G4-destabiling small molecules for the treatment of x-linked dystonia-parkinsonism.
5-ALA and its derivatives target TAF1 gene mutations in XDP, offering a treatment to delay or prevent symptoms and slow disease progression by stabilizing G-quadruplex structures, addressing the genetic cause of XDP.
Patent Information
- Application Number
- PCT/NL2025/050514
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-14
- Filing Date
- 2025-10-14
- Publication Date
- 2026-04-23
AI Technical Summary
Current treatments for X-linked dystonia-parkinsonism (XDP) primarily focus on managing symptoms and do not address the underlying genetic mutation causing the disease, which leads to progressive neurodegeneration and symptoms such as dystonia and parkinsonism.
The use of 5-aminolevulinic acid (5-ALA), its esters, or porphyrins like protoporphyrin IX, or their pharmaceutically acceptable salts to treat or prevent XDP by targeting the TAF1 gene mutations, potentially stabilizing G-quadruplex structures and ameliorating molecular phenotypes associated with the disease.
5-ALA and its derivatives can delay, reduce, or prevent the onset of XDP symptoms, slow disease progression, and improve quality of life by reducing dystonia and parkinsonism symptoms, particularly in individuals at risk or with early genetic modifications.
Smart Images

Figure 00000041_0000 
Figure 00000042_0000 
Figure 00000042_0001
Abstract
Description
[0001] P137987PC00 Title: G4-destabiling small molecules for the treatment of X-linked dystonia- parkinsonism. This invention relates to X-linked dystonia-parkinsonism (XDP), and in particular to the use of 5-aminolevulinic acid (5-ALA), a 5-ALA ester, a porphyrin such as protoporphyrin IX (PPIX) or a synthetic porphyrin such as TMPyP4 or a pharmaceutically acceptable salt thereof and derivatives of 5-ALA in XDP. X-linked dystonia-parkinsonism (XDP; MIM:314250), also known as DYT3 or Lubag syndrome, is a rare, progressive neurodegenerative disorder that primarily affects adult males with maternal ancestry from the Philippine Island of Panay. In the local Filipino dialect, XDP is referred to as "lubag," meaning "twisted," due to its characteristic dystonia (abnormal muscle tone and movements) and Parkinsonism (tremors, rigidity, and difficulty with movement) [1, 2]. XDP was first described in the clinic nearly 50 years ago [3]. Since then, extensive research has revealed that it is caused by an approximately 2.6 kb SINE-Alu-VNTR (SVA) retrotransposon insertion in intron 32 of the TATA-binding protein-associated factor-1 gene (TAF1) on chromosome Xq13 [4, 5]. TAF1 encodes a protein of the transcription factor II D (TFIID) complex, which plays an important role in the transcription of genes involved in neurodevelopmental processes [6–11]. Recent studies using XDP patient cells with and without the disease-specific SVA insertion (XDP-SVA) have shown that XDP-SVA leads to dysregulation of TAF1 transcription, including increased intron 32 retention and decreased expression of exons surrounding the XDP-SVA insertion [5, 12] (Figure 1). TAF1 dysregulation is thought to underlie the development of XDP, however the exact mechanism by which the XDP-SVA insertion contributes to TAF1 dysregulation remains poorly understood. SVA elements are a class of retrotransposons found exclusively in primate genomes
[0013] and belong to one of three active transposable element (TE) families in the human genome [14–16]. SVAs are a composite of several different repeat elements and consist of a (CCCTCT)n hexamer repeat, an Alu-like element, a variable number tandem repeat (VNTR), a SINE-R, and a Poly-A region. Guanine- rich sequences within SVAs have the inherent potential to form non-canonical four- stranded DNA structures, that are also referred to as G-quadruplexes (G4s). G4s can act as a roadblock to polymerase progression [17–19]. A previous investigation using in-depth in silico analysis of the XDP-SVA sequence has revealed the presence of multiple motifs that have the theoretic potential to form G- quadruplexes, with the most pronounced potential identified within the hexamer repeat and VNTR domains [4]. Recent studies have shown that the hexamer repeat region within the XDP- SVA exhibits variable lengths among different XDP patients, with longer hexamer repeats associated with earlier disease onset [4, 20]. Longer hexamer repeats are predicted to yield larger and more stable G4 structures. This notion contrasts with the previous consensus that has evolved from the genomic analyses of XDP. Those studies suggested that five disease specific single-nucleotide substitutions (commonly annotated as disease-specific sequence (DSC) 1, 2, 3, 10 and 12), a 48-bp deletion, and a unique SVA insertion are inherited together as an identical haplotype in all XDP probands leading to a variety of possible causes for the development of disease [4]. These seven variants (i.e., DSC1, DSC2, DSC3, DSC10, DSC12, 48-bp deletion and SVA insertion) fall within noncoding regions in and around the TAF1 gene. In the present invention the inventors have found that 5-aminolevulinic acid (5-ALA; CAS 106-60-5) and its derivatives are able to ameliorate molecular phenotypes associated with XDP and provide a treatment for those afflicted, and / or those at risk of developing the disease such as those carrying a genetic modification associated with XDP as described herein. SUMMARY OF THE INVENTION The invention provides 5-aminolevulunic acid (5-ALA), a 5-ALA ester, a porphyrin, or a pharmaceutically acceptable salt thereof for use in the treatment of X-linked dystonia-parkinsonism (XDP) in an individual. The invention also provides 5-aminolevulunic acid (5-ALA), a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use in treating an individual at risk of developing XDP. Specifically the invention provides 5- aminolevulunic acid (5-ALA), a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use in treating individual carrying a genetic modification associated with XDP, wherein treating results in delaying, reducing or preventing an onset of symptoms in said individual. Preferably the genetic modification comprises one or more genetic modifications in and / or around a TATA-binding protein-associated factor-1 (TAF1) gene such as selected from a disease-specific sequence change (DSC) 1, DSC2, DSC3, DSC10, DSC12, a 48-bp deletion and an SINE-Alu-VNTR (SVA) retrotransposon insertion in TAF1 gene. More preferably the genetic modification comprises an SINE-Alu-VNTR (SVA) retrotransposon insertion in TAF1 gene. The invention also provides the use of 5-ALA, a 5-ALA ester, a porphyrin or a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for the treatment of XDP in an individual or an individual at risk of developing XDP. Further provided is a pharmaceutical composition for the treatment of XDP in an individual or an individual at risk of developing XDP, comprising an effective amount of 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. Further provided is a pharmaceutical composition for use in the treatment of XDP or an individual at risk of developing XDP, comprising an effective amount of 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. In a further aspect is provided a pharmaceutical composition for the treatment of XDP in an individual or an individual at risk of developing XDP comprising 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof and one or more additional medicaments the treatment of XDP. In a further aspect is provided a pharmaceutical composition for use in the treatment of XDP in an individual or an individual at risk of developing XDP comprising 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof and one or more additional medicaments the treatment of XDP. Also provided is a method of treating XDP in a subject in need thereof, comprising administering to the subject an effective amount of 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof. The invention is also concerned with a method of delaying, reducing or preventing the onset of symptoms associated with XDP in a subject, comprising administering to the subject in need thereof an effective amount of 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof. In one embodiment the porphyrin is selected from the group of heme, uroporphyrin, coproporphyrin or protoporphyrin IX or a derivative or synthetic analogue thereof such as octaethylporphyrin, tetraphenylporphyrin, or TMPyP4. Preferably the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX. DETAILED DESCRIPTION OF THE INVENTION X-linked dystonia parkinsonism (XDP, DYT3, OMIM #314250) is a well- described X-linked recessive syndrome of combined dystonia-parkinsonism. All cases described so far have been linked to Filipino ancestry, suggesting a single genetic founder and genetic homogeneity. Although extremely rare globally, the prevalence of XDP in the Philippines is 0.31 per 100000; and in Panay Island, 5.74 per 100000. Ninety-five percent of affected individuals are males; the average age is 44 years (20–70 years); and the average age at onset is 39-40 years (12–64 years). Early onset of the disease may occur in adolescence or early adulthood. See also Rosales, 2010. J Mov Disord 3(2): 32-38. Disease associated genetic variants are not located in protein-coding segments based on current annotations of the human genome. XDP is characterized by a combination of dystonia (involuntary muscle contractions that cause repetitive movements or abnormal postures) and parkinsonism (a syndrome with symptoms similar to Parkinson's disease, including tremors, rigidity, and bradykinesia). XDP is caused by the mutation in the TAF1 gene described herein above. Without being bound by theory it is believed that the mutation affects gene regulation in the brain, leading to the symptoms of the disease. The disease often begins with focal dystonia, typically in the face, neck, or limbs, which can progress to generalized dystonia. Over time, parkinsonian features may also develop. Symptoms usually begin in early to mid-adulthood. The progression of XDP varies, but the disease often leads to severe disability. Dystonia tends to dominate in the early stages, while parkinsonism becomes more pronounced later. However, parkinsonian traits may also appear already in the early stages, such as in the second year from the onset of the disease. XDP is almost exclusively found in individuals with ancestry from the Panay Island in the Philippines, particularly in the province of Capiz. Present treatment focuses on managing symptoms, typically through medications used for dystonia and Parkinson's disease, botulinum toxin injections, and deep brain stimulation (DBS) in severe cases. While XDP may be characterized in part by symptoms similar to Parkinson’s disease, there are key pathological differences between XDP and Parkinson’s disease. XDP is characterized by progressive degeneration of specific neurons in the striatum, especially of medium spiny neurons (MSNs), also known as spiny projection neurons (SPNs), which are inhibitory GABAergic neurons. In contrast, Parkinson’s disease is characterized by degeneration and loss of dopaminergic neurons in the substantia nigra. Furthermore, individuals having Parkinson’s disease do not typically carry a mutation associated with XDP as described elsewhere herein. Present treatments of XDP involve using medications to address dystonia, parkinsonism, or both. Parkinsonism symptoms can improve with levodopa or dopamine agonist therapy. Dystonic features can improve in response to anticholinergics or benzodiazepines such as clonazepam. Any treatment or medical use provided by the invention may include one or more additional medicaments the treatment of XDP. Typically such one or more additional medicaments include levodopa, dopamine agonist therapy and / or another medicament for the treatment of Parkinsons, and / or an anticholinergic or benzodiazepine such as clonazepam and / or another medicament for the treatment of dystonia. In one aspect the invention provides a pharmaceutical composition for the treatment of XDP or an individual at risk of developing XDP comprising 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof and one or more additional medicaments the treatment of XDP. The one or more additional medicaments the treatment of XDP are preferably levodopa, dopamine agonist therapy and / or another medicament for the treatment of Parkinsons, and / or an anticholinergic or benzodiazepine such as clonazepam and / or another medicament for the treatment of dystonia. In a preferred embodiment the one or more additional medicaments the treatment of XDP is levodopa and / or an anticholinergic or benzodiazepine such as clonazepam. As used herein, the terms "treatment," "treat," and "treating" refer to delaying, reducing, or preventing the onset of or the progress of a disease, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have developed. