGACAACTTCTAAACGCCAAGTTAATCACTCAACGTAAGTTT

[0077] GATAATTTAACGAAAGCTGAACGTGGAGGTTTGAGTGAACTTGATAAAGCTG

[0078] GTTTTATCAAACGCCAATTGGTTGAAACTCGCCAAATCACTAAGCATGTGGCA

[0079] CAAATTTTGGATAGTCGCATGAATACTAAATACGATGAAAATGATAAACTTAT

[0080] TCGAGAGGTTAAAGTGATTACCTTAAAATCTAAATTAGTTTCTGACTTCCGAA

[0081] AAGATTTCCAATTCTATAAAGTACGTGAGATTAACAATTACCATCATGCCCAT

[0082] GATGCGTATCTAAATGCCGTCGTTGGAACTGCTTTGATTAAGAAATATCCAAA

[0083] ACTTGAATCGGAGTTTGTCTATGGTGATTATAAAGTTTATGATGTTCGTAAAA

[0084] TGATTGCTAAGTCTGAGCAAGAAATAGGCAAAGCAACCGCAAAATATTTCTTT

[0085] TACTCTAATATCATGAACTTCTTCAAAACAGAAATTACACTTGCAAATGGAGA

[0086] GATTCGCAAACGCCCTCTAATCGAAACTAATGGGGAAACTGGAGAAATTGTC TGGGATAAAGGGCGAGATTTTGCCACAGTGCGCAAAGTATTGTCCATGCCCC AAGTCAATATTGTCAAGAAAACAGAAGTACAGACAGGCGGATTCTCCAAGGA GTCAATTTTACCAAAAAGAAATTCGGACAAGCTTATTGCTCGTAAAAAAGACT GGGATCCAAAAAAATATGGTGGTTTTGATAGTCCAACGGTAGCTTATTCAGTC CTAGTGGTTGCTAAGGTGGAAAAAGGGAAATCGAAGAAGTTAAAATCCGTTA AAGAGTTACTAGGGATCACAATTATGGAAAGAAGTTCCTTTGAAAAAAATCC GATTGACTTTTTAGAAGCTAAAGGATATAAGGAAGTTAAAAAAGACTTAATC ATTAAACTACCTAAATATAGTCTTTTTGAGTTAGAAAACGGTCGTAAACGGAT GCTGGCTAGTGCCGGAGAATTACAAAAAGGAAATGAGCTGGCTCTGCCAAGC AAATATGTGAATTTTTTATATTTAGCTAGTCATTATGAAAAGTTGAAGGGTAG TCCAGAAGATAACGAACAAAAACAATTGTTTGTGGAGCAGCATAAGCATTAT TTAGATGAGATTATTGAGCAAATCAGTGAATTTTCTAAGCGTGTTATTTTAGC AGATGCCAATTTAGATAAAGTTCTTAGTGCATATAACAAACATAGAGACAAA CCAATACGTGAACAAGCAGAAAATATTATTCATTTATTTACGTTGACGAATCT TGGAGCTCCCGCTGCTTTTAAATATTTTGATACAACAATTGATCGTAAACGAT ATACGTCTACAAAAGAAGTTTTAGATGCCACTCTTATCCATCAATCCATCACT GGTCTTTATGAAACACGCATTGATTTGAGTCAGCTAGGAGGTGACTGA (SEQ ID NO: 31) (spCas9)

[0087] The guide nucleic acid

[0088] In embodiments comprising a nucleic acid-guided nuclease such as a Cas nuclease, the nuclease may be guided to its target for genetic engineering by nucleic acid (guide nucleic acid). Therefore, in those embodiments, the nucleic acid guided-nuclease system may comprise a guide nucleic acid. The guide nucleic acid may comprise DNA, RNA, a modified version of either (e.g. nucleic acid comprising chemical linkage modifications such as locked-nucleic acid), or a combination thereof (e.g. one nucleic acid molecule which comprises all of: adenine-, cytosine-, guanine-, thymine-, and uracil-based (deoxy)nucleotides).

[0089] The guide nucleic acid may comprise one or more nucleic acid molecules. For example, in embodiments comprising a Cas protein, the guide nucleic acid may comprise or consist of a CRISPR RNA (crRNA) molecule and a separate trans-activating crRNA (tracrRNA) molecule. In other embodiments, the guide nucleic acid may comprise one guide RNA (gRNA, a.k.a. sgRNA) molecule, wherein the gRNA molecule may comprise the sequences of otherwise separate crRNA and tracrRNA molecules, or a modified version thereof that optimises the steric presentation of nucleic acid to the nuclease. The skilled person will be familiar with different Cas proteins and the different structural and sequence requirements that each Cas protein has for its guide nucleic acid, and will be able to match a given Cas protein to a suitable guide nucleic acid structure without the exercise of inventive skills.

[0090] The sequences of the guide nucleic acid determines, either in part or wholly, the specificity of the catalytic activity of the nuclease and, therefore, the location of the genetic engineering. Therefore, in some embodiments, the guide nucleic acid may comprise a sequence that enables the targeting of phaZ and / or phaZ2, and optionally other genes of interest. In some embodiments, one nucleic acid molecule allows targeting of more than one (such as all) of the genetic loci to be genetically engineered. In some embodiments, such as embodiment wherein the guide nucleic acid may comprise one or more nucleic acid molecules, each such nucleic acid molecule may target a different genetic locus. In some such embodiments, the guide nucleic acid molecules may be introduced into the methanotrophic bacterium concurrently, or at different timepoint, e.g. after genetic engineering at least one locus has taken place.

[0091] The guide nucleic acid comprises at least one sequence with homology to the genetic locus to be engineered. The person skilled in the art will be familiar with the principles of designing guide nucleic acid molecules, such as gRNAs, that optimally target a given genetic locus, and tools that enable facile design without the exercise of inventive skills, such as Benchling, accessible at the URL www.benchling.com, and CRISPy-web as described in the publication Blin et al., ‘CRISPy-web: An online resource to design sgRNAs for CRISPR applications,’ Synthetic and Systems Biotechnology, 1(2), 2016, 118-121, doi: 10.1016 / j .synbio.2016.01.003, herein incorporated by reference, and accessible at the URL: crispy.secondarymetabolites.org. Alternatively or additionally, the person skilled in the art will be familiar with methods for identifying non-essential genes that may be most amenable for knock-out modifications in bacteria, such as methanotrophic bacterium, e.g. the method presented in the publication Rumah et al., “In Vivo Genome Editing in Type I and II Methanotrophs Using a CRISPR / Cas9 System”, ACS Synth. Bio. 2023, 12(2), 544-554, doi: 10. 1021 / acssynbio.2c00554. The genome-targeting portion of the guide nucleic acid may comprise any of the sequences according to SEQ ID NOs: 11-12 and 32-39. phaZ (PHB depolymerase) gRNA spacer (SEQ ID NO: 11): CAGATCAGGACCTTCTACG phaZ (PHB depolymerase) gRNA spacer (SEQ ID NO: 32) CGACCACGAAGTCTATGTCA phaZ (PHB depolymerase) gRNA spacer (SEQ ID NO: 33) ACGGACCGGATCGATGAAGT phaZ (PHB depolymerase) gRNA spacer (SEQ ID NO: 34) CCCGCCGCAAATATCCTGCG phaZ (PHB depolymerase) gRNA spacer (SEQ ID NO: 35) CATTGGCGACATTACGACCG phaZ2 (PHB Intracellular depolymerase) gRNA spacer (SEQ ID NO: 12): GATTCGATGATTCTGATGGG phaZ2 (PHB Intracellular depolymerase) gRNA spacer (SEQ ID NO: 36) GATGCAGCATCTCATATACG phaZ2 (PHB Intracellular depolymerase) gRNA spacer (SEQ ID NO: 37) CGTATATGAGATGCTGCATC phaZ2 (PHB Intracellular depolymerase) gRNA spacer (SEQ ID NO: 38) CGCCGCGCGCGCGGGCGCGA phaZ2 (PHB Intracellular depolymerase) gRNA spacer (SEQ ID NO: 39) GCGTCGGTCGCCGCGCGCGC ligD gRNA spacer (SEQ ID NO: 30)

[0092] GGAAGCGGGCTGTCCAATCG The entire guide nucleic acid molecule may comprise a sequence according to any of SEQ ID NOs: 13-14, wherein the underlined sequence (which targets ligD in SEQ ID NOs: 13-14) may be substituted for a sequence targeting the phaZ / phaZ2 gene, such as any of SEQ ID NOs: 32-39. Alternatively, or additionally, the sequence underlined in SEQ ID NOs: 13-14 may be substituted for a sequence targeting another desired genetic locus. gRNA sequence (SEQ ID NO: 13): GGAAGCGGGCTGTCCAATCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA GGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT gRNA sequence with terminator (SEQ ID NO: 14):

[0093] GGAAGCGGGCTGTCCAATCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA GGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTAT AAAAATAAGAAGCCTGCATTTGCAGGCTTCTTATTTTTAT

[0094] The guide nucleic acid may comprise 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, nucleotides that are different from the corresponding nucleobase in the genomic sequence. The said different nucleotides may be sequential, or alternatively at least two of the said different nucleotides may be separated by at least one nucleotide that is not different from the corresponding nucleobase in the genomic sequence. The person skilled in the art will be familiar with typical allowances for differences in nucleobases, and will incorporate that knowledge in the design of the guide nucleic acid without the exercise of inventive skills.

[0095] The guide nucleic acid may be delivered to the methanotrophic bacterium by way of introducing into the methanotrophic bacterium a nucleic acid that encodes the guide nucleic acid.

[0096] The donor template molecule

[0097] In some embodiments, including example embodiments wherein the genetic engineering involves i) genetic knock-in and ii) nucleic acid guided-nucleases, the genetic engineering may be carried out by providing the methanotrophic bacterium with a donor template (or “repair template”) molecule, such as nucleic acid. Therefore, in those embodiments, the nucleic acid guided-nuclease system may comprise a donor template molecule. The donor template molecule may contain a sequence (the template sequence) that can be incorporated into the methanotrophic bacterium’s genome, either directly (e.g. by ligation) or indirectly (e.g. by base-pairing and polymerase activity).

[0098] The person skilled in the art will recognise that, in cases wherein the genetic engineering would ideally comprise the outright knock-out of an essential gene, it may be advantageous for the genetic engineering to instead comprise the replacing of the target gene with a variant (such as a single-nt variant) that results in the expression of a protein variant (such as a single-aa variant) of lower activity compared to that of the endogenous protein. Thus, features and embodiments of the invention that refer to genetic knock-in may easily be adapted without the exercise of inventive skills to embodiments wherein genetic knock-out would otherwise be the preferred outcome, as an alternative way of achieving a substantially similar outcome.

[0099] In embodiments wherein the donor template molecule is nucleic acid, the donor template molecule may comprise or consist of DNA, RNA, a modified version of either (e.g. nucleic acid comprising chemical linkage modifications such as locked-nucleic acid), or a combination thereof (e.g. one nucleic acid molecule which comprises all of: adenine-, cytosine-, guanine-, thymine-, and uracil-based (deoxy)nucleotides). In preferred embodiments, the donor template molecule may comprise or consist of DNA.

[0100] The donor template molecule may comprise a sequence with homology to the genetic locus to be engineered. In some embodiments, the template sequence comprises two sequences (“homology arms”), one with homology to the upstream genomic sequence, and the other with homology to the downstream genomic sequences, from the genetic locus to be engineered. Each homology arm may independently comprise 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, nucleotides that are different from the corresponding nucleobase in the genomic sequence. The said different nucleotides may be sequential, or alternatively at least two of the said different nucleotides may be separated by at least one nucleotide that is not different from the corresponding nucleobase in the genomic sequence. Each homology arm may independently be about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 500 bp, about 600 bp, about 700 bp, about 1,000 bp, or about 1,500 bp, long, or longer. Preferably, each of the homology arms may independently be about 200-1,200 bp long. More preferably, each of the homology arms may independently be about 400-1,000 bp long. Yet more preferably, each of the homology arms may independently be about 400-600 bp long. Most preferably, each of the homology arms may be about 500 bp long.

