Eucalyptus plants with improved growth characteristics and methods of making the same
Transgenic expression of GDH, GCL, and TSR in plants creates a photorespiratory bypass to enhance photosynthetic and growth rates, addressing the limitations of the Calvin-Benson cycle and improving water use efficiency.
Patent Information
- Application Number
- PCT/IB2025/060447
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-16
- Filing Date
- 2025-10-14
- Publication Date
- 2026-04-23
AI Technical Summary
The Calvin-Benson cycle in plants is limited by photorespiration, which consumes energy and hampers productivity, especially in hot, dry environments, leading to challenges in enhancing plant growth and water use efficiency.
Introduction of a photorespiratory bypass through transgenic expression of eukaryotic glycolate dehydrogenase (GDH) from green algae or in combination with E. coli glyoxylate carboligase (GCL) and/or tartronic semialdehyde reductase (TSR) in plants, targeting chloroplasts to enhance photosynthetic and growth rates.
Improves photosynthetic rate, growth rate, and water use efficiency in plants by mitigating photorespiration, particularly in challenging environmental conditions.
Smart Images

Figure IB2025060447_23042026_PF_FP_ABST
Abstract
Description
[0001] Attorney Docket No.690229.0025 / 2WO TITLE OF THE INVENTION EUCALYPTUS PLANTS WITH IMPROVED GROWTH CHARACTERISTICS AND METHODS OF MAKING THE SAME CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No.63 / 707,837, filed October 16, 2024, which is incorporated by reference herein in its entirety. STATEMENT REGARDING SEQUENCE LISTING The Sequence Listing associated with this application is provided in XML format, and is hereby incorporated by reference into the specification. The name of the XML file containing the Sequence Listing is “690229.0025 Sequence Listing.” The XML file is 205,167 bytes, was created on October 13, 2025, and is being submitted electronically, concurrent with the filing of the specification. BACKGROUND OF THE INVENTION Technical Field This invention relates generally to the agriculture field, more specifically to polynucleotides that can be introduced into the genome of a plant to improve the photosynthetic rate and / or growth rate and / or water use efficiency of a plant. Description of the Subject Matter The Calvin-Benson cycle, which is responsible for photosynthetic carbon reduction, plays a vital role in carbon fixation within chloroplasts. However, this process faces limitations due to the simultaneous constraints on carboxylation and the regeneration of ribulose-1:5 bisphosphate (RuBP), the acceptor molecule. One of the primary obstacles arises from the oxygenation of RuBP by the enzyme Rubisco which catalyzes the formation of 3-phosphoglycerate (3PGA) and 2-phosphoglycolate (2PG), whereas carboxylation of RuBP forms 2 mol 3PGA. Photorespiration recycles two molecules of 2PG into one molecule of 3PGA; thus, only 25% of organic carbon is lost as CO2 whereas 75% is salvaged and used to synthesize RuBP, refilling the Calvin–Benson cycle. Nonetheless, photorespiration consumes significant energy and hampers overall plant productivity. Photorespiration is enhanced in hot, dry environments when plant cells close the stomata to slow water loss, CO2 is depleted and O2 accumulates. With the increase in global temperatures and extreme temperature incidences, the promotion of photorespiration and the formation of inhibitory compounds (inhibiting photosynthesis pathway for example) pose significant challenges to plant productivity. There exists a problem of finding a strategy to mitigate these challenges and enhance crops, including woody crops, sustainability. BRIEF SUMMARY OF THE INVENTION The invention relates to the introduction of a photorespiratory bypass through the transgenic expression of eukaryotic glycolate dehydrogenase (GDH) from the green algae Chlorella or Chlamydomonas (CxGDH) either by itself or in combination with Escherichia coli (E. coli) glyoxylate carboligase (GCL) (EcGCL) and / or E. coli tartronic semialdehyde reductase (TSR) (EcTSR) in plants, such as Eucalyptus plants. The transgenic expression of CxGDH results in an improved photosynthetic rate and / or growth rate and / or water use efficiency in plants, such as Eucalyptus plants. The invention also relates to methods for introducing or establishing a photorespiratory bypass within the chloroplast. This may be achieved by transferring specific enzymes to the chloroplast through a variety of techniques, including nuclear transformation of plant cells, plant tissues, or plants with the coding sequence of the respective protein operably linked to coding sequence of a chloroplast transit peptide (CTP) or by direct transformation of the chloroplast genome. Promoters driving the expression of the transgenes may be constitutive or regulated by environmental or technical factors. For example, the enzymes GDH, GCL, and TSR may be introduced into plants or plant parts thereof using single plasmid constructs, with each gene being regulated by its own promoter and terminator. Well-established gene integration techniques, such as Agrobacterium-mediated transfer, electroporation, microinjection, or chemical treatment, are applicable. This invention can be applied to any plant or plant part including plant cells and plant tissues. In one non-limiting embodiment, the plant is a dicotyledon plant. In other non-limiting embodiments, the plant is a tree. In other non- limiting embodiments, the plant is a eucalyptus plant. In various embodiments, the present disclosure contemplates, in part, a polynucleotide comprising a nucleotide sequence encoding a Chlorella or Chlamydomonas glycolate dehydrogenase (CxGDH) protein operably linked to a nucleotide sequence encoding a chloroplast transit peptide. In various embodiments, the nucleotide sequence encodes a fusion protein of the CxGDH protein and the chloroplast transit peptide. In some embodiments, the chloroplast transit peptide is derived from a polypeptide from the genus Populus, Arabidopsis, Eucalyptus, or Solanum. In other embodiments, the chloroplast transit peptide is derived from a Solanum tuberosum polypeptide. In some embodiments, the chloroplast transit peptide is derived from a Solanum tuberosum ribulose-1,5-biphosphate carboxylase polypeptide. In further embodiments, the chloroplast transit peptide is an amino acid sequence set forth in any one of SEQ ID NOs: 31, 32, 71, and 72. In some embodiments, the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii. In further embodiments, the CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65. In certain embodiments, the CxGDH protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65. In particular embodiments, the nucleotide sequence encoding a Chlorella or Chlamydomonas glycolate dehydrogenase (CxGDH) protein operably linked to a nucleotide sequence encoding a chloroplast transit peptide encodes an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in any one of SEQ ID NOs: 1 and 66-70. In further embodiments, the nucleotide sequence encoding a Chlorella or Chlamydomonas glycolate dehydrogenase (CxGDH) protein operably linked to a nucleotide sequence encoding a chloroplast transit peptide encodes an amino acid sequence set forth in any one of SEQ ID NOs: 1 and 66-70. In additional embodiments, the polynucleotide further comprises a nucleotide sequence encodes an E. coli glyoxylate carboligase (EcGCL) protein. In certain embodiments, the EcGCL protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NOs: 13 or 15. In certain embodiments, the EcGCL protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 13 or 15. In particular embodiments, the EcGCL protein is operably linked to a chloroplast transit peptide, optionally the chloroplast transit peptide is derived from a polypeptide from the genus Populus, Arabidopsis, Eucalyptus, or Solanum. In other embodiments, the chloroplast transit peptide is derived from a Solanum tuberosum polypeptide. In some embodiments, the chloroplast transit peptide is derived from a Solanum tuberosum ribulose-1,5-biphosphate carboxylase polypeptide. In further embodiments, the chloroplast transit peptide is an amino acid sequence set forth in any one of SEQ ID NOs: 31, 32, 71, and 72. In further embodiments, said nucleotide sequence encoding the EcGCL protein operably linked to a chloroplast transit peptide encodes an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical the sequence set forth in SEQ ID NO: 5. In further embodiments, said nucleotide sequence encoding the EcGCL protein operably linked to a chloroplast transit peptide encodes an amino acid sequence set forth in SEQ ID NO: 5. In additional embodiments, the polynucleotide further comprises a nucleotide sequence encodes an E. coli tartronic semialdehyde reductase (EcTSR) protein. In certain embodiments, said EcTSR protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 17. In certain embodiments, said EcTSR protein comprises an amino acid sequence set forth in SEQ ID NO: 17. In particular embodiments, said nucleotide sequence encoding the EcTSR protein is operably linked to a chloroplast transit peptide, optionally the chloroplast transit peptide is derived from a polypeptide from the genus Populus, Arabidopsis, Eucalyptus, or Solanum. In other embodiments, the chloroplast transit peptide is derived from a Solanum tuberosum polypeptide. In some embodiments, the chloroplast transit peptide is derived from a Solanum tuberosum ribulose-1,5-biphosphate carboxylase polypeptide. In further embodiments, the chloroplast transit peptide is an amino acid sequence set forth in any one of SEQ ID NOs: 31, 32, 71, and 72. In further embodiments, said nucleotide sequence encoding the EcTSR protein operably linked to a chloroplast transit peptide encodes an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 3. In further embodiments, said nucleotide sequence encoding the EcTSR protein operably linked to a chloroplast transit peptide encodes an amino acid sequence set forth in SEQ ID NO: 3. In additional embodiments, the polynucleotide comprises: one or more promoters, operably linked to said CxGDH protein, said EcGCL protein, and / or said EcTSR protein; a nucleotide sequence encoding one or more chloroplast transit peptides, operably linked to said CxGDH protein, EcGCL protein, and / or said EcTSR protein; and / or one or more terminators operably linked to said CxGDH protein, said EcGCL protein, and / or said EcTSR protein. In some embodiments, the one or more promoters can be a constitutive promoter. In further embodiments the one or more promoters is a CaMV35S, MSgt-CaVMV, CaMV19S, sgFiMV, SVBV, FMV34S, sugarcane bacilliform badnavirus promoter, CsVMV promoter, Arabidopsis ACT2 / ACT8 actin promoter, Arabidopsis ubiquitin UBQ1 promoter, barley leaf thionin BTH6 promoter, rice actin promoter, GOS2, Rice cyclophilin, and / or Maize H3 histone. In other embodiments, the one or more promoters can be a tissue-specific promoter. In further embodiments the one or more promoters is derived from a tissue, including leaf tissue, stem tissue, and photosynthetic tissue. In certain embodiments the one or more promoters is a RbcS promoter. In particular embodiments, the one or more promoters is a CaMV35S promoter and / or a MSgt-CaVMV promoter; and / or the one or more terminators is a NOS terminator, a 3A terminator, and / or a UBQ3 terminator. In some embodiments, one or more of the nucleotide sequences encoding the CxGDH protein, the nucleotide sequence encoding the EcGCL protein, and the nucleotide sequence encoding the EcTSR protein is operably linked to one or more nucleotide sequences encoding a CaMV35S promoter and / or a MSgt-CaVMV promoter, a NOS terminator, a 3A terminator, and / or a UBQ3 terminator. In certain embodiments, the polynucleotide encodes from 5’ to 3’: a CaMV35S promoter; a chloroplast transit peptide; a CxGDH protein; a NOS terminator; a MSgt- CaVMV promoter or a CaMV35S promoter; a chloroplast transit peptide; a EcGCL protein; a 3A terminator; a CaMV35S promoter; a chloroplast transit peptide; a EcTSR protein; and a UBQ3 terminator. In certain embodiments, the polynucleotide comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NOs: 36 or 37. In certain embodiments, the polynucleotide comprises a sequence set forth in SEQ ID NOs: 36 or 37. In further embodiments, the polynucleotide comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 40. In further embodiments the polynucleotide comprises a sequence set forth in SEQ ID NO: 40. In various embodiments, the present disclosure contemplates, in part, a method for improving the photosynthetic rate and / or growth rate and / or water use efficiency of a plant comprising introducing the polynucleotide contemplated herein into a cell of said plant. In further embodiments, the protein(s) expressed from the polynucleotide is targeted to chloroplasts of the plant produced. In various embodiments, the present disclosure contemplates, in part, a method for improving the photosynthetic