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be administered to an individual at risk, such as an individual carrying a genetic modification associated with XDP as described herein, prior to the onset of symptoms. The treatment administered prior to the onset of symptoms may result in delaying, reducing or preventing the onset of symptoms of XDP in said individual. Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence. Treatment with 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof can ameliorate one or more symptoms of the disease. The treatment with 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof can reduce one or more symptoms, especially dystonia in the treated individuals. It can reduce the frequency and severity of involuntary muscle contractions, alleviate pain, and improve function and quality of life. The effectiveness of the treatment may vary depending on the type of severity of the dystonia. The treatment with 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof can reduce symptoms of Parkinsonism in XDP patients. One of these is bradykinesia. In XDP, bradykinesia can manifest as difficulty in initiating movements, reduced spontaneous movement, and slower execution of tasks. The treatment can reduce one or more of these symptoms. Treatment with 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof can reduce muscle stiffness and resistance to movement in the individual. Tremors are less prominent in XDP. When present, they are usually resting tremors, meaning they occur when the muscles are relaxed and not in use. Treatment with 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof can improve the ability to make facial expressions. XDP is a progressive disease. Progression is defined by the gradual worsening of both dystonia and parkinsonism symptoms over time. Treatment with 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof can in particular slow or delay the progression of the disease compared to non-treated controls. Treatment with 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof can aid individuals who are at risk of developing the disease. The term “individual at risk” as used herein refers to an individual carrying a genetic modification associated with XDP, but that has not yet developed significant symptoms of XDP. Preferably, the genetic modification associated with XDP comprises one or more modifications in and / or around TATA-binding protein-associated factor-1 (TAF1) gene. In some embodiments, the genetic modification associated with XDP comprises modifications selected from disease-specific single-nucleotide substitutions DSC1, DSC2, DSC3, DSC10, DSC12; a 48-bp deletion and / or a SINE- Alu-VNTR (SVA) retrotransposon insertion in TAF1 gene. Preferably, the genetic modification comprises a SINE-Alu-VNTR (SVA) retrotransposon insertion in TAF1 gene. In most preferred embodiments, the genetic modification associated with XDP comprises the approximately 2.6 kb SINE-Alu-VNTR (SVA) retrotransposon insertion in intron 32 of the TATA-binding protein-associated factor-1 gene (TAF1) on chromosome Xq13, with the variable length VNTR. Treatment with 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof prior to developing significant symptoms can delay, reduce or prevent the onset of the symptoms of the disease. Preferably, the SVA retrotransposon insertion in TAF1 gene comprises a (CCCTCT)n hexamer repeat, wherein n is at least 20, preferably at least 30, at least 35, at least 40, or at least 55. Individuals with XDP and / or individuals carrying a genetic modification typically have between 20-55 hexamer repeats. In some embodiments, the SVA retrotransposon insertion comprises a (CCCTCT)n hexamer repeat, wherein n is at least 33, such as wherein n is 33-39. In other embodiments, a (CCCTCT)n hexamer repeat, wherein n is at least 40, such as wherein n is at least 40-55. Without being bound by theory, it is believed that the repeat number inversely correlates with age at disease onset, wherein a greater number of hexamer repeats is associated with an earlier onset of symptoms. For example, individuals with (CCCTCT)n hexamer repeat, wherein n is 40-55 may develop symptoms in their third or fourth decade of life, such as at an age of about 30-45 years. Individuals with (CCCTCT)n hexamer repeat, wherein n is 33-39 may develop symptoms in their fifth or sixth decade of life, such as at an age of about 50-60 years. In preferred embodiments, individuals afflicted with XDP have a (CCCTCT)n hexamer repeat, wherein n is at least 20, such as wherein n is between 35-55. In preferred embodiments, individuals carrying a modification associated with XDP have a have a (CCCTCT)n hexamer repeat, wherein n is at least 20, such as wherein n is between 30-55. The terms ‘subject’ and ‘individual’ are used interchangeably herein. The subject or individual can be an animal such as a laboratory animal. It is preferred that the subject or individual is a human. 5-Aminolevulinic acid (5-ALA) is a naturally occurring compound found in the human body, serving as an intermediate in the biosynthesis of heme
[0021] . Specifically, 5-ALA is first converted to porphobilinogen, which undergoes sequential enzymatic transformations via hydroxymethylbilane, uroporphyrinogen III, coproporphyrinogen III, and protoporphyrinogen IX which is further converted to protoporphyrin IX (PpIX). The final step of the heme biosynthesis pathway involves insertion of ferrous iron (Fe²⁺) into PpIX by ferrochelatase, thereby forming heme. Medical importance of 5-ALA has significantly increased in recent years. In 2017, the FDA approved 5-ALA, marketed as Gleolan, as an optical imaging agent to enhance resection of malignant brain tumor during surgery
[0022] . It is also used medically in photodynamic therapy (PDT) and for fluorescence- guided surgery, particularly in the treatment of certain cancers. Recent studies have demonstrated that 5-ALA is metabolized to produce intracellular porphyrins and protoporphyrin IX (PpIX), known G4-binding agents [24, 25]. 5-ALA is typically marketed in the form of an acid or of a salt. 5-ALA is the pure acidic form of 5-ALA. It is often used in biochemical research. The acidic form is less stable and can degrade.5-ALA salts are typically more stable. 5-ALA salt can exist in many forms. The presently most commonly marketed form is 5- Aminolevulinic Acid Hydrochloride (CAS 5451-09-2). It is more commonly used due to its stability and ease of handling. The hydrochloride salt form is water-soluble and is often used in medical applications. It is more stable than the acid form, which makes it preferable for storage and use in various applications. In the clinic 5-ALA is typically applied topically or administered orally to patients undergoing photodynamic therapy for certain types of skin cancer or for intraoperative visualization of tumors. For the present invention the means of administration may be oral, intrathecal or intracerebral. In preferred embodiments, the means of administration is oral. Common formulations for oral 5-ALA are tablets or capsules. An example of commercially available 5-ALA tablets is a nutritional supplement comprising 50 mg 5-ALA sold by Neo Pharma Japan. The capsules typically contain the hydrochloride salt, which is stable and water-soluble. The dosage varies depending on the indication, typically ranging from 10 mg to 250 mg per capsule. 5-ALA treatment is currently used in the diagnosis of bladder cancer, gliomas, and other tumors where it helps to visualize malignant tissue under a specific wavelength of light. Similar to capsules, tablets are typically formulated to contain 5-ALA hydrochloride. They can be immediate-release or extended-release, depending on the desired pharmacokinetic profile. Tablets are used in similar clinical settings as capsules. There are also powder formulations of 5-ALA. Such formulations allow the powder to be dissolved in water or another liquid before ingestion. It is useful for patients who may have difficulty swallowing capsules or tablets. This formulation is also used in clinical settings for controlled administration of 5- ALA such as before a diagnostic procedure. Alternatively, the means of administration is intrathecal or intracerebral which are particularly useful for bypassing the blood-brain barrier. Intrathecal administration as used herein refers to administration into the spinal canal. Intracerebral administration as used herein refers to administration into and / or around brain. Intracerebral administration may also include administration into ventricles of the brain.5-ALA and its derivatives may be administered intrathecally or intracerebrally via bolus injection or continuous infusion. 5-ALA and its derivatives may be in the form of an immediate release or in the form of a slow-release formulation. In preferred embodiments, 5-ALA and its derivates are provided intrathecally or intracerebrally in the form of a slow-release formulation. The term “slow- release” as used herein refers to a controlled, sustained or prolonged release of a compound (e.g., 5-ALA) over prolonged time period such as over a period of several days or weeks. Suitable slow-release delivery systems include biodegradable polymer matrix, nanoparticles, liposomal carriers. Slow-release formulations in the context of intrathecal administration may also include implantable intrathecal device such as intrathecal catheter connected to a pump / reservoir that provides controlled and / or programmable infusion over extended time period. Slow-release formulations in the context of intracerebral administration may also include injectable hydrogels, or biodegradable implants. The dose of 5-ALA depends on the specific application, typically ranging from 1 mg / kg to 20 mg / kg, preferably 2 mg / kg to 10 mg / kg body weight per day. Such a dose is suitable for the treatment of XDP or an individual at risk of developing XDP. The dose can also be given in a wider range when needed to achieve effect or to reduce serious side-effects. The dose for an individual at risk of developing XDP can be the same dose as the dose given to a patient with established symptoms. Alternatively it can be managed to reduce side effects if applicable. Suitable daily doses of 5-ALA include doses such as at least 30 mg, at least 50 mg, at least 100 mg, at least 150 mg, at least 200 mg, or at least 250 mg depending on body weight of the individual. A total daily dose as described herein above may be administered once per day, or divided in smaller sub-doses such as in 2, 3 or 4 sub-doses. For example, a daily dose of 200mg may be divided over two sub-doses of 100mg and administered throughout the course of the day (e.g. in the morning and in the evening). 