[0101] The donor sequence may comprise one or more (such as two) sequences according to SEQ ID NOs: 15-18 i.e. the sequences comprising the donor sequences for phaZ and phaZ2. In preferred embodiments, the donor sequence comprises sequences according to SEQ ID NOs: 15-16. In other preferred embodiments, the donor sequence comprises sequences according to SEQ ID NOs: 17-18. phaZ donor template (left homology arm) (SEQ ID NO: 15):

[0102] GACGCGATCTTGGTGACGCGGCCTTGTTGGCGCGAGCCGCCAGTTTCGCGGCG TTTCCCGCGCTGGCCCCCTTGGGGGGCTCCAGAGCGAGGCTCGTGGGGCGCCG GAGGATCGGCGTCCTCATCCTGCGCAGGCGCGCCGATCGTTCGCCGCGAAGC GGCCACTTTTTGCCGGAATTTTCCTATCGTGCCCGACGGGAATCAAAAAATGC GGATTTCTCGATTTTTCGCCCTTGTCGCCCTTGTCGCCCTGGGGGCGGCCCTTG GCGCCTGCGAGACGACCTCGCCGGCGCAGCAGCGCGCGGCTGACGACGCCCG CTGCCGGTCCTACGGCTTCAAGCGTGGGAGCGACGGCTTCTCGAAATGCCTGC TCGACATCGATCTCGACCGCTCCGCCGACCGGCGCGCGAGCCGGGAGGAACT CATGCTTTATGGCGGCCCGCGCTTCTATGGCGCGCCTTATTGGCGCTATTGGT GAGCCGCAGGCTCCCGGGAAAGCGC phaZ donor template (right homology arm) (SEQ ID NO: 16):

[0103] GCGCTGGAGAGGAGCCCTTGTTTCGCTGGCTTCCTCCGCAGCAAGGGCCGTGC CATCTGCCCAAGAAAGTGGCACATGACTTGCTGATCCGCAGACGGTTCAACG GGGACGAGAAATGCCGGTCGCGACGCTCACCATCAGCAGCAAAAACTACTCC TCCTGGTCGCTGCGCGGCTGGCTGATGATGAAGCTCTCCGGCCTGCCCTTCGA GGAAGTGGCCGTCGATCCCGACGACGCGACGGCGCGGGAGGAAATCCTTTTG CTCTCCCCTTCGATCCTCGTGCCCTGCCTGACTTATGACGGTTTCCGGATTTGG GACACTTTGGCGATCGGCGAATTCCTGAACGAGATCGCTCCCGAGGCGAAGC TGATGCCGGCCAACCGCTTGAGCCGCGCGCGCTGCCGCTCGATCTGCGGCGA GCTGCATTCAGGCTTCAATTCGCTGCGCTCGGCGCTGCCGATGAACCTCAAGG CGCATTTCCCGCATTTCAAGGTGTGGT phaZ2 donor template (left homology arm) (SEQ ID NO: 17):

[0104] CTGCGACGACGTCGTCAACCTGATTCCCGCCCGCGTCGCGGCGGCCCTCCTCG CCGCCGCCGCCTGGGCGATGGGAGCAGACGCGCGGGAAGCCTGGACGACCGC GCTGCGGGACGCAGGCAAGCACGCCTCGCCAAACGCCGGCTGGCCCGAGGCC GCGATGGCCGGCGCGCTCGGCCTCGCGCTCGGCGGGCCGCGCGCCTATCAGG

[0105] GGGCGAAGGTGGCGGGCGCGACGCTCGGAAAAGGTCGGCGCGACGCGAGGC CGAAAGACATTTCGCGCGCCCTGACGATTTACAGATGCGCGGCGGCCATGCTC TGGCTATTTGTTCTCGTCGGCGCGCTTGCAAGCGCTACATAGACTGTTTCTAA ACCACAATCCAAGGCGGCGCGCATATTGGCGCAGGGTTGAGCTTGCCCTTTCA

[0106] TTTTTCTGGAAATGAAATATTTTATAAGGGAATTGTGCAGCGCAACATGGCGT CGGCGTAGGAGGTGGGAGAAGCGTAATT phaZ2 donor template (right homology arm) (SEQ ID NO: 18):

[0107] TATGGTTTCCGTCTAATCGCTTCGCCGCGTCATTGCGAGGAGCGGAAGCGACG AAGCAATCCAGGGGCCGCAATGTGACTCTGGATTGTTTGGTCGCATTTTTCGA CGTCGGGTATACCCGACGTCGCGCCATATGCGCCTCGCAATGACGGTAGCCG GTATGACGCGACCGCCTCGCTCCGATTAGAGCGTCGGCTTCAGCCCCGCCTTC

[0108] TGATTTTCGCGTGCGAGCTTCATGACGTAAGTCTTCGTCTTCTCGTCGTCGAGC CAGGCGTCGACGCGCGGATTGGCGAGATGCTCCTGGCCCGTCTTTTCGAAAGT CTTCCAGGACGATCCGAGATATTGCGGCAGATTGAGAAAATCTCCGACCGTAT GCGAGATGTGGTGGTTTTGCAGCTTGAAGAGATAACCGCCCTGCGCGCCGAA GACCCTGGCGACCGCCGGATAAACGGGGAAGATTTCGGAGCGCGCGAGGTCG

[0109] TGAATTTCGTAATAGCCGAAGTCCC

[0110] In some embodiments, such as embodiments comprising genetic knock-in, the donor template molecule may be physically linked to the guide nucleic acid, e.g. via a chemical linker. The chemical linker may be nucleic acid. In some embodiments, the gRNA molecule may also comprise the template sequence.

[0111] The targeted nuclease may be delivered to the methanotrophic bacterium by way of introducing into the methanotrophic bacterium nucleic acid that encodes the donor template molecule.

[0112] In some embodiments, a methanotroph that would otherwise not produce bioplastic, or a methanotroph that would otherwise produce negligible amounts of bioplastic, (e.g. a wild-type methanotroph) may be genetically modified according to the invention herein so to achieve appreciable amounts of bioplastic production.

[0113] The genetic engineering system

[0114] The nucleic acid guided-nuclease system, also referred to herein as the genetic engineering system, may comprise a targeted nuclease such as Cas9, a guide nucleic acid such as a gRNA molecule and, optionally, a donor template molecule. The genetic engineering system may comprise a targeted nuclease such as Cas9 and a donor template molecule. The genetic engineering system may comprise a guide nucleic acid such as a gRNA molecule.

[0115] In certain embodiments wherein the genetic engineering system comprises a targeted nuclease such as Cas9 and a guide nucleic acid such as a gRNA molecule, the components of the genetic engineering system may be delivered to the methanotrophic bacterium as a ribonucleoprotein comprising the targeted nuclease (the protein) and the guide nucleic acid. Alternatively, in other embodiments, the components of the genetic engineering system may be delivered to the methanotrophic bacterium by way of introducing into the methanotrophic bacterium nucleic acid that encodes the components of the genetic engineering system instead. In these embodiments, all components of the genetic engineering system may be encoded by the same nucleic acid molecule, or by more than one (such as two, or three, or more) nucleic acid molecules. The nucleic acid molecule(s) may be plasmid(s). By way of non-limiting example only, the components of the genetic engineering system may be delivered to the methanotrophic bacterium by introducing into it three nucleic acid molecules, wherein: i. a first nucleic acid molecule, such as a plasmid, encodes the targeted nuclease, such as Cas9, ii. a second nucleic acid molecule, such as a plasmid, encodes the guide nucleic acid, and iii. a third nucleic acid molecule, such as a plasmid, encodes the donor template molecule.

[0116] In embodiments wherein at least two components of the genetic engineering system are delivered as nucleic acid molecule(s) to be expressed in the methanotrophic bacterium, each component-encoding sequence may be provided with a separate promoter. Alternatively, only one promoter may regulate the expression of the nucleic acid sequences encoding all components. The promoters regulating the expression of the components of the genetic engineering system may be standard promoters known in the art to achieve functional expression in methanotrophic bacteria. The promoters may comprise any of Po / s (e.g. from M. capsulatus (Bath)), Pmdh (e.g. from M. parvus OBBP), Phps (e.g. from M. capsulatus (Bath)), PmxaF (e.g. from M. capsulatus (Bath)), Pphac (e.g. from C. necator H16), P3, P13 , P / .' / i1. P / iik (e.g. from AT. parvus OBBP), Pnproi , T6, Sp6, araBAD (PBAD), lac, trp, gab, gal, Ptac. In certain embodiments, Cas9 may be regulated by a relatively weakly-expressing promoter, and the guide nucleic acid may be regulated by a relatively higher-expressing promoter. In certain embodiments, Cas9 may be regulated by Pmdh or Pphac, and the guide nucleic acid may be regulated by Po / Sor PmxaF. In certain embodiments comprising type II methanotrophs, such as M. parvus strains (e.g. M. parvus OBBP or BRCS2) or M. rosea strains (e.g. M. rosea BRCS 1), the promoters regulating the expression of the components of the genetic engineering system may be Pmdh or Po / S. In certain embodiments comprising type I methanotrophs, such as M. capsulatus strains (e.g. M. capsulatus (Bath)), the promoters regulating the expression of the components of the genetic engineering system may be Pphac or PmxaF.

[0117] The promoter may comprise the following (M. capsulatus (Bath) Po / S) sequence: CACCCAGGGATGGTCCGGCGGCACGGTTTTGACCTTGCGGCATGCTGGACAC GGCGCTGGCCCGTTTTCGCCGGCGGAAGGAGCTTACGGCGGGTGCGGGGGCA CTGAGGCGGCGACCATGACCGGCGGCGGCATCGCAGGAAAGCGACCCGAGCT TTCCAAACCTGTTCTTGACGTAACACGAAGTTCCGGGTACGGTTCTCCACTTTT CACTTGCGCGCTCCCATACTGGAGCGGTTTGCAACGGGCGCCCGTAAGCGCCT GATCAGTAAAGAGGGGCCGAAGC (SEQ ID NO: 19)

[0118] The promoter may comprise the following (M. parvus OBBP Pmdh) sequence: TACCGGGAGGAGATATGCCGATCTTTCCCGCCGCACATTACCGATAAATCGTG AAGACAGGTCGCGCGCCGTAAATTTATATGCGGTCGGATCGTCTCTCCCATAA AGCGCGGCAAGCGCCCCCAAGGAAGCGACCTTCAACGAACCGGGACAGCTCC AATTACAAAAGAGTGGAGCGTCTATACGAGGCGACGCCATCCTTTCAAGAAG CCATGAGCGGCCTTGCAGGACGTCGCAGGAGGACTCGTCT (SEQ ID NO: 20)

[0119] The promoter may comprise the following (C. necator Hl 6 P^oc) sequence: TTGACAGCGCGTGCGTTGCAAGGCAACAATGGACTCAAATGTCTCGGAATCG CTGACGATTCCCAGGTTTCTCCGGCAAGCATAGCGCATGGCGTCTCCATGCGA

[0120] GAATGTCGCGCTTGCCGGATAAAAGGGGAGCCGCTATCGGAATGGACGCAAG CCACGGCCGCAGCAGGTGCGGTCGAGGGCTTCCAGCCAGTTCCAGGGCAGAT GTGCCGGCAGACCCTCCCGCTTTGGGGGAGGCGCAAGCCGGGTCCATTCGGA

[0121] TAGCATCTCCCCATGCAAAGTGCCGGCCAGGGCAATGCCCGGAGCCGGTTCG AATAGTGACGGCAGAGAGACAATCAACA (SEQ ID NO: 21)

[0122] The promoter may comprise the following (M. capsulatus (Bath) POTOT) sequence: GAGGTTCAGGCGAAACCGCAGACTCAAGGGCGCTTGCTCCCGGGAAAGATCG

[0123] TATTAGTTTGCCTCGATCGGCGGTCCTTGTGACAGGGAGATATTCCCGACGGA

[0124] TCCGGGGCATTCGAGCGGAACCGCCCGCCGTGGGAGTTTTTCCAGCGAGCATT CGAGAGTTTTTCAAGGCGGCTTCGAGGGGTTATTCCGTAACGCCGCCGACATG ATCTGTCCCAGAATCTCCGCCGCTGTTCGTAGAGCGCCGATGCAGGGTCGGCA TCAATCATTCTTAGCGCTAGTAGTGGAGGAGA (SEQ ID NO: 22)

[0125] The promoter may comprise the following (M. capsulatus (Bath) Phps) sequence: GGCCGCCCTGCGAAAGGGGGGGCTGCATTGACAGCGGCCCCCTCACTCTTTAC

[0126] AGTTGGGAAATTGTGCGTTTAGCAATACCCCATAACTCCTAAGGCTTAAGCCC GACTTTTTTCTCTCTACCTTACTTTTTTGATCGGAGGAGATCTCA (SEQ ID NO: 23)