rate and / or growth rate and / or water use efficiency of a plant comprising introducing a polynucleotide comprising a nucleotide sequence encoding a CxGDH protein into a cell of said plant, wherein said protein is targeted to chloroplasts of the cell of said plant. In further embodiments, the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii. In further embodiments, the CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65. In certain embodiments, the plant is a tree. In particular embodiments, the tree is Eucalyptus (Eucalyptus spp)., Pine (Pinus spp.), Poplar (Populus spp.), Spruce (Picea spp.), Birch (Betula spp.), Acacia (Acacia spp.), Beech (Fagus sylvatica), Oak (Quercus spp.), Willow (Salix spp.), Aspen (Populus tremula), Bamboo (Woody Grass) (Bambusoideae spp.), Douglas Fir (Pseudotsuga menziesii), Hemlock (Tsuga spp.), Sweetgum (Liquidambar styraciflua), Maple (Acer spp.), Alder (Alnus spp.), Larch (Larix spp.), Teak (Tectona grandis), Rubber Tree (Hevea brasiliensis), Paulownia (Paulownia spp.), Balsa (Ochroma pyramidale), Cedar (Cedrus spp.), Mahogany (Swietenia spp.), Chestnut (Castanea spp.), or Kapok (Ceiba pentandra). As used herein, Eucalyptus includes Eucalyptus species and hybrids thereof, including: Eucalyptus alba, Eucalyptus bancroftii, Eucalyptus botryoides, Eucalyptus bridgesiana, Eucalyptus calophylla, Eucalyptus camaldulensis, Eucalyptus citriodora, Eucalyptus cladocalyx, Eucalyptus coccifera, Eucalyptus curtisii, Eucalyptus dalrympleana, Eucalyptus deglupta, Eucalyptus delagatensis, Eucalyptus diversicolor, Eucalyptus dunnii, Eucalyptus ficifolia, Eucalyptus globulus, Eucalyptus gomphocephala, Eucalyptus grandis, Eucalyptus gunnii, Eucalyptus henryi, Eucalyptus laevopinea, Eucalyptus macarthurii, Eucalyptus macrorhyncha, Eucalyptus maculata, Eucalyptus marginata, Eucalyptus megacarpa, Eucalyptus melliodora, Eucalyptus nicholii, Eucalyptus nitens, Eucalyptus nova- angelica, Eucalyptus obliqua, Eucalyptus occidentalis Eucalyptus obtusiflora, Eucalyptus oreades, Eucalyptus pauciflora, Eucalyptus polybractea, Eucalyptus regnans, Eucalyptus resinifera, Eucalyptus robusta, Eucalyptus rudis, Eucalyptus saligna, Eucalyptus sideroxylon, Eucalyptus stuartiana, Eucalyptus tereticornis, Eucalyptus torelliana, Eucalyptus urnigera, Eucalyptus urophylla, Eucalyptus viminalis, Eucalyptus viridis, Eucalyptus wandoo, Eucalyptus youmanni, and hybrids thereof. In particular embodiments, the plant is a eucalyptus plant. In further embodiments, the plant is a Eucalyptus grandis x urophylla hybrid plant. In various embodiments, the present disclosure contemplates, in part, a method of generating a transgenic plant comprising introducing the polynucleotide contemplated herein into a cell of said plant. In various embodiments, the present disclosure contemplates, in part, a method of generating a transgenic plant comprising introducing a polynucleotide comprising a nucleotide encoding a CxGDH protein into a cell of said plant, wherein said CxGDH protein is targeted to chloroplasts of the plant produced. In certain embodiments, the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii. In further embodiments, the CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65. In certain embodiments, the transgenic plant is a dicotyledonous plant. In particular embodiments, the transgenic plant is a tree. In particular embodiments, the tree is Eucalyptus (Eucalyptus spp)., Pine (Pinus spp.), Poplar (Populus spp.), Spruce (Picea spp.), Birch (Betula spp.), Acacia (Acacia spp.), Beech (Fagus sylvatica), Oak (Quercus spp.), Willow (Salix spp.), Aspen (Populus tremula), Bamboo (Woody Grass) (Bambusoideae spp.), Douglas Fir (Pseudotsuga menziesii), Hemlock (Tsuga spp.), Sweetgum (Liquidambar styraciflua), Maple (Acer spp.), Alder (Alnus spp.), Larch (Larix spp.), Teak (Tectona grandis), Rubber Tree (Hevea brasiliensis), Paulownia (Paulownia spp.), Balsa (Ochroma pyramidale), Cedar (Cedrus spp.), Mahogany (Swietenia spp.), Chestnut (Castanea spp.), or Kapok (Ceiba pentandra). As used herein, Eucalyptus includes Eucalyptus species and its hybrids including: Eucalyptus alba, Eucalyptus bancroftii, Eucalyptus botryoides, Eucalyptus bridgesiana, Eucalyptus calophylla, Eucalyptus camaldulensis, Eucalyptus citriodora, Eucalyptus cladocalyx, Eucalyptus coccifera, Eucalyptus curtisii, Eucalyptus dalrympleana, Eucalyptus deglupta, Eucalyptus delagatensis, Eucalyptus diversicolor, Eucalyptus dunnii, Eucalyptus ficifolia, Eucalyptus globulus, Eucalyptus gomphocephala, Eucalyptus grandis, Eucalyptus gunnii, Eucalyptus henryi, Eucalyptus laevopinea, Eucalyptus macarthurii, Eucalyptus macrorhyncha, Eucalyptus maculata, Eucalyptus marginata, Eucalyptus megacarpa, Eucalyptus melliodora, Eucalyptus nicholii, Eucalyptus nitens, Eucalyptus nova-angelica, Eucalyptus obliqua, Eucalyptus occidentalis Eucalyptus obtusiflora, Eucalyptus oreades, Eucalyptus pauciflora, Eucalyptus polybractea, Eucalyptus regnans, Eucalyptus resinifera, Eucalyptus robusta, Eucalyptus rudis, Eucalyptus saligna, Eucalyptus sideroxylon, Eucalyptus stuartiana, Eucalyptus tereticornis, Eucalyptus torelliana, Eucalyptus urnigera, Eucalyptus urophylla, Eucalyptus viminalis, Eucalyptus viridis, Eucalyptus wandoo, Eucalyptus youmanni, and hybrids thereof. In additional embodiments, the transgenic plant is a eucalyptus plant. In further embodiments, the transgenic plant is a Eucalyptus grandis x urophylla hybrid plant. In various embodiments, the present disclosure contemplates, in part, a genetically modified plant or part thereof comprising the polynucleotide contemplated herein. In various embodiments, the present disclosure contemplates, in part, a genetically modified plant or part thereof comprising a CxGDH protein expressed in the chloroplasts of said modified plant or part thereof. In further embodiments, the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii. In further embodiments, the CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65. In further embodiments, the genetically modified plant or part thereof has an increased photosynthetic rate as compared to a control plant. In further embodiments, the genetically modified plant or part thereof has an increased growth rate as compared to a control plant, optionally the genetically modified plant or part thereof has an increased height as compared to a same aged control plant. In another further embodiment, the genetically modified plant has an increased water use efficiency as compared to a control plant. In particular embodiments, the plant is a dicotyledonous plant. In particular embodiments, the plant is a tree. In particular embodiments, the tree is Eucalyptus (Eucalyptus spp)., Pine (Pinus spp.), Poplar (Populus spp.), Spruce (Picea spp.), Birch (Betula spp.), Acacia (Acacia spp.), Beech (Fagus sylvatica), Oak (Quercus spp.), Willow (Salix spp.), Aspen (Populus tremula), Bamboo (Woody Grass) (Bambusoideae spp.), Douglas Fir (Pseudotsuga menziesii), Hemlock (Tsuga spp.), Sweetgum (Liquidambar styraciflua), Maple (Acer spp.), Alder (Alnus spp.), Larch (Larix spp.), Teak (Tectona grandis), Rubber Tree (Hevea brasiliensis), Paulownia (Paulownia spp.), Balsa (Ochroma pyramidale), Cedar (Cedrus spp.), Mahogany (Swietenia spp.), Chestnut (Castanea spp.), or Kapok (Ceiba pentandra). As used herein, Eucalyptus includes Eucalyptus species and hybrids thereof, including: Eucalyptus alba, Eucalyptus bancroftii, Eucalyptus botryoides, Eucalyptus bridgesiana, Eucalyptus calophylla, Eucalyptus camaldulensis, Eucalyptus citriodora, Eucalyptus cladocalyx, Eucalyptus coccifera, Eucalyptus curtisii, Eucalyptus dalrympleana, Eucalyptus deglupta, Eucalyptus delagatensis, Eucalyptus diversicolor, Eucalyptus dunnii, Eucalyptus ficifolia, Eucalyptus globulus, Eucalyptus gomphocephala, Eucalyptus grandis, Eucalyptus gunnii, Eucalyptus henryi, Eucalyptus laevopinea, Eucalyptus macarthurii, Eucalyptus macrorhyncha, Eucalyptus maculata, Eucalyptus marginata, Eucalyptus megacarpa, Eucalyptus melliodora, Eucalyptus nicholii, Eucalyptus nitens, Eucalyptus nova-angelica, Eucalyptus obliqua, Eucalyptus occidentalis Eucalyptus obtusiflora, Eucalyptus oreades, Eucalyptus pauciflora, Eucalyptus polybractea, Eucalyptus regnans, Eucalyptus resinifera, Eucalyptus robusta, Eucalyptus rudis, Eucalyptus saligna, Eucalyptus sideroxylon, Eucalyptus stuartiana, Eucalyptus tereticornis, Eucalyptus torelliana, Eucalyptus urnigera, Eucalyptus urophylla, Eucalyptus viminalis, Eucalyptus viridis, Eucalyptus wandoo, Eucalyptus youmanni, and hybrids thereof. In particular embodiments, the plant is eucalyptus. In further embodiments, the plant is a Eucalyptus grandis x urophylla hybrid plant. In various embodiments, the present disclosure contemplates, in part, a fusion polypeptide comprising a CxGDH protein and a chloroplast transit peptide. In further embodiments, the chloroplast transit peptide is derived from a polypeptide from the genus Populus, Arabidopsis, Eucalyptus, or Solanum. In other embodiments, the chloroplast transit peptide is derived from a Solanum tuberosum polypeptide. In some embodiments, the chloroplast transit peptide is derived from a Solanum tuberosum ribulose-1,5-biphosphate carboxylase polypeptide. In further embodiments, the chloroplast transit peptide is an amino acid sequence set forth in any one of SEQ ID NOs: 31, 32, 71, and 72. In further embodiments, the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii. In certain embodiments, the CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65. In certain embodiments, the fusion polypeptide, comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 1 and 66-70. In further embodiments, the present disclosure contemplates, in part, a genetically modified plant or part thereof comprising the fusion polypeptide. In additional embodiments, the genetically modified plant or part thereof further comprises an EcGCL protein or a fusion polypeptide comprising an EcGCL protein and a chloroplast transit peptide. In particular embodiments, the EcGCL protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in any one of SEQ ID NOs: 5, 13, or 15. In particular embodiments, the EcGCL protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 5, 13, or 15. In additional embodiments the genetically modified plant or part thereof, further comprises an EcTSR protein or a fusion polypeptide comprising an EcTSR protein and a chloroplast transit peptide. In particular embodiments, the EcTSR protein comprises the amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NOs: 3 or 17. In particular embodiments, the EcTSR protein comprises an amino acid sequence set forth in SEQ ID NOs: 3 or 17. In some embodiments, the genetically modified plant or part thereof, comprises an amino acid sequence set forth in SEQ ID NO: 1 and / or an amino acid sequence set forth in SEQ ID NO:3 and / or an amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the genetically modified plant part is pulp. In various embodiments, the present disclosure contemplates, in part, a processed material comprising pulp from a genetically modified plant comprising the polynucleotide contemplated herein. In further embodiments, the processed material comprising pulp is paper. In other embodiments, the present disclosure contemplates, in part, a product comprising pulp made by the process comprising the steps of: introducing the polynucleotide contemplated herein into a cell of a plant; generating a transgenic plant; growing said transgenic plant; and harvesting pulp from said transgenic plant. In certain embodiments, the cell is from a dicotyledonous plant. In particular embodiments, the cell is from a tree and in further embodiments, the tree is Eucalyptus (Eucalyptus spp)., Pine (Pinus spp.), Poplar (Populus spp.), Spruce (Picea spp.), Birch (Betula spp.), Acacia (Acacia spp.), Beech (Fagus sylvatica), Oak (Quercus spp.), Willow (Salix spp.), Aspen (Populus tremula), Bamboo (Woody Grass) (Bambusoideae spp.), Douglas Fir (Pseudotsuga menziesii), Hemlock (Tsuga spp.), Sweetgum (Liquidambar styraciflua), Maple (Acer spp.), Alder (Alnus spp.), Larch (Larix spp.), Teak (Tectona grandis), Rubber Tree (Hevea brasiliensis), Paulownia (Paulownia spp.), Balsa (Ochroma pyramidale), Cedar (Cedrus spp.), Mahogany (Swietenia spp.), Chestnut (Castanea spp.), or Kapok (Ceiba pentandra). As used herein, Eucalyptus includes Eucalyptus species and its hybrids including: Eucalyptus alba, Eucalyptus bancroftii, Eucalyptus botryoides, Eucalyptus bridgesiana, Eucalyptus calophylla, Eucalyptus camaldulensis, Eucalyptus citriodora, Eucalyptus cladocalyx, Eucalyptus coccifera, Eucalyptus curtisii, Eucalyptus dalrympleana, Eucalyptus deglupta, Eucalyptus delagatensis, Eucalyptus diversicolor, Eucalyptus dunnii, Eucalyptus ficifolia, Eucalyptus globulus, Eucalyptus gomphocephala, Eucalyptus grandis, Eucalyptus gunnii, Eucalyptus henryi, Eucalyptus laevopinea, Eucalyptus macarthurii, Eucalyptus macrorhyncha, Eucalyptus maculata, Eucalyptus marginata, Eucalyptus megacarpa, Eucalyptus melliodora, Eucalyptus nicholii, Eucalyptus