5-ALA administration may be continuous day-after-day administration, as well as periodic or limited administration, although continuous day-after-day administration is generally desirable.5-ALA may be administered daily and continuously for a period of at least 4 weeks, at least 1 month, at least 3 months, at least 6 months, at least 1 year, at least 2 years. The daily administration may also be maintained for several years, such as for at least 3 years, including at least 5 year, including at least 10 years. As 5-ALA is metabolized in the body it is preferred to administer it on a regular basis during the day and / or in the form of an extended release formulation. Patients are recommended to avoid direct sunlight and bright lights after taking 5-ALA due to the risk of phototoxicity, as 5-ALA increases photosensitivity. Common side effects include nausea, vomiting, and photosensitivity reactions. The oral formulations ensure that 5-ALA is delivered effectively to the body, where it is then metabolized to protoporphyrin IX, a photosensitive compound for therapeutic effect. The use of 5-ALA and esters of 5-ALA (5-amino-4-oxo-pentanoic acid) otherwise known as 5-aminolevulinic acid) in PDT is well known. Application of 5- ALA in such therapy is typically topical, usually in the form a cream or ointment. 5-ALA and all such derivatives of 5-ALA, as well as their pharmaceutically acceptable salts, are suitable for the uses and methods herein described. The 5-ALA derivatives useful in accordance with the invention may be any derivative of 5-ALA capable of forming porphyrin or protoporphyrin IX (PpIX) in vivo. Typically, such derivatives will be a precursor of PpIX or of a PpIX derivative (e.g. a PpIX ester) in the biosynthetic pathway for heme and which are therefore capable of inducing an accumulation of PpIX at the site to be treated following administration in vivo. Suitable precursors of PpIX or PpIX derivatives include 5- ALA prodrugs which might be able to form 5-ALA in vivo as an intermediate in the biosynthesis of PpIX or which may be converted (e.g. enzymatically) to porphyrins without forming 5-ALA as an intermediate. 5-ALA esters are among the preferred compounds for use in the methods herein described. Esters of 5-aminolevulinic acid and N-substituted derivatives thereof are preferred compounds for use in the invention. Those compounds in which the 5- amino group is unsubstituted (i.e. the ALA esters) are particularly preferred. Such compounds are generally known and described in the literature (see, for example, WO96 / 28412, WO02 / 10120 and WO2005 / 092838 to PhotoCure ASA, the contents of which are incorporated herein by reference). These patent application publications are referred to herein specifically for the 5-ALA-esters, the salts and the addition salts described therein, which 5-ALA esters are all suitable 5-ALA ester for use in the present inventions. The compounds of WO96 / 28412 are the compounds of formula (I) and the preferred embodiments of the compounds described therein wherein formula I is, R22N-CH2COCH2-CH2CO-OR1(I); wherein R1may represent alkyl optionally substituted by hydroxy, alkoxy, acyloxy, alkoxycarbonyloxy, amino, aryl, oxo or fluoro groups and optionally interrupted by oxygen, nitrogen, sulphur or phosphorus atoms,- and R2, each of which may be the same or different, represents a hydrogen atom or a group R1) and salts thereof. The compounds of WO02 / 10120 are the compounds of formula (II) and the preferred embodiments of the compounds described therein wherein formula II is, R22N-CH2COCH2-CH2CO-OR1(II); wherein R1represents an optionally substituted alkyl group other than an unsubstituted straight-chained alkyl; and R2independently represents a hydrogen atom or an optionally substituted alkyl group) or a pharmaceutically acceptable salt thereof. In a preferred embodiment R1in formula II represents an optionally substituted branched alkyl group, preferably a C5-30 alkyl group, or R1represents a substituted alkyl group; R2, each of which may be the same or different, represents a hydrogen atom or an optionally substituted alkyl group, e.g. a group R1; wherein any substituted alkyl group is substituted by one or more groups selected from hydroxy, alkoxy, acyloxy, alkoxycarbonyloxy, amino, aryl, nitro, oxo, fluoro, - SH, -NR32 and -PR32 groups, and any alkyl group is optionally interrupted by one or more -0-, -NR3-, -S-or -PR3- groups, in which R3in formula II represents a hydrogen atom or a C1-6 alkyl group) The compounds of WO2005 / 092838 are the acid addition salt of compounds of formula (III) and the preferred embodiments of the compounds described therein wherein formula III is R22N-CH2C0CH2-CH2C0-0R1(III) wherein R1and R2each independently represents a hydrogen atom or an optionally substituted straight-chained, branched or cyclic alkyl group which may optionally be interrupted by one or more -0-, -NR3-, -S-or -PR3- groups; and R3is a hydrogen atom or a C1-6 alkyl group) and wherein the acid to prepare the acid addition salt is an acid with a pKa of about 5 or less, preferably of about 3 or less, wherein in a particularly preferred embodiment the acid for the preparation of the acid addition salt is sulfonic acid. In a preferred embodiment R1in formula III either represents an unsubstituted alkyl group (e.g. C1-6- alkyl) or an alkyl group (e.g. C1-2 alkyl) substituted by an aryl group (e.g. phenyl) and / or each R2in formula III represents a hydrogen atom. In a preferred embodiment R1in formula III is a benzyl or substituted benzyl group. Said compound of formula III is preferably 5-ALA, 5-ALA methyl ester, 5-ALA hexyl ester, 5-ALA benzyl ester, 5-ALA 2-methylpentyl ester, 5-ALA 4-methylpentyl ester, 5-ALA 2- (2-ethoxyethoxy)ethyl ester, 5-ALA 4- methylbenzyl ester or 5-ALA 4-isopropylbenzyl ester. In a preferred embodiment R1in formula III is 5-ALA, 5-ALA methyl ester, 5-ALA hexyl ester or 5-ALA benzyl ester. Esters of 5-aminolevulinic acid with substituted or unsubstituted alkanols, i.e. alkyl esters are especially preferred compounds for use in the invention. Examples of such compounds include those of general formula IV: R22N—CH2COCH2—CH2CO—OR1(IV) wherein R1represents a substituted or unsubstituted straight-chained, branched or cyclic alkyl group (e.g. a substituted or unsubstituted straight-chained alkyl group); and each R2independently represents a hydrogen atom or an optionally substituted alkyl group, e.g. a group R1) and pharmaceutically acceptable salts thereof. As used herein, such as used in formula’s I, II, III or IV, the term “alkyl”, unless stated otherwise, includes any long or short chain, cyclic, straight-chained or branched aliphatic saturated or unsaturated hydrocarbon group. The unsaturated alkyl groups may be mono- or polyunsaturated and include both alkenyl and alkynyl groups. Unless stated otherwise, such groups may contain up to 40 atoms. However, alkyl groups containing up to 30, preferably up to 10, particularly preferably up to 8, especially preferably up to 6, e.g. up to 4 carbon atoms are preferred. The substituted alkyl R1and R2groups may be mono or poly-substituted. Suitable substituents may be selected from hydroxy, alkoxy, acyloxy, alkoxycarbonyloxy, amino, aryl, nitro, oxo, fluoro, —SR3, —NR32 and —PR32 groups, and each alkyl group may be optionally interrupted by one or more —O—, —NR3—, —S— or —PR3— groups, in which R3 is a hydrogen atom or a C1-6 alkyl group). Preferred substituted alkyl R1groups include those carrying one or more oxo groups, preferably straight-chained C4-12 alkyl (e.g. C8-10 alkyl) groups substituted by one, two or three (preferably two or three) oxo groups. Examples of such groups include 3,6-dioxa-1-octyl and 3,6,9-trioxa-1-decyl groups. Particularly preferred for use in the invention are those compounds of formula I, II, III and IV in which at least one R2represents a hydrogen atom. In especially preferred compounds each R2represents a hydrogen atom. Compounds of formula I, II, III and IV in which R1represents an unsubstituted alkyl group (preferably C1-8 alkyl, e.g. C1-6 alkyl) or an alkyl group (e.g. C1-2 alkyl, especially C1 alkyl) substituted by a substituent as hereinbefore defined (e.g. by an aryl group such as phenyl or by an alkoxy group such as methoxy) are also preferred. Unsubstituted alkyl groups which may be used in the invention include both branched and straight-chained hydrocarbon groups. Compounds of formula I, II, III and IV in which R1is a C4-8, preferably a C5-8, straight chain alkyl group which is branched by one or more C1-6 (e.g. C1-2 alkyl) groups are preferred. Representative examples of suitable unsubstituted branched alkyl groups include 2-methylpentyl, 4-methylpentyl, 1-ethylbutyl and 3,3-dimethyl-1-butyl. 