Oligonucleotide compositions and methods thereof
Modified oligonucleotides with specific sugar and linkage modifications, leveraging ADAR proteins, address inefficiencies in nucleic acid editing by enhancing stability and selectivity while reducing toxicity and immune response.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- WAVE LIFE SCI LTD
- Filing Date
- 2025-10-17
- Publication Date
- 2026-04-23
AI Technical Summary
Existing oligonucleotide technologies for editing nucleic acids, particularly adenosine residues, face challenges in efficiency, selectivity, stability, and cellular uptake, often requiring exogenous components that can cause immune stimulation and toxicity.
Designing oligonucleotides with specific sugar, nucleobase, and internucleotidic linkage modifications, such as 2'-F and phosphoryl guanidine linkages, to enhance editing efficiency, selectivity, and stability, utilizing endogenous ADAR proteins for targeted adenosine modification.
The modified oligonucleotides demonstrate improved stability, selectivity, and reduced immune stimulation, achieving high efficiency in adenosine editing with minimal toxicity and enhanced cellular uptake.
Smart Images

Figure IMGF000004_0001 
Figure IMGF000037_0001 
Figure IMGF000094_0001
Abstract
Description
OLIGONUCLEOTIDE COMPOSITIONS AND METHODS THEREOFCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to United States Provisional Application Nos. 63 / 709.396, filed on October 18, 2024, and 63 / 783,180, filed on April 03, 2025, the entirety of each of which is incorporated herein by reference.BACKGROUND
[0002] Oligonucleotides are useful in various applications, e.g., therapeutic, diagnostic, and / or research applications. For example, oligonucleotides targeting various genes can be useful for treatment of conditions, disorders or diseases related to such target genes.SUMMARY
[0003] Among other things, tire present disclosure provides designed oligonucleotides and compositions thereof which oligonucleotides comprise modifications (e g., modifications to nucleobases sugars, and / or intemucleotidic linkages, and patterns thereof) as described herein. In some embodiments, technologies (compounds (e g., oligonucleotides), compositions, methods, etc.) of the present disclosure (e.g., oligonucleotides, oligonucleotide compositions, methods, etc.) are particularly useful for editing nucleic acids, e.g., site-directed editing in nucleic acids (e.g., editing of target adenosine). In some embodiments, as demonstrated herein, provided technologies can significantly improve efficiency of nucleic acid editing, e.g., modification of one or more A residues, such as conversion of A to I. In some embodiments, the present disclosure provides technologies for editing (e.g., for modifying an A residue, e.g., converting an A to 1) in an RNA. In some embodiments, the present disclosure provides technologies for editing (e.g., for modifying an A residue, e.g., converting an A to an I) in a transcript, e.g., mRNA. Among other things, provided technologies provide the benefits of utilization of endogenous proteins such as ADAR (Adenosine Deaminases Acting on RNA) proteins (e.g., AD ARI and / or ADAR2). for editing nucleic acids, e.g., for modifying an A (e.g., as a result of G to A mutation). Those skilled in the art will appreciates that such utilization of endogenous proteins can avoid a number of challenges and / or provide various benefits compared to those technologies that require the delivery of exogenous components (e g., proteins (e.g., those engineered to bind to oligonucleotides (and / or duplexes thereof with target nucleic acids) to provide desired activities), nucleic acids encoding proteins, viruses, etc.).
[0004] Particularly, in some embodiments, oligonucleotides of provided technologies comprise useful sugar modifications and / or patterns thereof (e.g.. presence and / or absence of certain modifications), nucleobase modifications and / or patterns thereof (e.g., presence and / or absence of certain modifications), intemucleotidic linkages modifications and / or stereochemistry and / or patterns thereof [e.g., types, modifications, and / or configuration (Rp or Sp) of chiral linkage phosphorus, etc.], etc., which, when combined with one or moreother structural elements described herein (e.g., additional chemical moieties) can provide high activities and / or various desired properties, e.g., high efficiency of nucleic acid editing, high selectivity, high stability, high cellular uptake, low immune stimulation, low toxicity, improved distribution, improved affinity, etc. In some embodiments, provided oligonucleotides provide high stability, e.g.. when compared to oligonucleotides having a high percentage of natural RNA sugars utilized for adenosine editing. In some embodiments, provided oligonucleotides provide high activities, e.g., adenosine editing activity. In some embodiments, provided oligonucleotides provide high selectivity, for example, in some embodiments, provided oligonucleotides provide selective modification of a target adenosine in a target nucleic acid over other adenosine in the same target nucleic acid (e.g., 2, 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 fold or more modification at the target adenosine than another adenosine, or all other adenosine, in a target nucleic acid).
[0005] For example, in some embodiments, the provided technology provides technologies targeting CFTR. In some embodiments, the provided technologies target a codon encoding W1282X. In some embodiments, a target adenosine is in a codon that encodes W1282X. In some embodiments, the provided technologies target a codon comprising a c.3846G>A mutation. In some embodiments, a target adenosine is in a codon that comprises a c.3846G>A mutation. In some embodiments, the provided technologies target a codon comprising rs77010898. In some embodiments, a target adenosine is in a codon that comprises rs77010898.
[0006] Among other things, the present disclosure provides designed oligonucleotides and compositions of improved properties and / or activities compared to reference oligonucleotides and compositions (e.g., those described herein or reported in the art). For example, in some embodiments, as demonstrated herein provided oligonucleotide and compositions can provide improved stability, pharmacokinetic properties, pharmacodynamic properties and / or improved activities (e g., for A-to-I editing). Various designed oligonucleotides and compositions are described herein. For example, in some embodiments, the present disclosure provides oligonucleotides and compositions thereof, including chirally controlled oligonucleotide compositions thereof, wherein the oligonucleotides comprise several (e.g., 1, 2, 3, 4, or 5 or more; in some embodiments, 3 or more) nucleosides independently comprising sugar modifications (e.g., 2 ’-OR modifications wherein Ris optionally substituted Cue alkyl (e.g., 2’-OMe, 2’-M0E, etc.,), bicyclic sugars (e.g., LNA sugars, cEt sugars, etc.)) at their 5’- and 3’-ends. In some embodiments, the first several (e.g., 1 , 2, 3, 4, or 5 or more; in some embodiments, 3 or more) nucleosides and / or the last several (e.g., 1, 2, 3, 4, or 5 or more; in some embodiments, 3 or more) nucleosides independently comprise sugar modifications. In some embodiments, the first 3 or more and the last 3 or more nucleosides independently comprise sugar modifications. In some embodiments, one or more intemucleotidic linkages bonded to such nucleosides are non-negatively charged intemucleotidic linkage such as phosphoryl guanidine intemucleotidic linkages like nOOl. In some embodiments, both the first and the last intemucleotidic linkages are independently non- negatively charged intemucleotidic linkages. In some embodiments, both the first and the last intemucleotidiclinkages are independently phosphoryl guanidine intemucleotidic linkages. In some embodiments, both the first and the last intemucleotidic linkages are independently nOO 1. In some embodiments, they are both chirally controlled and are Rp. In some embodiments, an oligonucleotide comprises a nucleoside No which comprises a natural DNA sugar (two 2 -H), a natural RNA sugar or a 2’-F modified sugar. In some embodiments. No is a nucleoside opposite to a target adenosine when an oligonucleotide is utilized for adenosine editing. In some embodiments, sugar of No is a natural DNA sugar. In some embodiments, sugar of Ni (“+” or nothing before a number indicates counting toward the 5’-direction (5’ ...NiNoN-i... 3’)) is a 2’-Fmodified sugar, a natural DNA sugar, or a natural RNA sugar. In some embodiments, sugar of Ni is a DNA sugar. In some embodiments, sugar of N.iindicates counting toward the 3’-direction (5’ ...NiN0N.i ... 