nitens, Eucalyptus nova-angelica, Eucalyptus obliqua, Eucalyptus occidentalis Eucalyptus obtusiflora, Eucalyptus oreades, Eucalyptus pauciflora, Eucalyptus polybractea, Eucalyptus regnans, Eucalyptus resinifera, Eucalyptus robusta, Eucalyptus rudis, Eucalyptus saligna, Eucalyptus sideroxylon, Eucalyptus stuartiana, Eucalyptus tereticornis, Eucalyptus torelliana, Eucalyptus urnigera, Eucalyptus urophylla, Eucalyptus viminalis, Eucalyptus viridis, Eucalyptus wandoo, Eucalyptus youmanni, and hybrids thereof. In additional embodiments, the cell is from a eucalyptus plant. In further embodiments, the cell is from a Eucalyptus grandis x urophylla hybrid plant. BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention. FIG. 1: Schematic of Construct 1, Construct 2, Construct 3, Construct 4, and Construct 5 (also referred to as cassette number 1, cassette number 2, cassette number 3, cassette number 4, and cassette number 5, respectively). FIG.2A: RT-PCR results, RNA transcription levels in transgenic plants containing cassette number 3: EcGDH + EcGCL + EcTSR. FIG.2B: RT-PCR results, RNA transcription levels in transgenic plants containing cassette number 2: CvGDH + EcGCL + EcTSR. FIG.3: Leaf selection fully expanded leaves of similar size from the lower third of the upper canopy (white arrow). Typically leaf number 3 or 4 is from the branch tip (black arrow). FIG.4: Construct 1 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and wild- type (WT) height. FIG. 5: Construct 1 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT growth rate. FIG. 6: Construct 1 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT photosynthetic rate curve. FIG.7: The maximum rate of Rubisco carboxylation (Vcmax) of Construct 1 events in comparison to WT plants. FIG. 8: Construct 1 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT transpiration rate. FIG. 9: Construct 1 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT Water use efficiency (WUE). FIG.10: Construct 2 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT height. FIG.11: Construct 2 (CvGDH_EcGCL_EcTSR) 64A Eucalyptus Tg event vs WT plant height. FIG.12: Construct 2 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT growth rate. FIG.13: Construct 2 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT photosynthetic rate curve. FIG.14: Construct 2 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT Maximum assimilation rate (Amax) rates. FIG.15: Construct 2 (CvGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT water use efficiency. FIG. 16: Construct 3 (EcGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT height. FIG. 17: Construct 3 (EcGDH_EcGCL_EcTSR) Eucalyptus Tg events and WT photosynthetic rate curve. FIG.18: Construct 4 (EcGDH) eucalyptus Tg events and WT height. FIG.19: Construct 4 (EcGDH) eucalyptus Tg events and WT photosynthetic rate curve. BRIEF DESCRIPTION OF THE SEQUENCE IDENTIFIERS SEQ ID NO: 1 is an amino acid sequence of a fused StRbcS Chloroplast Transit Peptide (CTP) and a truncated CvGDH. SEQ ID NO: 2 is a nucleotide sequence of a fused StRbcS CTP and CvGDH (codon optimized). SEQ ID NO: 3 is an amino acid sequence of a fused StRbcS CTP and EcTSR. SEQ ID NO: 4 is a nucleotide sequence of a fused StRbcS CTP and EcTSR (codon optimized). SEQ ID NO: 5 is an amino acid sequence of a fused StRbcS CTP and EcGCL. SEQ ID NO: 6 is a nucleotide sequence of a fused StRbcS CTP and EcGCL (codon optimized). SEQ ID NO: 7 is an amino acid sequence of a fused StRbcS CTP: E. coli glcD_glcE_glcF fused w / (Gly4Ser)3 linkers. SEQ ID NO: 8 is a nucleotide sequence of a fused StRbcS CTP: E. coli glcD_glcE_glcF fused w / (Gly4Ser)3 linkers. SEQ ID NO: 9 is an amino acid sequence of a Chlorella variabilis GDH (Uniprot E1Z356). SEQ ID NO: 10 is a nucleotide sequence of a Chlorella variabilis GDH E1Z356 coding sequence. SEQ ID NO: 11 is a truncated amino acid sequence of a Chlorella variabilis GDH E1Z356. SEQ ID NO: 12 is a truncated nucleotide Chlorella variabilis GDH E1Z356 coding sequence optimized. SEQ ID NO: 13 is an amino acid sequence of glyoxylate carboligase Uniprot A0A0H2YWH4 (native). SEQ ID NO: 14 is a nucleotide sequence of a glyoxylate carboligase Uniprot A0A0H2YWH4 coding sequence (native) SEQ ID NO: 15 is an amino acid sequence of a glyoxylate carboligase Uniprot P0AEP7 (native). SEQ ID NO: 16 is a nucleotide sequence of a glyoxylate carboligase P0AEP7 coding sequence optimized. SEQ ID NO: 17 is an amino acid sequence of a EcTSR (Uniprot P77161). SEQ ID NO: 18 is a nucleotide sequence of a EcTSR (Uniprot P77161) optimized coding sequence. SEQ ID NO: 19 is a nucleotide sequence of a EcTSR (Uniprot P77161) coding sequence. SEQ ID NO: 20 is an amino acid sequence of a E. coli glcD (Uniprot P0AEP9). SEQ ID NO: 21 is a nucleotide sequence of a E. coli glcD (Uniprot P0AEP9). SEQ ID NO: 22 is a nucleotide sequence of a E. coli glcD (Uniprot P0AEP9) coding sequence optimized. SEQ ID NO: 23 is an amino acid sequence of a E. coli glcE (Uniprot P52073). SEQ ID NO: 24 is a nucleotide sequence of a E. coli glcE (Uniprot P52073) coding sequence. SEQ ID NO: 25 is a nucleotide sequence of a E. coli glcE (Uniprot P52073) coding sequence optimized. SEQ ID NO: 26 is an amino acid sequence of a E. coli glcF (Uniprot P52074). SEQ ID NO: 27 is a nucleotide sequence of a E. coli glcF (Uniprot P52074) coding sequence. SEQ ID NO: 28 is a truncated amino acid sequence of a E. coli glcF (Uniprot P52074). SEQ ID NO: 29 is a truncated nucleotide sequence of a E. coli glcF (Uniprot P52074) coding sequence optimized. SEQ ID NO: 30 is a nucleotide sequence of a E. coli glcD_glcE_glcF fused w / (Gly4Ser)3 linkers. SEQ ID NO: 31 is an amino acid sequence of a RuBisCO small subunit Solanum tuberosum. SEQ ID NO: 32 is an amino acid sequence of a RuBisCo small subunit CTP (RbcS1;Eucgr.J01502.2). SEQ ID NO: 33 is a nucleotide sequence of a 35S promoter. SEQ ID NO: 34 is a nucleotide sequence of a Eucalyptus Eucgr.J01502.2 RuBisCo promoter. SEQ ID NO: 35 is a nucleotide sequence of a Promoter MSgt-CaVMV. SEQ ID NO: 36 is a nucleotide sequence of construct 1 SEQ ID NO: 37 is a nucleotide sequence of construct 2 SEQ ID NO: 38 is a nucleotide sequence of construct 3 SEQ ID NO: 39 is a nucleotide sequence of construct 4 FusedEcGDH. SEQ ID NO: 40 is a nucleotide sequence of construct 5 CvGDH. SEQ ID NO: 41 is a nucleotide sequence of a Chlorella GDH PCR forward primer. SEQ ID NO: 42 is a nucleotide sequence of a Chlorella GDH PCR reverse primer. SEQ ID NO: 43 is a nucleotide sequence of a glcE forward primer. SEQ ID NO: 44 is a nucleotide sequence of a glcE reverse primer. SEQ ID NO: 45 is a nucleotide sequence of a glcF forward primer. SEQ ID NO: 46 is a nucleotide sequence of a glcF reverse primer. SEQ ID NO: 47 is a nucleotide sequence of a EcGCL forward primer (constructs 3&6). SEQ ID NO: 48 is a nucleotide sequence of a EcGCL reverse primer (constructs 3&6). SEQ ID NO: 49 is a nucleotide sequence of a EcGCL forward primer (constructs 1,2,4,5). SEQ ID NO: 50 is a nucleotide sequence of a EcGCL reverse primer (constructs 1,2,4,5). SEQ ID NO: 51 is a nucleotide sequence of a EcTSR forward primer. SEQ ID NO: 52 is a nucleotide sequence of a EcTSR reverse primer. SEQ ID NO: 53 is a nucleotide sequence of a Chlorella GDH RT-PCR forward primer. SEQ ID NO: 54 is a nucleotide sequence of a Chlorella GDH RT-PCR reverse primer. SEQ ID NO: 55 is a nucleotide sequence of a EucActin forward primer. SEQ ID NO: 56 is a nucleotide sequence of a EucActin reverse primer. SEQ ID NO: 57 is an amino acid sequence of a Chlorella sorokiniana GDH protein. SEQ ID NO: 58 is an amino acid sequence of a Chlorella vulgaris GDH protein. SEQ ID NO: 59 is an amino acid sequence of a Chlorella ohadii GDH protein. SEQ ID NO: 60 is an amino acid sequence of a Chlorella desiccata (nom. nud.) GDH protein. SEQ ID NO: 61 is a truncated amino acid sequence of a Chlamydomonas reinhardtii GDH protein. SEQ ID NO: 62 is an amino acid sequence of a Chlorella sorokiniana GDH protein truncated. SEQ ID NO: 63 is an amino acid sequence of a Chlorella vulgaris GDH protein truncated. SEQ ID NO: 64 is an amino acid sequence of a Chlorella ohadii GDH protein truncated. SEQ ID NO: 65 is an amino acid sequence of a Chlorella desiccata (nom. nud.) GDH protein truncated. SEQ ID NO: 66 is a truncated amino acid sequence of Chlorella sorokiniana GDH protein fused to StRbcS Chloroplast Transit Peptide (CTP). SEQ ID NO: 67 is a truncated amino acid sequence of Chlorella vulgaris GDH protein fused to StRbcS Chloroplast Transit Peptide (CTP). SEQ ID NO: 68 is a truncated amino acid sequence of Chlorella ohadii GDH protein fused to StRbcS Chloroplast Transit Peptide (CTP). SEQ ID NO: 69 is a truncated amino acid sequence of Chlorella desiccata (nom. nud.) GDH protein fused to StRbcS Chloroplast Transit Peptide (CTP). SEQ ID NO: 70 is a truncated amino acid sequence of Chlamydomonas reinhardtii GDH protein fused to StRbcS Chloroplast Transit Peptide (CTP). SEQ ID NO: 71 is an amino acid sequence of an Arabidopsis Chloroplast Transit Peptide (CTP) (P10798). SEQ ID NO: 72 is an amino acid sequence of a Poplar Chloroplast Transit Peptide (CTP) (A0A8T2WUD8). SEQ ID NO: 73 is a nucleotide sequence of a NOS terminator. SEQ ID NO: 74 is an amino acid sequence of Chlamydomonas reinhardtii GDH protein. SEQ ID NO: 75 is a nucleotide sequence of a Lignotuber forward primer. SEQ ID NO: 76 is nucleotide sequence of a Lignotuber reverse primer. SEQ ID NO: 77 is a nucleotide sequence of a Lignotuber probe. SEQ ID NO: 78 is a nucleotide sequence of a NPTII forward primer. SEQ ID NO: 79 is a nucleotide sequence of a NPTII reverse primer. SEQ ID NO: 80 is a nucleotide sequence of a NPTII probe. SEQ ID NO: 81 is a nucleotide sequence of a Agro forward primer. SEQ ID NO: 82 is a nucleotide sequence of a Agro reverse primer. SEQ ID NO: 83 is a nucleotide sequence of a Agro probe. SEQ ID NO: 84 is a nucleotide sequence of a CvGDH reverse primer. SEQ ID NO: 85 is a nucleotide sequence of a CvGDH probe. SEQ ID NO: 86 is a nucleotide sequence of a GCL reverse primer. SEQ ID NO: 87 is a nucleotide sequence of a GCL probe. SEQ ID NO: 88 is a nucleotide sequence of a TSR forward primer. SEQ ID NO: 89 is a nucleotide sequence of a TSR reverse primer. SEQ ID NO: 90 is a nucleotide sequence of a TSR probe. SEQ ID NO: 91 is a nucleotide sequence of a RuBisCO small subunit Solanum tuberosum. SEQ ID NO: 92 is a nucleotide sequence of a Rubisco small subunit CTP (RbcS1;Eucgr.J01502.2). SEQ ID NO: 93 is a nucleotide sequence encoding Chlorella sorokiniana GDH protein. SEQ ID NO: 94 is a nucleotide sequence encoding Chlorella vulgaris GDH protein. SEQ ID NO: 95 is a nucleotide sequence encoding Chlorella ohadii GDH protein. SEQ ID NO: 96 is a nucleotide sequence encoding Chlorella desiccata (nom. nud.) GDH protein. SEQ ID NO: 97 is a nucleotide sequence of Arabidopsis CTP - P10798. SEQ ID NO: 98 is a nucleotide sequence of Poplar CTP - A0A8T2WUD8. SEQ ID NO: 99 is a nucleotide sequence encoding Chlamydomonas reinhardtii GDH protein. DETAILED DESCRIPTION OF THE INVENTION The present invention may be understood more readily by reference to the following detailed description of preferred embodiments of the invention and the Examples included therein and to the Figures and their previous and following description. Such description is intended to be illustrative and not limiting with respect to the scope of the present invention. It will be understood that other embodiments may be practiced with some variations without departing from the spirit or scope of the subject invention. Overview The present disclosure generally relates to, in part, enhanced photosynthetic performance, such as an increase in photosynthetic rate; increase CO2 fixation rates, such as increase carboxylation, carbon assimilation; increased height and growth rate; and improved water use efficiency, such as lower transpiration, was achieved by introducing a photorespiration bypass in transgenic plants, including transgenic Eucalyptus plants. The E. coli glycolate catabolic pathway comprises five E. coli genes encoding three enzymes: glycolate dehydrogenase (GDH) three subunits (GDH D, E, and F), glyoxylate carboligase (GCL), and tartronic semialdehyde reductase (TSR). The present disclosure describes introducing one or more of these enzymes into plants, which facilitated the conversion of 2-phosphoglycolate to glycerate and then to 3PGA bypassing the formation of glycine and its conversion into serine, which is accompanied by the release of NH3. Described is replacing the three GDH subunits with a single eukaryotic GDH from the green algae Chlorella or Chlamydomonas (CxGDH). Also described are transgenic plants with the CxGDH, such as Eucalyptus plants, and methods related to improved carbon fixation, including increased photosynthetic rate, improved water use efficiency, increased max height and / or increased growth in said transgenic plants. Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used in this application and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. For example, reference to a component is intended also to include composition of a plurality of components. References to a composition containing “a” constituent is intended to include other constituents in addition to the one named. The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives. The term “and / or” should be understood to mean either one, more than one, or all of the alternatives. As used herein, the term “about” or “approximately” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 15%, 14%, 13%, 12%, 11% 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the term “about” or “approximately” refers a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length ±15%, ±14%, ±13%, ±12%, ±11%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% about a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, a range, e.g., 1 to 5, about 1 to 5, or about 1 to about 5, refers to each numerical value encompassed by the range. For example, in one non-limiting and merely illustrative embodiment, the range “1 to 5” is equivalent to the expression 1, 2, 3, 4, 5; or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0; or 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or 5.0. As used herein, the term “substantially” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher compared to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, “substantially the same” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that produces an effect, e.g., a physiological effect, that is approximately the same as a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. Throughout this specification, unless the context requires otherwise, the words “comprise”, “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. By “consisting of” is meant including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of” is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of” indicates that the listed elements are required or mandatory, but that no other elements are present that materially affect the activity or action of the listed elements. Reference throughout this specification to “one embodiment,” “an embodiment,” “a particular embodiment,” “a related embodiment,” “a certain embodiment,” “an additional embodiment,” or “a further embodiment” or combinations thereof means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the foregoing phrases in various places throughout this application are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. It is also understood that the positive recitation of a feature in one embodiment, serves as a basis for excluding the feature in a particular embodiment. As used herein, "inserting" or "introducing" a nucleic acid into the plant genome or "providing" a nucleic acid to a plant cell should be understood as encompassing all methods available in the art to provide a plant cell comprising the nucleic acid, whether such introduction is achieved by plant transformation methods or by crossing the recipient plant with a donor plant into which the nucleic acid of interest was previously introduced. Other methods of transferring a nucleic acid from a donor plant to a recipient plant include e.g. protoplast fusion followed by regeneration of the fused protoplasts. In the context of the present invention the term "genome" includes both the nuclear genome as well as the plastid genome. It will be clear that the methods of transformation used are of minor relevance to the current invention. Transformation of plants is a routine technique. Advantageously, any of several transformation methods may be used to introduce the nucleic acid / gene of interest into a suitable cell. As used herein, the terms “nucleic acid”, “nucleic acid molecule”, and “polynucleotide” and “polynucleotide molecule” are used interchangeably and to mean according to conventional meaning, as a sequence of nucleotides (or nucleotide sequence). Polynucleotides includes reference to a deoxyribonucleotide or ribonucleotide polymer, or chimeras thereof, in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids) and / or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). A polynucleotide can be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. In general, polynucleotides can be of the DNA or RNA type, preferably of the DNA type. Polynucleotides may be single-stranded or double-stranded and either recombinant, synthetic, or isolated. Synthetic nucleic acids are generated in vitro. Examples of such synthetic nucleic acids are those in which the codons which encode polypeptide(s) having the enzymatic activity of a glycolate dehydrogenase according to the invention have been optimized in accordance with the host organism in which it is to be expressed (e.g., by replacing codons with those codons more preferred or most preferred in codon usage tables of such host organism or the group to which such host organism belongs, compared to the original host). As used herein, the term “codon-optimized” refers to substituting codons in a polynucleotide encoding a polypeptide in order to increase the expression, stability and / or activity of the polypeptide. Factors that influence codon optimization include, but are not limited to one or more of: (i) variation of codon biases between two or more organisms or genes or synthetically constructed bias tables, (ii) variation in the degree of codon bias within an organism, gene, or set of genes, (iii) systematic variation of codons including context, (iv) variation of codons according to their decoding tRNAs, (v) variation of codons according to GC %, either overall or in one position of the triplet, (vi) variation in degree of similarity to a reference sequence for example a naturally occurring sequence, (vii) variation in the codon frequency cutoff, (viii) structural properties of mRNAs transcribed from the DNA sequence, (ix) prior knowledge about the function of the DNA sequences upon which design of the codon substitution set is to be based, (x) systematic variation of codon sets for each amino acid, and / or (xi) isolated removal of spurious translation initiation sites. Methods for codon optimization are well known and are a routine technique. The terms “polypeptide”, “peptide”, and “protein” are used interchangeably herein to refer to a polymer of amino acid residues and according to conventional meaning, as a sequence of amino acids. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally- occurring amino acid, as well as to naturally-occurring amino acid polymers. The terms “polypeptide”, “peptide” and “protein” are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. In one embodiment, a polypeptide includes fusion polypeptides and other variants. Polypeptides can be prepared using any of a variety of well-known recombinant and / or synthetic techniques. Polypeptides are not limited to a specific length, e.g., they may comprise a full-length protein sequence, a fragment of a full-length protein, such as a truncated polypeptide, or a fusion protein, and may include post-translational modifications of the polypeptide. Examples of truncated polypeptides (or truncated proteins) include removing a naturally occurring signaling peptide. As used herein, a “fusion polypeptide” or “fusion protein” mean one or more polypeptides have been joined together to express as a single translated polypeptide. The one or more polypeptides may be directly fused or indirectly fused with one or more linker polypeptides (or “linker”). Linker polypeptides can be between 1 and 200 amino acids in length, between 1 and 100 amino acids in length, or between 1 and 50 amino acids in length, including all integer values in between. For example, a nucleotide sequence may encode a fusion protein of the CvGDH protein and a chloroplast transit peptide, wherein a polypeptide linker is between the CvGDH protein and the chloroplast transit peptide. In another example, a nucleotide sequence may encode a fusion protein of the CvGDH protein and a chloroplast transit peptide, wherein the chloroplast transit peptide is directly linked to the N-terminal of the CvGDH protein. As used herein “operably linked” includes reference to a functional linkage between more than one sequences, such as a functional linkage between a first and a second sequence; thus, the function of one of the sequences is affected by another. Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation. Nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter sequence may be operably linked to a protein encoding sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the protein encoding sequence. Operably linked includes that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. Operably linked also includes not being contiguous, such as with enhancers. As used herein, the term “plant” is used in its broadest sense, including, but is not limited to, any species of woody, ornamental or decorative, crop or cereal, and fruit or vegetable plant. As used herein, the term “plant” does not include algae. Non-limiting examples of plants include plants from the genus Hevea or the genus Persea or the genus Populus or the genus Eucalyptus. Other examples include plants from the genuses Acorus, Aegilops, Allium, Amborella, Angophora, Antirrhinum, Apium, Arabidopsis, Arachis, Beta, Betula, Brassica, Capsicum, Ceratopteris, Citrus, Corymbia, Cryptomeria, Cycas, Descurainia, Eschscholzia, Glycine, Gossypium, Hedyotis, Helianthus, Hordeum, Ipomoea, Lactuca, Linum, Liriodendron, Lotus, Lupinus, Lycopersicon, Medicago, Mesembryanthemum, Nicotiana, Nuphar, Oryza, Pennisetum, Phaseolus, Physcomitrella, Picea, Pinus, Poncirus, Prunus, Robinia, Rosa, Saccharum, Schedonorus, Secale, Sesamum, Solanum, Sorghum, Stevia, Thellungiella, Theobroma, Triphysaria, Triticum, Vitis, Zea, or Zinnia. Plants included in the invention are any plants amenable to transformation techniques, including gymnosperms and angiosperms, both monocotyledons and dicotyledons. Examples of monocotyledonous angiosperms include, but are not limited to, asparagus, field and sweet corn, barley, wheat, rice, sorghum, onion, pearl millet, rye and oats and other cereal grains. Examples of dicotyledonous include, but are not limited to eucalyptus, rubber tree, avocado, poplar tree, tomato, tobacco, cotton, rapeseed, field beans, soybeans, peppers, lettuce, peas, alfalfa, clover, cole crops or Brassica oleracea (e.g., cabbage, broccoli, cauliflower, brussel sprouts), radish, carrot, beets, eggplant, spinach, cucumber, squash, melons, cantaloupe, sunflowers and various ornamentals. Examples of woody species include poplar, pine, sequoia, cedar, oak, eucalyptus, etc. Still other examples of plants include, but are not limited to, wheat, cauliflower, tomato, tobacco, corn, petunia, trees, rubber tree, etc. As used herein, the term “cereal crop” is used in its broadest sense. The term includes, but is not limited to, any species of grass, or grain plant (e.g., barley, corn, oats, rice, wild rice, rye, wheat, millet, sorghum, triticale, etc.), non-grass plants (e.g., buckwheat flax, legumes or soybeans, etc.). As used herein, the term “crop” or “crop plant” is used in its broadest sense. The term includes, but is not limited to, any species of plant edible by humans or used as a feed for animals or used, or consumed by humans, or any plant used in industry or commerce, such as for use to make paper. As used herein, the term “plant” also refers to either a whole plant, a plant part, or organs (e.g., leaves, stems, roots, pulp, etc.), a plant cell, or a group of plant cells, such as plant tissue, plant seeds and progeny of same. Plantlets are also included within the meaning of “plant.” The class of plants which can be used in the methods of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants. The term “plant part” or “plant parts thereof” as used herein refers to any part of a plant, including a plant cell, plant tissue, plant seed, leaf, stem, roots, pulp, etc. The term “plant cell” as used herein refers to protoplasts, gamete producing cells, and cells which regenerate into whole plants. Plant cell, as used herein, further includes, without limitation, cells obtained from or found in: seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. Plant cells can also be understood to include modified cells, such as protoplasts, obtained from the aforementioned tissues. As used herein, “plant cells” do not include algal cells. As used herein, “transgenic plant”, “Tg plant”, or “genetically modified plant” includes reference to a plant which comprises within its genome a heterologous polynucleotide or which lacks, by means of homologous recombination or other methods, a native polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette. “Transgenic” is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid or lacks a native nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term “transgenic” as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation. As used herein, the term “transgenic,” when used in reference to a plant (i.e., a “transgenic plant”) refers to a plant that contains at least one