[0127] The promoter may comprise the following (P13) sequence:

[0128] TGCGTTTCTTAAGGCTGAGGGAAAGTACCCAAAAATTCATCCTTCTCGCCTAT

[0129] GCTCTGGGGCCTCGGCAGATGCGAGCGCTGCATACCGTCCGGTAGGTCGGGA AGCGTGCAGTGCCGAGGCGGATTAATCGATTTCCCTTTTAATCATCCGGCTCG

[0130] TATAATGTGTGGAGACTTGAATTCACTAGTTTAACTTTAAGAAGGAGATATAC AT (SEQ ID NO: 24)

[0131] The promoter may comprise the following (Pnproi) sequence:

[0132] GGCCGCTGTATCCATATGACCATGATTACGAATTCGAGCTCGGTACCAAATTA

[0133] AGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTTAAGGCTGAGGGA

[0134] AAGTACCCAAAAATTCATCCTTCTCGCCTATGCTCTGGGGCCTCGGCAGATGC GAGCGCTGCATACCGTCCGGTAGGTCGGGAAGCGTGCAGTGCCGAGGCGGAT TCCCGCATTGACAGCGCGTGCGTTGCAAGGCAACAATGGACTCAAATGTCTCG GAATCGCTGACGATTCCCAGGTTTCTCCGGCAAGCATAGCGCATGGCGTCTCC ATGCGAGAATGTCGCGCTTGCCGGATAAAAGGGGAGCCGCTATCGGAATGGA CGCAAGCCACGGCCGCAGCAGGTGCGGTCGAGGGCTTCCAGCCAGTTCCAGG

[0135] GCAGATGTGCCGGCAGACCCTCCCGCTTTGGGGGAGGCGCAAGCCGGGTCCA TTCGGATAGCATCTCCCCATGCAAAGTGCCGGCCAGGGCAATGCCCGGAGCC GGTTCGAATAGTGACGGCAGAGAGACAATCAACA (SEQ ID NO: 25)

[0136] The promoter may comprise the following (P3) sequence:

[0137] TAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTTAAGGCTGAGG GAAAGTACCCAAAAATTCATCCTTCTCGCCTATGCTCTGGGGCCTCGGCAGAT GCGAGCGCTGCATACCGTCCGGTAGGTCGGGAAGCGTGCAGTGCCGAGGCGG ATTAATCGATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGAATTCACT

[0138] AGTTTAACTTTAAGAAGGAGATATACAT (SEQ ID NO: 26)

[0139] In some embodiments wherein the components of the genetic engineering system are delivered as a nucleic acid molecule such as a plasmid, the plasmid may comprise the backbone sequence of a pMTL plasmid, such as pMTL94111 or pMTL94115.

[0140] The basic pMTL94111 plasmid sequence, which may be used to derive a suitable plasmid backbone sequence according to standard methods in the art, may comprise or consist of the sequence according to SEQ ID NO: 27:

[0141] CTAGCataaaaataagaagcctgcatttgcaggcttcttatttttatTGGCGCGCCGACTGGCCGGAAC TGACCCCACAAGGCCCTAGCGTTTGCAATGCACCAGGTCATCATTGACCCAGG CGTGTTCCACCAGGCCGCTGCCTCGCAACTCTTCGCAGGCTTCGCCGACCTGC

[0142] TCGCGCCACTTCTTCACGCGGGTGGAATCCGATCCGCACATGAGGCGGAAGG TTTCCAGCTTGAGCGGGTACGGCTCCCGGTGCGAGCTGAAATAGTCGAACATC CGTCGGGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATACGAATTTCGTGTA

[0143] GTGGTCGCCAGCAAACAGCACGACGATTTCCTCGTCGATCAGGACCTGGCAA CGGGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGGTGCAGCAGCGACA CCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAGCCCATCGCCGTCGCCTGT

[0144] AGGCGCGACAGGCATTCCTCGGCCTTCGTGTAATACCGGCCATTGATCGACCA GCCCAGGTCCTGGCAAAGCTCGTAGAACGTGAAGGTGATCGGCTCGCCGATA GGGGTGCGCTTCGCGTACTCCAACACCTGCTGCCACACCAGTTCGTCATCGTC GGCCCGCAGCTCGACGCCGGTGTAGGTGATCTTCACGTCCTTGTTGACGTGGA AAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGGTG

[0145] AACAGGGCAGAGCGGGCCGTGTCGTTTGGCATCGCTCGCATCGTGTCCGGCC

[0146] ACGGCGCAATATCGAACAAGGAAAGCTGCATTTCCTTGATCTGCTGCTTCGTG

[0147] TGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTGACCTGTTTTGCCAGGTCCTC

[0148] GCCGGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGGTCAT

[0149] CGACTTCGCCAAACCTGCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGG

[0150] CGGCCGATGGCGCGGGCAGGGCAGGGGGAGCCAGTTGCACGCTGTCGCGCTC

[0151] GATCTTGGCCGTAGCTTGCTGGACCATCGAGCCGACGGACTGGAAGGTTTCGC

[0152] GGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTCGGCGGA

[0153] AAACCCCGCGTCGATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGAT

[0154] TCATTCACCCTCCTTGCGGGATTGCCCCGACTCACGCCGGGGCAATGTGCCCT

[0155] TATTCCTGATTTGACCCGCCTGGTGCCTTGGTGTCCAGATAATCCACCTTATCG

[0156] GCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTCCTTCTCGTACTTGGTATT

[0157] CCGAATCTTGCCCTGCACGAATACCAGCTCCGCGAAGTCGCTCTTCTTGATGG

[0158] AGCGCATGGGGACGTGCTTGGCAATCACGCGCACCCCCCGGCCGTTTTAGCG

[0159] GCTAAAAAAGTCATGGCTCTGCCCTCGGGCGGACCACGCCCATCATGACCTTG

[0160] CCAAGCTCGTCCTGCTTCTCTTCGATCTTCGCCAGCAGGGCGAGGATCGTGGC

[0161] ATCACCGAACCGCGCCGTGCGCGGGTCGTCGGTGAGCCAGAGTTTCAGCAGG

[0162] CCGCCCAGGCGGCCCAGGTCGCCATTGATGCGGGCCAGCTCGCGGACGTGCT

[0163] CATAGTCCACGACGCCCGTGATTTTGTAGCCCTGGCCGACGGCCAGCAGGTAG

[0164] GCCTACAGGCTCATGCCGGCCGCCGCCGCCTTTTCCTCAATCGCTCTTCGTTCG

[0165] TCTGGAAGGCAGTACACCTTGATAGGTGGGCTGCCCTTCCTGGTTGGCTTGGT

[0166] TTCATCAGCCATCCGCTTGCCCTCATCTGTTACGCCGGCGGTAGCCGGCCAGC

[0167] CTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGT

[0168] GAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCT

[0169] GACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCC

[0170] TGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACC

[0171] CCGAAGCAGGGTTATGCAGCGGAAAAGATCCGTCGACCCTTTCCGACGCTCA

[0172] CCGGGCTGGTTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAAC

[0173] GCGCCAGAAACGCCGTCGAAGCCGTGTGCGAGACACCGCAGCCGCCGGCGTT

[0174] GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGACGT

[0175] TGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGGGCAG

[0176] GCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCGGCGAAA

[0177] ACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGCCTGGGGATA

[0178] AGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGACAGATGAGGGG CGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGATGAGGGGCGCACCT

[0179] ATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCCAGCATTTGCAAGGGT

[0180] TTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTTTTAACCTGCTTTTAAACCA

[0181] ATATTTATAAACCTTGTTTTTAACCAGGGCTGCGCCCTGTGCGCGTGACCGCG

[0182] CACGCCGAAGGGGGGTGCCCCCCCTTCTCGAACCCTCCCGGCCCGCTAACGCG

[0183] GGCCTCCCATCCCCCCAGGGGCTGCGCCCCTCGGCCGCGAACGGCCTCACCCC

[0184] AAAAATGGCAGGGCCGGCCATGTCAGCTACTGGGCTATCTGGACAAGGGAAA

[0185] ACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATA

[0186] GCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGG

[0187] GCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTT

[0188] GCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGA

[0189] TGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGC

[0190] CGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGC

[0191] TGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTT

[0192] TGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCG

[0193] CGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGT

[0194] TGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAG

[0195] GATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGA

[0196] TGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACC

[0197] AAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGT

[0198] CGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTG

[0199] TTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCC

[0200] ATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGA

[0201] TTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTT

[0202] GGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCC

[0203] TCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCC

[0204] TTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGAGTTTAAACC

[0205] CAAGCTGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGAT

[0206] AAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGC

[0207] CAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGC

[0208] AACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATT

[0209] AAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTT

[0210] AAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATC

[0211] TCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC

[0212] GTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTG CTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATC AAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATA CCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTC TGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTG CCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCG GATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCT TGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGA AAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGC AGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGG TATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTG TGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCT TTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGGTACCCCTGCAGG CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTG TTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCAGGAAACAGCTATGACCg cGGagaaggccatcctgacggatggccttttgcggccgcAGACGTGCGGGTCGAAACTTGTTGTA ACGGAGGGGGCGTTTGTTCTAAGTTAGGCGCCAGCCAAGCGCTACGATACTC AAAGGGGAGGCGGCATATGACCATGATTACGAATTCGGTACCCGGGGATCCT CTAGAGTCGACGTCACGCGTCCATGGAGATCTCGAGGCCTGCAGACATGCAA GCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTT ACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG CGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGC

[0213] GAATGGCG (SEQ ID NO: 27)

[0214] The nucleic acid molecule(s), such as plasmid(s), to be expressed in the methanotrophic bacterium may be delivered to the methanotrophic bacterium by any method that is known in the art to result in successful delivery. By way of example, the methanotrophic bacterium may be transformed with the desired nucleic acid molecule(s), such as plasmid(s), e.g. by chemical transformation, or by electroporation. In some favoured embodiments, the nucleic acid molecule(s), such as plasmid(s), to be expressed are delivered to the methanotrophic bacterium by bacterial conjugation with at least one donor bacterium (e.g. one bacterium, or two or more bacteria) carrying the desired nucleic acid molecule(s), such as plasmid(s). The at least one donor bacterium may be any bacterium that can engage in bacterial conjugation, such as an F+bacterium, or E. coli S I 7-1 pir, or E. coli S I 7-1. In a preferred embodiment, the donor bacterium is E. coli S I 7-1 pir, for example with the following genome: TpR SmR rec A thi pro hsdR- M+RP4: 2-Tc:Mu: Km Tn7 'kpir. The bacterial conjugation may be bi-parental, or tri- parental. In a preferred embodiment, the bacterial conjugation is bi-parental. The skilled person will match the genetic information of the bacteria to the suitable or most effective conjugation settings, e.g. an F+donor bacterium may be paired with an F methanotrophic bacterium in embodiments wherein the plasmid(s) comprise(s) an oriT sequence.

[0215] In certain embodiments, the nucleic acid molecule(s), such as plasmid(s), to be expressed in the methanotrophic bacterium are stably integrated into the genome of the methanotrophic bacterium. In certain embodiments, the nucleic acid molecule(s), such as plasmid(s), to be expressed in the methanotrophic bacterium are not stably integrated into the genome of the methanotrophic bacterium, persisting instead as separate nucleic acid molecule(s).

[0216] In embodiments wherein at least one component of the genetic engineering system is delivered as a nucleic acid molecule that encodes it, the nucleic acid molecule may be chemically modified to enhance its expression in the methanotrophic bacterium, such as by way of codon-optimisation, or to limit it, such as by substituting-in codons that are suboptimal for expression in the methanotrophic bacterium.

[0217] In some embodiments, including embodiments comprising bioplastic (such as PHB) production and accumulation after phaZ-phaZ2 double knock-out, bioplastic (such as PHB) production may take place only after induction. For example, in some embodiments comprising the delivery of the components of the genetic engineering system to the methanotrophic bacterium as a plasmid encoding them, the sequence encoding at least one of the components of the genetic engineering system is downstream of an inducible or repressible promoter, and the said component(s) may be induced only at a specific time point during the culturing of the methanotrophic bacterium. In other embodiments, all promoters are constitutive promoters and bioplastic (such as PHB) production according to the invention takes place spontaneously when all components of the genetic engineering system are introduced into the methanotrophic bacterium.