3')) is a 2'-F modified sugar, a natural DNA sugar, or a natural RNA sugar. In some embodiments, sugar of N.i is a DNA sugar. In some embodiments, sugar of Nj is a 2’-F modified sugar. In some embodiments, between N2 and their 5’-ends oligonucleotides comprise multiple 2’-F modified sugars and multiple 2’-modified sugars (e.g., 2 ’-OR modified sugars wherein R is optionally substituted Ci.6alkyl, bicyclic sugars such as LNA sugars, cEt sugars, etc.). In some embodiments, oligonucleotides comprise one or more (e.g., 1-20, 1-15, 1-10, 2-15, 2- 10, or 1. 2, 3, 4, 5, 6, 7, 8. 9, 10, 11, 12, 13. 14. 15. 16, 17, 18, 19, 20 or more) 2’-F blocks and one or more (e.g., 1-20, 1-15, 1-10, 2-15. 2-10. or 1, 2. 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15. 16. 17. 18. 19, 20 or more) separating blocks from N2 to their 5 ’-ends (e.g., first domains and first subdomains of second domains combined when first subdomains end with and include N2), wherein each nucleoside in a 2’-F block independently comprises a 2’-F modification, each nucleoside in a separating block independently comprises no 2’-F modification, and each block independently comprises one or more (e.g., 1-20, 1-15, 1-10, 2-15, 2-10, or 1. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14. 15. 16, 17, 18, 19, 20 ormore) nucleosides. In some embodiments, there are two or more such 2’-F blocks and two or more such separating blocks. In some embodiments, one or more or all such separating blocks are independently bonded to two 2’-F blocks. In some embodiments, each nucleoside in one or more or all separating blocks independently comprise a 2 ’-OR modification wherein R is optionally substituted Cue alkyl or is a bicyclic sugar such as a LNA sugar, a cEt sugar, etc. In some embodiments, each nucleoside in one or more or all separating blocks independently comprise a 2 ’-OR modification wherein R is optionally substituted Cue alkyl. In some embodiments, each nucleoside in one or more or all separating blocks independently comprise a 2’-OMe or 2’-MOE modification. In some embodiments, each of such 2’-F and separating blocks independently comprises 1 , 2, 3, 4 or 5 nucleosides. In some embodiments, nucleosides close to No, e.g., N2,NI, No, N.i, N.2, etc., do not contain large 2’-modificatoins such as 2’-MOE. In some embodiments, sugars of N2, Ni, No, N.i, and N-2 arc independently natural DNA sugar, 2’-F modified sugar, or 2’-OMe modified sugar. In some embodiments, sugars of Ni, No, N.i are each a natural DNA sugar. In some embodiments, each chiral intemucleotidic linkage is independently chirally controlled.
[0007] As demonstrated herein, among other things, the present disclosure provides useful modified sugars, modified nucleobases, and modified nucleosides that are useful at various positions in oligonucleotides,e.g., for target adenosine editing. Particularly, in some embodiments, the present disclosure provides useful modified sugars, modified nucleobases, and modified nucleosides that can be utilized at Ni, No, or N.i. In some embodiments, provided technologies, e.g., those comprising [3nU] and 2'-OMc modified sugar or DNA sugar at No, can provide improved properties, e.g.. improved stability and / or editing activities, when compared to reference technologies. In some embodiments, the present disclosure provides an oligonucleotide comprising 5’-NiNoN.i-3’, wherein Ni, No, and N.i are each independently a nucleoside and are linked by intemucleotidic linkages. In some embodiments, the present disclosure provides an oligonucleotide comprising 5’-NiNoN-i-3’, wherein Ni, No, and N.i are each independently a nucleoside and are linked by intemucleotidic linkages, wherein the oligonucleotide is capable of binding to a target nucleic acid with No opposite to a target adenosine. In some embodiments. Nocomprises a modified sugar, a modified nucleobase. or a modified nucleoside. In some embodiments, Ni comprises a modified sugar, a modified nucleobase, or a modified nucleoside. In some embodiments, N.i comprises a modified sugar, a modified nucleobase, or a modified nucleoside.
[0008] In some embodiments, the present disclosure provides an oligonucleotide capable of editing a target adenosine in a nucleic acid encoding a truncated CFTR polypeptide to produce a full-length CFTR polypeptide. In some embodiments, a nucleic acid encoding a truncated CFTR polypeptide encodes a W1282X mutation. In some embodiments, a nucleic acid encoding a truncated CFTR polypeptide comprises a c.3846G>A mutation. In some embodiments, a nucleic acid encoding atruncated CFTR polypeptide comprises rs77010898.
[0009] In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises at least 15. 16, 17, 18, 19, 20, 21, 22, 23, 24. or 25 bases of a base sequence that is identical with or complementary to a base sequence of a CFTR gene or a transcript thereof, wherein the oligonucleotide comprises one or more modified sugars, one or more modified nucleobases, and / or one or more modified intemucleotidic linkages. In some embodiments, abase sequence of the oligonucleotide comprises at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 bases of a base sequence that is complementary to a CFTR transcript. In some embodiments, a base sequence of the oligonucleotide comprises at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 bases of a base sequence that is complementary to a CFTR mRNA. In some embodiments, a base sequence of the oligonucleotide comprises at least 15, 16, 17, 18, 19, 20, 21, 22. 23, 24, or 25 contiguous bases of a base sequence that is identical with or complementary to a base sequence of a CFTR gene or a transcript thereof. In some embodiments, a base sequence of the oligonucleotide comprises at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous bases of a base sequence that is complementary to a CFTR transcript. In some embodiments, a base sequence of the oligonucleotide comprises at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous bases of a base sequence that is complementary to a CFTR mRNA. In some embodiments, a base sequence of the oligonucleotide comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous bases ofUGGUAUCACUCCAAGGGCUUUCCTUCACUG, UGGUAUCACUCCAAAGGUUUUCCTUCACUG,GGUAUCACUCCAAAGGCUUUCCTUCACUGU, or GGUAUCACUCCAAGGGCUUUCCTUCACUG, wherein each T can be independently replaced with U and vice versa.
[0010] In some embodiments, the present disclosure provides an oligonucleotide comprising a first domain and a second domain, wherein the first domain comprises one or more 2’-F modifications, and the second domain comprises one or more sugars that do not have a 2’-F modification. In some embodiments, a provided oligonucleotide comprises one or more chiral modified intemucleotidic linkages.
[0011] In some embodiments, the present disclosure provides an oligonucleotide comprising:(a) a first domain; and(b) a second domain, wherein: the first domain comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more sugars comprising a 2’-F modification; the second domain comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or20 or more sugars each independently comprising a 2'-OR modification wherein R is not -H (e.g., 2’-OMe, 2, -MOE, 2’-O-LB-4’ wherein LBis optionally substituted -CH2-, etc.): the oligonucleotide comprises 5'-NiNoN.i-3’, wherein Ni, No, and N.i are each independently a nucleoside and are linked by intemucleotidic linkages; the oligonucleotide comprises a modified sugar, a modified nucleobase, or a modified nucleoside at No, N.i or Ni; and the oligonucleotide is capable of binding to a target nucleic acid with No opposite to a target adenosine.
[0012] In some embodiments, the present disclosure provides an oligonucleotide comprising:(a) a first domain; and(b) a second domain, wherein about 20%-80% (e.g., about 25%-80%, 30%-80%, 35%-80%, 40%-80%, 40%-70%, 40%- 60%, 50%-80%, 50%-75%, 50%-60%, 55%-80%, 60-80%, or about 50%, 55%, 60%, 65%, 70%, 75%, or 80%) of all sugars of the first domain comprises a 2’-F modification; the second domain comprises at least 1, 2. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16. 17, 18, 19, or 20 or more modified sugars comprising no 2’-F modification, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all sugars of the second domain comprise no 2’-F modification; the oligonucleotide comprises 5’-NiNoN-i-3’, wherein Ni, No, and N.i arc each independently a nucleoside and are linked by intemucleotidic linkages; the oligonucleotide comprises a modified sugar, a modified nucleobase. or a modified nucleoside at No, N.i or Ni; and the oligonucleotide is capable of binding to a target nucleic acid with No opposite to a target adenosine.