heterologous gene in one or more of its cells, or that lacks at least one native gene, such as by means of homologous recombination, in one or more of its cells. As used herein, the term “transit peptide” means a peptide molecule that when linked, either fused directly or fused indirectly via linkers, to a protein of interest directs the protein to a particular tissue, cell, subcellular location, or cell organelle. Examples include, but are not limited to, chloroplast transit peptides (CTP), nuclear targeting signals, and vacuolar signals. A chloroplast transit peptide is of particular use in the present invention for directing expression of GDH, GCL, and / or TSR to the chloroplasts. Accordingly, in a preferred embodiment of the invention, a sequence coding for a peptide may be used that will direct CxGDH, EcGCL, and / or EcTSR into chloroplasts. DNA coding for a transit peptide, such as a chloroplast targeting sequence, may preferably be placed upstream (5') of a sequence coding for the protein of interest (such as CvGDH), but may also be placed downstream (3') of the coding sequence, or both upstream and downstream of the coding sequence. A chloroplast transit peptide (CTP), in particular, can be engineered to be fused to the N-terminus of proteins that are to be targeted into the plant chloroplast. Many chloroplast-localized proteins are expressed from nuclear genes as precursors and are targeted to the chloroplast by a CTP that is removed during the import steps. Examples of chloroplast proteins include the small subunit (RbcS2) of ribulose-1,5,-bisphosphate carboxylase, ferredoxin, ferredoxin oxidoreductase, the light- harvesting complex protein I and protein II, and thioredoxin F. It has been demonstrated in vivo and in vitro that non-chloroplast proteins may be targeted to the chloroplast by use of protein fusions with a CTP and that a CTP is sufficient to target a protein to the chloroplast. Such technics are well-known and routine. Other exemplary chloroplast targeting sequences include the Arabidopsis thaliana EPSPS CTP, the Petunia hybrida EPSPS CTP, the maize cab-m7 signal sequence (PCT WO 97 / 41228), the pea glutathione reductase signal sequence (PCT WO 97 / 41228), AtRbcS4 (U.S. Patent 5,728,925), AtShkG, AtShkGZm (WO04009761), and PsRbcS. As used herein “CxGDH” refers to glycolate dehydrogenase (GDH) from the green algae (CxGDH) and includes GDH from the genus Chlorella and the genus Chlamydomonas. CxGDH includes reference to GDH from Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii. As used herein “control plant” refers to an unmodified plant that can be used in comparison to a plant that has been modified in accordance with the methods and compositions disclosed herein. A control plant may be a wild-type plant. In other embodiments, the control plant is a parent, sibling, or clone of a transgenic or genetically modified plant and does not contain the introduced heterologous polynucleotide. To facilitate an understanding of the principles and features of the various embodiments of the disclosure, various illustrative embodiments are explained herein. Although exemplary embodiments of the disclosure are explained in detail, it is to be understood that other embodiments are contemplated. Accordingly, it is not intended that the disclosure is limited in its scope to the details of construction and arrangement of components set forth in the description or examples. The disclosure is capable of other embodiments and of being practiced or carried out in various ways. Photosynthesis Photosynthesis plays a pivotal role in the conversion of solar energy into chemical energy, sustaining life on Earth. The Calvin-Benson cycle, a key process in photosynthesis, is responsible for carbon fixation and the production of sugars in C3 plants. C3 plants, including many important crops such as rice, wheat and also the woody crop eucalyptus, rely on the enzyme ribulose-1,5-bisphosphate carboxylase / oxygenase (Rubisco) for primary CO2fixation. Despite being the most abundant protein in chloroplasts, Rubisco is considered inefficient due to its ability to catalyze both carboxylation and oxygenation of ribulose-1,5-bisphosphate. The balance between these two activities is influenced by the CO2 / O2ratio in leaves. Carboxylation reactions generate phosphoglycerate, which enters the Calvin cycle to produce starch, sucrose, and regenerate ribulose-1,5-bisphosphate. On the other hand, oxygenation reactions produce phosphoglycerate and phosphoglycolate. In C3 plants, phosphoglycolate is recycled through photorespiration, whereby one molecule of CO2 is released for every two molecules of phosphoglycolate. This results in a net loss of fixed carbon, reducing sugar and biomass production. Additionally, ammonia is produced as a byproduct and needs to be refixed, requiring energy-consuming reactions within the chloroplast. Although photorespiration negatively impacts plant growth and yield, its importance lies in the recovery of carbon from phosphoglycolate and the efficient removal of photosynthesis inhibitors. Mutants unable to perform photorespiration cannot grow under ambient CO2 concentrations. Furthermore, photorespiration acts as a protective mechanism, dissipating excess photochemical energy and preventing over-reduction of the chloroplast under high light intensities. Photorespiration represents a significant challenge for crop improvement due to its substantial contribution to CO2 losses in C3 plants. In moderate conditions, these losses account for approximately 20% of net photosynthesis in C3 plants, and they can be even higher in warm and dry environments. Consequently, researchers have recognized photorespiration as a crucial target for enhancing crop productivity. Glycolate dehydrogenases also play a pivotal role in green algae, including Chlamydomonas reinhardtii (Aboelmy & Peterhansel, 2014. Plant Physiology and Bichemistry, 79; 25-30) and Chlorella variabilis (Nelson & Tolbert, 1970. Archives of biochemistry and biophysics, 141; 102-110; Blanc et al., The Chlorella variabilis NC64A Genome Reveals Adaptation to Photosymbiosis, (2010)). Improved Plant Productivity and Growth The present invention relates generally to the improvement of plant productivity and growth and more specifically to the improved carbon fixation and growth in transgenic plants, such as Eucalyptus, expressing GDH originated from green algae, such as Chlorella. The present invention also relates to compositions involving the combination of CxGDH with E. coli GCL and E. coli TSR and methods related to the introduction of such compositions into plants, including Eucalyptus plants, resulting in an improved photosynthetic rate and / or maximum height and / or growth and / or water use efficiency of a plant. Polynucleotides comprising a nucleotide sequence encoding a green algae glycolate dehydrogenase (CxGDH) protein and a nucleotide sequence encoding a chloroplast transit peptide are contemplated herein. In various embodiments, the chloroplast transit peptide is derived from a Solanum tubersom ribulose-1, 5-biphosphate carboxylase polypeptide. In other embodiments, the polynucleotide further comprises a nucleotide sequence encoding an E. coli glyoxylate carboligase (EcGCL) protein. In further embodiments, the polynucleotide comprises a nucleotide sequence encoding an E. coli tartronic semialdehyde reductase (EcTSR) protein. In additional embodiments the polynucleotide comprises one or more nucleotide sequences encoding one or more promoters, one or more chloroplast transit peptides, a CxGDH protein, one or more terminators, a E. coli glyoxylate carboligase protein, and a E. coli tartronic semialdehyde reductase protein. In further embodiments, the polynucleotide encodes a promoter, a chloroplast transit peptide, a CxGDH, and a terminator. In various embodiments, methods for improving the photosynthetic rate and / or growth rate and / or water use efficiency of a plant by introducing the polynucleotide or expressing the polypeptides contemplated herein are contemplated. In other embodiments, methods for generating a transgenic plant by introducing the polynucleotides contemplated herein are contemplated. Further embodiments include genetically modified plants or parts thereof comprising a CxGDH protein expressed in the chloroplasts of said modified plants or parts thereof. In further embodiments, the genetically modified plant has an increased photosynthetic rate as compared to a control plant, which may be a wild-type plant; has an increased maximum height and / or growth rate as compared to a control plant, which may be a wild-type plant; and / or has an increased water use efficiency as compared to a control plant, which may be a wild-type plant. EXAMPLES Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non-limiting fashion. Example 1 – Construction of Binary Vector Binary vector pBI121 (Clontech, Palo Alto CA) was modified for the cloning of constructs. The neomycin phosphotransferase II (nptII) gene cassette, controlled by the nopaline synthase (NOS) promoter and terminator, was replaced with a synthetic DNA fragment containing a Eucalyptus-optimized nptII coding sequence (CDS) under the control of the cauliflower mosaic virus 35S promoter (CaMV 35S) fused to the tobacco etch virus (TEV) translational enhancer and a downstream CaMV terminator. This cassette was cloned using the BstZ17I / PmeI-HindIII restriction sites. For Eucalyptus plant transformation, the following cassettes were inserted into pBI121 binary vector (see a summary in Table 1). Cassette #1 CvGDH_EcGCL_EcTSR_1 (SEQ ID NO: 36)– A binary vector harboring T-DNA pBI121 comprising a gene encoding Chlorella variabilis glycolate dehydrogenase (CvGDH; SEQ ID NO: 12) operably linked to CaMV35S promoter (SEQ ID NO: 33) and NOS terminator (SEQ ID NO: 73); a gene encoding Escherichia coli glyoxylate carboligase (EcGCL; SEQ ID NO: 16), operably linked to the MSgt-CaVMV promoter (as disclosed in US 18 / 685,643), and the pea 3A terminator (GenBank Accession No. X04333.1); and Escherichia coli Tartronic Semialdehyde Reductase (EcTSR; SEQ ID NO: 18), operably linked to the CaMV35S promoter, and the Arabidopsis thaliana UBQ3 terminator (GenBank Accession No. L05363.1). Proteins were expressed as a translational fusion to a chloroplast transit peptide derived from the ribulose-1,5-bisphosphate carboxylase polypeptide from Solanum tuberosum (StRbcS; Uniprot #P26574) (SEQ ID NOs: 1, 3, and 5). The binary vector was transformed into Agrobacterium tumefaciens strain EHA105. Recombinant Agrobacterium colonies were selected on LB agar plates containing 50 mg / L kanamycin. Cassette #2 CvGDH_EcGCL_EcTSR_2 (SEQ ID NO: 37) – A binary vector harboring T-DNA pBI121 comprising a gene encoding CvGDH operably linked to CaMV35S promoter and NOS terminator; a gene encoding EcGCL, operably linked to the CaMV35S promoter, and the pea 3A terminator and EcTSR, operably linked to the CaMV35S promoter, and the Arabidopsis thaliana UBQ3 terminator. Proteins were expressed as a translational fusion to a chloroplast transit peptide derived from StRbcS (SEQ ID NOs: 1, 3, and 5). The binary vector was transformed into Agrobacterium tumefaciens strain EHA105. Recombinant Agrobacterium colonies were selected on LB agar plates containing 50 mg / L kanamycin. Cassette #3 FusedEcGDH_EcGCL_EcTSR (SEQ ID NO: 38) – A binary vector harboring T-DNA pBI121 comprising a gene encoding multi-subunit fusion Escherichia coli glcD+glcE+glcF (Fused EcGDH; SEQ ID NO: 30) operably linked to CaMV35S promoter and NOS terminator; a gene encoding EcGCL, operably linked to the CaMV35S promoter, and the pea 3A terminator and EcTSR, operably linked to the CaMV35S promoter, and the Arabidopsis thaliana UBQ3 terminator. Proteins were expressed as a translational fusion to a chloroplast transit peptide derived from StRbcS (SEQ ID NOs: 3, 5, and 7). The Fused EcGDH was generated by fusion of glcD (Uniprot # A0A0E1ZST0), glcE (Uniprot # H9UWL3), and glcF (Uniprot # P52074) cDNAs using intervening flexible (Gly4Ser)3 linkers to form full GDH. The binary vector was transformed into Agrobacterium tumefaciens strain EHA105. Recombinant Agrobacterium colonies were selected on LB agar plates containing 50 mg / L kanamycin Cassette #4 FusedEcGDH (SEQ ID NO: 39) – A binary vector harboring T-DNA pBI121 comprising a gene encoding Fused EcGDH operably linked to CaMV35S promoter and NOS terminator. The binary vector was transformed into Agrobacterium tumefaciens strain EHA105. Recombinant Agrobacterium colonies were selected on LB agar plates containing 50 mg / L kanamycin Cassette #5 CvGDH (SEQ ID NO: 40) - A binary vector harboring T-DNA pBI121 comprising a gene encoding CvGDH operably linked to CaMV35S promoter and NOS terminator. Protein was expressed as a translational fusion to a chloroplast transit peptide derived from StRbcS (SEQ ID NO 1). The binary vector was transformed into Agrobacterium tumefaciens strain EHA105. Recombinant Agrobacterium colonies were selected on LB agar plates containing 50 mg / L kanamycin.