[0218] In some other embodiments, including embodiments comprising M. capsulatus (Bath), induction of bioplastic (such as PHB) production may be by way of culturing the methanotrophic bacterium in conditions that stimulate bioplastic (such as PHB) production e.g. culture in nitrogen-deficient growth medium such as nitrogen-free NMS medium. In some of these embodiments, methane gas or methanol may be provided to the methanotrophic bacterium only after induction has taken place.

[0219] Bioplastic (such as PHB) production may take place for a defined amount of time. In some embodiments, bioplastic (such as PHB) production may take place for a at least about 1 hour. In some embodiments, bioplastic (such as PHB) production may take place for a at least about 12 hours. In some embodiments, bioplastic (such as PHB) production may take place for a at least about 24 hours. In some preferred embodiments, bioplastic (such as PHB) production may take place for about 3 days, or more.

[0220] The skilled person realises that it may be advantageous to allow the methanotrophic bacterium to grow and multiply before induction of bioplastic (such as PHB) production, and / or during bioplastic (such as PHB) production. Thus, in some embodiments comprising induction of bioplastic (such as PHB) production, bioplastic (such as PHB) production may take place cyclically, that is to say: periods of bioplastic such as PHB production (such as by culturing in nitrogen-free growth media) may be alternated with periods of growth (such as by culturing in nitrogen-containing growth media, which may also be known as nitrogen-rich). The nitrogen-free growth media may be any media that support the growth of the methanotrophic bacterium but that comprise no added sources of nitrogen. For example, the nitrogen-free growth medium may be formulated as Nitrate Mineral Salt (NMS) medium but without any added nitrate (nf-NMS). The nitrogen-rich growth media may be any growth media that support the growth of the methanotrophic bacterium while also comprising sources of nitrogen. For example, the nitrogen-containing growth medium may be formulated as NMS medium with added nitrate, such as in the form of potassium nitrate. In embodiments wherein the nitrogencontaining growth medium such as NMS comprises added potassium nitrate, the potassium nitrate may be added at a concentration of at least about 0.1 pg / L. In some embodiments, the nitrogen-rich growth medium such as NMS comprises the added potassium nitrate at a concentration of about 5 g / L. In some embodiments, the nitrogencontaining growth medium such as NMS comprises the added potassium nitrate at a concentration of from about 0.1 pg / L to about 5 g / L. In some embodiments, the nitrogencontaining growth medium such as NMS comprises the added potassium nitrate at a concentration of at least about 0.5 g / L, or more. In some embodiments, the nitrogen- containing growth medium such as NMS comprises the added potassium nitrate at a concentration of at least about 1 g / L, or more. In some embodiments, the nitrogencontaining growth medium such as NMS comprises the added potassium nitrate at a concentration of at least about 1.5 g / L, or more. In some embodiments, the nitrogencontaining growth medium such as NMS comprises the added potassium nitrate at a concentration of from about 0.5 g / L to about 1.5 g / L. In some preferred embodiments, the nitrogen-containing growth medium such as NMS comprises the added potassium nitrate at a concentration of from about 0.75 g / L to about 1.5 g / L. In some more preferred embodiments, the nitrogen-containing growth medium such as NMS comprises the added potassium nitrate at a concentration of from about 0.75 g / L to about 1.25 g / L. In some yet more preferred embodiments, the nitrogen-containing growth medium such as NMS comprises the added potassium nitrate at a concentration of from about 0.9 g / L to about 1.1 g / L. In the most preferred embodiments, the nitrogencontaining growth medium comprises NMS comprising added potassium nitrate at a concentration of about 1 g / L. Alternatively, alternative nitrate salts may be provided in any of the above recited quantities.

[0221] Recovery of the bioplastic

[0222] In some embodiments, the produced bioplastic (such as PHB) is released from the methanotrophic bacterium. In some embodiments, the produced bioplastic (such as PHB) is released by lysis of the methanotrophic bacterium. In some embodiments, the produced bioplastic (such as PHB) may remain substantially amorphous while in the methanotrophic bacterium, and only become crystalline to an appreciable degree once it is released from the methanotrophic bacterium. Lysis of the methanotrophic bacterium may be achieved, for example, by chemical, biochemical, or physical methods, or by a combination thereof. Chemical lysis may comprise osmotic shock, and / or the use of detergent (i.e. amphipathic) molecules. Physical lysis may comprise disruption with bead mills, sonication, freezing / thawing (and cycles therebetween), grinding, blending, homogenisation, use of a French press or similar implements, and / or a combination of any number of these. In one embodiment, the methanotroph is lysed by enzyme(s). In one embodiment, the methanotroph is pelleted (e.g. by centrifugation) and resuspended in a lysis buffer. Additionally or alternatively, the produced bioplastic (such as PHB) may be recovered by extraction in any suitable solvent, or solution. For example, the produced bioplastic (such as PHB) may be recovered by extraction in a solvent comprising any one or more (such as all) of: chloroform, methylene chloride, dichloroethane, ammonia, surfactants, sodium hypochlorite. In some embodiments, the produced bioplastic (such as PHB) may be recovered by extraction in biocompatible solvents, or solution. Alternatively or additionally, the produced bioplastic (such as PHB) may be recovered by treatment with at least one enzyme. In some preferred embodiments, the produced bioplastic (such as PHB) may be recovered by extraction in a solvent comprising chloroform.

[0223] According to another aspect of the present invention, there is provided a bioplastic, such as PHB, or a crystal thereof, produced by any of the methods of the invention herein.

[0224] The PHB may be blended or copolymerised with other monomers of polyhydroxyalkanoate (PHA) (or other biodegradable polymers) to form copolymers thereof.

[0225] Definitions

[0226] References to reduced protein expression levels may be understood throughout the specification as a decrease in the expression level of a given protein in the genetically engineered methanotrophic bacterium, with respect to the non-genetically engineered methanotroph (such as a wild-type methanotrophic bacterium).

[0227] The term “bioplastic” refers to any polymer that may be easily degraded (such as by enzymatic digestion) by any cell or virus. Preferably, the bioplastic according to the invention is easily degraded by a naturally-occurring bacterium.

[0228] The terms “phaZ” and “phaZ2” refer to the respective gene, as annotated in the organism M. parvus BRCS2. It is expressly envisaged herein that the skilled person would easily target for genetic engineering the orthologue of either gene, or of both genes, however annotated in other methanotrophic bacteria, without the exercise of inventive skills. Similarly, the terms “PhaZ” and “PhaZ2” refer to the respective protein as named in the organism M. parvus BRCS2. It is expressly envisaged herein that the skilled person would easily reduce functional expression of proteins homologous to either protein, or both proteins, however named in other methanotrophic bacteria, without the exercise of inventive skills.

[0229] The term “protein” may refer generally to a peptide, a polypeptide, a protein, a multisubunit protein, or a protein complex, either naturally occurring or synthetic. Any of these may comprise a non-peptidic component e.g. a glycan, ion, metal (e.g. metal atom), cofactor, lipid, nucleic acid, linker, chemical modification, tag, polymer, chromophore, or a combination of any number of these.

[0230] Where reference is made to a variant polypeptide or protein, the skilled person will understand that one or more amino acid residue or nucleotide substitutions, deletions or additions, may be tolerated, optionally two substitutions may be tolerated in the sequence, such that it maintains its function. The skilled person will appreciate that 1, 2, 3, 4, 5 or more amino acid residues may be substituted, added or removed without affecting function References to sequence identity may be determined by BLAST sequence alignment (www.ncbi.nlm.nih.gov / BLAST / ) using standard / de fault parameters. For example, the sequence may have at least 99% identity and still function according to the invention. In other embodiments, the sequence may have at least 98% identity and still function according to the invention. In another embodiment, the sequence may have at least 95% identity and still function according to the invention. In another embodiment, the sequence may have at least 90%, at least 85%, or at least 80% identity and still function according to the invention. In one embodiment, the variation and sequence identity may be according to the full length sequence. In other embodiments, the variation may be limited to non-conserved sequences and / or sequences outside of active sites, such as binding domains. Therefore, an active site or binding site of a protein may be 100% identical, whereas the flanking sequences may comprise the stated variations in identity. Such variants may be termed “conserved active site variants”.

[0231] Amino acid substitutions may be conservative substitutions. For example, a modified residue may comprise substantially similar properties as the wild-type substituted residue. For example, a substituted residue may comprise substantially similar or equal charge or hydrophobicity as the wild-type substituted residue. For example, a substituted residue may comprise substantially similar molecular weight or steric bulk as the wild-type substituted residue. The skilled person will recognise that features of one aspect or embodiment described herein may be used with any other aspect or embodiment described herein.

[0232] The skilled person will understand that optional features of one embodiment or aspect of the invention may be applicable, where appropriate, to other embodiments or aspects of the invention.

[0233] The skilled person will recognise that the compositions, components, media, and cell types, according to the present invention may be easily adapted as necessary to various other embodiments, while retaining substantially similar functions and achieving substantially similar results.

[0234] As used herein, references to words in the singular, for example when preceded by “a”, “an”, or “the”, are generally to be construed as including the plural and vice versa, unless the context clearly implies or requires otherwise.

[0235] Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying drawings.

[0236] Brief Description of the Figures

[0237] Figure 1. A. TraDIS results. Summary from data analysis of transposon insertion sequencing reads obtained showing percentage of transposon insertion reads mapped to the reference genome of M. parvus BRCS2, Unique Insertion Sites (UIS) and Insertion Index. Up to 97.6% mapping to the reference genome was obtained, resulting in 412,174 unique insertion sites (UIS), an average of one insertion per 11 base pairs, enabling the assay of every gene in both genome and mega plasmids oiMethylocystis parvus BRCS2. A scoring system was applied to introduce additional stringency when determining essential genes. The 484 genes that have the highest score (8) were observed to be essential in all passages. C. Binomial distribution plotted to determine the cutoff point between essential and non-essential genes of transposon library grown under initial growth conditions (NMS agar plates) and 1st passage (NMS liquid media). D. Binomial distribution plotted to determine the cutoff point between essential and non-essential genes of transposon library grown under 2nd passage (NMS liquid media) and 3rd passage (NMS liquid media).

[0238] Figure 2. Distribution of insertion indices across BRCS2 genome. Frequency and distribution of transposon directed insertion-site sequence reads across the entire Methylocystis parvus BRCS2 genome for a pool of one million transposon mutants. The y-axis shows the number of mapped sequence reads; x-axis shows the positions of the transposon insertion. This illustrates the unbiased transposon insertion across the genome of Methylocystis parvus BRCS2, further demonstrating the randomness of transposon insertion in our organism. This is crucial to ensure that insertions are occurring across the entire genome.

[0239] Figure 3. A. The typical metabolic pathway of PHB production and degradation, which is reproduced from D’Alessio et al. (2017), ‘Transcriptome analysis of polyhydroxybutyrate cycle mutants reveals discrete loci connecting nitrogen utilization and carbon storage in Sinorhizohium meliloti mSystems, 2(5), doi: 10. 1128 / msystems.00035-17. B. PHB cycle genes identified in this study as essential or non-essential in Methylocystis spp., and the effect of their deletion on PHB production.

[0240] Figure 4. % PHB per dry cell weight for selected PHB methanotroph mutants. M e Bath is the negative control, which does not contain the PHB pathway; M p BRCS2 WT is the wild type strain; M p BRCS2 AphaZ is engineered phaZ gene deletion; M p BRCS2 AphaZ2 is the engineered phaZ2 gene deletion; M p BRCS2 AphaZAphaZ2 is the engineered phaZ and phaZ2 double gene deletions.

[0241] Figure 5. Schematic illustration of CRISPR plasmids used to delete genes phaZ and phaZ2.

[0242] Figure 6. A. Gene Maps showing the arrangement of genes into three PHA gene clusters cluster as found in OBBP-Final. This accounts for 7 of 12 identified genes. Gaps between the coding sequences are marked, prs-. Ribose-phosphate diphosphokinase, not previously considered PHA associated. Panel produced with BioRender.com B. Chromosomal map of OBBP-Final showing the location of PHA pathway associated genes. Panel produced in Benchling. Figure 7. Maximum Likelihood tree of phaZ genes drawn from the genome (M. parvus OBBP-Final). Model used is LG+G. Branches are annotated with lengths measured in substitutions per site. Junctions are labelled with their frequency within 100 bootstraps. Figures produced using MEGA (Tamura et al. , ‘MEGA11 : Molecular Evolutionary Genetics Analysis Version 11 ’, Mol Biol Evol. 2021 Jun 25;38(7):3022-7).