[0013] In some embodiments, the present disclosure provides an oligonucleotide comprising:(a) a first domain; and(b) a second domain, wherein the first domain comprises at least 1, 2. 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15. 16. 17. 18,19, or 20 or more sugars comprising a 2 -F modification and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more sugars each independently comprising a 2 ’-OR modification wherein R is not -H (e.g., 2’-OMe, 2, -MOE, 2‘-O-LB-4’ wherein LBis optionally substituted -CH2-, etc.); and the second domain comprises at least 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more sugars each independently comprising a 2'-OR modification wherein R is not -H (e.g., 2’-OMe. 2, -MOE, 2’-O-LB-4’ wherein LBis optionally substituted -CEE-, etc.).
[0014] In some embodiments, the present disclosure provides an oligonucleotide comprising:(a) a first domain; and(b) a second domain, wherein about 20%-80% (e.g., about 25%-80%, 30%-80%, 35%-80%, 40%-80%, 40%-70%, 40%- 60%, 50%-80%. 50%-75%, 50%-60%, 55%-80%. 60-80%, or about 50%.55%, 60%, 65%, 70%, 75%, or 80%) of all sugars of the first domain comprises a 2’-F modification, and about 20%-70% (e.g., about 20%- 60%, 20%-50%, 30%-60%, 30%-50%, 40%-50%, or about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%) of all sugars of the first domain independently comprises a 2’-OR modifications wherein R is not -H (e.g., 2’-OMe, 2, -MOE, 2'-O-LB-4’ wherein LBis optionally substituted -CH2-, etc.); and the second domain comprises at least 1, 2. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16. 17, 18, 19, or 20 or more modified sugars comprising no 2’-F modification, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all sugars of the second domain comprise no 2’-F modification.
[0015] In some embodiments, a second domain comprises or consists of a first subdomain, a second subdomain and a third subdomain as described herein. In some embodiments, a first subdomain comprises one or more (e.g., 1-10, 1-5, 1-3, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars each independently comprising a 2’-OR modification wherein R is not -H (e.g., 2’-OMe, 2, -MOE, 2'-O-LB-4’ wherein LBis optionally substituted -CH2-, etc.). In some embodiments, there are more such sugars in a first subdomain than 2’-F modified sugars. In some embodiments, none of sugars in a second subdomain contain any 2 ’-OR modifications wherein R is optionally substituted Ci.6aliphatic or 2’-O-LB-4’). In some embodiments, each sugar of a second subdomain is independently a natural DNA sugar, a natural RNA sugar or a 2’-F modified sugar. In some embodiments, each sugar of a second subdomain is independently a natural DNA sugar or a natural RNA sugar. In some embodiments, each sugar of a second subdomain is independently a natural DNA sugar or a 2’-F modified sugar. In some embodiments, each sugar of a second subdomain is independently a natural DNA sugar. In some embodiments, there are three nucleosides in a second subdomain. In some embodiments, when binding to a target the second nucleoside the three is opposite to a target adenosine. In some embodiments, the sugar of a second nucleoside does not contain any 2’-OR modifications as described herein (e.g., 2’-OMe, 2’-MOEetc.). In some embodiments, such a sugar is a natural DNA sugar. In some embodiments, it is a natural RNA sugar. In some embodiments, it is a 2'-F modified sugar. In some embodiments, a third subdomain comprises one or more (e.g., 1-10, 1-5, 1-3, 1, 2, 3. 4, 5, 6, 7. 8, 9, or 10) sugars each independently comprising a 2 -OR modification wherein R is not -H (e.g.. 2’-OMe, 2, -MOE, 2’-O-LD-4’ wherein LDis optionally substituted -CH2-, etc.). In some embodiments, there are more such sugars in a third subdomain than 2’-F modified sugars.
[0016] In some embodiments, a second domain comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more modified sugars independently comprising a 2’-OR modification, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all sugars of a second domain comprise a 2 -OR modification, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, R is methyl. In some embodiments, R is -CH2CH2OCH3. As described herein, other sugar modifications may also be utilized in accordance with the present disclosure, optionally with base modifications and / or intemucleotidic linkage modifications described herein.
[0017] In some embodiments, an oligonucleotide comprises or is of a 5 ’-first domain-second domain-3’ structure. In some embodiments, a second domain comprises or is of a 5 ’-first subdomain-second subdomain- third subdomain-3’ structure. In some embodiments, an oligonucleotide comprises or is of a 5 ’-first domain- first subdomain-second subdomain-third subdomain-3’ structure. In some embodiments, oligonucleotide is conjugated to an additional moiety, e.g., various additional chemical moieties as described herein. In some embodiments, an oligonucleotide comprises an additional moiety, e.g., an additional moiety as described herein. In some embodiments, an additional chemical moiety is or comprises a lipid moiety, a small molecule moiety, a carbohydrate moiety, a nucleic acid moiety (e.g., an oligonucleotide moiety, a nucleic acid moiety which can provide and / or modulate one or more properties and / or activities, etc. (e.g., a moiety of RNase FI- dependent oligonucleotide, RNAi oligonucleotide, aptamer, gRNA, etc.), and / or a peptide moiety.
[0018] In some embodiments, base sequence of a provided oligonucleotide is substantially complementary' to the base sequence of a target nucleic acid comprising a target adenosine. In some embodiments, a provided oligonucleotide when aligned to a target nucleic acid comprises one or more mismatches (non-Watson-Crick base pairs). In some embodiments, a provided oligonucleotide when aligned to a target nucleic acid comprises one or more wobbles (e.g., G-U. I-A, G-A, I-U, 1-C, etc.). In some embodiments, mismatches and / or wobbles may help one or more proteins, e g., ADAR1, ADAR2, etc., to recognize a duplex formed by a provided oligonucleotide and a target nucleic acid. In some embodiments, provided oligonucleotides form duplexes with target nucleic acids. In some embodiments, ADAR proteins recognize and bind to such duplexes. In some embodiments, nucleosides opposite to target adenosines are located in the middle of provided oligonucleotides, e.g., with 5-50 nucleosides to 5' side, and 1-50 nucleosides on its 3’ side. In some embodiments, a 5’ side has more nucleosides than a 3’ side. In some embodiments, a 5’ side has fewer nucleosides than a 3’ side. In some embodiments, a 5’ side has the same number of nucleosides as a 3’ side. In some embodiments, provided oligonucleotides comprise 15-40, e.g., 15, 20, 25,30, etc. contiguous bases of oligonucleotides described in the Tables. In some embodiments, base sequences of provided oligonucleotides are or comprises base sequences of oligonucleotides described in the Tables.
[0019] In some embodiments, with utilization of various structural elements (e.g., various modifications, stereochemistry, and patterns thereof), the present disclosure can achieve desired properties and high activities with short oligonucleotides, e.g., those of about 20-40, 25-40, 25-35, 26-32, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleobases in length.
[0020] In some embodiments, provided oligonucleotides comprise modified nucleobases. In some embodiments, a modified nucleobase promotes modification of a target adenosine. In some embodiments, a nucleobase which is opposite to a target adenine maintains interactions with an enzyme, e.g., ADAR, compared to when a U is present, while interacts with a target adenine less strongly than U (e.g., forming fewer hydrogen bonds). In some embodiments, an opposite nucleobase and / or its associated sugar provide certain flexibility (e.g., when compared to U) to facility modification of a target adenosine by enzymes, e.g., AD ARI, ADAR2, etc. In some embodiments, a nucleobase immediately 5’ or 3’ to the opposite nucleobase (to a target adenine), e.g., I and derivatives thereof, enhances modification of a target adenine. Among other tilings, the present disclosure recognizes that such a nucleobase may causes less steric hindrance than G when a duplex of a provided oligonucleotide and its target nucleic acid interact with a modifying enzyme, e.g., ADAR1 or ADAR2. In some embodiments, base sequences of oligonucleotides are selected (e.g., when several adenosine residues are suitable targets) and / or designed (e.g., through utilization of various nucleobases described herein) so that steric hindrance may be reduced or removed (e.g., no G next to the opposite nucleoside of a target A).