4-methylpentyl is particularly preferred. Compounds of formula I, II, III and IV in which R1is a C1-10 straight-chained alkyl group are also preferred. Representative examples of suitable unsubstituted alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl and octyl (e.g. n- propyl, n-butyl, n-pentyl, n-hexyl and n-octyl). Hexyl, especially n-hexyl, is a particularly preferred group. Methyl is also particularly preferred. Also preferred for use in the invention are those compounds of formula I, II, III and IV in which R1represents a C1-2 alkyl group (preferably a C1 alkyl group) optionally substituted by an aryl group. Still further preferred for use in the invention are those compounds of formula I in which R1represents an alkyl group (e.g. C1-2 alkyl, especially C1 alkyl) substituted by an aryl group (e.g. phenyl). Preferred substituted alkyl R1groups which may be present in compounds of formula I, II, III and IV include C1-6 alkyl, preferably C1-4 alkyl, particularly preferably C1 or C2 alkyl (e.g. C1 alkyl) substituted (preferably terminally substituted) by an optionally substituted aryl group. By an “aryl group” is meant a group which is aromatic. Preferred aryl groups comprise up to 20 carbon atoms, more preferably up to 12 carbon atoms, for example, 10 or 6 carbon atoms. Aryl groups which may be present in the compounds of the invention may be heteroaromatic (e.g. 5-7 membered heteroaromatics) but are preferably non- heteroaromatic. By “non-heteroaromatic” is meant an aryl group having an aromatic system comprising electrons originating solely from carbon atoms. Preferred aryl groups include phenyl and napthyl, especially phenyl. In preferred compounds for use in the invention one or two aryl groups may be present, preferably one. Aryl groups which may be present in the compounds of the invention may optionally be substituted by one or more (e.g.1 to 5), more preferably one or two, groups (e.g. one group). Preferably the aryl group is substituted at the meta or para position, most preferably the para position. Suitable substituent groups may include haloalkyl (e.g. trifluoromethyl), alkoxy (i.e. —OR groups wherein R is preferably a C1-6 alkyl group), halo (e.g. iodo, bromo, more especially chloro and fluoro), nitro and C1-6 alkyl (preferably C1-4 alkyl). Preferred C1-6 alkyl groups include methyl, isopropyl and t-butyl, particularly methyl. Particularly preferred substituent groups include chloro and nitro. Still more preferably the aryl group is unsubstituted. In a further preferred aspect the invention provides a compound of formula I, II, III and IV wherein R1represents an aryl substituted C1-4 alkyl group (preferably C1-2, e.g. C1), preferably wherein said aryl group comprises up to 20 carbon atoms (e.g. up to 12 carbon atoms, especially 6 carbon atoms) and is itself optionally substituted, and each R2is as hereinbefore defined (e.g. each R2is hydrogen), or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for use in XDP or for use in an individual at risk of developing XDP. Preferred compounds for use in the invention include methyl ALA ester, ethyl ALA ester, propyl ALA ester, butyl ALA ester, pentyl ALA ester, hexyl ALA ester, octyl ALA ester, 2-methoxyethyl ALA ester, 2-methylpentyl ALA ester, 4-methylpentyl ALA ester, 1-ethylbutyl ALA ester, 3,3-dimethyl-1-butyl ALA ester, benzyl ALA ester, 4-isopropylbenzyl ALA ester, 4-methylbenzyl ALA ester, 2-methylbenzyl ALA ester, 3-methylbenzyl ALA ester, 4-[t-butyl]benzyl ALA ester, 4- [trifluoromethyl]benzyl ALA ester, 4-methoxybenzyl ALA ester, 3,4-[di- chloro]benzyl ALA ester, 4-chlorobenzyl ALA ester, 4-fluorobenzyl ALA ester, 2- fluorobenzyl ALA ester, 3-fluorobenzyl ALA ester, 2,3,4,5,6-pentafluorobenzyl ALA ester, 3-nitrobenzyl ALA ester, 4-nitrobenzyl ALA ester, 2-phenylethyl ALA ester, 4-phenylbutyl ALA ester, 3-pyridinyl-methyl ALA ester, 4-diphenyl-methyl ALA ester and benzyl-5-[(1-acetyloxyethoxy)-carbonyl]amino levulinate. Still further preferred compounds for use in the invention include methyl ALA ester, ethyl ALA ester, 2-methoxyethyl ALA ester, benzyl ALA ester, 4- isopropylbenzyl ALA ester, 4-methylbenzyl ALA ester, 2-methylbenzyl ALA ester, 3-methylbenzyl ALA ester, 4-[t-butyl]benzyl ALA ester, 4-[trifluoromethyl]benzyl ALA ester, 4-methoxybenzyl ALA ester, 3,4-[di-chloro]benzyl ALA ester, 4- chlorobenzyl ALA ester, 4-fluorobenzyl ALA ester, 2-fluorobenzyl ALA ester, 3- fluorobenzyl ALA ester, 2,3,4,5,6-pentafluorobenzyl ALA ester, 3-nitrobenzyl ALA ester, 4-nitrobenzyl ALA ester, 2-phenylethyl ALA ester, 4-phenylbutyl ALA ester, 3-pyridinyl-methyl ALA ester, 4-diphenyl-methyl ALA ester and benzyl-5-[(1- acetyloxyethoxy)-carbonyl]amino levulinate. Particularly preferred compounds for use in the invention include methyl ALA ester, hexyl ALA ester and benzyl ALA ester, especially methyl ALA ester. The compounds for use in the invention may be prepared by any conventional procedure available in the art (e.g. as described in WO02 / 10120 to PhotoCure ASA). For example, esters of 5-ALA may be prepared by reaction of 5-ALA with the appropriate alcohol in the presence of acid. Alternatively compounds for use in the invention may be available commercially (e.g. from PhotoCure ASA, Norway). The compounds for use according to the invention may be in the form of a free amine (e.g. —NH2, —NHR2or —NR2R2) or preferably in the form of a physiologically acceptable salt. Such salts preferably are acid addition salts with physiologically acceptable organic or inorganic acids. Suitable acids include, for example, hydrochloric, nitric, hydrobromic, phosphoric, sulphuric, sulphonic and sulphonic acid derivatives. Hydroiodic acids may also be suitable. Particularly preferred salts are acid addition salts with hydrochloric acid and sulphonic acid derivatives (e.g. mesylate or tosylate) as described in WO2005 / 092838 to PhotoCure ASA, the entire contents of which are incorporated herein by reference. Procedures for salt formation are conventional in the art. In the uses and methods of the invention compound as hereinbefore defined, preferably 5-ALA or an ester of 5-ALA may be used alone in XDP or an individual at risk of developing XDP. Alternatively, a combination of two or more; preferably two, compounds as described herein may be used wherein at least one of the compounds is selected from 5-ALA and an ester of 5-ALA, or a pharmaceutically acceptable salt thereof. Porphyrins are a group of heterocyclic, macrocyclic, organic compounds, composed of four modified pyrrole subunits interconnected at their α carbon atoms via methine bridges (=CH−). In vertebrates, an essential member of the porphyrin group is heme, which is a component of hemoproteins, whose functions include carrying oxygen in the bloodstream. Porphyrin complexes have a square planar MN4 core. The periphery of the porphyrins, consisting of sp2-hybridized carbons, generally display small deviations from planarity. For free porphyrins, the two pyrrole protons are mutually trans and project out of the N4 plane. These nonplanar distortions are associated with altered chemical and physical properties. The porphyrin as referred to herein is preferably a porphyrin from the group of heme, uroporphyrin, coproporphyrin or protoporphyrin IX or a derivative or synthetic analogue thereof such as octaethylporphyrin, tetraphenylporphyrin, or TMPyP4. Preferably, the porphyrin is an active 5-ALA metabolite such as Protoporphyrin IX (PpIX). Protoporphyrin IX, the chemical structure of which is depicted in figure 8D, is a preferred porphyrin. Protoporphyrin IX (CAS 553-12-8) is an important precursor to biologically essential prosthetic groups such as heme, cytochrome c, and chlorophylls. As a result, a number of organisms are able to synthesize this tetrapyrrole from basic precursors such as glycine and succinyl-CoA, or glutamic acid. Despite the wide range of organisms that synthesize protoporphyrin IX, the process is largely conserved from bacteria to mammals with a few distinct exceptions in higher plants. In the biosynthesis of those molecules, the metal cation is inserted into protoporphyrin IX by enzymes called chelatases. For example, ferrochelatase converts the compound into heme B (i.e. Fe-protoporphyrin IX or protoheme IX). In chlorophyll biosynthesis, the enzyme magnesium chelatase converts it into Mg-protoporphyrin IX. The general term protoporphyrin refers to porphyrin derivatives that have the outer hydrogen atoms in the four pyrrole rings replaced by other functional groups. In modern times, 'proto-' specifies a porphyrin species bearing methyl, vinyl, and carboxyethyl / propionate side groups. Preferred synthetic porphyrins are octaethylporphyrin, tetraphenylporphyrin and TMPyP4 (meso-5,10,15,20-Tetrakis-(N-methyl-4-pyridyl)porphine), the structure of which is depicted in figures 8E, 8F and 8G, respectively. More preferably, the synthetic porphyrin is TMPyP4. Furthermore the compounds for use according to the invention may be formulated and / or administered with other active components which are able to increase the therapeutic effect. For example, chelating agents may beneficially be included and / or co-administered in order to enhance the accumulation of Pp; the chelation of iron by the chelating agent prevents its incorporation into Pp to form heme by the action of the enzyme ferrochelatase, thereby leading to a build-up of Pp. Suitable chelating agents include aminopolycarboxylic acids, including any of the chelants described in the literature for metal detoxification or for the chelation of paramagnetic metal ions in magnetic resonance imaging contrast agents. Particular mention may be made of EDTA, CDTA (cyclohexane diamine tetraacetic acid), DTPA and DOTA and well known derivatives / analogues thereof EDTA and DTPA are particularly preferred. To achieve the iron-chelating effect, desferrioxamine and other siderophores may also be used, e.g. in conjunction with aminopolycarboxylic acid chelating agents such as EDTA. Where present, the chelating agent may conveniently be used at a concentration of 0.05 to 20%, e.g. 0.1 to 10% (w / w). Penetration enhancers may also have a beneficial effect in enhancing the therapeutic effect of the compounds for use in the invention. Surface-penetration assisting agents, especially dialkylsuphoxides such as dimethylsulphoxide (DMSO), may therefore also be included in the compositions for use in the invention and / or co-administered. The surface-penetration assisting agent may be any of the skin- penetration assisting agents described in the pharmaceutical literature e.g. chelators (e.g. EDTA), surfactants (e.g. sodium dodecyl sulphate), non-surfactants, bile salts (e.g. sodium deoxycholate) and fatty acids (e.g. oleic acid). Examples of appropriate surface penetrating assisting agents include isopropanol, HPE-101 (available from Hisamitsu), DMSO and other dialkylsulphoxides, in particular n- decylmethyl-sulphoxide (NDMS), dimethylsulphacetamide, dimethylformamide (DMFA), dimethylacetamide, glycols, various pyrrolidone derivatives (Woodford et al., J. Toxicol. Cut. & Ocular Toxicology, 1986, 5: 167-177), and Azone® (Stoughton et al., Drug Dpv. Ind. Pharm. 1983, 9: 725-744), or mixtures thereof. The surface penetration agent may conveniently be provided in a concentration range of 0.2 to 50% (w / w), e.g. about 10% (w / w). The compositions for use in accordance with the invention may additionally include lubricating agents, wetting agents, emulsifying agents, suspending agents, preserving agents, sweetening agents, flavoring agents, adsorption enhancers, e.g. surface penetrating agents as mentioned below, and the like. The compounds for use according to the invention may be formulated in any conventional manner with one or more physiologically acceptable carriers or excipients, according to techniques well known in the art. Where appropriate, compounds or compositions for use in the invention are sterilized, e.g. by γ- irradiation, autoclaving or heat sterilization, before or after the addition of a carrier or excipient where that is present, to provide sterile formulations. The compositions of the invention may also be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the patient by employing procedures well known in the art. Solubilizing and / or stabilizing agents may, for example, be used, e.g. cyclodextrins (CD) α, β, γ and HP- β cyclodextrin. Compositions may be in any appropriate dosage form, for example as an emulsion or in liposomes, niosomes, microspheres, nanoparticles or the like. The compounds for use in the invention may then be absorbed to, incorporated in or bound to these forms. The pH in the final composition is preferably in the range 2.5 to 7.4. Slightly acidic pH, for example pH 5-7, is preferred. Compositions may be administered systemically (e.g. orally or parenterally) or locally (e.g. by injection or topically) at or near the affected site. Compositions