[0243] Figure 8. An updated version of Figure 3A illustrating the PHB synthesis and degradation pathway appended with gene locations on the M. parvus OBBP genome. Genes with questionable attribution are annotated with “(?)”. Figure created with BioRender.com.

[0244] Figure 9. A map of the CRISPR-Cas Plasmid pMTL9BR2-Cas9 with generalised Ikb homology arms and no insertion cargo. The left homology arm, right homology arm, intervening region and seed are customised to the target. Additional work was done to improve the plasmid map identifying regions using a combination of the Benchling Auto annotate tool, Addgene sequence analyser, and parts from the Standard Registry of Biological Parts (SRBP). The relevant sources are labelled where this took place. Cpa Fdx / terminator is the terminator from the ferredoxin gene of Clostridium pasteurianum. An identified incomplete Ampicillin resistance gene should be inactive and was not previously identified. Plasmid map generated using Benchling.

[0245] Figure 10. % PHB per dry cell weight for selected M. trichosporium OB3b mutants. Me. Bath WT is the negative control (Methylocystis), which does not contain the PHB pathway; Mt. OB3b WT is the Methylosinus trichosporium OB3b wild type strain; AphaZA is engineered phaZA (a.k.a. phaZ) gene deletion in OB3b; AphaZB is the engineered phaZB (a.k.a. phaZ2) gene deletion in OB3b; AphaZAAphaZB is the engineered phaZA and phaZB double gene deletions in OB3b.

[0246] Examples

[0247] Example 1 - M. parvus BRCS2

[0248] Construction of the CRISPR plasmids for M. parvus BRCS2 modification CRISPR / Cas9 plasmids (Figure 5) targeting PHB metabolism genes phaZ (PHB depolymerase) and phaZ2 (PHB internal depolymerase) were constructed broadly as described in the publication Rumah et al., “In Vivo Genome Editing in Type I and II Methanotrophs Using a CRISPR / Cas9 System”, ACS Synth. Bio. 2023, 12(2), 544-554, doi: 10. 1021 / acssynbio.2c00554, including the supplementary information thereto, both herein incorporated by reference.

[0249] A three-fragment DNA HiFi assembly was used to construct CRISPR / Cas9 plasmids, using pMTL9BR-Cas9 digested with restriction enzymes Sbfl. and Asci as the backbone. Primers were designed for PCR amplification of fragments using the Gibson assembly option on Benchling. Benchling was also used to design guide RNA spacers for target genes. DNA fragments (gRNA, left and right homology arms) specific to the target gene were first amplified with high-fidelity Q5 DNA polymerase. Amplified fragments were then purified and assembled according to New England Biolabs (NEB) HiFi kit instructions. After HiFi assembly, plasmids were transformed into chemically competent E. coli DH5a cells using heat shock. 100 of transformed E. coli DH5a was spread on LB agar plates with kanamycin (50 pg / mL) and incubated at 37 °C overnight. The next day, colonies with successful plasmid assemblies were identified using PCR. Such colonies were grown overnight in LB broth with kanamycin (50zg / mL). After overnight growth, plasmid DNA was extracted and sequence was confirmed via Sanger sequencing. Plasmids with correct sequences were transformed into conjugation donor E. coli S 17-1 'kpir.

[0250] Generation of gene deletion mutants in M. parvus BRCS2

[0251] Mutants were generated broadly as described in the publication Rumah et al., “In Vivo Genome Editing in Type I and II Methanotrophs Using a CRISPR / Cas9 System”, ACS Synth. Bio. 2023, 12(2), 544-554, doi: 10. 1021 / acssynbio.2c00554, including the supplementary information thereto, both herein incorporated by reference.

[0252] E. coli S I 7-1 pir harbouring the intended CRISPR plasmid was grown overnight in LB media containing kanamycin (50 / zg / mL). The absorbance (OD600) of the grown overnight culture was measured and the volume required to give 1 mL of E. coli S I 7-1 pir at OD600 of 1 was calculated and pipetted into an Eppendorf tube. For example, 0.4 mL of OD600 2.5 gave 1 mL of OD600 1. The E. coli S 17-1 Xpzr culture was then washed three times with NMS medium to remove the antibiotics by centrifuging at 8,000 rpm for three minutes. After the third wash, a calculated volume of methanotroph culture was mixed to have 1 : 1 donor recipient ratio by OD. The mixture of E. coll S I 7- 1 pir and methanotroph was spun at 8000 rpm for three minutes and resuspended in 50 z L of NMS which was spotted on a dry plate of NMS Bacto Agar containing 0.5% yeast extract. The spot was allowed to dry, and the plates were placed in air-tight anaerobic jars sparged with CH4 and incubated at 30 °C for typically 48 hr. After 48 hr of mating, the spot was scraped with a sterile loop and resuspended in 1 mL of NMS. The resuspension was then plated on NMS Bacto agar plates containing kanamycin (50 zg / mL) and nalidixic acid (25 / zg / mL), and incubated for up to two weeks. Transconjugant colonies growing on NMS antibiotic plates were picked, patch-plated on NMS antibiotic plates and dipped into a 25 zL PCR mix according to NEB UK Q5 High-fidelity polymerase instructions, using gene target specific flanking primers. In all cases, mutations were further confirmed with Sanger sequencing.

[0253] Determining the PHB concentration

[0254] PHB concentration (Figure 4) was determined broadly as described in the publication Rumah et al. , “Isolation and characterisation of Methylocystis spp. for poly-3- hydroxybutyrate production using waste methane feedstocks”, AMB Expr 11 :6 (2021), doi: 10.1186 / s 13568-020-01159-4, including the supplementary information thereto, which are both herein incorporated by reference.

[0255] In short, one 250 mL serum bottle with 30 mL NMS medium was inoculated from colonies growing on plates and grown for several days with pure methane. This culture was used to inoculate main cultures (30 mL NMS in 250 mL serum bottles) to OD600 0.05. CH4 gas was added (57.5 mL) to the serum bottles which resulted in a ratio of 1 :4 CH4:air. This culture was grown for three days, re-gassing every day, before the grown cells were resuspended in NMS media without nitrogen source (potassium nitrate). Absence of nitrogen source in the culture media triggers PHB accumulation. The culture was then re-gassed with air and CH4 daily for another 3 days and then harvested for PHB analysis.

[0256] After three days of PHB accumulation, the cell cultures were pelleted and freeze-dried overnight using the Thermo Micromodulyo Freeze Dryer (Thermo Scientific, UK). The pellets were transferred to a pre-weighed 2 mL Eppendorf and weighed again. These pellets were then transferred to 16 mm diameter round-bottom screw cap centrifuge tube. In a fume cupboard, 100 pL of 1 mg / mL benzoic acid solution in 1 -propanol was added. This was followed by 4 mL of 25% concentrated hydrochloric acid in 1-propanol. The glass tubes were then heated at 100 °C for two hours. After cooling, 4 mL of deionised water was added, and each tube was vortexed for 30 s to cause phase separation. The top layer was discarded, 4 mL of deionised water was added, and each tube was vortexed again for 30 s. The top layer was discarded for the second time and 1 mL of the bottom layer was transferred into a GC snap vial cap which was analysed on an Agilent 6890 N Series gas chromatograph, equipped with an Agilent 7983 autosampler, an Agilent 5973 MS detector and a J & W DB-wax column (20 m x 0.18 mm, 0.18 mm film thickness). Injection temperature of 250 °C was applied with standard single split insert with a glass wool packing. The oven program following 1 / L injection was as follows: 5 min hold at 60 °C, 20 °C / min to 240 °C, and hold for 6 min. Split injections were made with 10: 1 split ratio. Hydrogen carrier gas with constant flow control was used at 0.6 mL / min. MS analysis was in scanning mode from 40 to 500 m / z produced with El auto ionization, the MS solvent delay was 3 min and no additional voltage was applied to the electron multiplier.

[0257] Example 2 - M. parvus OBBP

[0258] Genomic Analysis of PHB Production and Degradation pathways in M. parvus OBBP

[0259] In this Example 2, a survey of available genomes was carried out followed by sequencing and assembly of an improved genome of the type II methanotroph type strain Methylocystis parvus OBBP, and an investigation into its chromosomal annotation and that of its two mega plasmids. Part of the work in this Example 2 is published in the article Stevens et al., “A Complete Genome of the Alphaproteobacterial Methanotroph Methylocystis parvus OBBP”, Microbiology Resource Announcements 2023, 12(4), eLocator: e00076-23, Pubmed 36951565, herein incorporated by reference. The final genome has been deposited in GenBank under the accessions: CP092968 (chromosome), CP092969 (pMpar-1) and CP092970 (pMpar-2). pMPar-1 and pMPar-2 are the M. parvus OBBP megaplasmids. PacBio, Illumina and Sanger sequencing data and PacBio methylation data has been deposited in the NCBI BioProject PRJNA812408. An incomplete M. parvus OBBP genome at the contig stage is available as assembly GenBank: GCA_000283235. 1, named MetPar_1.0, consisting of 108 contigs, N50- 95,607, L50-18, 4,475,912 bp. However, a gapped genome could lead to issues in editing including missing genes and unintended edits. This previous genome has been heavily used in research including the production of a genome scale model in 2019, so it was herein aimed to update this to a complete genome for the OBBP strain. As an improved genome, sequencing and error checking of the new genome were exhaustive to ensure a complete and reliable reference was achieved. The new assembly was completed de novo using a hybrid PacBio CCS long read, Illumina short read strategy.

[0260] The PacBio CCS (circular consensus sequencing) implementation used here forms single DNA fragments into a loop with adapters then replicates the loop repeatedly with DNA polymerase giving a sequence signal by fluorescent nucleotide incorporation. This gives multiple sequencing “subreads” of each single fragment that are aligned and a consensus formed to give a final extremely high accuracy polished read over lengths of 10-30 kb. This avoids the low accuracy issues generally associated with long read sequencing from a single pass.

[0261] Annotation of the genome was performed using the NCBI Prokaryotic Genome Annotation Pipeline (PGAP) version 6. This resulted in 4,379 annotated genes of which 4,228 were coding, 2 full rRNA gene sets consisting of 5S, 16S and 23 S plus48 tRNAs, 4 ncRNAs and 93 pseudo genes. Annotated genes were split across the contigs 3,923 in the chromosome, 226 pMpar-1, 230 in pMpar-2. Of the annotated genes 702 (17.9%), 59 (26.1%) and 62 (27.0%) were hypothetical proteins respectively.

[0262] PHB depolymerases (PhaZ) are associated with PHB granule surfaces. In vitro PHB depolymerases have been found inactive on non-native PHB granules, native granules that have undergone treatment through chemical means or extraction including freezing and centrifugation. This indicates the PHB depolymerase is either required to complex with other proteins or the PHB becomes inaccessible after treatment e.g. structural changes due to crystallisation. A wide range of PhaZ have been identified with seven (depolymerases PhaZal to PhaZa5, PhaZdl, and PhaZd2) having been identified in C. necator. An additional two proteins PhaZb and PhaZc have been designated oligomer hydrolases in the literature, but their functional difference is unclear. The PHB production pathway from phaABC (alternatively phbABC) (Figure 3A) catalyses the production of PHB or PHAs from Acetyl-CoA. The reverse reaction is initiated by PHB / PHA depolymerase phaZ. The pathway is regulated by the synthesis repressor phaR and phasins. The M. parvus OBBP genome MetPar l .O identifies two PHB synthases phbCI and phbCII, two depolymerases depA and depB, one phaA, phaB, phaR and one phasin. More details required to infer the naming scheme against the genome was not supplied, so typing was carried out where required with locations supplied to aid future work.

[0263] PGAP annotation identified phaBAR in a group (MMG94_18030-18040, Figure 6A) with other genes distributed over the chromosome. Two phaZ (MMG94_06000 and 17300), one phasin (MMG94_16150) and two phasin family proteins (MMG94_03835 and MMG94_16155). One phaC (MMG94_08230) was identified by PGAP and two others (MMG94_15885 and MMG94_15895) were identified as alpha / beta fold hydrolases through InterPro, which assigns this to a phaC protein family group PTHR36837. BLAST searching indicated some homologues of the latter genes have been annotated as phaC others not. A highly divergent PHB depolymerase family esterase was not found in M. parvus OBBP but was found in M. rosea BRCS 1 and GW6, M. trichosporium OB3b, M. bryophillia S285 and M. heteri H2; this was confirmed by BLAST search. phaM an activator of phaC in C. necator was not identified by BLAST.