[0021] Various intemucleotidic linkages may be utilized in oligonucleotides in accordance with the present disclosure. In some embodiments, an oligonucleotide comprises one or more types of intemucleotidic linkage. In some embodiments, an oligonucleotide comprises two or more types of intemucleotidic linkage. In some embodiments, an oligonucleotide comprises at least three types of intemucleotidic linkages. In some embodiments, a linkage contains a linkage phosphorus atom bonded to an oxygen atom which oxygen atom is not bonded to or is not part of a backbone sugar (“a PO linkage”, e.g., a natural phosphate linkage). In some embodiments, a linkage contains a linkage phosphorus atom bonded to a sulfur atom which sulfur atom is not bonded to or is not part of a backbone sugar (“a PS linkage”, e.g., a phosphorothioate intemucleotidic linkage). In some embodiments, a linkage contains a linkage phosphorus atom bonded to a nitrogen atom which nitrogen atom is not bonded to or is not part of a backbone sugar (c'a PN linkage”, e.g., nOOl). In some embodiments, an oligonucleotide comprises one or more PS linkages. In some embodiments, an oligonucleotide comprises one or more PO linkages. In some embodiments, an oligonucleotide comprises one or more PN linkages. In some embodiments, an oligonucleotide comprises one or more PS and one or more PO linkages. In some embodiments, an oligonucleotide comprises one or more PS and one or more PN linkages. In some embodiments, an oligonucleotide comprises one or more PS, one or more PN and one or more PO linkages. In some embodiments, a PS linkage is a phosphorothioate linkage. In some embodiments, each PS linkage is independently a phosphorothioate linkage. In some embodiments, a PO linkage is a natural phosphate linkage.In some embodiments, each PO linkage is independently a natural phosphate linkage. In some embodiments, a PN linkage is a phosphoryl guanidine linkage. In some embodiments, each PN linkage is independently a phosphoryl guanidine linkage.
[0022] In some embodiments, a first domain comprises one or more PO linkages, one or more PS linkages and one or more PN linkages. In some embodiments, a first subdomain comprises one or more PO linkages, one or more PS linkages and / or one or more PN linkages. In some embodiments, a first subdomain comprises one or more PO linkages. In some embodiments, a first subdomain comprises one or more natural phosphate linkages. In some embodiments, second subdomain comprises one or more modified intemucleotidic linkages. In some embodiments, each intemucleotidic linkage bonded to a nucleoside of a second subdomain is independently a modified intemucleotidic linkage. In some embodiments, each intemucleotidic linkage bonded to a nucleoside of a second subdomain is independently a PS or PN linkages. In some embodiments, a third subdomain comprises one or more PO linkages, one or more PS linkages and / or one or more PN linkages. In some embodiments, a third subdomain comprises one or more PO linkages. In some embodiments, a third subdomain comprises one or more natural phosphate linkages. In some embodiments, a third subdomain comprises one or more PS linkages. In some embodiments, a third subdomain comprises one or more PN linkages. In some embodiments, a third subdomain comprises one or more PO linkages, one or more PS linkages and one or more PN linkages. In some embodiments, the first intemucleotidic linkage of a first domain or an oligonucleotide is a PN linkage. In some embodiments, the last intemucleotidic linkage of a third subdomain or an oligonucleotide is a PN linkage. In some embodiments, a natural DNA sugar is bonded to a modified intemucleotidic linkage. In some embodiments, a natural DNA sugar is bonded to a PN or PS intemucleotidic linkage. In some embodiments, each natural DNA sugar in an oligonucleotide or a portion thereof (e.g., a first domain, a first subdomain, a second subdomain, a third subdomain, etc.) is independently bonded to a modified intemucleotidic linkage. In some embodiments, each natural DNA sugar is independently bonded to a PN or PS intemucleotidic linkage. In some embodiments, a natural RNA sugar is bonded to a modified intemucleotidic linkage. In some embodiments, a natural RNA sugar is bonded to a PN or PS intemucleotidic linkage. In some embodiments, each natural RNA sugar in an oligonucleotide or a portion thereof (e.g., a first domain, a first subdomain, a second subdomain, a third subdomain, etc.) is independently bonded to a modified intemucleotidic linkage. In some embodiments, each natural RNA sugar is independently bonded to a PN or PS intemucleotidic linkage.
[0023] In some embodiments, a 2’-F modified sugar is bonded to a modified intemucleotidic linkage. In some embodiments, a 2’-F modified sugar is bonded to a PN or PS intemucleotidic linkage. In some embodiments, each 2'-F modified sugar in an oligonucleotide or a portion thereof (e.g., a first domain, a first subdomain, a second subdomain, a third subdomain, etc.) is independently bonded to a modified intemucleotidic linkage. In some embodiments, each 2’-F modified sugar is independently bonded to a PN or PS intemucleotidic linkage. In some embodiments, each PO linkage is independently a natural phosphate linkage. In some embodiments, each PS linkage is independently a phosphorothioate intemucleotidic linkage.In some embodiments, one or more PN linkages are independently non-negatively charged intemucleotidic linkage. In some embodiments, one or more PN linkages are independently neutral intemucleotidic linkage. In some embodiments, one or more PN linkages are independently phosphoryl guanidine linkages. In some embodiments, each PN linkage is independently a phosphoryl guanidine linkage. In some embodiments, one or more PN linkages are independently nOOl. In some embodiments, each PN linkage is independently nOOl.
[0024] In some embodiments, oligonucleotides of the present disclosure provides modified intemucleotidic linkages (i.e., intemucleotidic linkages that are not natural phosphate linkages). In some embodiments, linkage phosphorus of modified intemucleotidic linkages (e.g., chiral intemucleotidic linkages) are chiral and can exist in different configurations ( / ?p and Sp). Among other things, the present disclosure demonstrates that incorporation of modified intemucleotidic linkage, particularly with control of stereochemistry of linkage phosphorus centers (so that at such a controlled center one configuration is enriched compared to stereorandom oligonucleotide preparation), can significantly improve properties (e.g., stability) and / or activities (e.g., adenosine modifying activities (e.g., converting an adenosine to inosine). In some embodiments, provided oligonucleotides have stereochemical purity significantly higher than stereorandom preparations. In some embodiments, provided oligonucleotides are chirally controlled.