as described herein are preferably administered orally. Compositions that may be administered systemically include plain or coated tablets, capsules, suspensions and solutions containing the active component optionally together with one or more inert conventional carriers and / or diluents, e.g. with corn starch, lactose, sucrose, microcrystalline cellulose, magnesium stearate, polyvinylpyrrolidone, citric acid, tartaric acid, water, water / ethanol, water / glycerol, water / sorbitol, water / polyethyleneglycol, propyleneglycol, stearylalcohol, carboxymethylcellulose or fatty substances such as hard fat or suitable mixtures thereof. Compositions that may be administered locally (e.g. topically) include gels, creams, ointments, sprays, lotions, salves, sticks, soaps, powders, pessaries, aerosols, drops, solutions and any of the other conventional pharmaceutical forms in the art. Creams, ointments and gels are especially preferred. Creams, ointments and gels may be formulated with an aqueous or oily base with the addition of suitable thickening and / or gelling agents. Lotions may be formulated with an aqueous or oily base and will, in general, also contain one or more emulsifying, dispersing, suspending, thickening or coloring agents. Powders may be formed with the aid of any suitable powder base. Drops and solutions may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing, solubilising or suspending agents. Aerosol sprays are conveniently delivered from pressurised packs, with the use of a suitable propellant. Particularly preferably the compositions for use in XDP or in an individual at risk of developing XDP according to the invention will be in the form of a ready-to- use composition such as a cream or as a kit as hereinbefore defined. The concentration of the 5-ALA compounds described herein in the final compositions for PDT will vary depending on several factors including the chemical nature of the compound, the chemical composition, mode of administration and nature of the disease to be treated. Preferably, however, concentration ranges of less than 20% wt, more preferably less than 10% wt, still more preferably 0.05 to 8% wt, yet more preferably 0.5 to 6% wt, e.g.1.5 to 4.5% wt or 2 to 4% wt are used. The most preferred concentrations for local (e.g. topical) administration is in the range 2 to 4% wt. Thus viewed from a yet further aspect the invention provides a pharmaceutical composition comprising 5-ALA or an ester of 5-ALA as hereinbefore defined and a pharmaceutically acceptable carrier or excipient, wherein the concentration of said 5-ALA or an ester of 5-ALA is 2 to 8% wt (e.g. 2 to 4.5% wt). Viewed from a still further aspect the invention provides a pharmaceutical composition comprising 5-ALA or an ester of 5-ALA as hereinbefore defined and a pharmaceutically acceptable carrier or excipient, wherein the concentration of said 5-ALA or an ester of 5-ALA is 2 to 8% wt (e.g.2 to 4.5% wt) for use in therapy (e.g. XDP). By the term “administered” is meant that the composition is delivered to the subject or individual. This may be achieved, for example, by applying the composition to the skin and allowing it to permeate therethrough. Preferably the composition is administered at regular intervals preferably in the form of an extended release formulation. We utilize 5-ALA, a precursor of G4 binding agents, to modulate G4 stability within the pathogenic XDP-SVA. The invention will now be described in more detail by way of the following non-limiting examples. For the purpose of clarity and a concise description features are described herein as part of the same or separate embodiments, however, it will be appreciated that the scope of the invention may include embodiments having combinations of all or some of the features described. FIGURE LEGENDS Figure 1. XDP patient cells display a molecular phenotype reminiscent of a transcriptional blockage of TAF1 transcription by G4-forming sequences in the SVA insertion. A) Genomic position of the pathogenic SVA insertion in XDP patients. The SVA is positioned in opposite direction of the TAF1 gene B) Proposed model, showing how G4 sequences in the SVA form a blockade for the progression of RNA PolII, leading to increased intron retention of intron 32, and a decrease in expression of full length TAF1 transcript, evidenced by the relatively lower expression levels of exons downstream of the SVA insertion. Figure 2. A) schematic showing the position of the hexamer repeat (CCCTCT) in the SVA within the TAF1 locus in XDP patients. Note that the SVA is positioned on the negative strand, and the hexamer repeat the RNA Polymerase encounters during transcription consists of the reversed complemented AGAGGG sequence. B) The AGAGGG repeat sequence is variable in size in XDP patients, varying between 35-55 repeats [4]. G4 motif analysis and G4 prediction tools indicate the Hexamer repeat region as extraordinarily rich in G4-forming sequences. C) While most SVA insertions display a repeat of the hexamer sequence, the number of repeats varies wide between SVA classes, but also between individual SVA insertions. In our genome, only 17 out of 3000 SVAs contain a hexamer repeat that exceeds 35 repeats, indicating that the size of the hexamer repeat in the XDP-SVA is of an extraordinary size. Figure 3. 5-ALA treatment reduces TAF1 i32 expression in XDP patient iPSCs. A) RNA-seq profile of intron retention of intron 32 in the TAF1 locus in two XDP patient cell lines (XDP1 / XDP2) and the isogenic control lines where the SVA was deleted (dSVA1 / dSVA2). The position of q-RT-PCR amplicon is indicated by the black bar at the bottom of the figure. B) Schematic of 5-ALA metabolism, showing the derivation of porphyrins from 5-ALA and hence the indirect effect of 5- ALA on G4-destabilization. (C-G) Quantification of TAF1 i32 RNA expression levels in 5-ALA treated (C) XDP1, (D) XDP2, (E) XDP3, (F) XDP4, and (G) dSVA1 iPSCs. Relative quantification was assessed using quantitative reverse transcription PCR (qRT-PCR) where i32 expression levels were normalized to TAF1 exon 27. Each bar represents the mean ± SEM of N=6 replicate samples. Statistical significance was assessed using a two-sided t-test, *p-value<0.05, ns = not significant. (H) Hexamer repeat sizes in 4 different XDP patients, analyzed in this study. Figure 4. 5-ALA treatment increases expression of downstream TAF1 exons. Quantification of TAF1 i32 and exon expression level in untreated and 5-ALA treated (A) XDP1, (B) XDP3 and C) the control dSVA1 iPSCs. Relative quantification was assessed using Cap-seq where TAF1 exons 1-28 were used for normalization. Each bar represents the mean ± SEM of six biological replicates. Analysis was performed using DESeq2 with default parameters. Exons were considered differentially expressed if they had a p-value < 0.05 and exhibited greater than 25% change in expression (fold-change > 1.25 or < 0.75). *p- value<0.05. For all panels, exons with significantly changed levels are highlighted with grey background, significant exons are indicated by an asterisk. The vertical dashed line indicates the position of the XDP-SVA in intron 32 of TAF1. In panel C the scissor indicates the removal of the XDP-SVA by CRISPR-Cas9 mediated deletion. Figure 5. 5-ALA does not affect transcriptional aberrations in other G4- implicated repeat expansion disorders. Panel A, overview of the FMR1 locus and the CGG repeat associated with Fragile X syndrome. Showing in dark blue a CGG repeat driven transcript present in unmethylated full mutation carriers, both as the annotated transcript and the raw mapped RNA-seq data with a zoom in of the region. In light blue, the CGG repeat and the predicted, unexpanded G4 forming sequence. Panel B, overview of the C9orf72 locus showing the expanding repeat in light blue and a zoom in of the region, primer locations for measurement of intron 1 expression shown in red alongside results of RT-PCR in a control iPSC line and 2 ALS individual iPSC lines. Quantification of intron 1 expression levels in 5-ALA treated (C) FMR1 unmethylated expansion carrier fibroblasts, (D) Control iPSCs, (E) ALS1 iPSCs, and (F) ALS2 iPSCs. Relative quantification was assessed using quantitative reverse transcription PCR (qRT-PCR) where intron 1 expression levels were normalized to (C) FMR1 downstream exons x-x, (D-E) C9orf72 downstream exons x-x . Each bar represents the mean ± SEM of N=6 replicate samples. Statistical significance was assessed using a two-sided t-test, ns = not significant. Figure 6. 5-ALA restores 39% of the transcriptional phenotype associated with XDP. A) Plot showing differential genes in XDP iPSCs compared to the isogenic control cell line dSVA1 where the pathogenic SVA is removed. B) Expression of overall TAF1 expression is normalized upon SVA genetic removal C) GO term analysis of differentially expressed genes show many processes involved in RNA Polymerase II transcription being affected, as expected from the reduced availability of the general transcription factor TAF1 in XDP cells. D) heatmap showing the normalization of 39% of XDP-associated gene expression abnormalities upon 5-ALA treatment (the lower two clusters), a total of 1345 genes. Figure 7. Proposed model of action of 5-ALA and it’s active Porphyrin metabolites such as protoporphyrin IX (PpIX) in normalizing the molecular phenotypes of XDP. The 5-ALA derived porphyrins counteract or prevent the formation of G4-quadruplex structures in the XDP-SVA and thereby remove the blockage for RNA-polymerase to produce full length TAF1 transcripts. Figure 8. Structures of compounds (A) 5-ALA, (B) 5-ALA methyl ester also referred to as methyl-aminolevulinate or MAL, (C) porphyrin, (D) protoporphyrin IX, (E) octaethylporphyrin, (F) tetraphenylporphyrin and (G) TMPyP4. EXAMPLES The Hexamer repeat of the XDP-SVA is extremely large and rich for G4 motifs Recent studies suggest that the G-rich sequences within SVAs can form non- canonical four-stranded G4 structures known to impede polymerases [17–19]. Previous research using in-depth in silico analysis has revealed the presence of multiple motifs with the capacity to form G4 structures within the pathogenic XDP-SVA insertion [4]. One component of the SVA that is particularly rich in sequences that can form into G4-structures is the hexamer repeat region on the 5’- side of the SVA (Figure 2A). Most SVAs in our genome contain the hexamer CCCTCT sequence, and most SVAs contain the hexamer as a repeated sequence. Between and within SVA-classes, the size of the hexamer repeat varies widely, indicating the instability of the repeat as is observed for other repeat expansions (Figure 2B). To assess whether the size of the CCCTCT repeat in the XDP-SVA is comparable to other SVAs, we plotted repeat sizes of all fixed SVA insertions in our genome alongside the sizes of hexamer repeats observed in the XDP-SVA. While 99,4% of all genomic fixed SVAs had a hexamer repeat size < 35 repeats [4], the XDP-SVA stands out because of its extraordinarily long hexamer repeat size. Only 17 other SVAs had a hexamer repeat size in the same order, and only 6 of these were located inside an intron, similar to the XDP-SVA in the intron of TAF1. Noteworthy is that the upper range of hexamer sizes of the XDP-SVA were not observed in any of the other 3000 SVA insertions in our genome, indicating that the XDP-SVA is extraordinarily large and because intronic SVA insertions are not at all uncommon in our genome we hypothesize that it may not be so much the SVA itself, but rather the size of the hexamer repeat that underlays its pathogenic influence on TAF1 expression. Indeed, recent reports show that the size of the hexamer repeat is inversely correlated to disease onset (but not severity), supporting the observations we made with regards to the hexamer size in the XDP- SVA. The unusually large hexamer repeat in XDP SVA insertion contains multiple G-rich sequences as the source of multiple G4 quadruplex structures, which could impede the transcription of full length TAF1 transcripts by RNA Polymerase II. Indeed, G4 motif analysis and G4 prediction tools indicate the Hexamer repeat region as extraordinarily rich in G4-forming sequences (Figure 2C). 