[0264] A “polyhydroxyalkanoic acid system family protein” MMG94_07210 was identified by PGAP, this had no matches by BLAST (discontiguous megablast) outside of Methylocystis by nucleotide. The annotation appears to draw from protein homology and annotation by Interpro to IPRO 13433. No literature origin of this group could be found but all members are stated to be within the gammaproteobacterial notably Pseudomonas . No further information could be gained but this could be evidence of an HGT event and / or an unidentified regulatory element. The location of the identified PHA associated genes on the M. parvus chromosome are laid out in Figure 6B.

[0265] To better type gene lineages, gene trees were generated for phaZ genes. Sequences were gathered by a combination of BLAST and annotation searching to include all copies within select Methylocystaceae spp. And Cupriavidus necator the model species for PHB production, a-proteobacterialmethanotrophs appear to be within the PHB production class I group along with C. necator. PHB depolymerase family esterases were checked in an initial phaZ tree version but then excluded due to large divergence (6-7 length branches). A highly divergent PHB depolymerase from M. rosea BRCS1 (F7D13_04210), which was also present in M. rosea GW6 and Methylocystis sp. SB2 and SC2, was also excluded with similar branch lengths. phaZ depolymerase genes (Figure 7) formed two clusters herein named phaZa and phaZb (herein alternatively referred to as phaZ and phaZ2, respectively). All Methylocystaceae species had one copy of phaZa and one of phaZb. It is not clear how these correlate with the depA and depB stated by del Cerro et al.. Genes manually annotated in facultative methylotroph Methylohacterium extorquens AM179 as depA and depB both appear to cluster together near the phaZa group. C. necator phaZ clustered separately except for a single gene within phaZb.

[0266] Some additional PHB degradation pathway genes were identified, two 3- hydroxybutyrate (3HB) dehydrogenases (MMG94_09715 and 15170) one of which is closely adjacent to an acetoacetate decarboxylase (MMG94_15175). The 3HB dehydrogenase converts the monomer into acetoacetate with release of reduced NAD. The acetoacetate decarboxylase converts acetoacetate into acetone and CO2 providing an alternative to the Acetoacetyl-CoA synthetase route of degradation illustrated in Figure 3A. Another acetoacetate decarboxylase family protein was identified at MMG94_04030. No Acetoacetyl-CoA synthetase could be readily identified but an “acyl CoA:acetate / 3 -ketoacid CoA transferase” named YdiF by PGAP (MMG94_13125) is a potential candidate. These may be important enzymes to downregulate in redirecting flux to greater PHB accumulation and stopping its degradation. An updated version of Figure 3A illustrating the PHB synthesis and degradation pathway in M. parvus OBBP, with appended genome locations of genes, is presented in Figure 8.

[0267] Identification of non-essentiality of phaZ and phaZ2 genes in M. parvus OBBP

[0268] This section of Example 2 demonstrates the non-essentiality of PhaZ and PhaZ2 in M. parvus OBBP, which enables their genetic deletion for the purposes of PHB production and accumulation according to the invention herein. The non-essentiality of both genes was also established by TraDIS analysis (Figure 1). Part of the work in this chapter was published as part of “In Vivo Genome Editing in Type I and II Methanotrophs Using a CRISPR / Cas9 System” Rumah et al. 2023. Materials and Methods

[0269] The CRISPR system utilised has a fully functioning WT Cas9 nuclease from Streptococcus pyogenes on a single plasmid active in M. parvus OBBP or M. capsulatus Bath. The base plasmid pMTL9BR2-Cas9 is based on the pMTL90882 plasmid, itself produced from the pMTL80451 Clostridium shuttle plasmid. Its assembly was carried as per the Rumah et al. 2023 paper herein referenced. The CRISPR system elements consist of the Cas9 nuclease, an sgRNA consisting of a 150bp handle and 20bp seed region and a homology repair cassette of two 500 or lOOObp left and right arms which may flank an insertion / replacement cargo or with nothing between for a deletion (Figure 9). For use in M. parvus OBBP Cas9 is under the methanol dehydrogenase promoter Pmdh and the sgRNA is under the acetolactate synthase promoter Po / S. Both promoters are native to M. parvus, constitutive and have low expression in E. coll. The sgRNA is replaced, and the homology arms and cargo are inserted, to customise the plasmid for its target.

[0270] Plasmids were assembled by HiFi assembly. HiFi assemblies were designed using assembly primers shown in Table 1, wherein the underlined sequences are the guide RNA spacers. HiFi overlap sizes of 20-50 bp were used during design. HiFi Assembly was performed using NEBuilder HiFi DNA Assembly Master Mix (E2621, NEB).

[0271] Table 1.

[0272] The assembly of the plasmids listed in Table 2 was achieved by one-pot HiFi reaction. Homology arms were produced by PCR of the LHA-F and LHA-R or RHA-F and RHA- R of each target against M. parvus OBBP gDNA. Each target had one pair of 500-bp homology arms designed to produce an in-frame deletion of the coding region. sgRNAs were produced by PCR combining the relevant sgRNA_Fl or F2 with sgRNA_R using pMTL9BR2-Cas9 as the template. The pMTL9BR2-Cas9 backbone was digested with Pad and Asd, antarctic phosphatase treated. Then the sgRNA, digested backbone, homology arms and sgRNA were assembled in a one-pot HiFi reaction and transformed into E. coli NEB 5 -a.

[0273] Table 2. All plasmids also contained RK2 oriV, RP4 oriT, trfA, ColEl oriV, kanR, Cas9, Pmdh, P« / s and tfdx. Plasmids are based on the pMTL9BR2-Cas9 plasmid. Each gene in Table 3 was alternatively targeted by the two plasmids laid out in Table 3, and others, to disrupt PHB degradation in M. parvus OBBP.

[0274] Table 3.

[0275] Introduction of DNA into M. parvus OBBP was performed using RP4 based mobilisation and E. coli S 17-1 Lpir as the donor cell, essentially following the method published in Martin et al., ‘Methane monooxygenase mutants of Methylosinus trichosporium constructed by marker-exchange mutagenesis’, FEMS Microbiology Letters, Volume 127, Issue 3, April 1995, Pages 243-248, doi: 10. 1111 / j . 1574-6968.1995. tb07480.x, herein incorporated by reference. Briefly, plasmids transformed into E. coli S I 7-1 Xpzr were grown overnight and an equivalent volume of an OD600 of 1 at 1 ml was added (Equation 1) to a 1.5-ml centrifuge tube e.g. for a starting OD600 of 2, 0.5ml was used.

[0276] (Equation 1)

[0277] This was washed 3 times with 600 pl NMS to remove residual antibiotics by centrifugation at 6,200g for three minutes. An equivalent volume of an OD600 of 1 at 1ml of methanotroph set up for growth 3-4 days before was added. This was centrifuged as above, resuspended in 50 pl NMS and placed in the middle of a pre-dried mating plate (NMS agar+0.5% yeast extract) and allowed to dry. Plates were incubated with methane at 30 °C for 24 hr. After this time the mating pellet was picked in its entirety using a plastic loop and resuspend in 1 ml of NMS. This was vortexed for 15 seconds to terminate mating. Dilutions were then made and 100 pl spread onto NMS selective plates (NMS agar + nalidixic acid 25 pg / ml + plasmid resistant antibiotic) unless otherwise noted the antibiotic is kanamycin at 50 pg / ml. The plasmid resistant antibiotic selects against non-conjugated methanotrophs, nalidixic acid selects against donor E. coli. Spread plates were incubated with methane and successful transconjugants identified by PCR or miniprep and sequencing. Editing efficiency (EdE) was calculated as the number of successfully edited colonies divided by the total number of successful and WT colonies according to the PCR results. All pairs were tested against M. parvus OBBP gDNA to confirm expected size WT bands were produced.

[0278] Results

[0279] As established experimentally for phaC (Rumah et al. 2023, herein referenced), and by TraDIS for phaABC (Figure 1), the PHB synthesis genes are essential in M. parvus, though this was not identified by the M. parvus genome scale model. This is unusual compared to other strains like C. necator where PHB production has been successfully eliminated. Other genes thought to regulate PHB production were found non-essential and so were targeted. This included the PHA repressor phaR, the annotated phasin phas and two “phasin family proteins” phafl and phaf2. The two phaZ PHA depolymerase genes were found non-essential and were also targeted for KO. Their elimination could act to increase PHB accumulation by stopping its degradation. It is theorised that the non-essentiality of the phaZ genes identified in the TraDIS may be due to gene duplication-based redundancy.

[0280] Plasmids designed against similar targets in M. parvus BRCS2 were used in M. parvus OBBP (Table 3, and other plasmids). These were transformed into S I 7-1 pir and conjugated. One such plasmid (EdE - 40%) produced successful and verified in-frame deletions at the phaZb locus.

[0281] Example 3 - M. trichosporium OB3b

[0282] The same method and strategy of Example 2 above were replicated in this Example 3, in another PHB -accumulating methanotrophic strain, Methylosinus trichosporium OB3b. Figure 10 shows the PHB production results in this strain, which increases across the phaZA (phaZ), phaZB (phaZ2), and phaZA-phaZB genetic deletions. Within the Type II methanotrophs, PHB yields in OB3b are typically lower compared to other methanotrophs like Methylocystis species.

[0283] Sequences M. parvus BRCS2 phaZ gene sequence:

[0284] ATGTATGACGCCTATCAGGCCTATGCCGACTTCATCGATCCGGTCCGTACGGC CGCCGCGAGCAATGAGCGCATCCTGAGCCTTTTCGGGACGATGCAATTCGTCT CGCCGCTTCGGTGCTGGCAAGCCTATCATGAAGTCGTCTCTTTGGCGGGCTTC ACCCATAAGCGGCCGGATTACGGCATTGGCGACATTACGACCGAGGCGGGCG AGACCACGCCCGTCGTCGAGACGCCTGTGACCTCGACGCCCTTCTGCACGCTG CAGCGCTTCTCCCGCGCCGGCGCGAGCGGCGATCCGCGCGTGCTGCTCGTCGC GCCCATGTCCGGCCATTTCGCCACGCTCCTGCGCGGCACGATCCGCACGCTGC

[0285] TGCGCGACCACGAAGTCTATGTCACGGACTGGCGCAACCCGCGAGACATTCC

[0286] GCTCGATCAGGGGAGCTTCGCTTTCGAGGACTTCGTCCAGCACATCATCGACT

[0287] TCCTGAAATTCATGGGACCGCAATCCCATCTCGTCGCCGTCTGCCAGCCGACC

[0288] GTCCCGGCGCTCGTGGCCGTCGCGCTGATGGCGCAGGAGCAAGACCCCGACC

[0289] AGCCCGCGAGCCTCACGCTGATGGCCGGGCCGATCGACGCCCGCGTCTCGCC

[0290] CACGAAAGTGAATGAATTCGCGACCTCGAAGCCCATCGAATGGTTTCGCGAA

[0291] AAAATGATCAGCACCGTCCCGCGCGGCCTGCCCGGCGCGGGACGGCGCGTCT

[0292] ATCCCGGCTTCGTGCAGCTTGCGGCTTTCATGTCGATGAACATCGACCGGCAC

[0293] CGGAAAGCCTTCGCCGATCTCTTCGAGCACAGGGTCAAGGGGGACGACGCCA

[0294] AGGCCGATCAGATCAGGACCTTCTACGAGGAATATTTCGCGATCATGGATCTC

[0295] GACGCGGATTTCTATCTGCACACGATCGAGACGGTCTTCCAGAAATTTGCCCT

[0296] TCCGGAAGGCAATCTGACTTTCAAGGGTCGAAAGGTCGAACCGCGCGCCATC

[0297] AAGAAGACCTTCCTGCTCACGGTCGAAGGCGAGAAGGACGACATCTGCGCCA TCGGCCAGACGCTCGCCGCGCAGGATATTTGCGGCGGGTTACGCCCTTATATG AAATCGCACCATATGCAGGCGGGCGTGGGCCATTACGGCGTCTTCAACGGCA AGCGCTGGGACAGTCAGATCTATCCGGTCGTGCGCGAACATATTCGCTGCAGC

[0298] ATATAG (SEQ ID NO: 28)

[0299] M. parvus BRCS2 phaZ2 gene sequence:

[0300] ATGGACCGTATGTCGTACCACGTATATGAGATGCTGCATCTGGCCTTCGCGCC

[0301] CGCGCGCGCGGCGACCGACGCGCTTCTCCATACGATCAAGAGTCCGCTCAAC

[0302] CCGCTCTACCATACCTCCTTCGGCCGCAGCATCGCCGCCTCGGCGGAACTCTT

[0303] CGAGCGCATGACCCGCCGCTACGGCAAGCCCATATTCGGCCTCGACACGACC

[0304] AAGGTCGACGGCGTCGAGGTGGACATTGTGGAAGAGCATGTCTGGACCAAGC

[0305] CCTTCTGCAGCCTGCTTCACTTCAGCCGGCGATTCGAGGGCGAGGCGTCGCGA CAGTCCAAGCTGCTCATCGTCGCCCCGATGTCGGGCCATTACGCGACCCTGCT GCGCGGCACGGTCGAGGCCTTTCTGCCGTCGCACGACGTCTATGTCACCGACT GGGCCGACGCCAGGACGGTGCCGGTGATCGAAGGCGCTTTCGATCTCGACGA TTATATCGACTATCTCGAAGAGATGCTGCAGCATCTCGCGCAGGACGGGATTC CCGTCCATACGCTCGGCGTCTGTCAAGCTTCCGTGCCGCTGGTCTGCGCCATC GCCGCGATGGAGGCCGCCGACGATCCGGCCGCGCCGGATTCGATGATTCTGA TGGGCGGTCCCATCGATACGCGCGTCAATCCGACAGCGGTGAACAAGCTCGC AGAAAAACGCGGCATCGACTGGTTCCGCCGCCACTGCATCCACACGGTCCCTT TCCCGCACGCCGGCATGGGCCGCGACGTCTATCCCGGCTTTCTGCAGCTTTCC GGCTTCATGGCGATGAATATCGAACGCCATGTCACCGCGCATATGGAGATGTT CAACCATCTCGTCGAGGGCGACGGCGATTCGGCCGAAAAGCATCGCGATTTC TACGACGAATATCTCGCGGTGATGGACCTGACAGCCGAATTCTATCTGCAGAC CGTGGAGCGCGTCTTCATCAAGCATGAAGTGCCGCTGGGTCTGCTGCGCCATC GGGGCGAACTGATCGACCTGAAGAAAATCCGCCGCACGGCGCTGCTGACGGT CGAAGGAGAGAAGGACGATATTTCCGGCGTCGGCCAGACGCTCGCCGCGCAG GAGCTTTGCGCCGGCATTCCCGCCGCCCGCAAATCCCATCACCTTCAGGAGGG CGTCGGCCATTACGGCGTCTTCAACGGCTCGCGCTTCCGCAGGGACATCGCGC CGCGCATCGTGGCCTTTACGCGCGAGATGGAGAAGGTGGAAGCGTAA (SEQ ID NO: 29)