[0025] In some embodiments, oligonucleotides of the present disclosure comprise one or more chiral intemucleotidic linkages whose linkage phosphorus is chiral (e.g., a phosphorothioate intemucleotidic linkage). In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% (e.g., 50%-100%, 60%-100%, 70-100%, 75%- 100%, 80%-100%, 90%-100%, 95%-100%, 60%-95%, 70%-95%, 75-95%, 80-95%, 85-95%, 90-95%, 50%, 60%, 70%, 75%. 80%, 85%, 90%, 95%, or 99%, etc.) of all, or all intemucleotidic linkages in an oligonucleotide, are chiral intemucleotidic linkages. In some embodiments, at least one intemucleotidic linkage is a chiral intemucleotidic linkage. In some embodiments, at least one intemucleotidic linkage is a natural phosphate linkage. In some embodiments, each intemucleotidic linkage is independently a chiral intemucleotidic linkage. In some embodiments, at least one chiral intemucleotidic linkage is a phosphorothioate intemucleotidic linkage. In some embodiments, each is a phosphorothioate intemucleotidic linkage. In some embodiments, one or more chiral intemucleotidic linkages are independently a non- negatively charged intemucleotidic linkage or a neutral intemucleotidic linkage. In some embodiments, one or more chiral intemucleotidic linkages are independently a phosphoryl guanidine intemucleotidic linkage. In some embodiments, one or more chiral intemucleotidic linkages are independently chirally controlled. In some embodiments, each chiral intemucleotidic linkage is independently chirally controlled. In some embodiments, one or more chiral intemucleotidic linkages are not chirally controlled. In some embodiments, each phosphorothioate intemucleotidic linkage is independently chirally controlled. In some embodiments, each modified intemucleotidic linkage is independently a phosphorothioate or a non-negatively charged intemucleotidic linkage. In some embodiments, each modified intemucleotidic linkage is independently a phosphorothioate or a neutral intemucleotidic linkage. In some embodiments, each modified intemucleotidiclinkage is independently a phosphorothioate or a neutral intemucleotidic linkage. In some embodiments, each modified intemucleotidic linkage is independently a phosphorothioate or a phosphoryl guanidine intemucleotidic linkage. In some embodiments, a phosphoryl guanidine intemucleotidic linkage is nOOl. In some embodiments, each phosphoryl guanidine intemucleotidic linkage is nOOl. In some embodiments, each non-negatively charged intemucleotidic linkage is nOO 1 . In some embodiments, each neutral intemucleotidic linkage is nOOl. In some embodiments, a modified intemucleotidic linkage n002. In some embodiments, it is n006. In some embodiments, it is n006-2. In some embodiments, it is n020. In some embodiments, it is n004.In some embodiments, it is n008. In some embodiments, it is n025. In some embodiments, it is n026. Various modified intemucleotidic linkages are described herein. A linkage phosphorus can be either / ?p or Sp. In some embodiments, at least one linkage phosphorus is Sp. In some embodiments, at least one linkage phosphoms is Sp. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% (e.g, 50%-100%, 60%-100%, 70-100%, 75%- 100%, 80%-100%, 90%-100%, 95%-100%, 60%-95%, 70%-95%, 75-95%, 80-95%, 85-95%, 90-95%, 50%,60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, etc.) of all, or all chiral intemucleotidic linkages in an oligonucleotide, are Sp. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7. 8, 9, 10, 11, 12, 13, 14, 15. 16. 17,18, 19, or 20, or at least 50%. 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% (e.g., 50%-100%, 60%-100%.70-100%, 75%-100%, 80%-100%, 90%-100%, 95%-100%, 60%-95%, 70%-95%, 75-95%, 80-95%, 85-95%,90-95%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, etc.) of all, or all phosphorothioate intemucleotidic linkages in an oligonucleotide, are Sp. In some embodiments, at least 50% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 60% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 70% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 75% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 80% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 85% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 90% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 95% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 96% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 97% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 98% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, no more than 3, 4, 5, 6, 7, 8, 9, or 10 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 3 consecutive phosphorothioate intemucleotidic linkages arc Rp. In some embodiments, no more than 4 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 5 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments. no more than 6 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments. no more than 7 consecutive phosphorothioate intemucleotidic linkages are 7?p. In some embodiments, no more than 8 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 9consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 10 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, consecutive Rp phosphorothioate intemucleotidic linkages are not utilized in portions wherein the majority (e.g., greater than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more) or all of sugars are natural DNA and / or RNA and / or 2’-F modified sugars. In some embodiments, when consecutive Rp phosphorothioate intemucleotidic linkages are utilized, one or more or the majority (e.g., greater than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more) or all of such intemucleotidic linkages are independently bonded to sugars which can improve stability. In some embodiments, when consecutive Rp phosphorothioate intemucleotidic linkages are utilized, one or more or the majority’ (e.g., greater than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more) or all of such intemucleotidic linkages are independently bonded to bicyclic sugars or 2 ’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, when consecutive Rp phosphorothioate intemucleotidic linkages are utilized, one or more or the majority (e.g., greater than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more) or all of such intemucleotidic linkages are independently bonded to 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, each 2' -OR modified sugar is independently a 2’-OMe modified sugar or a 2’ -MOE modified sugar. In some embodiments, each 2’-ORmodified sugar is independently a 2’-OMe modified sugar. In some embodiments, each 2’-OR modified sugar is independently a 2 ’-MOE modified sugar.
[0026] In some embodiments, stereochemistry’ of one or more chiral linkage phosphorus of provided oligonucleotides are controlled in a composition. In some embodiments, the present disclosure provides a composition comprising a plurality of oligonucleotides, wherein oligonucleotides of a plurality share a common base sequence, and the same configuration of linkage phosphorus (e.g.. all are Rp or all are Sp for the chiral linkage phosphorus) independently at one or more (e.g., about 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all chiral intemucleotidic linkages) chiral intemucleotidic linkages (“chirally controlled intemucleotidic linkages”). In some embodiments, they share the same stereochemistry at each chiral linkage phosphorus. In some embodiments, oligonucleotides of a plurality share the same constitution. In some embodiments, oligonucleotides of a plurality are structurally identical except the intemucleotidic linkages. In some embodiments, oligonucleotides of a plurality are structurally identical. In some embodiments, at least at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in a composition, or of all oligonucleotides sharing the common base sequence, share the pattern of backbone chiral centers of oligonucleotides of the plurality. In some embodiments, at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in a composition, or of all oligonucleotides sharing the common base sequence, are oligonucleotides of the plurality.
[0027] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide, wherein at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or95% of all oligonucleotides in a composition, or of all oligonucleotides having the same base sequence of the oligonucleotide, or of all oligonucleotide having the same base sequence and sugar and base modifications, or of all oligonucleotides of the same constitution, share the same configuration of linkage phosphorus (e.g., all are Rp or all are Sp for the chiral linkage phosphorus) independently at one or more (e.g., about 1-50, 1-40, 1- 30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all chiral intemucleotidic linkages) chiral intemucleotidic linkages with the oligonucleotide. In some embodiments, tire present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide, wherein at least about 50%, 60%. 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in a composition, or of all oligonucleotides having the same base sequence of the oligonucleotide, or of all oligonucleotide having the same base sequence and sugar and base modifications, or of all oligonucleotides of the same constitution, are one or more forms of the oligonucleotide (e.g., acid forms, salt forms (e.g. pharmaceutically acceptable salt forms; as appreciated by those skilled in the art, in case the oligonucleotide is a salt, other salt forms of the corresponding acid or base form of the oligonucleotide), etc ).
[0028] In some embodiments, as demonstrated herein chirally controlled oligonucleotide compositions provide a number of advantages, e.g., higher stability, activities, etc., compared to corresponding stereorandom oligonucleotide compositions. In some embodiments, it was observed that chirally controlled oligonucleotide compositions provide high levels of adenosine modifying (e.g., converting A to I) activities with various isoforms of an ADAR protein (e.g., pl50 and pl 10 forms of ADAR1) while corresponding stereorandom compositions provide high levels of adenosine modify ing (e.g., converting A to I) activities with only certain isoforms of an ADAR protein (e.g., pl50 isoform of ADAR1).
[0029] In some embodiments, provided oligonucleotides comprise an additional moiety, e.g., a targeting moiety, a lipid moiety, a carbohydrate moiety, etc. Among other things, additional moieties may facilitate delivery' to certain target locations, e.g., cells, tissues, organs, etc. (e.g., locations comprising receptors that interact with additional moieties). In some embodiments, additional moieties facilitate delivery to lung.