5-ALA treatment reduces TAF1 i32 expression in XDP patient iPSCs We hypothesized that the introduction of atypical G4 structures by the XDP-SVA insertion within TAF1 intron 32 may impede RNA polymerase activity (Fig 1B), leading to the aberrant TAF1 transcription observed in XDP (Fig 3A). While 5- ALA, through its active Porphyrin metabolites such as protoporphyrin IX (PpIX), has recently shown promise in modulating G4 structures, its therapeutic potential for XDP remains unexplored. To determine whether 5-ALA, through its Porphyrin metabolites (Fig 3B and Fig 8) has therapeutic potential for XDP, we treated both XDP and dSVA isogenic control (lacking the XDP-SVA insertion) induced pluripotent stem cells (iPSCs) with 5-ALA for 48 hours. Subsequently, quantitative reverse-transcription PCR (qRT-PCR) was employed to assess the level of TAF1 intron 32 (i32) expression between untreated and 5-ALA treated conditions. In patient 1 iPSCs (XDP1), treatment with 5-ALA resulted in a significant reduction of i32 expression at both 25uM (fold-change=0.717, p-value=2.24E-06) and 50uM (fold-change=0.722, p-value=2.290E-06) concentrations (Fig. 3C). Similar observations were made across three additional XDP patient iPSC lines treated with 5-ALA, where a significant reduction in i32 expression was observed for at least one concentration of 5-ALA tested. For XDP patient 2 iPSCs (XDP2), treatment with 25uM of 5-ALA resulted in a small but significant reduction of i32 expression (fold-change=0.945, p-value=0.0115) (Fig. 3D). For XDP patient 3 iPSCs (XDP3), treatment with both 25uM and 50uM of 5-ALA led to a significant reduction in i32 expression (25uM: fold-change=0.724, p-value=1.01E-06; 50uM: fold-change=0.786, p-value=8.5E-05) (Fig. 3E). Additionally, treatment of XDP patient 4 iPSCs (XDP4) with 50uM of 5-ALA resulted in a significant reduction of i32 expression (fold-change=0.768, p-value=0.0371) (Fig. 3F). Conversely, no significant changes in i32 expression were observed when patient 1 dSVA iPSCs (dSVA1), lacking the XDP-SVA insertion, were treated with 5-ALA (Fig. 3G). It is well established that TAF1 i32 levels are significantly elevated in XDP iPSCs compared to controls lacking the XDP-SVA insertion [5, 12]. Therefore, the observed reduction in i32 expression levels in 5-ALA treated XDP cells indicates an improvement in the XDP molecular phenotype, highlighting the therapeutic promise of 5-ALA in combating this neurological disorder. Noteworthy is the difference in size of the hexamer repeats between the 4 XDP patients and the fact that patient 2, which has the smallest hexamer repeat size also displays the smallest change in intron 32 retention (Fig. 3H). 5-ALA treatment increases expression of downstream TAF1 exons Previous studies have reported a slight decrease in the overall expression level of the TAF1 gene due to the presence of the XDP-SVA insertion [5, 12]. Subsequent analysis at the exon level further elucidated that the exons located in proximity to the XDP-SVA insertion site are primarily responsible for this observed decrease [5]. To investigate the impact of 5-ALA treatment on this molecular phenotype, we utilized capture RNA Capture-sequencing (RNA Cap-seq) and conducted exon-level differential expression (DE) analysis of the TAF1 gene. In the case of patient 1 (XDP1), exon-level DE analysis revealed a significant increase in the expression of TAF1 exons located downstream of the XDP-SVA insertion in intron 32 of TAF1 (exons 33-34 and 36-38) in 5-ALA treated compared to untreated patient iPSCs (Fig. 4A). Similar results were obtained for patient 3, where a significant increase in the expression of downstream exons (exons 34-38) was observed upon treatment of XDP3 iPSCs with 5-ALA (Fig. 4B). The observed effect can be fully contributed to the presence of the SVA insertion, because no change in downstream exon expression was observed when dSVA1 isogenic control cells (which has the SVA insertion removed) were treated with 5-ALA (Fig. 4C). The RNA Cap-seq data were also used to validate 5-ALA induced i32 expression changes. Similar to our results obtained using qRT-PCR (Fig. 1), analysis of the RNA Cap-seq data revealed significant increase of i32 expression in 5-ALA treated XDP patient cell lines (XDP1 and XDP3) but not dSVA isogenic control cell line (dSVA1) (Fig. 4A-C; left-most bar graphs). These findings provide compelling evidence that 5-ALA treatment alleviates the TAF1 intronic and exonic molecular phenotype associated with XDP. Moreover, the absence of the effect in the dSVA isogenic control cells lacking the XDP-SVA insertion underscores the specific regulatory impact of 5-ALA on the disease-causing XDP-SVA insertion. 5-ALA does not affect transcriptional aberrations in other G4-mediated repeat expansion disorders G4 structures have been implicated in a number of other repeat expansion disorders, including but not limited to Amyotrophic lateral sclerosis (ALS) caused by an expansion of a GGGGCC repeat in the C9orf72 gene and Fragile X-associated tremor / ataxia syndrome (FXTAS) caused by an expansion of a CGG repeat in the FMR1 gene (Asamitsu et al.2021, Hausler et al 2014). Both ALS and FXTAS have been shown to exhibit aberrant transcription influenced by the expanded repeat. The molecular phenotypes include retention of intronic reads surrounding the repeat expansion and there is evidence supporting the G4 forming potential of the expansions themselves (Fig. 5A, B, references). In the case of FXTAS, treatment with the G4 destabilising compound TMPyP4 was shown to increase transcription efficiency (Ofer et al 2009). Based on the effect of the 5-ALA treatment in modulating the molecular phenotype in XDP iPSCs, it was investigated whether 5- ALA could also mitigate the G4 driven molecular phenotypes in these disorders. iPSCs from both ALS individuals and a control line and fibroblasts from the carrier of an unmethylated expansion of the FMR1 CGG repeat where treated with 5-ALA for 48 hours. RNA from these samples was analysed using quantitative reverse- transcription PCR (qRT-PCR) to compare relative expression of intron 1 of both FMR1 and C9orf72 under different concentrations of 5-ALA. At the concentration of 5-ALA and the other conditions used in this experiment neither the FMR1 fibroblasts, nor the ALS iPSCs showed significant changes in the levels of intron 1 transcription (Fig. 5C-F). This suggests that in the cell lines tested and with the same treatment parameters that were effective to normalize the molecular phenotype of XDP, 5-ALA does not have an effect on the molecular phenotypes caused by the repeat expansions in the C9orf72 and FMR1 genes. It is noteworthy that the expanded repeat in XDP (CCCTCTn) differs in structure and / or size from the repeats in C9orf72 (GGGGCCn) and FMR1 (CGGn). Without being bound by theory it is believed that the effect of 5-ALA is quite specific to specific repeats or conformations of G4 structures, and it’s genome-wide effect on other G4s, some of which are essential for normal gene function, may be fairly limited. 5-ALA restores 39% of the transcriptional phenotype associated with XDP While aberrant TAF1 transcription is considered a primary factor in the manifestation of XDP disease, additional transcriptional signatures are likely associated with the condition. This is particularly plausible given that TAF1 encodes a core subunit of the TFIID transcription complex, which plays a central role in regulating the transcription of numerous genes [6]. Despite this understanding, the transcriptional phenotype associated with XDP remains poorly defined. Moreover, the influence of 5-ALA treatment on this XDP-associated transcriptional phenotype is currently unknown. Therefore, in this study, we utilized total RNA-seq and differential expression analysis to identify transcriptional signatures and subsequently evaluate the impact of 5-ALA on this disease-associated transcriptional phenotype. Building upon our previous findings demonstrating the beneficial effects of 5-ALA on TAF1 transcription, we hypothesize that 5-ALA treatment will also mitigate additional associated transcriptional phenotypes. To delineate the transcriptional phenotype associated with XDP, we conducted differential expression (DE) analysis between XDP1 and dSVA1 iPSCs. This analysis revealed a total of 3419 differentially expressed genes (DEGs), comprising 1707 upregulated and 1712 downregulated genes (Fig. 3A). Consistent with prior observations, the TAF1 gene exhibited significant downregulation in XDP relative to dSVA cells (padj=3.06E-12, L2FC=-0.7600) (Fig. 3B). Functional enrichment analysis unveiled an association of the DEGs with RNA transcription and splicing pathways (Fig. 3C), suggesting aberrations in these pathways in XDP disease compared to control cells. Subsequently, we assessed the expression of these DEGs in 5-ALA treated cells and observed that approximately 39% (1345 / 3419) were restored to expression levels similar to those in control dSVA1 cells upon 5-ALA treatment (Fig. 3D).Collectively, these results provide comprehensive insights into the transcriptional phenotype of XDP, revealing significant dysregulation of key genes and pathways associated with RNA transcription and splicing, and highlights the potential therapeutic effects of 5-ALA treatment in restoring gene expression patterns towards a normal state. The XDP-SVA insertion harbors unique structural features, particularly its unusually large hexamer repeat, which is rich in G4-forming motifs. Without being bound by theory we believe that this feature causes the transcriptional dysregulation observed in XDP, supporting many previous studies showing that G4 structures can impede RNA polymerase activity. Our results indicate that treatment with 5-ALA significantly reduces the transcriptional deficits in the TAF1 locus, characteristic for XDP: Intron retention of intron 32 is significantly reduced in XDP patient cells treated with 5-ALA, without affecting control cells (Fig.7). In addition, 5-ALA normalizes the expression levels of TAF1-exons downstream of the SVA insertion, indicating that 5-ALA significantly increased the production of full- length TAF1 transcripts, at the expense of XDP-associated truncated TAF1 transcripts. The neutralizing effect of 5-ALA on both deficits in TAF1 transcription in XDP-patient derived cells, indicates that 5-ALA has therapeutic potential in mitigating the molecular phenotype associated