[0306] Methylosinus trichosporium OB3b phaZA gene sequence: ctacacgctgttctggatatggtcgcgcagcaccggatagatctgattgtcccagcgcttgccgttgaacacgccataatggc cgacgcccgcctgcagatgatgtgacttcatatagggccgcagcccgctgcagaggtcctgcgctgcgagcgtctggccg acggcgcaaatatcgtccttctcgccctcgacggtgagcagaaacgtcttcttgatcgcgcgtggcgtcaccgggcgccctt tgaaaagcagcttgcctgcagaaagggcattcttatggaacacggtctcgatcgtctccagatagaagcgcgcgtcgagatc catgatggcgaaatattcctcgtagaaagtgcggatgcggtcggccttctcgtgctcgccttcgacgcgatggcggaacatg tccatgaaagcgttggcgtggcggtcgacgttcatgctcatgaagccggcgatctgcagaaagcccggatagaccttgcgt ccggcgcccggaaggccgcgcggcaccacgccgatcacattgtcgcggaaccattcgatcggcttcgacgtggcgaattc attgaccttggtgggcgcgacgctgatgtcgatcggccccgccatcagcgtgaggctcgcgggctgcgccggatcattgtc ctcggccatcgccgcgacggcggcgagcgcggcgaccgtcggctgacagacggcgacgacatgcgcgggctgcccca gaaaacggatgaaatcgatgagatgctggacgaactcgtccatgccgaacacgcctgcggcgagcggtatgtcgcgcgtg ttgatccaatcggtcacatagacgtcgtggtcctgcagcagcgtgcggatggtgccgcgcagcagcgtcgcgaaatgccc ggacatcggcgcgaccagcagcacgcgcgggagattttcggcgtccttgcgcgagaagcgcagcagcgtggcgaaggg cgtcgcatagacgggctcctcgacgacatcgacgaaggcgccgtcatgcgtggcgatccgatctatgccgtagcacggac gcttatgcgtgaagccgagcagagcgacgagctcgcaataggcctggaagcatcgcgcgggcgacgcataaggcgtgg aggtccacaggcgaagcagtcgttcgccgctggccgccgccagacggagacgattgctcacgtcggcgtagctctgataa gcgtcatacat (SEQ ID NO: 54) Methylosinus trichosporium OB3b phaZB gene sequence: atggatcggctgtcttaccagctctatgagatgatgcatctggccttcgcgccggcgcgcgcgatgtcggacgcaacgctca cgaccttcaccaatccgttcaaccctttcgcgcatacctccgtcggccgcagcgtcgcggcggcggcggaattgttcgagc ggatgacgcgccgttacagcaagccggtcttcggactgaaggagacgacggtcgacggcctcgtcgttccggtcacggaa gaggtgctgtgggagcgcccgttctgccgcctcgtgcatttccggcgccagcgcgcggagggtgcgccgcgccagtcca agctgctgatcgtcgccccgatgtccgggcattttgcgaccttgctgcgcggcacggtcgaggccttcctgccgagccatga cgtctacatcaccgattggtgcaacgcccgcgtcgtcccgaccgagcgcggcgccttcggtctcgacgattacatcgattat ctcatcgagatgatgcgcatcctgtccaagcgcggcgacggcgtgtcgctgcacacgctcggcgtctgccaggcgtcggt gccgctgatctgcgcggtagcggcgctggacggcgagggcggcgtggacgcgcccgaatccatggtgctgatgggcgg gccgatcgatccgcgccgcagcccgaccgcggtcaaccgcctcgccgtcgagcgcggcgtcgactggttccaccgccat tgcatccacaccgtgccgttcccgcacgccgggctcgggcgcagcgtctatccgggctttctgcagctctcgggcttcatgg cgatgaatctcgagcgccatgtcgccgcccatgtggagatgttcaaccatctcgtcgagggcgacggcgattcggcggaaa agcatcgcgatttctatgacgaatatctcgcggtcatggatctcgacgccgacttctatctggagacggtggagaaggtgttc attcgccacgaaatcccgcaaggggagctgcgccatcacggcgagctcatcgatcttacggcgatccagcgcaccgctct gctcacggtcgagggcgagaaggacgatatctccggcgtcggccagacctatgcggcgcaggagctgtgcgccaatattc ccgaggcgcgcaagcaacattatctgcaagagggcgtcggccattacggcgtgttcaacggctcgcgcttccgcaaggag atcgcgccgcgcatcggcgatttcatggcgagggtggagcaggcgggcggctga (SEQ ID NO: 55) pmmoA DNA sequence 1 (SEQ ID NO: 1): atgtcacaatcgaaaagcgggggggcggtcggtccgttcaactccgtggccgaggccgcgggttgcgtcgcgacgacgg actggatgcttctggttctgctgtttttcgccgttctcggcggctaccacgtccacttcatgctgacggcgggcgactgggact tctggattgactggaaggatcgtcgtatgtggccgacggtcgttccgatcctgggcgtgacgttctgcgcggcgtcgcaggc tttctggtgggtcaacttccgtctgccgttcggcgccgttttcgcggctctgggcctgctgattggcgagtggatcaaccgcta cgtcaacttctggggctggacctatttcccgatcagcctggtgttcccgtccgctctgatcgttccggcgatctggcttgacgt gatcctgcttctgtcgggctcctatgtgatcacggcggttgtcggttcgctgggctggggtcttttgttctatccgaacaactgg ccggcgatcgccgccttccaccaggcgacggagcagcatggtcagctgatgacgctggcggatctgatcggccttcacta cgtccgcacgtcgatgccggaatatatccgcatggtcgagcgcggcacgctgcgcaccttcggtaaggacgttgtgccggt tgcggcgttcttctcgggcttcgtctcgatgatggtgtatttcctgtggtggttcatgggccgctggtattcgacgacgaaggtc atcgacaccatctga pmmoA DNA sequence 2 (SEQ ID NO: 2): atgtctctatcgaacgaaacggtcccggccgcaggcaaggcctgggcctcgaaggaagagttcatcggctgcgtgaagct gaccgactggattctgctcctcatcctcttcctggtgctgctcggctccttccacatccactacatgctgctcgccggcgactg ggacttctggatcgacttcaaggatcgccgcatgtggccgaccgtggcgcccatcgtcgccatgtgcttcgccgccgccgc ccagtccttcttctggcagaagttccgcctgcccttcggcgccacggtcgcggtcttcgccctgctcgtcggcgagtggatca accgctacgacaatttctggggttggaccttcttcccgatcaatctggtcttcccttccgcgctgatcccgatgggattctggct cgacatcgtgctgctgctttcgggcagctggacggtgacggcggttgtcggcgcgatgggctggggcctgctcttctatccg agcaattggccggtgctggcgcagtttcatcaggcgaccgaggtcgacggcgtgctgctcacactcgccgatctcatcggc ttcaactacgtccgcacgggcacgcccgaatatatccgcatgatcgagcgcggcacgctgcgcaccttcggtaaggacgtc gttccggtcgcggccttcttctccggcttcgtctcgatgctcgtctacttcctctggtggaaggtcggcggctggttctcgacg accgcctatatcgacaacgaagacgtctga pmmoB DNA sequence 1 (SEQ ID NO: 3): atgaaaaagctagtcaagctcgccgccctcggcgcggcggctgctgtggcggcgacgctcggagcgattgctccggcctc ggcgcacggcgagaagtcgcagcaggcgtttcttcgcatgcgcacgctgaactggtatgacgttgcgtggtcgaagacga cggtgaacgtcaacgaggacatggttctgtcgggcaagattcacgtcttctcggcttggccgcaggcggtcgccaatccgc gcgtgtcgttcctgaacgccggcgagccgggtccggttctggttcgcacggctcagttcatcggcgagcagttcgctcctcg ttcggtgtcgcttgagatcggcaaggactatgcgttctcggtcaatctgcgcggccgtcgcgccggccggtggcacgtcca cgctcagatcaacgtcgaaggcggcggcccgatcatcggccccggccagtggattgagatcaagggcgacatgaaggac ttcaccgatccggtgacgctccttgacggctcgaccgtcgatctcgagcatttcggcatcagccgcgtttacgcgtggcatct gccgtggatggcgattggcgcggcgtggattctgttctggttcgtccggaagggcatcatcgcgtcttatctgaaggttgctg aaggccgtccggacgacgtcatcggcgatgacgaccgccgcattggcgcgatcgttctcgcgctgacgatcctcgcgacg atcatcggctatgcggtgacgaactcgaccttcccgcgcacgatcccgcttcaggccggcttgcagaagccgctgacgccg atcgagacggaaggcacggcgggcgtgggcaaggagcaggtgacgaccgagctgaacggcggcgtctacaaggttcc gggccgcgagctgaccatcaatgtgaaggtcaagaacggcacgtcgcagccggttcgcctcggcgaatacaccgcggct ggcctgcgcttcctgaacccgtccgtgttcaccacgaagcctgacttcccggattacctgcttgccgaccgcggcctgtcga acgacgacacgatcgcgcccggcgagtcgaaggaaatcgtcgtgaagatccaggacgcgcgttgggacattgagcgtct gtccgacctggcttacgacaccgacagccagatcggcggcctgctgttcttcttcacgcccgacggcaagcgcttcgcggc tgaagtcggcggcccggtgattccgaagttcgtcgccggcgacatgccctaa pmmoB DNA sequence 2 (SEQ ID NO: 4): gtgggcttcgccgcagccgtcgcgatgctgacgctctccgctacgccggccgccgcgcatggcgaacgctcgcagcagg ccttccttcggatgcgcacgctgaactggtatgacgtcaaatggtcgaagacgtcgctgaacgtcaatgaagagatggagct gaccggaaaggtccacgtcttctccggctggccgcaggccgtcgcgaagccgcaggaagccttcctcaatgtcggcgagc cgggtccggtcctcatccgcaagagcgcctcggtgggcgaagtgccggtgccgcgcaccttctcgatggatgtcggctatg actatgaatacaagatcggcctgaaggcgcgccgtccggggcggtatcacgtccatgtccagatcaatgtgaaggatggcg gtccgatcgtcggtcccggccagtggatcgagatcaagggcgacatgaaggacttcaccaatccggtgacgctcctcgac ggctcgaccatcgatctcgaaacctacgggatcaactggacatacgcctatcacttcatctggatggcggccgctctcgtctg gatcctctactggttcctgcagaaaggcatcatcgttcgcggctggcaggtcgcggcgggcaaacggcatgagatgatcac gcccaacgacaagcgtttcggggccatctggctcgcggtcgccatgcttgcgctgctgatcttctacgccaacgccaaccgt gaattcccgcgcacgctgcccatgcaggcgggtttgctgaccggcattccgttcctcgaggattcgcgggccgagacggtg tctctccattattcgggcggctcctataaggtgcccggccgcgaattgacgatgaacgtgcagatcacgaacaaaggtcatg agccgctgcgcatcggcgagttcacgaccgccggcctgcgcttcctcaatccggacgtgttcacgacgcgccctgaattcc ccgactatctgatggcggatcgcggcctttcggtgaacgatccgacgccgatcgcgccgggcgagaccaggagcctcgtc atcacggtgcaggatgcgcgcttcgacgtcgagcgcctgtccgacctcgcctacgatacggacagccagttcggcggcct cctcttcctgttcagcccctcgggcaagcgcgagaaggtggaagtcggcggtccggtgatcccgaaattccagcttggcgc gacgctctaa pmmoC DNA sequence 1 (SEQ ID NO: 5): atgagctcgacgactagcgcagctgctggcgcagctgctgaggtagagtccgtagtcgatctgcgtggcatgtggattggc ctggctctgctgaacacgttttatctgatcgtgcgcatttacgagcagatctatggctggcgcgccggccttgattcgttcgcg ccggagttccagacctactggatgtcgatcctttggaccgagatcccgcttgagctggtttcgggccttggcctcgccggcta tctgtggaagacgcgcgaccgcaacgtcgacgcggtttcgccgcgcgaagagatgcgccgcctggtcgttctggtgcagt ggctcgtcgtttacggcatcgccatttactggggcgcgtcgttcttcacggagcaggacggcacctggcacatgacggtgat ccgcgacacggacttcacgccgtcgcacatcatcgagttctacatgagctacccgatttattcggtgatcgcggttggcgcgt tcttctatgcgaagacccgcattccgtatttcgctcatggctactcgctggcgttcctgatcgtggccatcggcccgttcatgat catcccgaacgttggcctgaacgagtggggccacactttctggttcatggaagagctgttcgtggctccgctgcattggggct tcgtgttcttcggctggatggcgctgggcgtgttcggcgtggttctgcagatcctgatgcgcatccatgcgctggtcggcaag gacggcgtcgccctcctcaccgagtaa pmmoC DNA sequence 2 (SEQ ID NO: 6): atgagcatgacaaaaaccggcgccgcgggcgccgcgaaaggcgccgagcggatattggatcgcaaacccctgctcgtcg gcgttttggcgctgacaggcttcgtcgccttcttgcgtttctacgaacagctatttggctggagcgcggggcttgactcgttttc gcccgaatatcagatctattggctcaatctgctcaaagcggccatcgccctcgctttcgccggcgcgggcggactcttcggc tatctctggcgcacgcgcgaccgcaaactggccgcgctctcgcccacggacgagatgcgccggcttctctatctcattcagt ggctcgtcattttcgcgcttgcgctgttttggggcctgagctttttcacggagcagaccgcggtctggcacatgaccgccgttc gcgacacggatttcaccccaagcaacatcgtcaccttttacgcgtcatatccgcttttcgcgattatcggggccggcgccttcc tttacgcgaagacgcgcctgcctctcttcgccaatggctactcgttggctttcctcgtccttgtcgtaggcttgttcatgaccatc ccgaatgtgggcttcaatgaatggggtcatacatcgtggtcgatggatgagggcttcgcgggtccgctgcattggggcttcg tcttcttcggatggatgtcgcttggggtcttcggcgtcgtgctgctgatcctcggccggctgcgggcgcttctcggccctgaa ctcgtcgcagcgttcgccggccgctga pmmoC DNA sequence 3 (SEQ ID NO: 7): atgagtgtctcaacgcaaaccgcggcaggcgcggtcgcctcggaaaagccgatcgtcgatctcaggggaatgtggatcgg gctcgctctgctcaacagcttctatctgctcgtgcgcatttacgagcagatctatggctggcgcgccgggctggattcattcgc tcccgaattccagacctattggatgtcgatcctctggtcggaaattccgctggagctggtctccggcctcgccctcgccggct atctgtggaagacgcgcattcgcgacatgtcgaccgttacgccgcgtcaggaaatgcgcgccatcgtcgacaatgtgaagt ggctcgtcgtctattccgccgcgatctactggggcgcctccttcttcacggagcaggacggcacctggcatatgacggtgat ccgcgacaccgacttcacgccgtcgcacatcatcgaattctatatgagctacccgatctattcggtgctggcgatcggctgct tcttccacgcgaagacgcgcattccctacttctcgaagggttattcgctcgcctatctgatcgtgtcgatcggccccttcatgat catcccgaatgtcggcctcaatgaatggggtcatacgttctggttcatggaagaactcttcgtcgcgccgctgcattggggctt cgtgttcttcggatggatggcgctcggcgtgttcggcgtcgtgctgcagcttctgctgaacgtgcatcgcctggtcggcaag gacggcgtcgcgcttctgacggagtga pmmoC DNA sequence 4 (SEQ ID NO: 8): atgtctctgacaacagacaaagccggagctgcggcgaaagagtcggccgactcgatcgtcaattttcgtcctgcttatctcgc catggctgcgcttgggacgttttacgtcggcatccgcatctatgagcagtatttcggctggaaagccggtctcgattctttcgc gcccgagttccagacctactggctcaacatcatgtggaccgagctgccgctcgaattcatcgccttctgcgcgatcggcggc tatttgtggaagacgcgcgaccgcaacatcaacgccgtcgcgccgcgcgaggaaatgcgtcgcctgatcacgctgatcgg atggctgctcgtctacgccttcaccgtctattggggcgcgagctacttcaccgagcaggacggcacctggcatcagaccgtc atccgcgacacggacttcacgccgagccacattctggagttctacctcagctatccgatctacatcatcgcgggctggggcg ccttcatgtatggccgcacgcgcattccgcaattcgcgaaccggatttcgctggctttcctgctgttcttcgcgggccccttcat gatcttcccgaatgtcggcctgaatgaatggggccacaccttctggttcatggaagagctgttcacggcgccgctgcattgg ggcttcgtcttcttcggctggttcggcctcgccatgttcggcaccgtgctgcagatcctccatcgcgtgatcgagctcagcaa ggagttcgagaaggacatcctcgcgatttaa pmmoC DNA sequence 5 (SEQ ID NO: 9): atgagcatatctacgcagaccgcagtcggcgtggctgatgaagccaagccgatcgtcgacctcaggggcctttggatcgg gctcgcgcttctcaacagcttctatctgctcgtgcgcatttacgagcagatctatggctggcgcgcgggtctcgactccttcgc gccggagttccagacctactggatatcgattctctggaccgaaattcctttggagctggtgtccggcctcgccctcgccggct atctgtggaagacgcgcattcgcgacatgtcgaccgtcacgccgcgccaggaaatgcgcgccatcgtcgacaatgtgaaat ggctcgtcgtctatgcggcggcgatctattggggcgcgtctttctttaccgagcaggacggcacctggcatatgacggtgat ccgcgacacggacttcacgccgtcgcacatcatcgaattctatatgagctacccgatctactcgatcctggcgatcggctgct tcttccatgcgaagacgcggattccctacttctcgaagggctattcgctggcctatctgatcgtctcgatcgggcccttcatgat catcccgaatgtcggcctcaatgaatggggccacaccttctggttcatggaggaactcttcgtcgcgccgctgcattggggct tcgtgttcttcggctggatggccctcggcgtgttcggcgtcgtgctgcagcttctgttgaacgtgcatcgcctgctcggcaag gaaggcgtcgctcttcttaccggcgagtaa pmmoC DNA sequence 6 (SEQ ID NO: 10): atgagctcgacgactagcgcagctgctggcgcagctgctggcgcagctgctgaggtagagtccgtagtcgatctgcgtgg catgtggattggcttggctctgctgaacacgttttatctgatcgtgcgcatttacgagcagatctatggctggcgcgccggcct tgattcgttcgcgccggagttccagacctactggatgtcgatcctttggaccgagatcccgcttgagctggtttcgggccttgg cctcgccggctatctgtggaagacgcgcgaccgcaacgtcgacgcggtttcgccgcgcgaagagatgcgccgcctggtc gttctggtgcagtggctcgtcgtttacggcatcgccatttactggggcgcgtcgttcttcacggagcaggacggcacctggc acatgacggtgattcgcgacacggacttcacgccgtcgcacatcatcgagttctacatgagctacccgatttattcggtgatc gcggttggcgcgttcttctatgcgaagacccgcattccgtatttcgctcatggctactcgctggcgttcctgatcgtggccattg gcccgttcatgatcatcccgaacgttggcctgaacgagtggggccacaccttctggttcatggaagagctgttcgtggctcc gctgcattggggcttcgtgttcttcggctggatggcgctgggcgtgttcggcgtggttctgcagatcctgatgcgcatccatg cgctggtcggcaaggaaggcgtcgccctcctcaccgagtaa

Claims

CLAIMS1. A methanotrophic bacterium, wherein the methanotrophic bacterium is capable of PHB synthesis, and is genetically engineered to reduce or knockout expression of phaZ and / or phaZ2 genes, or orthologues thereof.

2. The methanotrophic bacterium according to claim 1, wherein the methanotrophic bacterium is a type II methanotroph.

3. The methanotrophic bacterium according to claim 1 or 2, wherein the methanotrophic bacterium is of the Methylocystaceae family.

4. The methanotrophic bacterium according to any preceding claim, wherein the methanotrophic bacterium comprises M. parvus.

5. The methanotrophic bacterium according to any of claims 1-3, wherein the methanotrophic bacterium comprises M. trichosporium and the orthologues consist of phaZA and phaZB.

6. The methanotrophic bacterium according to any preceding claim, wherein the genetic engineering of the methanotrophic bacterium results in the increased production of poly- 3-hydroxybutyrate (PHB).

7. The methanotrophic bacterium according to any preceding claim, wherein the expression of phaZ and / or phaZ2 is knocked-out by mutation or silenced by siRNA.

8. Use of the methanotrophic bacterium according to any preceding claim, for the production of PHB, and optionally the consumption of methane or methanol.

9. A method of production of PHB, the method comprising the step of culturing a methanotrophic bacterium according to any preceding claim, wherein the PHB is produced by the methanotrophic bacterium during the culture.

10. The method according to claim 9, further comprising the culturing of the methanotrophic bacterium with methane or methanol.

11. The method according to claim 9 or 10, further comprising cycling at least once between the steps of i) culturing the methanotroph in a nitrogen-containing growth medium, optionally wherein the nitrogen content of the nitrogen-containing medium comprises at least about 0.5 g / L potassium nitrate, and ii) culturing the methanotroph in a nitrogen-free growth medium in the presence of methane gas or methanol.

12. A method of increasing the production of PHB in a methanotroph, the method comprising the step of genetically engineering the methanotroph to express reduced levels of PhaZ and / or PhaZ2, or to express PhaZ and / or PhaZ2 having reduced PHB depolymerase activity.

13. The method of claim 12, wherein the methanotroph is genetically engineered using a CRISPR / Cas9-based genetic engineering system.

14. The method of claim 12, wherein the genetic engineering comprises or consists of genetic knock-out of phaZ and / or phaZ2.

15. The method of claim 12, wherein the genetic engineering comprises or consists of homologous recombination to substitute or delete phaZ and / or phaZ2 genes in whole or in part, or to provide an insert therein.

16. A bioplastic produced by the methanotrophic bacterium according to any of claims 1-7, or produced by any of the methods of claims 9-15.

Images