[0030] In some embodiments, the present disclosure provides technologies for preparing oligonucleotides and compositions thereof, particularly chirally controlled oligonucleotide compositions. In some embodiments, provided oligonucleotides and compositions thereof are of high purity. In some embodiments, oligonucleotides of the present disclosure are at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% stereochemically pure at linkage phosphorus of chiral intemucleotidic linkages. In some embodiments, oligonucleotides of the present disclosure arc prepared stcrcosclcctivcly and arc substantially free of stereoisomers. In some embodiments, in provided compositions comprising a plurality of oligonucleotides which share the same base sequence of the same pattern of chiral linkage phosphorus stereochemistry (e.g.. comprising one or more of 7?p and / or Sp, wherein each chiral linkage phosphorus is independently / ?p or Sp), at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all oligonucleotides in the composition that share the same base sequence as oligonucleotides of the plurality share the same pattern of chiral linkagephosphorus stereochemistry or are oligonucleotides of the plurality. In some embodiments, in provided compositions comprising a plurality of oligonucleotides which share the same base sequence of the same pattern of chiral linkage phosphorus stereochemistry, at least 50%, 60%. 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all oligonucleotides in the composition that share the same constitution as oligonucleotides of the plurality share the same pattern of chiral linkage phosphorus stereochemistry or are oligonucleotides of the plurality.
[0031] In some embodiments, the present disclosure describes useful technologies for assessing oligonucleotide and compositions thereof. For example, various technologies of the present disclosure are useful for assessing adenosine modification. As appreciated by those skilled in the art, in some embodiments, modification / editing of adenosine can be assessed through sequencing, mass spectrometry, assessment (e.g.. levels, activities, etc.) of products (e.g., RNA, protein, etc.) of modified nucleic acids (e.g., wherein adenosines of target nucleic acids are converted to inosines), etc., optionally in view of other components (e.g., ADAR proteins) presence in modification systems (e.g., an in vitro system, an ex vivo system, cells, tissues, organs, organisms, subjects, etc.). Those skilled in the art will appreciate that oligonucleotides which provide adenosine modification of a target nucleic acid can also provide modified nucleic acid (e g., wherein a target adenosine is converted into I) and one or more products thereof (e.g.. mRNA, proteins, etc.). Certain useful technologies are described in the Examples.
[0032] As described herein, oligonucleotides and compositions of the present disclosure may be provided / utilized in various forms. In some embodiments, the present disclosure provides compositions comprising one or more forms of oligonucleotides, e.g., acid forms (e g., in which natural phosphate linkages exist as -O(P(O)(OH)-O-, phosphorothioate intemucleotidic linkages exist as -O(P(O)(SH)-O-). base forms, salt forms (e.g., in which natural phosphate linkages exist as salt forms (e.g., sodium salt (- O(P(O)(O Na+)-O-), phosphorothioate intemucleotidic linkages exist as salt forms (e.g., sodium salt (- O(P(O)(S Na )-Q-) etc. As appreciated by those skilled in the art, oligonucleotides can exist in various salt fomis, including pharmaceutically acceptable salts, and in solutions (e.g., various aqueous buffering system), cations may dissociate from anions. In some embodiments, the present disclosure provides a pharmaceutical composition comprising a provided oligonucleotide and / or one or more pharmaceutically acceptable salts thereof, and a pharmaceutically acceptable carrier. In some embodiments, pharmaceutical compositions are chirally controlled oligonucleotide compositions.
[0033] Provided technologies can be utilized for various purposes. For example, those skilled in the art will appreciate that provided technologies arc useful for many purposes involving modification of adenosine, e.g., correction of G to A mutations, modulate levels of certain nucleic acids and / or products encoded thereby (e.g., reducing levels of proteins by introducing A to G / I modifications), modulation of splicing, modulation of translation (e.g., modulating translation start and / or stop site by introducing A to G / I modifications), modulation of RNA / protein interactions, etc.
[0034] In some embodiments, the present disclosure provides technologies for preventing or treating acondition, disorder or disease that is amenable to an adenosine modification, e.g. conversion of A to I or G. As appreciated by those skilled in the art, I may perform one or more functions of G, e.g., in base pairing, translation, etc. In some embodiments, a G to A mutation may be corrected through conversion of A to I so that one or more products, e.g., proteins, of the G-version nucleic acid can be produced. In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease associated with a mutation, comprising administering to a subject susceptible thereto or suffering therefrom a provided oligonucleotide or composition thereof, which oligonucleotide or composition can edit a mutation. In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease associated with a G to A mutation, comprising administering to a subject susceptible thereto or suffering therefrom a provided oligonucleotide or composition thereof, which oligonucleotide or composition can modify an A. In some embodiments, provided technologies modify an A in a transcript, e.g., RNA transcript. In some embodiments, an A is converted into an I. In some embodiments, during translation protein synthesis machineries read I as G. In some embodiments, an A form encodes one or more proteins that have one or more higher desired activities and / or one or more better desired properties compared those encoded by its corresponding G form. In some embodiments, an A fonn provides higher levels, compared to its corresponding G form, of one or more proteins that have one or more higher desired activities and / or one or more better desired properties. In some embodiments, products encoded by an A form are structurally different (e.g., longer, in some embodiments, full length proteins) from those encoded by its corresponding G form. In some embodiments, an A fonn provides structurally identical products (e.g., proteins) compared to its corresponding G form.
[0035] In some embodiments, the present disclosure provides technologies for modulating levels of RNA and / or products encoded thereby by, e.g., editing a target adenosine. In some embodiments, the present disclosure provides technologies for increasing levels of RNA and / or products (e.g., polypeptides) encoded thereby by, e.g., editing atarget adenosine. In some embodiments, editing of an adenosine in a RNA modulates RNA processing, stability, transport, etc. In some embodiments, editing of an adenosine in a RNA modulates level of a RNA. In some embodiments, editing of an adenosine in a RNA modulates level of a product (e.g., a polypeptide) encoded thereby. In some embodiments, editing of an adenosine in a RNA increases level of the RNA. In some embodiments, editing of an adenosine in a RNA increases level of a product (e.g., a polypeptide) encoded thereby. In some embodiments, a RNA is a transcript. In some embodiments, a RNA is mRNA. In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease associated with levels of a transcript and / or a product encoded thereby, comprising administering to a subject susceptible thereto or suffering therefrom a provided oligonucleotide or composition thereof, which oligonucleotide or composition can modify a target adenosine in the transcript. In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease, comprising administering to a subject susceptible thereto or suffering therefrom a provided oligonucleotide or composition thereof, which oligonucleotide or composition can modify a target adenosinein a RNA thereby modulating (e.g., increasing) levels of a RNA and / or a product encoded thereby. In some embodiments, a RNA is a transcript. In some embodiments, a transcript is a CFTR transcript, e g., a CFTR mRNA. In some embodiments, a product encoded thereby is a CFTR polypeptide, e g., a CFTR protein. In some embodiments, a target adenosine is an adenosine targeted by oligonucleotides in the relevant Tables.
[0036] As those skilled in the art will appreciate, many conditions, disorders or diseases are associated with mutations that can be modified by provided technologies and can be prevented and / or treated using provided technologies. For example, it is reported that there are over 20,000 conditions, disorders or diseases are associated with G to A mutation and can benefit from A to I editing. In some embodiments, a condition, disorder or disease is cystic fibrosis. In some embodiments, a condition, disorder or disease is cystic fibrosis associated with a W1282X mutation. In some embodiments, a condition, disorder or disease is cystic fibrosis associated with a c.3846G>A mutation. In some embodiments, a condition, disorder or disease is cystic fibrosis associated with rs77010898.BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc ), sugar modifications (e g., 2’-F, 2’-OMe, [Ld]), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Human bronchial epithelial cells expressing CFTR-W1282X allele were dosed gymnotically with 3 uM of indicated oligonucleotides targeting CFTR.
[0038] Figure 2. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e g., 2’-F, 2’-OMe, etc ), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 3 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed.* indicates no data reported. Error bars represent standard error of the mean (SEM).
[0039] Figure 3. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-0Me, 2’-M0E, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 3 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed.* indicates no data reported. Error bars represent SEM.
[0040] Figure 4. Provided technologies can provide increased expression of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkagemodifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-OMe, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 3 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Total CFTR transcript expression was analyzed by qPCR. Graphs display mean total CFTR transcript expression relative to untreated control. * indicates no data reported. Error bars represent SEM.