[0002] Table 1 Expression Cassettes Construct no.Vector Cassette Promoter CTP Gene Terminator35S StRbcS CvGDH NOS MSgt- Example 2 – Eucalyptus Plant Transformation and Regeneration Following cloning verification, the constructs in Table 1 and FIG. 1 were transformed into Eucalyptus background clone tissue by A. tumefaciens strain EHA105, and transformed tissue was regenerated into Transgenic (Tg) plants. The constructs were transformed as described in Prakash et al., 2009 and regenerated as provided in US11555195B2, incorporated herein by reference in its entirety. More specifically, shoots of Eucalyptus were propagated in-vitro on Murashige and Skoog medium (MS also called MSO or MS0 (MS-zero)) basal salt medium consisting of 3% (w / v) sucrose and 0.8% (w / v) agar. All in-vitro plant materials were incubated at 25±2°C for 16-h photoperiod with cool white fluorescent lamps with an intensity of 30 llEm-2 s- 1. Agro bacterial culture collected at late log phase was pelleted and re- suspended in MS basal salt medium. Leaves from in-vitro material were collected and used as explants for transformation experiments. Explants were pre-cultured on the MS regeneration medium supplemented with 0.5 mg / 16-Benzylaminopurine (BAP) and 0.1 mg / 1 NAA for 2 d. Later, pre-cultured Eucalyptus grandis leaf explants were gently shaken in the bacterial suspension for 10 min and blotted dry on a sterile filter paper. Explants were then cultivated in medium under the pre-culture conditions for two days. Following co-cultivation, explants were washed in MS liquid medium, blotted dry on a sterile filter paper, and transferred to MS regeneration medium containing 0.5 mg / 1 6- Benzylaminopurine and 0.1 mg / l 1-Naphthaleneacetic acid supplemented with 40 mg / l. kanamycin and 300 mg / l cefotaxime. After 4-5 weeks of culture, regeneration was observed and explants were transferred to liquid elongation medium (MS medium supplemented with 0.5 mg / 1 BAP, 40 mg / l kanamycin, and 300 mg / 1 cefotaxime) on paper bridges. The elongated shoots (1.5-2 cm) were propagated on MS medium with 0.1 mg / 1 BAP, and leaf segments regenerated. Positive explants were grown on MS medium containing 0.04mg / L BAP. Example 3 – Transformant Selection and Gene Expression Analysis (PCR) To select transgenic shoots for further phenotyping, elongated shoots were analyzed by PCR. Tg plants obtained from vector pBI121, were tested using primer pairs that generate fragments indicative of the presence of the different genes. Primers against FusedEcGDH, CvGDH, TSR and GCL. The primer pairs are listed in Table 2. Consequently, the transcript level of Fused EcGDH, CvGDH, TSR and GCL genes was measured for PCR positive transgenic eucalyptus events using RT-PCR. For the RT-PCR analysis, total RNA from leaves of the transgenic Eucalyptus plants was extracted using Plant / Fungi total RNA purification kit (Norgen, Cat#25800) according to the manufacturer’s protocol. Residual genomic DNA was treated with TURBO DNA-free the PrimeScript One Step RT-PCR (Takara, Cat#RR055). Actin (EucActin) was used as a reference gene. Negative control – no template. “CDS” means coding sequence. Table 2 - PCR SEQ SEQ Amplicon NO: NO: size (bp) TGTTAAGGCT CCTAAAAAGG 43 44 GlcE CDS 310 GCCAGAGAGC GGAGCGCTGA CATGCTTAAC AGCACGCTCA 45 46 GTAATTCAAC GlcF CDS 434 GAAGCTCAAT AGAAA GCL (Con TACGAGCCTC GGCATCAGAC 49 50 1,2,4,5) 435 TTCCCGTGTA ACTATCCCAA CDS ACCATAGTGG GTTAGGAAGA 51 52 TSR CDS 504 ACATGAGCAG TTGAGGGCGA ACGACGCTTT TGCACAAGGG CvGDH 41 42 304 TCTCTTCGGT GGTCTTTGTT CDS Table 3 - RT-PCR SEQ SEQ Amplicon Amplicon ID Forward Primer ID Reverse Primer expected Sequence NO: NO: size (bp) TGTTAAGGCT CCTAAAAAGG 43 44 GlcE CDS 310 GCCAGAGAGC GGAGCGCTGA ATCGCCAAGC CACCATACCG GCL (Con 47 48 402 CCGTTTCTAA GCCATAAGCT 3&6) CDS GCL (Con TACGAGCCTC GGCATCAGAC 49 50 1,2,4,5) 435 TTCCCGTGTA ACTATCCCAA CDS ACCATAGTGG GTTAGGAAGA 51 52 TSR CDS 504 ACATGAGCAG TTGAGGGCGA ATACTCGCCG AGAACACCTT CvGDH 53 54 838 CCCATAAGTC GAAGTCACG CDS CAGGTGTTAT GCCTTAGGAT 55 GGTTGGTATG 56 TGAGAGGTGC EucActin 220 GGAC TTC For Multiplex TaqMan Assay, leaf tissue samples were collected from putative transgenic plants and wild-type controls. Genomic DNA was extracted using Extract-N- Amp Plant extraction and dilution solutions (Merck, E7526 and D5688). 2 multiplex TaqMan assays were designed to simultaneously detect up to four target sequences (Tables 4 and 5). Primers and probes were designed using macVector’s primer design module. Each probe was labeled with a unique fluorophore (FAM, VIC, Cy5, and NED) to allow for simultaneous detection of all four targets. Real-time PCR reactions were performed using the TaqMan®FastAdvancedMasterMix (Applied Biosystems). Fluorescence data were collected at the end of each annealing / extension step. Raw data were analyzed using QuantStudio Design & Analysis Software v1.5.1 (Applied Biosystems). The presence of each target was determined based on the amplification curves and Ct values. Samples were considered positive for a particular target if the Ct value was below 35 and the amplification curve showed typical exponential growth. Table 4 Target pFw pRev probe ore SEQ ID NO: 75: SEQ ID NO: 76: SEQ ID NO: 77: VIC r CCCTACAGCCCACCT GCATCTCGAGTTCGATC CCGACGAGCGACTTACCGA TCGT TGTGT GCAAG NPTII SEQ ID NO: 78: SEQ ID NO: 79: SEQ ID NO: 80: NED GGTGAATGGGCAGAT GGTAGAATGCGATACGC TCCTCTATGGGATTGCT CGTTT TGTGA Agro SEQ ID NO: 81: SEQ ID NO: 82: SEQ ID NO: 83: FAM CGTCTGTTTGGAATGT GCAACCATCGGATAATC ATCACAGCATGACGCCGGA GGTG GAC AGAAT CvGDH SEQ ID NO: 53: SEQ ID NO: 84: SEQ ID NO: 85: Cy5 ATACTCGCCGCCCAT TCTGGCTAACACCGCAA GCAATACAAGATCGGTCCTG AAGTC CAC Table 5 Target pFw pRev probe ore SEQ ID NO: 75; SEQ ID NO: 76: SEQ ID NO: 77: VIC er CCCTACAGCCCACCTT GCATCTCGAGTTCGATC CCGACGAGCGACTTACCGA CGT TGTGT GCAAG GCL SEQ ID NO: 47: SEQ ID NO: 86: SEQ ID NO: 87: Cy5 ATCGCCAAGCCCGTTT ATGAGGTGGAAGGCCT TCTAAGATGGCCGTGACCGT CTAA GTTG TSR SEQ ID NO: 88: SEQ ID NO: 89: SEQ ID NO: 90: FAM AGGCCAGCGACATCAT TTCCCCTTGAGAGAGGC TCCTCAAGTTGAAGAGGTGC CTTC CTT Example 4 – Transgenic Eucalyptus Photochemistry and Growth Rate Measurements Events exhibiting the presence of the transgenes were selected for further analysis. These selected events were propagated to 10 copies on MS medium containing 0.04mg / L BAP and placed on rooting media. Rooted Tg plants were transferred from tissue culture to soil pots, acclimated, and grown in greenhouse under natural conditions for three months. Eight to twelve replicates of each event were planted in a randomized plot design under 25-28°C conditions. Height and growth: After two to three months, canopy height was measured. The height was determined by measuring the length of the stem of each WT or transgenic plant from the root crown to the top. The growth rate of a plant represents the rate of increase in height and is calculated according to the following equation: take the current value and subtract that from the previous value. Next, divide this difference by the previous value and multiply by 100 to get a percentage representation of the rate of growth. Photochemistry: The photosynthetic measurements were conducted on three to four selected Eucalyptus plants from a pool of eight to twelve replicates per experimental event. In order to minimize the effect of the canopy size on the rate of total transpiration and water depletion from the pots, the selected plants were those which were in height closest to the group height average. For each plant, three to four fully expanded leaves of similar age and size were chosen from the lower third of the upper canopy, sampling leaf number 3-4 from the tip of branch number 10-15 from the apical tip (FIG. 3). This selection strategy targets leaves that are mature and well-exposed to sunlight, ensuring optimal photosynthetic activity while minimizing potential factors such as light stress and senescence (Bhagsari et al., 1986. Crop science, 26(1); 127-132). Photosynthetic Rate was measured as the amount of carbon dioxide that is fixed per meter squared per second across a range of photosynthetic photon flux densities(light intensity) (PPFD: 0, 100, 200, 400, 600, 800, 1000, 1500, 2000, 2400 mol m ² s ¹).Viable leaves as described above were used to measure photosynthetic rate for Tg plants. For Cassette 2, Photosynthetic rate was measured as a function of photosynthetic photon flux density (PPFD) (A / Q response curves) using LI-6400 / XT portable gas exchange system (Li-Cor, Lincoln, Nebraska, USA). Cuvette conditions were maintained at a leaf temperature of 24.5° C., relative humidity of 50%, and ambient controlled CO2 concentration (400ppm). Resulting data analyzed by the Marshall-Biscoe model (Marshall & Biscoe, 1980. J. Experimental Botany, 31(1); 29-39) to derive / estimate the maximum rate of net photosynthesis (Amax). For Cassette 1, photosynthetic rate was measured using LI-Core 6800 gas exchange system (Li-Cor, Lincoln, Nebraska, USA) according to the manual protocol. Viable leaves as described above were used to measure photosynthetic rate. It was measured as the amount of carbon dioxide that is fixed per meter squared per second across a range of CO2concentration (0, 50, 100, 200, 300, 400, 600, 800, 1000ppm). All measurement were taken under constant light intensity, humidity and leaf temperature (1200PAR, 50%RH and 24c) and the CO2 respond curve (A / Ca (A / Ci) curve) was plotted (A- Assimilation; Ca- the capacity of plants to assimilate atmospheric carbon dioxide; Ci- intracellular CO2mol m-1). Resulting data analyzed by the FvCB model described by Sharkey, 2015. Plant, Cell & Environment, 39(6), 1161- 1163 to determine Maximum carboxylation rate of Rubisco (Vcmax). All measurements were taken between 9:00 am and 2:00 pm to capture peak photosynthetic rates and minimize the influence of diurnal variation (Tenhunen et al., Stomatal Function, Stanford University Press, 1987, pp.323-351). Maximum assimilation rate (Amax) is the net assimilation when neither light nor CO2are limiting photochemistry, net assimilation at a saturating light intensity and a saturating CO2 concentration. Amaxrepresents the maximum capacity of the leaf for carbon assimilation. Reported as the rate of CO2 uptake per unit time per unit leaf area (μmol of CO2m-2s-1) calculated from the light (A / Q response curve) and / or A / Ci curve. Maximum velocity of carboxylation (Vc max) is used to describe the response ofassimilation to CO2 concentration (A / Ci curve). Vc max represents the maximum velocity ofcarbon fixation by Rubisco. The gold-standard technique for determining Vc maxis to derive Vc maxfrom the initial slope of an A–Ci curve (the response of photosynthesis, A to intercellular CO2 concentration, Ci) (Bernacchi et al., 2013. Plant, Cell & Environment, 36(9); 1641-1657; Farquhar et al., 1980. Planta, 149(1); 78-90; Sharkey, et al., 2007. Plant, Cell & Environment, 30(9); 1035-1040). Transpiration is the process of losing water through the surface of the leaves.Transpiration rate is calculated by the Licor 6400 or Licor 6800 according to the formula: mol H2O m-2s-1F = molar flow rate of air entering the leaf chamber, mol s-1Water use efficiency (WUE) is defined as the amount of the total dry matterproduced by plants per unit of water used. Is calculated by Licor 6400 or Licor 6800 according to the formula: Water use efficiency (WUE): WUE% ("CO2" / "H2O")"A [ mol(CO2) m–2 s–1] X 10^-6" / "E [mol (H2O) m-2 s-1]" X 100 = WUE%A = net assimilation rate, mol CO2m-2s-1E = transpiration, mol H2O m-2s-1Licor computed parameter Transpiration:Total Vapor: Net photosynthesis (A): Intercellular CO2: Water use efficiency (WUE): WUE% ("CO2" / "H2O") –2s–1] X 10^-6" / "E [mol (H2O) m-2s-1]" X 100 = WUE% 2 m-2s-1ce = incoming CO2 concentration, mol CO2 mol air-1co = outgoing CO2concentration, mol CO2mol air-1Cs = mole fraction of CO2 2 mol-1air Cr = mole fraction of CO2 2 mol-1air Ci = intercellular CO2 2mol air-1E = transpiration, mol H2O m-2s-1-1gbw = boundary layer conductance to water vapor, mol H2O m-2s-1gsw = stomatal conductance to water vapor, mol H2O m-2s-1gtc = total conductance to CO2, mol CO2 m-2s-1gtw = total conductance to water vapor, mol H2O m-2s-1kf = (K2 + 1) / (K + 1)2 K = stomatal ratio (dimensionless); estimate of the ratio of stomatal conductances of one side of the leaf to the other s = leaf area, m2S = leaf area, cm2ue = incoming flow rate, mol air s-1uo = outgoing flow rate, mol air s-1we = incoming H2O mole fraction, mol H2O mol air-1 wo = outgoing H2O mole fraction, mol H2O mol air-1 Ws = sample IRGA mole fraction of water vapor, mmol H2O mol air-1 Wr = reference IRGA mole fraction of water vapor, mmol H2O mol air-1 Wl = mole fraction of water vapor within the leaf, mmol H2O mol air-1 Statistical analysis was performed using JMP software (SAS Institute Inc., Cary, NC, USA), conducting an ANOVA followed by Dunnett's test, where events significantly