with XDP. Interestingly, the absence of an effect of 5-ALA on two other pathogenic repeat expansions involved in G4-related disorders suggests a degree of specificity for the XDP context. In further support of a normalizing effect of 5-ALA treatment on the XDP-molecular phenotype, 39% of all genes that were affected by a partial loss of functional TAF1 protein in XDP cells, displayed normalized expression values after 48 hours of 5- ALA treatment. This further highlights 5-ALA treatment as a targeted therapeutic strategy for XDP, offering a novel approach to alleviating disease symptoms at the molecular level. The present invention opens avenues for further exploration into how 5-ALA is effective in preventing, delaying or restoring any of the pathological phenotypes associated with XDP in other model systems and XDP-patients. Materials and Methods XDP iPSC culture Parental XDP (MIN15i-33363.D and MIN04i-33109.2B) and dSVA (MIN31i- 33363.D.3C2 and MIN32i-33109.2B.3A12) iPSC lines were obtained from the WiCell. XDP probands and respective dSVA iPSCs were cultured at 37 °C with 5% CO2 on Growth Factor Reduced Matrigel-coated (Corning) plates in mTeSR1 (STEMCELL). Media was changed daily, and the cells were split when they reached 80-90% confluency with Accutase. After each passage, 10 μM Y-27632 Rock inhibitor (Tocris) was added to the media and removed after 24 hours by refreshing the media. UFM Fibroblast culture Unmethylated full mutation fibroblasts were obtained from the Erasmus MC, Rotterdam, NL and the Institute of Genomic Medicine, Catholic University, 00168 Rome, Italy). Fibroblasts were cultured at 37 °C with 5% CO2 in DMEM, high glucose, GlutaMAXTM, supplemented with 10% HIFBS (GibcoTM), 1x MEM Non- Essential Amino Acids solution (GibcoTM) and 100 U / ml pen / strep (GibcoTM). Media was changed every 2-3 days and cells were passaged when they reached 80- 90% confluency using Trypsin-EDTA (0.25% Trypsin, 0.5 mM EDTA). ALS iPSC culture ALS iPSC lines, ALS1 (ALS-J4), ALS2 (ALS-L3) and control (929c4) were obtained from (??). Cells were cultured at 37 °C with 5% CO2 on Matrigel-coated (Corning) plates in StemFlex medium (GibcoTM). Media was changed every 2-3 days and cells were split when they reached 70-80% confluency using Versene (GibcoTM). After each passage, 10 μM Y-27632 Rock inhibitor (Tocris) was added to the media and removed after 24 hours by refreshing the media. 5-ALA treatment Cells were seeded at a density of 30,000 cells / cm2onto a 24-well plate. The following day (1 day after seeding), a standard media change was conducted. On the subsequent day (2 days after seeding), treatment with 5-Aminolevulinic acid (5- ALA) (Bio Connect / Cosmo, CRI-AL-00-1) commenced. This involved replacing the media with 5-ALA supplemented media. Due to the highly unstable nature of 5- ALA, all treatments were carried out using freshly prepared 5-ALA stocks. For this, A 50 mM stock solution of 5-ALA was prepared by reconstituting a lyophilized aliquot in water, followed by syringe filtering of the solution to ensure purity before use. Cells were treated with fresh media supplemented with 5-ALA at three time points (0 hours, 24 hours, and 42 hours). At 48 hours, cells were harvested for RNA isolation. RNA isolation Cells were washed once with PBS before collection in TRIzol Reagent. Total RNA was extracted using TRIzol Reagent (ThermoFisher), followed by gDNA removal and RNA purification using an RNA clean and concentrator kit (Zymo Research). qRT-PCR analysis to FMR1 exon 5-6 using the following primers: FMR1_intron1_F: CAGACAGGACACGTTTGGCTA, FMR1_intron1_R: ACATAAACGCGGGGTTACCTT, FMR1_exon5-6_F: GCAGCATGTGATGCA ACTTACA, FMR1_exon5-6_R: CGCCTCTTTGGCACACATT. Reactions were run on an applied biosystems 7500 real-time qPCR machine, using an annealing temperature of 60C, for 40 cycles. ddCt method was used for relative quantification analysis. Two-sided t-test was used for statistical testing. Capture RNA-sequencing (Cap-seq) Six replicates were analyzed per condition (n=6). TRIzol RNA isolation was performed as described above. Ribosomal depleted RNA-seq libraries were prepared using the TruSeq® Stranded Total RNA Library Prep Kit Human / Mouse / Rat kit (Illumina, 20020596) following manufacturer's instructions. Libraries were quantified using DNA HS Bioanalyzer chip, and equal molar amounts were pooled together. Custom designed MyBaits probes (Arbor Bioscience) were designed (Design ID: D10165TAF1) to target and capture both cDNA and intron sequences of the TAF1 gene. Custom MyBaits probes kit was used according to the manufacturer's instructions to capture and enrich pooled sequencing libraries. Briefly, libraries were blocked using Block O, C, and X buffers and then hybridized with capture probes for 16-24 hours at 65C. Samples were washed and cleaned, and KAPA HiFi HotStartReadMix was used to PCR amplify (14 cycles) the libraries. The final amplified and enriched libraries were cleaned using AmPureXP beads and sequenced on Illumina NextSeq500 using Mid Output flow cell 2x75 cycles. Total RNA sequencing TRIzol RNA isolation was performed as described above. Ribosomal RNA was depleted from total RNA with the rRNA depletion kit (NEB# E6310) and subsequently prepared for RNA-seq with the NEBNext Ultra Directional RNA Library Prep Kit (NEB #E7420) at GenomeScan. Samples were sequenced at 150 bp paired-end at an Illumina Hiseq 4000 device. Analysis of RNA-sequencing data Raw fastq sequencing reads were trimmed of poor quality and adapter sequences using FASTP
[0030] (fastp --qualified_quality_phred 30). Trimmed fastq files were then mapped to UCSC hg38 human reference genome using STAR
[0031] (STAR –outFilterMultimapNmax 20 outFilterMismatchNmax 5 --alignMatesGapMax 0 -- alignIntronMax 0 -- outFilterMatchNminOverLread 0.66 --alignEndsType EndToEnd). The human gene annotation file (Homo_sapiens.GRCh38.104.gtf) was downloaded from ENSEMBL and converted to UCSC hg38 compatible annotations using the chromToUcsc python script. The final gene annotation file used also included an annotation for the intronic region upstream of the XDP-SVA insertion (TAF1_partialTAF1_intron32, chrX:71424239-71440488). The STAR-mapped BAM files and our custom gene annotation file were used to generate both transcript- level and exon-level count tables using FeatureCounts
[0032] (featureCounts -M -t exon). Count tables were filtered to only include transcript and exon IDs targeted by MyBaits probes. Normalization and differential expression analysis were performed using DEseq2
[0033] . For both Cap-seq experiments expression was normalized to TAF1 exons 1-28, and differential expression was performed using default DEseq2 parameters. A transcript or exon was considered differentially expressed if padj<0.05 and change was greater than 25% (L2FC>0.3219 or L2FC<- 0.4150). CITED ART 1. Nolte D, Niemann S, Müller U (2003) Specific sequence changes in multiple transcript system DYT3 are associated with X-linked dystonia parkinsonism. Proceedings of the National Academy of Sciences, 100(18):10347–10352. https: / / doi.org / 10.1073 / pnas.1831949100 2. Evidente VGH, Advincula J, Esteban R, Pasco P, Alfon JA, Natividad FF, Cuanang J, Luis AS, Gwinn-Hardy K, Hardy J, Hernandez D, Singleton A (2002) Phenomenology of “Lubag” or X-linked dystonia–parkinsonism. Movement Disorders, 17(6):1271–1277. https: / / doi.org / 10.1002 / mds.10271 3. Lee LV, Pascasio FM, Fuentes FD, Viterbo GH (1976) Torsion dystonia in Panay, Philippines. Advances in neurology, 14:137–51. 4. Bragg DC, Mangkalaphiban K, Vaine CA, Kulkarni NJ, Shin D, Yadav R, Dhakal J, Ton M-L, Cheng A, Russo CT, Ang M, Acuña P, Go C, Francoeur TN, Multhaupt-Buell T, Ito N, Müller U, Hendriks WT, Breakefield XO, Sharma N, Ozelius LJ (2017) Disease onset in X-linked dystonia-parkinsonism correlates with expansion of a hexameric repeat within an SVA retrotransposon in TAF1. Proceedings of the National Academy of Sciences, 114(51):E11020–E11028. https: / / doi.org / 10.1073 / pnas.1712526114 5. Aneichyk T, Hendriks WT, Yadav R, Shin D, Gao D, Vaine CA, Collins RL, Domingo A, Currall B, Stortchevoi A, Multhaupt-Buell T, Penney EB, Cruz L, Dhakal J, Brand H, Hanscom C, Antolik C, Dy M, Ragavendran A, Underwood J, Cantsilieris S, Munson KM, Eichler EE, Acuña P, Go C, Jamora RDG, Rosales RL, Church DM, Williams SR, Garcia S, Klein C, Müller U, Wilhelmsen KC, Timmers HTM, Sapir Y, Wainger BJ, Henderson D, Ito N, Weisenfeld N, Jaffe D, Sharma N, Breakefield XO, Ozelius LJ, Bragg DC, Talkowski ME (2018) Dissecting the Causal Mechanism of X-Linked Dystonia- Parkinsonism by Integrating Genome and Transcriptome Assembly. Cell, 172(5):897-909.e21. https: / / doi.org / 10.1016 / j.cell.2018.02.011 6. Thomas MC, Chiang C-M (2006) The General Transcription Machinery and General Cofactors. Critical Reviews in Biochemistry and Molecular Biology, 41(3):105–178. https: / / doi.org / 10.1080 / 10409230600648736 7. Papai G, Weil PA, Schultz P (2011) New insights into the function of transcription factor TFIID from recent structural studies. Current Opinion in Genetics & Development, 21(2):219–224. https: / / doi.org / 10.1016 / j.gde.2011.01.009 Anandapadamanaban M, Andresen C, Helander S, Ohyama Y, Siponen MI, Lundström P, Kokubo T, Ikura M, Moche M, Sunnerhagen M (2013) High- resolution structure of TBP with TAF1 reveals anchoring patterns in transcriptional regulation. Nature Structural & Molecular Biology, 20(8):1008– 1014. https: / / doi.org / 10.1038 / nsmb.2611 Grünberg S, Hahn S (2013) Structural insights into transcription initiation by RNA polymerase II. Trends in Biochemical Sciences, 38(12):603–611. https: / / doi.org / 10.1016 / j.tibs.2013.09.002 Malkowska M, Kokoszynska K, Rychlewski L, Wyrwicz L (2013) Structural bioinformatics of the general transcription factor TFIID. Biochimie, 95(4):680– 691. https: / / doi.org / 10.1016 / j.biochi.2012.10.024 Gudmundsson S, Wilbe M, Filipek-Górniok B, Molin A-M, Ekvall S, Johansson J, Allalou A, Gylje H, Kalscheuer VM, Ledin J, Annerén G, Bondeson M-L (2019) TAF1, associated with intellectual disability in humans, is essential for embryogenesis and regulates neurodevelopmental processes in zebrafish. Scientific Reports, 9(1):10730. https: / / doi.org / 10.1038 / s41598-019-46632-8 Rakovic A, Domingo A, Grütz K, Kulikovskaja L, Capetian P, Cowley SA, Lenz I, Brüggemann N, Rosales R, Jamora D, Rolfs A, Seibler P, Westenberger A, König I, Klein C (2018) Genome editing in induced pluripotent stem cells rescues TAF1 levels in X-linked dystonia-parkinsonism. Movement Disorders, 33(7):1108–1118. https: / / doi.org / 10.1002 / mds.27441 Wang H, Xing J, Grover D, Hedges DJ, Han K, Walker JA, Batzer MA (2005) SVA elements: a hominid-specific retroposon family. J. Mol. Biol., 354(4):994– 1007. https: / / doi.org / 10.1016 / j.jmb.2005.09.085 Kazazian HH, Wong C, Youssoufian H, Scott AF, Phillips DG, Antonarakis SE (1988) Haemophilia A resulting from de novo insertion of L1 sequences represents a novel mechanism for mutation in man. Nature, 332(6160):164– 166. https: / / doi.org / 10.1038 / 332164a0 Batzer MA, Gudi VA, Mena JC, Foltz DW, Herrera RJ, Deininger PL (1991) Amplification dynamics of human-specific (HS) alu family members. Nucleic Acids Research, 19(13):3619– 3623. https: / / doi.org / 10.1093 / nar / 19.13.3619 16. Ostertag EM, Goodier JL, Zhang Y, Kazazian HH (2003) SVA elements are nonautonomous retrotransposons that cause disease in humans. Am. J. Hum. Genet, 73(6):1444–1451. https: / / doi.org / 10.1086 / 380207 17. Han H, Hurley LH, Salazar M (1999) A DNA polymerase stop assay for G- quadruplex-interactive compounds. Nucleic Acids Research, 27(2):537–542. https: / / doi.org / 10.1093 / nar / 27.2.537 18. Lexa M, Steflova P, Martinek T, Vorlickova M, Vyskot B, Kejnovsky E (2014) Guanine quadruplexes are formed by specific regions of human transposable elements. BMC Genomics, 15(1):1032. https: / / doi.org / 10.1186 / 1471-2164-15- 1032 19. Qin Y, Rezler EM, Gokhale V, Sun D, Hurley LH (2007) Characterization of the G-quadruplexes in the duplex nuclease hypersensitive element of the PDGF-A promoter and modulation of PDGF-A promoter activity by TMPyP4. Nucleic Acids Research, 35(22):7698– 7713. https: / / doi.org / 10.1093 / nar / gkm538 20. Westenberger A, Reyes CJ, Saranza G, Dobricic V, Hanssen H, Domingo A, Laabs B, Schaake S, Pozojevic J, Rakovic A, Grütz K, Begemann K, Walter U, Dressler D, Bauer P, Rolfs A, Münchau A, Kaiser FJ, Ozelius LJ, Jamora RD, Rosales RL, Diesta CCE, Lohmann K, König IR, Brüggemann N, Klein C (2019) A hexanucleotide repeat modifies expressivity of X-linked dystonia parkinsonism. Annals of Neurology, 85(6):812–822. https: / / doi.org / 10.1002 / ana.25488. 