[0041] Figure 5. Provided technologies can provide increased expression of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc ), sugar modifications (e.g., 2’-F, 2’-OMe, 2’-M0E, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 3 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Total CFTR transcript expression was analyzed by qPCR. Graphs display mean total CFTR transcript expression relative to untreated control. * indicates no data reported. Error bars represent SEM.
[0042] Figure 6. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-OMe, 2’-MOE, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTRW1282X were dosed gymnotically with 3 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed. Error bars represent SEM.
[0043] Figure 7. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-OMe, LNA, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W 1282X were dosed gymnotically with 3 uM of indicated oligonucleotides. Cells w ere harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed.* indicates no data reported. Error bars represent SEM.
[0044] Figure 8. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2 -F, 2’-0Mc, 2’-M0E, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 3 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed.* indicates no data reported. Error bars represent SEM.
[0045] Figure 9. Provided technologies can provide editing of target transcripts. Oligonucleotidescomprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e g., 2’-F, 2’-OMe, etc ), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with various concentrations of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Error bars represent SEM.
[0046] Figure 10. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e.g., 2'-F, 2'-OMe. 2’-M0E, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 0.5 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed. Error bars represent SEM.
[0047] Figure 11. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2 -F, 2’-OMe, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with various concentrations of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Error bars represent SEM.
[0048] Figure 12. Provided technologies can provide increased levels of CFTR W1282 polypeptide. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc ), sugar modifications (e g., 2’-F, 2’-0Me, etc.), and stereochemistry and patterns thereof were designed and assessed. 16EIBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 6 uM of ADR-0110591. Untreated 16HBE14o cells expressing CFTR W1282X and wild-type (WT) 16HBE14o cells were examined as controls. After 72 hours, cells were lysed in RIPA buffer and analyzed via western blotting using the UNC- 596p antibody (CFTR Antibody Distribution Program at the University of North Carolina). Membrane protein Na+ / K+ATPase was used as a loading control. CFTR protein was quantified using Image J software and normalized to the loading control.
[0049] Figure 13. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e.g., 2’-F, 2’-OMe. etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 0.2 uM or 8 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editingobserved. Error bars represent SEM. For each oligonucleotide, tire left column represents data for 8 uM and the right column represents data for 0.2 uM.
[0050] Figure 14. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS. PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-OMe, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 0.2 uM or 8 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed. * indicates no data reported. Error bars represent SEM. For each oligonucleotide, the left column represents data for 8 uM and the right column represents data for 0.2 uM.
[0051] Figure 15. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-OMe, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 0.2 uM or 8 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed. Error bars represent SEM. For each oligonucleotide, the left column represents data for 8 uM and the right column represents data for 0.2 uM.
[0052] Figure 16. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e g., 2’-F, 2'-OMe. etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W 1282X were dosed gymnotically with 0.2 uM or 8 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed. Error bars represent SEM. For each oligonucleotide, the top bar represents data for 0.2 uM and the bottom bar represents data for 8 uM.
[0053] Figure 17. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e g., 2’-F, 2’-OMe, etc ), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 0.2 uM or 8 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed. Error bars represent SEM. For each oligonucleotide, the top bar represents data for 0.2 uM and the bottom bar represents data for 8 uM.
[0054] Figure 18. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS,PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-OMe, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 0.2 uM or 8 uM of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Graph displays mean editing observed. Error bars represent SEM. For each oligonucleotide, the top bar represents data for 0.2 uM and the bottom bar represents data for 8 uM.
[0055] Figure 19. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e g., 2'-F, 2 -OMe. etc ), and stereochemistry and patterns thereof were designed and assessed. 16EIBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with various concentrations of indicated oligonucleotides. Cells were harvested after 48 hours. Editing was quantified by Sanger sequencing. Error bars represent SEM.
[0056] Figure 20. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-0Me, homo- DNA, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 3uM of indicated oligonucleotides. Cells were harvested 48 hours later, and RNA was collected and transcribed into cDNA. Editing was quantified by Sanger sequencing. Error bars represent standard error of the mean (SEM).
[0057] Figure 21. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-0Me, homo- DNA, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 6 uM (top bar) or 0.5 uM (bottom bar) of indicated oligonucleotides. Cells were harvested 48 hours later, and RNA was collected and transcribed into cDNA. Editing was quantified by Sanger sequencing. Error bars represent standard error of the mean (SEM).
[0058] Figure 22. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2 -F, 2’-0Mc, homo- DNA, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 8 uM (top bar) or 0.3 uM (bottom bar) of indicated oligonucleotides. Cells were harvested 48 hours later, and RNA was collected and transcribed into cDNA. Editing was quantified by Sanger sequencing. Error bars represent standard error of the mean (SEM).
[0059] Figure 23. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as base modifications (e.g., [3nU]), linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2 -F, 2'-OMe, homo- DNA, etc.), and stereochemistry and patterns thereof were designed and assessed. 16HBE14o bronchial epithelial cells expressing CFTR W1282X were dosed gymnotically with 8 uM (top bar) or 0.3 uM (bottom bar) of indicated oligonucleotides. Cells were harvested 48 hours later, and RNA was collected and transcribed into cDNA. Editing was quantified by Sanger sequencing. Error bars represent standard error of the mean (SEM).DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0060] Technologies of the present disclosure may be understood more readily by reference to the following detailed description of certain embodiments.Definitions
[0061] As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version. Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001.
[0062] As used herein in the present disclosure, unless otherwise clear from context, (i) the term “a” or "an" may be understood to mean "at least one”; (ii) the term “or” may be understood to mean “and / or”; (iii) the terms “comprising”, “comprise”, “including” (whether used with “not limited to” or not), and “include” (whether used with ’‘not limited to” or not) may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps; (iv) the term “another” may be understood to mean at least an additional / second one or more; (v) the terms “about” and “approximately” may be understood to pennit standard variation as would be understood by those of ordinary skill in tire art; and (vi) where ranges are provided, endpoints are included.
[0063] Unless otherwise specified, description of oligonucleotides and elements thereof (e.g., base sequence, sugar modifications, intemucleotidic linkages, linkage phosphorus stereochemistry, patterns thereof, etc.) is from 5’ to 3’. As those skilled in the art will appreciate, in some embodiments, oligonucleotides may be provided and / or utilized as salt forms, particularly pharmaceutically acceptable salt forms, e.g., sodium salts. As those skilled in the art will also appreciate, in some embodiments, individual oligonucleotides within a composition may be considered to be of the same constitution and / or structure even though, within such composition (e.g., a liquid composition), particular such oligonucleotides might be in different salt form(s) (and may be dissolved and the oligonucleotide chain may exist as an anion form when, e g., in a liquid composition) at a particular moment in time. For example, those skilled in the art will appreciate that, at agiven pH, individual intemucleotidic linkages along an oligonucleotide chain may be in an acid (H) form, or in one of a plurality of possible salt forms (e.g., a sodium salt, or a salt of a different cation, depending on which ions might be present in the preparation or composition), and will understand that, so long as their acid forms (e.g., replacing all cations, if any, with H1) are of the same constitution and / or structure, such individual oligonucleotides may properly be considered to be of the same constitution and / or structure.
[0064] Aliphatic: As used herein, ‘’aliphatic” means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or combinations thereof. In some embodiments, aliphatic groups contain 1-50 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-20 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-10 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-9 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-8 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-7 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.
[0065] Alkenyl: As used herein, the term “alkenyl” refers to an aliphatic group, as defined herein, having one or more double bonds.
[0066] Alkyl: As used herein, the tenn “alkyl” is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In some embodiments, alkyl has 1-100 carbon atoms. In certain embodiments, a straight chain or branched chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C1-C20 for straight chain, C2-C20 for branched chain), and alternatively, about 1-10. In some embodiments, cycloalkyl rings have from about 3-10 carbon atoms in their ring structure where such rings are monocyclic, bicyclic, or polycyclic, and alternatively about 5, 6 or 7 carbons in the ring structure. In some embodiments, an alkyl group may be a lower alkyl group, wherein a lower alkyl group comprises 1-4 carbon atoms (e g., C1-C4 for straight chain lower alkyls).