[0003] Example 5 – Expression of Construct 1 (Cassette 1: CvGDH_EcGCL_EcTSR_1) in Eucalyptus Leaf explants of Eucalyptus grandis x urophylla clone were infected as described above in Example 2 with the recombinant Agrobacterium harboring Cassette 1 and co- cultivated on MS medium for two days. The explants propagated and elongated as described in Example 2. To select Tg events for further phenotyping, elongated shoots were analyzed by Multiplex TaqMan Assay as described in Example 3. Five independent transgenic events expressing the CvGDH_EcGCL_EcTSR construct (Construct 1) and wild-type (WT) Eucalyptus were selected and grown in a greenhouse under natural light for 92 days. The events are disclosed in Table 6. Plant height and growth rate was measured as described in Example 4 and is disclosed in FIG. 4. Tg event E7_1B had the greatest height and the highest growth rate (FIG.5), followed by E6_11B, E6_1A, E6_10B and E3_16B, respectively (FIG.4 and 5). Wild-type plants had lower heights and lower growth rate than the events expressing the CvGDH_EcGCL_EcTSR cassette 1 (FIG.4 and 5). Table 6 Selected Events Construct 2 Construct Event E3_16B Tg plants were measured for their photosynthetic rate (FIG.6), Maximum velocity of carboxylation (Vc max) (FIG.7), transpiration rate (FIG.8) and water use efficiency (FIG. 9) as described in Example 4. E7-1B presented the highest photosynthesis rate. When a plateau is reached that means that the CO2 is no longer the limiting factor rather, the limiting factor becomes one or more of the other factors such as light intensity, O2levels and temperature. Results in FIG.6 demonstrate that the CO2 concentration affects the plateau at a higher level, so it is a limiting factor for longer in E7-1B plant in comparison to WT. Notably the maximum rate of Rubisco carboxylation (Vc max) of Tg plants was higher than in WT plant as seen in FIG.7. Transpiration rate was significantly lower for E6_10B (FIG.8) together with higher WUE (FIG. 9) which indicates that these plants are more effective in their water consumption economy. The differences between the events may be due to the plant genome’s gene integration place. Example 6 – Transformation of Construct 2 (Cassette 2: CvGDH_EcGCL_EcTSR_2) in Eucalyptus Leaf explants of Eucalyptus grandis x urophylla clone were infected as described above in Example 2, with the recombinant Agrobacterium harboring Cassette 2 (CvGDH_EcGCL_EcTSR_2) and co-cultivated on MS (Murashige and Skoog) medium for two days. The explants propagated and elongated as described in Example 2. Fourteen independent PCR-positive Tg events were tested in RT-PCR (Example 3, FIG.2). Six events exhibiting high expression of the transgenes are presented in Table 7 and were selected for further analysis. These six selected events were propagated to 10 copies on MS medium containing 0.04mg / L BAP and placed on rooting media and grown in a greenhouse under natural light for 91 days together with WT plants. Plant height was measured as described in Example 4. Results are disclosed in FIG.10 and 11. Tg event 64A had the greatest height, followed by 68A, 67A, 63A, 61A, 54A and WT, respectively. Wild-type plants had lower heights than the events expressing the CvGDH_EcGCL_EcTSR construct, however growth rate was not significantly different between Tg events and WT (FIG. 12). Photochemistry analysis using LI-Core 6400XT was performed as disclosed in Example 4. Results are disclosed in FIG. 13. A light intensity (Photosynthetic photon flux density (PPFD)) response curve (A / Q) was generated by subjecting the leaves to a range of light intensities (Q mol m-2S-1) as disclosed in Example 4. 61A has the highest photosynthesis rate, followed by 68A, 67A, 64A, 54A, 63A and WT, respectively. When a plateau is reached it signifies that the light intensity is no longer the limiting factor rather, the limiting factor becomes one or more of the other factors such as CO2 levels, O2 levels and temperature. Results in FIG. 13 demonstrate that the light intensity affects the plateau at a higher level for the transgenic plants, so it is the limiting factor for longer in these plants in comparison to WT. Notably the maximum photosynthesis rate of Rubisco carboxylation (Amax) of Tg plants was higher than in WT plants as seen in FIG. 14. WT plants had a lower WUE (FIG. 15) which indicates that these plants are less effective in their water consumption economy than most of the Tg plants. WUE was highest for event 61A followed by 68A, 64A, and 67A (all above WT plants). 63A and 54A plant had lower WUE than WT. These results indicate that 54A event had low water consumption effectiveness whereas 61A has the highest water consumption effectiveness. The differences between the events are probably due to the plant genome’s gene integration place. Table 7 Selected Events Construct 2 Construct Event Repeats TS534_54A (54A) 10 Example 7 – Transformation of Construct 3 (Cassette 3: FusedEcGDH_EcGCL_EcTSR) in Eucalyptus Leaf explants of Eucalyptus grandis x urophylla clone were infected as described above in Example 2, with the recombinant Agrobacterium harboring Construct 3 (FusedEcGDH_EcGCL_EcTSR) and co-cultivated on MS medium for two days. The explants propagated and elongated as described in Example 2. 10 independent PCR-positive events were selected for further analysis. These 10 selected events were propagated to 10 copies on MS medium containing 0.04mg / L BAP and placed on rooting media. Nine selected independent transgenic FusedEcGDH_EcGCL_EcTSR events in Table 8 and wild-type (WT) Eucalyptus were selected and grown in a greenhouse under natural light for 71 days. Plant height and photosynthesis rate were measured as described in Example 4. Results are disclosed in FIG.16. Gas-exchange measurements were performed on intact eucalyptus leaves under constant irradiance using the LI-COR 6400XT portable photosynthesis system to assess their photosynthetic characteristics. A light intensity (Photosynthetic photon flux density (PPFD)) response curve (A / Q) was generated by subjecting the leaves to a range of light intensities (Q mol m-2S-1) (FIG.17). Table 8 Selected Events Construct 3 Construct Event Repeats TS221_1B 12 TS221_2B 12 TS221_4B 12 TS221 _6A 13 FusedEcGDH_EcGCL_EcTSR TS221_10B 12 TS221 _24A 12 TS221 _25A 12 TS221 _30A 12 TS221 _34A 13 - WT 8 Transgenic plants obtained from construct 3 (FusedEcGDH_EcGCL_EcTSR) that contain the fused E. Coli GDH, GCL and TSR did not display any significant change compared to the wild-type in terms of growth (FIG.16) and photosynthetic rate (FIG.17). Contrary to that, events obtained from construct 1 or 2 (CvGDH_EcGCL_EcTSR) resulted in enhanced growth (FIGs.4, 5, 10,11, 12) and increased photosynthesis rate (FIGs.6, 13). Example 8 - Transformation of Construct 4 (Cassette 4: FusedEcGDH) in Eucalyptus Leaf explants of Eucalyptus grandis x urophylla clone were infected as described above in Example 2, with the recombinant Agrobacterium harboring Construct 4 (FusedEcGDH) and co-cultivated on MS (Murashige and Skoog) medium for two days. The explants propagated and elongated as described in Example 2. 10 independent PCR-positive events were selected for further analysis. These 10 selected events were propagated to 10 copies on MS medium containing 0.04mg / L BAP and placed on rooting media. The selected independent transgenic events of the Fused EcGDH construct disclosed in Table 9 and wild-type (WT) Eucalyptus were selected and grown in a greenhouse under natural light for about 3 months. Plant height (FIG.18) and photosynthetic rate (FIG.19) was measured as described in Example 4. Gas-exchange measurements were performed on intact Eucalyptus leaves under constant irradiance using the LI-COR 6400XT portable photosynthesis system to assess their photosynthetic characteristics. A light intensity (Photosynthetic photon flux density (PPFD)) response curve (A / Q) was generated by subjecting the leaves to a range of light intensities (Q mol m-2S-1). Results are disclosed in FIG.19. Table 9 Selected Events Construct 4 Construct Event Repeats TS215_13A (13A) 12 - WT 12 Transgenic plants obtained from constructs 4 (FusedEcGDH) did not display any significant change compared to the wild-type in terms of growth (FIG. 18) and photosynthetic rate (FIG.19) and are similar to the set of results obtained from construct 3. Example 9 – Transformation of Construct 5 (Cassette 5: CvGDH) in Eucalyptus Leaf explants of Eucalyptus grandis x urophylla clone were infected as described above in Example 2, with the recombinant Agrobacterium harboring Construct 5 (CvGDH) and co-cultivated on MS (Murashige and Skoog) medium for two days. The explants were propagated and elongated as described in Example 2. Positive Tg events were tested in RT-PCR. Selected events were propagated to 10 copies on MS medium containing 0.04mg / L BAP and were placed on rooting media and grown in a greenhouse under natural light for 2-3 months together with WT plants. Plant height will be measured as described in Example 4. Photochemistry analysis using LI-Core 6400XT will be performed as disclosed in Example 4.
Claims
What is claimed is:
1. A polynucleotide comprising a nucleotide sequence encoding a Chlorella or Chlamydomonas glycolate dehydrogenase (CxGDH) protein operably linked to a nucleotide sequence encoding a chloroplast transit peptide.
2. The polynucleotide of claim 1, wherein the nucleotide sequence encodes a fusion protein of the CxGDH protein and the chloroplast transit peptide.
3. The polynucleotide of claim 1 or claim 2, wherein said chloroplast transit peptide is derived from a polypeptide from the genus Populus, Arabidopsis, Eucalyptus, or Solanum, preferably said chloroplast transit is derived from a Solanum tuberosum ribulose-1,5-biphosphate carboxylase polypeptide.
4. The polynucleotide of any one of claims 1 to 3, wherein the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii.
5. The polynucleotide of any one of claims 1 to 4, wherein said CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65.
6. The polynucleotide of any one of claims 1 to 5, wherein said CxGDH protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65.
7. The polynucleotide of any one of claims 1 to 6, wherein said nucleotide sequence encodes an amino acid sequence that is at least 70%, at least 75%, at least80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in any one of SEQ ID NOs: 1 and 66- 70.
8. The polynucleotide of any one of claims 1 to 7, wherein said nucleotide sequence encodes an amino acid sequence set forth in any one of SEQ ID NOs: 1 and 66-70.
9. The polynucleotide of any one of claims 1 to 8, further comprising a nucleotide sequence encoding an E. coli glyoxylate carboligase (EcGCL) protein.
10. The polynucleotide of claim 9, wherein said EcGCL protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NOs: 13 or 15.
11. The polynucleotide of claim 9 or claim 10, wherein said EcGCL protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 13 or 15.
12. The polynucleotide of any one of claims 9 to 11, wherein said nucleotide sequence encoding the EcGCL protein is operably linked to a chloroplast transit peptide, optionally wherein said chloroplast transit peptide is derived from a Solanum tuberosum ribulose-1,5-biphosphate carboxylase polypeptide.
13. The polynucleotide of claim 12, wherein said nucleotide sequence encoding the EcGCL protein operably linked to a chloroplast transit peptide encodes an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical the sequence set forth in SEQ ID NO: 5.
14. The polynucleotide of claim 12 or claim 13, wherein said nucleotide sequence the EcGCL protein operably linked to a chloroplast transit peptide encodes an amino acid sequence set forth in SEQ ID NO:
5.