21. NEUBERGER A (1958) [Metabolism of aminolevulinic acid and the biosynthesis of heme]. Exposes annuels de biochimie medicale, 8(20):31–9. 22. Utsuki S, Miyoshi N, Oka H, Miyajima Y, Shimizu S, Suzuki S, Fujii K (2007) Fluorescence-guided resection of metastatic brain tumors using a 5- aminolevulinic acid-induced protoporphyrin IX: pathological study. Brain Tumor Pathology, 24(2):53–55. https: / / doi.org / 10.1007 / s10014-007-0223-3 23. Novotny A, Stummer W (2003) 5-Aminolevulinic Acid and the Blood-Brain Barrier – A Review. Medical Laser Application, 18(1):36–40. https: / / doi.org / 10.1078 / 1615-1615-00085 24. Shioda N, Yabuki Y, Yamaguchi K, Onozato M, Li Y, Kurosawa K, Tanabe H, Okamoto N, Era T, Sugiyama H, Wada T, Fukunaga K (2018) Targeting G- quadruplex DNA as cognitive function therapy for ATR-X syndrome. Nature Medicine, 24(6):802–813. https: / / doi.org / 10.1038 / s41591-018-0018-6 25. Asamitsu S, Yabuki Y, Ikenoshita S, Wada T, Shioda N (2020) Pharmacological prospects of G-quadruplexes for neurological diseases using porphyrins. Biochemical and Biophysical Research Communications, 531(1):51–55. https: / / doi.org / 10.1016 / j.bbrc.2020.01.054 26. Haeusler AR, Donnelly CJ, Periz G, Simko EAJ, Shaw PG, Kim M-S, Maragakis NJ, Troncoso JC, Pandey A, Sattler R, Rothstein JD, Wang J (2014) C9orf72 nucleotide repeat structures initiate molecular cascades of disease. Nature, 507(7491):195–200. https: / / doi.org / 10.1038 / nature13124 27. Zhou B, Liu C, Geng Y, Zhu G (2015) Topology of a G-quadruplex DNA formed by C9orf72 hexanucleotide repeats associated with ALS and FTD. Scientific Reports, 5(1):16673. https: / / doi.org / 10.1038 / srep16673 28. Maltby CJ, Krans A, Grudzien SJ, Palacios Y, Muiños J, Suárez A, Asher M, Khurana V, Barmada SJ, Dijkstra AA, Todd PK (2023) AAGGG repeat expansions trigger RFC1-independent synaptic dysregulation in human CANVAS Neurons. bioRxiv, :2023.12.13.571345. https: / / doi.org / 10.1101 / 2023.12.13.571345 29. Asamitsu S, Yabuki Y, Ikenoshita S, Kawakubo K, Kawasaki M, Usuki S, Nakayama Y, Adachi K, Kugoh H, Ishii K, Matsuura T, Nanba E, Sugiyama H, Fukunaga K, Shioda N (2021) CGG repeat RNA G-quadruplexes interact with FMRpolyG to cause neuronal dysfunction in fragile X-related tremor / ataxia syndrome. Science Advances, 7(3):eabd9440. https: / / doi.org / 10.1126 / sciadv.abd9440 30. Chen S, Zhou Y, Chen Y, Gu J (2018) fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics, 34(17):i884–i890. https: / / doi.org / 10.1093 / bioinformatics / bty560" 31. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics (Oxford, England), 29(1):15–21. https: / / doi.org / 10.1093 / bioinformatics / bts635 32. Liao Y, Smyth GK, Shi W (2014) featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics, 30(7):923–930. https: / / doi.org / 10.1093 / bioinformatics / btt656 Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12):550. https: / / doi.org / 10.1186 / s13059-014-0550-8
Claims
CLAIMS 1. 5-aminolevulunic acid (5-ALA), a 5-ALA ester, a porphyrin, preferably wherein the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX, or a pharmaceutically acceptable salt thereof for use in the treatment of X-linked dystonia-parkinsonism (XDP) in an individual.
2. 5-ALA, a 5-ALA ester, a porphyrin, or a pharmaceutically acceptable salt thereof for use according to claim 1, wherein the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX.
3. 5-aminolevulunic acid (5-ALA), a 5-ALA ester, a porphyrin, preferably wherein the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX, or a pharmaceutically acceptable salt thereof for use in treating an individual carrying a genetic modification associated with XDP, wherein treating results in delaying, reducing or preventing an onset of symptoms in said individual, preferably wherein the genetic modification comprises one or more genetic modification in and / or around a TATA-binding protein-associated factor-1 (TAF1) gene selected from a disease-specific sequence change (DSC) 1, DSC2, DSC3, DSC10, DSC12, a 48-bp deletion and an SINE-Alu-VNTR (SVA) retrotransposon insertion in TAF1 gene, more preferably wherein the genetic modification comprises an SINE-Alu-VNTR (SVA) retrotransposon insertion in TAF1 gene.
4. 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use according to claim 2, wherein the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX.
5. A pharmaceutical composition for use in the treatment of XDP in an individual or treating an individual carrying a genetic modification associated with XDP, wherein treating results in delaying, reducing or preventing an onset of symptoms in said individual, comprising an effective amount of 5-ALA, a 5-ALA ester, a porphyrin, preferably wherein the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX, or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.
6. A pharmaceutical composition for use in the treatment of XDP in an individual or treating an individual carrying a genetic modification associated with XDP, wherein treating results in delaying, reducing or preventing an onset of symptoms in said individual, comprising 5-ALA, a 5-ALA ester, a porphyrin, preferably wherein the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX, or a pharmaceutically acceptable salt thereof and one or more additional medicaments for the treatment of XDP.
7. 5-ALA, a 5-ALA ester, a porphyrin, preferably wherein the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX, or a pharmaceutically acceptable salt thereof for use according to claim 3, or the pharmaceutical composition for use according to any one claims of 4-5, wherein the genetic modification comprises an SINE-Alu-VNTR (SVA) retrotransposon insertion in TAF1 gene.
8. A method of delaying or reducing the onset of symptoms of XDP in a subject, comprising administering to the subject in need thereof an effective amount of 5- ALA, a 5-ALA ester, a porphyrin, preferably wherein the porphyrin is an active 5- ALA metabolite such as protoporphyrin IX, or a pharmaceutically acceptable salt thereof.
9. 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use, the pharmaceutical composition for use, or the method of any one of preceding claims, wherein the 5-ALA ester is an ester of 5-aminolevulinic acid with a substituted or unsubstituted alkanol.
10. 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use, the pharmaceutical composition for use, or the method of any one of the preceding claims, wherein the 5-ALA ester is an alkyl ester.
11. 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use, the pharmaceutical composition for use, or the method of any one of the preceding claims, wherein the 5-ALA ester is a compound of general formula IV:R22N—CH2COCH2—CH2CO—OR1(IV) wherein R1represents a substituted or unsubstituted straight-chained, branched or cyclic alkyl group (e.g. a substituted or unsubstituted straight-chained alkyl group); and each R2independently represents a hydrogen atom or an optionally substituted alkyl group, preferably a group R1) and pharmaceutically acceptable salts thereof.
12. 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use, the pharmaceutical composition for use, or the method of any one of the preceding claims, wherein the 5-ALA ester is methyl ALA ester, ethyl ALA ester, propyl ALA ester, butyl ALA ester, pentyl ALA ester, hexyl ALA ester, octyl ALA ester, 2-methoxyethyl ALA ester, 2-methylpentyl ALA ester, 4-methylpentyl ALA ester, 1-ethylbutyl ALA ester, 3,3-dimethyl-1-butyl ALA ester, benzyl ALA ester, 4-isopropylbenzyl ALA ester, 4-methylbenzyl ALA ester, 2-methylbenzyl ALA ester, 3-methylbenzyl ALA ester, 4-[t-butyl]benzyl ALA ester, 4- [trifluoromethyl]benzyl ALA ester, 4-methoxybenzyl ALA ester, 3,4-[di- chloro]benzyl ALA ester, 4-chlorobenzyl ALA ester, 4-fluorobenzyl ALA ester, 2- fluorobenzyl ALA ester, 3-fluorobenzyl ALA ester, 2,3,4,5,6-pentafluorobenzyl ALA ester, 3-nitrobenzyl ALA ester, 4-nitrobenzyl ALA ester, 2-phenylethyl ALA ester, 4-phenylbutyl ALA ester, 3-pyridinyl-methyl ALA ester, 4-diphenyl-methyl ALA ester and benzyl-5-[(1-acetyloxyethoxy)-carbonyl]amino levulinate.
13. 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use, the pharmaceutical composition for use, or the method of claim 12, wherein the 5-ALA ester is methyl ALA ester, ethyl ALA ester, 2-methoxyethyl ALA ester, benzyl ALA ester, 4-isopropylbenzyl ALA ester, 4-methylbenzyl ALA ester, 2-methylbenzyl ALA ester, 3-methylbenzyl ALA ester, 4-[t-butyl]benzyl ALA ester, 4-[trifluoromethyl]benzyl ALA ester, 4-methoxybenzyl ALA ester, 3,4-[di- chloro]benzyl ALA ester, 4-chlorobenzyl ALA ester, 4-fluorobenzyl ALA ester, 2- fluorobenzyl ALA ester, 3-fluorobenzyl ALA ester, 2,3,4,5,6-pentafluorobenzyl ALA ester, 3-nitrobenzyl ALA ester, 4-nitrobenzyl ALA ester, 2-phenylethyl ALA ester, 4-phenylbutyl ALA ester, 3-pyridinyl-methyl ALA ester, 4-diphenyl-methyl ALA ester and benzyl-5-[(1-acetyloxyethoxy)-carbonyl]amino levulinate.
14. 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use, the pharmaceutical composition for use, or the method of claim 13, wherein the ester is methyl ALA ester, hexyl ALA ester and benzyl ALA ester, preferably methyl ALA ester.
15. 5-ALA, a 5-ALA ester, a porphyrin or a pharmaceutically acceptable salt thereof for use, the pharmaceutical composition for use, or the method of any one of the preceding claims, wherein the porphyrin is selected from the group of heme, uroporphyrin, coproporphyrin or protoporphyrin IX or a derivative or synthetic analogue thereof such as octaethylporphyrin, tetraphenylporphyrin or TMPyP4, preferably wherein the porphyrin is an active 5-ALA metabolite such as protoporphyrin IX.
Citation Information
Patent Citations
Esters of 5-aminolevulinic acid as photosensitizing agents in photochemotherapy
WO1996028412A1
Esters of 5-aminolevulinic acid as photosensitizing agents in photochemotherapy
WO2002010120A1
Acid addition salts of 5-aminolevulinic acid or its derivatives
WO2005092838A1