15. The polynucleotide of any one of claims 1 to 14, further comprising a nucleotide sequence encoding an E. coli tartronic semialdehyde reductase (EcTSR) protein.
16. The polynucleotide of claim 15, wherein said EcTSR protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
17.
17. The polynucleotide of claim 15 or 16, wherein said EcTSR protein comprises an amino acid sequence set forth in SEQ ID NO:
17.
18. The polynucleotide of any one of claims 15 to 17, wherein said nucleotide sequence encoding the EcTSR protein is operably linked to a chloroplast transit peptide, optionally wherein said chloroplast transit peptide is derived from a Solanum tuberosum ribulose-1,5-biphosphate carboxylase polypeptide.
19. The polynucleotide of claim 18, wherein said nucleotide sequence encoding the EcTSR protein operably linked to a chloroplast transit peptide encodes an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
3.
20. The polynucleotide of claim 18 or claim 19, wherein said nucleotide sequence encoding the EcTSR protein operably linked to a chloroplast transit peptide encodes an amino acid sequence set forth in SEQ ID NO: 3.
21. The polynucleotide of any one of claims 1 to 20, comprising: one or more promoters, operably linked to said CxGDH protein, said EcGCL protein, and / or said EcTSR protein; a nucleotide sequence encoding one or more chloroplast transit peptides, operably linked to said EcGCL protein, and / or said EcTSR protein; and / or one or more terminators operably linked to said CxGDH protein, said EcGCL protein, and / or said EcTSR protein.
22. The polynucleotide of claim 21, wherein the one or more promoters is a CaMV35S promoter and / or a MSgt-CaVMV promoter; and / or wherein the one or more terminators is a NOS terminator, a 3A terminator, and / or a UBQ3 terminator.
23. The polynucleotide of any one of claims 1 to 22, wherein one or more of said nucleotide sequence encoding the CxGDH protein, said nucleotide sequence encoding the EcGCL protein, and said nucleotide sequence encoding the EcTSR protein is operably linked to one or more nucleotide sequences encoding a CaMV35S promoter and / or a MSgt-CaVMV promoter, a NOS terminator, a 3A terminator, and / or a UBQ3 terminator.
24. The polynucleotide of any one of claims 1 to 23, wherein said polynucleotide encodes from 5’ to 3’: (a) a CaMV35S promoter; (b) a chloroplast transit peptide; (c) a CxGDH protein; (d) a NOS terminator; (e) a MSgt-CaVMV promoter or a CaMV35S promoter; (f) a chloroplast transit peptide; (g) a EcGCL protein; (h) a 3A terminator; (i) a CaMV35S promoter;(j) a chloroplast transit peptide; (k) a EcTSR protein; and (l) a UBQ3 terminator.
25. The polynucleotide of any one of claims 1 to 24, wherein said polynucleotide comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 36 or 37.
26. The polynucleotide of any one of claims 1 to 25, wherein said polynucleotide comprises a sequence set forth in SEQ ID NO: 36 or 37.
27. The polynucleotide of any one of claims 1 to 8, wherein said polynucleotide comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
40.
28. The polynucleotide of any one of claims 1 to 8, wherein said polynucleotide comprises a sequence set forth in SEQ ID NO:
40.
29. A method for improving the photosynthetic rate and / or growth rate and / or water use efficiency of a plant comprising introducing the polynucleotide of any one of claims 1 to 28 into a cell of said plant.
30. The method of claim 29, wherein the protein(s) expressed from the polynucleotide is targeted to chloroplasts of the plant produced.
31. A method for improving the photosynthetic rate and / or growth rate and / or water use efficiency of a plant comprising introducing a polynucleotide comprising a nucleotide sequence encoding a CxGDH protein into a cell of said plant, wherein said protein is targeted to chloroplasts of the cell of said plant.
32. The method of claim 31, wherein the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii.
33. The method of claim 31 or claim 32, wherein said CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65.
34. The method of any one of claims 29 to 33, wherein said plant is a tree.
35. The method of any one of claims 29 to 34, wherein said tree is selected from a group consisting of a Eucalyptus (Eucalyptus spp)., Pine (Pinus spp.), Poplar (Populus spp.), Spruce (Picea spp.), Birch (Betula spp.), Acacia (Acacia spp.), Beech (Fagus sylvatica), Oak (Quercus spp.), Willow (Salix spp.), Aspen (Populus tremula), Bamboo (Woody Grass) (Bambusoideae spp.), Douglas Fir (Pseudotsuga menziesii), Hemlock (Tsuga spp.), Sweetgum (Liquidambar styraciflua), Maple (Acer spp.), Alder (Alnus spp.), Larch (Larix spp.), Teak (Tectona grandis), Rubber Tree (Hevea brasiliensis), Paulownia (Paulownia spp.), Balsa (Ochroma pyramidale), Cedar (Cedrus spp.), Mahogany (Swietenia spp.), Chestnut (Castanea spp.), and Kapok (Ceiba pentandra).
36. The method of any one of claims 29 to 35, wherein said plant is a eucalyptus plant, optionally wherein said plant is a Eucalyptus grandis x urophylla hybrid plant.
37. A method of generating a transgenic plant comprising introducing the polynucleotide of any one of claims 1 to 28 into a cell of said plant.
38. A method of generating a transgenic plant comprising introducing a polynucleotide comprising a nucleotide sequence encoding a CxGDH protein into a cell of said plant, wherein said CxGDH protein is targeted to chloroplasts of the plant produced.
39. The method of claim 38, wherein the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii.
40. The method of claim 38 or claim 39, wherein said CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65.
41. The method of any one of claims 37 to 40, wherein said transgenic plant is a tree.
42. The method of claim 41, wherein said tree is selected from the group consisting of a Eucalyptus (Eucalyptus spp)., Pine (Pinus spp.), Poplar (Populus spp.), Spruce (Picea spp.), Birch (Betula spp.), Acacia (Acacia spp.), Beech (Fagus sylvatica), Oak (Quercus spp.), Willow (Salix spp.), Aspen (Populus tremula), Bamboo (Woody Grass) (Bambusoideae spp.), Douglas Fir (Pseudotsuga menziesii), Hemlock (Tsuga spp.), Sweetgum (Liquidambar styraciflua), Maple (Acer spp.), Alder (Alnus spp.), Larch (Larix spp.), Teak (Tectona grandis), Rubber Tree (Hevea brasiliensis), Paulownia (Paulownia spp.), Balsa (Ochroma pyramidale), Cedar (Cedrus spp.), Mahogany (Swietenia spp.), Chestnut (Castanea spp.), and Kapok (Ceiba pentandra).
43. The method of any one of claims 37 to 42, wherein said transgenic plant is a eucalyptus plant, optionally wherein said transgenic plant is a Eucalyptus grandis x urophylla hybrid plant.
44. A genetically modified plant or part thereof comprising the polynucleotide of any one of claims 1 to 28.
45. A genetically modified plant or part thereof comprising a CxGDH protein expressed in the chloroplasts of said modified plant or part thereof.
46. The genetically modified plant or part thereof of claim 45, wherein the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii.
47. The genetically modified plant or part thereof of claim 45 or claim 46, wherein said CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65.
48. The genetically modified plant or part thereof of any one of claims 44 to 47, wherein: (i) the genetically modified plant has an increased photosynthetic rate as compared to a control plant; (ii) the genetically modified plant has an increased growth rate as compared to a control plant, optionally the genetically modified plant or part thereof has an increased height as compared to a same aged control plant; and / or (iii) the genetically modified plant has an increased water use efficiency as compared to a control plant;wherein the control plant is a wild-type plant.
49. The genetically modified plant or part thereof of any one of claims 44 to 48, wherein the plant is a dicotyledonous plant.
50. The genetically modified plant or part thereof of any one of claims 44 to 49, wherein the plant is a tree.
51. The genetically modified plant or part thereof of claim 50, wherein said tree is selected from the group consisting of a Eucalyptus (Eucalyptus spp)., Pine (Pinus spp.), Poplar (Populus spp.), Spruce (Picea spp.), Birch (Betula spp.), Acacia (Acacia spp.), Beech (Fagus sylvatica), Oak (Quercus spp.), Willow (Salix spp.), Aspen (Populus tremula), Bamboo (Woody Grass) (Bambusoideae spp.), Douglas Fir (Pseudotsuga menziesii), Hemlock (Tsuga spp.), Sweetgum (Liquidambar styraciflua), Maple (Acer spp.), Alder (Alnus spp.), Larch (Larix spp.), Teak (Tectona grandis), Rubber Tree (Hevea brasiliensis), Paulownia (Paulownia spp.), Balsa (Ochroma pyramidale), Cedar (Cedrus spp.), Mahogany (Swietenia spp.), Chestnut (Castanea spp.), and Kapok (Ceiba pentandra).
52. The genetically modified plant or part thereof of any one of claims 44 to 51, wherein the plant is eucalyptus, optionally wherein said plant is a Eucalyptus grandis x urophylla hybrid plant.
53. A fusion polypeptide comprising a CxGDH protein and a chloroplast transit peptide.
54. The fusion polypeptide of claim 53, wherein said chloroplast transit peptide is derived from a polypeptide from the genus Populus, Arabidopsis, Eucalyptus, or Solanum, preferably said chloroplast transit is derived from a Solanum tuberosum ribulose-1,5-biphosphate carboxylase polypeptide.
55. The fusion polypeptide of claim 53 or claim 54, wherein the CxGDH protein is of the species Chlorella variabilis (Cv), Chlorella sorokiniana, Chlorella vulgaris, Chlorella ohadi, Chlorella desiccata (nom. nud.), or Chlamydomonas reinhardtii.
56. The fusion polypeptide of any one of claims 53 to 55, wherein said CxGDH protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 9, 11, and 57-65.
57. The fusion polypeptide of any one of claims 53 to 56, comprising an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in any one of SEQ ID NOs: 1 and 66-70.
58. A genetically modified plant or part thereof of comprising the fusion polypeptide of any one of claims 53 to 57.
59. The genetically modified plant or part thereof of claim 58, further comprising an EcGCL protein or a fusion polypeptide comprising an EcGCL protein and a chloroplast transit peptide.
60. The genetically modified plant or part thereof of claim 59, wherein the EcGCL protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in any one of SEQ ID NOs: 5, 13, or 15.
61. The genetically modified plant or part thereof of claim 59 or claim 60, wherein the EcGCL protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 5, 13, or 15.
62. The genetically modified plant or part thereof of any one of claims 58 to 61, further comprising an EcTSR protein or a fusion polypeptide comprising an EcTSR protein and a chloroplast transit peptide.
63. The genetically modified plant or part thereof of claim 62, wherein the EcTSR protein comprises the amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 3 or 17.
64. The genetically modified plant or part thereof of claim 62 or claim 63, wherein the EcTSR protein comprises an amino acid sequence set forth in SEQ ID NO: 3 or 17.
65. The genetically modified plant or part thereof of any one of claims 58 to 64, comprising an amino acid sequence set forth in SEQ ID NO: 1 and / or an amino acid sequence set forth in SEQ ID NO: 3 and / or an amino acid sequence set forth in SEQ ID NO:
5.
66. The genetically modified plant part of anyone of claims 44 to 52 and 58 to 65, wherein the plant part is pulp.
67. A processed material comprising the pulp of claim 66.
68. A product comprising pulp made by the process comprising the steps of: introducing the polynucleotide of any one of claims 1 to 28 into a cell of a plant; generating a transgenic plant;growing said transgenic plant; and harvesting pulp from said transgenic plant.
69. The product of claim 68, wherein the plant is a dicotyledonous plant.
70. The product of claim 68 or claim 69, wherein the plant is a tree.
71. The product of claim 70, wherein said tree is selected from the group consisting of a Eucalyptus (Eucalyptus spp)., Pine (Pinus spp.), Poplar (Populus spp.), Spruce (Picea spp.), Birch (Betula spp.), Acacia (Acacia spp.), Beech (Fagus sylvatica), Oak (Quercus spp.), Willow (Salix spp.), Aspen (Populus tremula), Bamboo (Woody Grass) (Bambusoideae spp.), Douglas Fir (Pseudotsuga menziesii), Hemlock (Tsuga spp.), Sweetgum (Liquidambar styraciflua), Maple (Acer spp.), Alder (Alnus spp.), Larch (Larix spp.), Teak (Tectona grandis), Rubber Tree (Hevea brasiliensis), Paulownia (Paulownia spp.), Balsa (Ochroma pyramidale), Cedar (Cedrus spp.), Mahogany (Swietenia spp.), Chestnut (Castanea spp.), and Kapok (Ceiba pentandra).
72. The product of any one of claims 68 to 71, wherein the plant is eucalyptus, optionally wherein said plant is a Eucalyptus grandis x urophylla hybrid plant.