[0067] Alkynyl: As used herein, the term “alkynyl” refers to an aliphatic group, as defined herein, having one or more triple bonds.
[0068] Analog: The term “analog” includes any chemical moiety which differs structurally from a reference chemical moiety or class of moieties. but which is capable of performing at least one function of such a reference chemical moiety or class of moieties. As non-limiting examples, a nucleotide analog differs structurally from a nucleotide but performs at least one function of a nucleotide; a nucleobase analog differs structurally from a nucleobase but performs at least one function of a nucleobase; etc.
[0069] Animal: As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g.. a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate and / or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish and / or worms. In some embodiments, an animal may be a transgenic animal, a genetically-engineered animal and / or a clone.
[0070] Aryl: The term “aryl", as used herein, used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy.” or “aryloxyalkyl,” refers to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic. In some embodiments, an aryl group is a monocyclic, bicyclic or polycyclic ring system having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic, and wherein each ring in the system contains 3 to 7 ring members. In some embodiments, each monocyclic ring unit is aromatic. In some embodiments, an and group is a biaryl group. Tire term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of tire present disclosure, “aryl” refers to an aromatic ring system which includes, but is not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.
[0071] Characteristic portion: As used herein, the term “characteristic portion”, in the broadest sense, refers to a portion of a substance whose presence (or absence) correlates with presence (or absence) of a particular feature, attribute, or activity of the substance. In some embodiments, a characteristic portion of a substance is a portion that is found in the substance and in related substances that share the particular feature, attribute or activity, but not in those that do not share the particular feature, attribute or activity. In certain embodiments, a characteristic portion shares at least one functional characteristic with the intact substance. For example, in some embodiments, a “characteristic portion” of a protein or polypeptide is one that contains a continuous stretch of amino acids, or a collection of continuous stretches of amino acids, that together are characteristic of a protein or polypeptide. In some embodiments, each such continuous stretch generally contains at least 2, 5, 10, 15, 20, 50, or more amino acids. In general, a characteristic portion of a substance (e.g., of a protein, antibody, etc.) is one that, in addition to the sequence and / or structural identity specified above, shares at least one functional characteristic with the relevant intact substance. In some embodiments, a characteristic portion may be biologically active.
[0072] Chiral control: As used herein, “chiral control” refers to control of the stereochemical designation of the chiral linkage phosphorus in a chiral intemucleotidic linkage within an oligonucleotide. As used herein, a chiral intemucleotidic linkage is an intemucleotidic linkage whose linkage phosphoms is chiral. In some embodiments, a control is achieved through a chiral element that is absent from the sugar and base moieties ofan oligonucleotide, for example, in some embodiments, a control is achieved tirrough use of one or more chiral auxiliaries during oligonucleotide preparation, which chiral auxiliaries often are part of chiral phosphoramidites used during oligonucleotide preparation. In contrast to chiral control, a person having ordinary skill in the art will appreciate that conventional oligonucleotide synthesis which does not use chiral auxiliaries cannot control stereochemistry at a chiral intemucleotidic linkage if such conventional oligonucleotide synthesis is used to form the chiral intemucleotidic linkage. In some embodiments, the stereochemical designation of each chiral linkage phosphorus in each chiral intemucleotidic linkage within an oligonucleotide is controlled.
[0073] Chirally controlled oligonucleotide composition: Tire tenns “chirally controlled oligonucleotide composition7’, “chirally controlled nucleic acid composition”, and the like, as used herein, refers to a composition that comprises a plurality of oligonucleotides (or nucleic acids) which share a common base sequence, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage phosphorus stereochemistry at one or more chiral intemucleotidic linkages (chirally controlled or stereodefined intemucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition (“stereodefined”), not a random Rp and Sp mixture as non-chirally controlled intemucleotidic linkages). In some embodiments, a chirally controlled oligonucleotide composition comprises a plurality of oligonucleotides (or nucleic acids) that share: 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone phosphoms modifications, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage phosphoms stereochemistry at one or more chiral intemucleotidic linkages (chirally controlled or stereodefined intemucleotidic linkages, whose chiral linkage phosphoms is Rp or Sp in tire composition (“stereodefined”), not a random Rp and Sp mixture as non-chirally controlled intemucleotidic linkages). Level of the plurality of oligonucleotides (or nucleic acids) in a chirally controlled oligonucleotide composition is pre-determined / controlled or enriched (e.g., through chirally controlled oligonucleotide preparation to stereoselectively form one or more chiral intemucleotidic linkages) compared to a random level in a nonchirally controlled oligonucleotide composition. In some embodiments, about l%-100%, (e.g., about 5%- 100%, 10%-100%, 20%-100%, 30%-100%. 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90- 100%. 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%. 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%. 92%, 93%, 94%, 95%, 96%. 97%. 98%. 99%, or 100%, or at least 5%. 10%. 20%, 30%, 40%, 50%, 60%, 70%. 80%. 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition are oligonucleotides of the plurality. In some embodiments, about 1%- 100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%- 100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%. 50%. 60%, 70%, 80%, 85%, 90%, 91%, 92%. 93%. 94%, 95%, 96%, 97%, 98%, 99%, or 100%. or at least 5%, 10%, 20%, 30%. 40%. 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition that share the common base sequence, the common pattern of backbone linkages, and tire common pattern of backbone phosphoms modifications areoligonucleotides of the plurality. In some embodiments, a level is about l%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%,95-100%, 50%-90%, or about 5%. 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%. 92%. 93%, 94%, 95%, 96%, 97%. 98%. 99%, or 100%, or at least 5%. 10%. 20%, 30%, 40%, 50%, 60%, 70%, 80%. 85%. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a composition, or of all oligonucleotides in a composition that share a common base sequence (e.g., of a plurality of oligonucleotide or an oligonucleotide type), or of all oligonucleotides in a composition that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications, or of all oligonucleotides in a composition that share a common base sequence, a common patter of base modifications, a common pattern of sugar modifications, a common pattern of intemucleotidic linkage types, and / or a common pattern of intemucleotidic linkage modifications. In some embodiments, the plurality of oligonucleotides share the same stereochemistry at about 1-50 (e.g., about 1-10, 1-20, 5-10, 5-20, 10-15, 10- 20, 10-25, 10-30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral intemucleotidic linkages. In some embodiments, the plurality of oligonucleotides share the same stereochemistry at about 1 %-l 00% (e.g., about5%-100%. 10%-100%, 20%-100%. 30%-100%, 40%-100%, 50%-100%. 60%-100%, 70%-100%, 80-100%.90-100%, 95-100%, 50%-90%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%.65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of chiral intemucleotidic linkages. In some embodiments, oligonucleotides (or nucleic acids) of a plurality share the same pattern of sugar and / or nucleobase modifications, in any. In some embodiments, oligonucleotides (or nucleic acids) of a plurality are various forms of the same oligonucleotide (e.g., acid and / or various salts of the same oligonucleotide). In some embodiments, oligonucleotides (or nucleic acids) of a plurality are of the same constitution. In some embodiments, level of tire oligonucleotides (or nucleic acids) of the plurality is about 1 %- 100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%,90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%. 80%. 85%, 90%, 91%,92%, 93%, 94%, 95%. 96%. 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%. 70%,80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides (or nucleic acids) in a composition that share the same constitution as the oligonucleotides (or nucleic acids) of the plurality. In some embodiments, each chiral intemucleotidic linkage is a chiral controlled intemucleotidic linkage, and the composition is a completely chirally controlled oligonucleotide composition. In some embodiments, oligonucleotides (or nucleic acids) of a plurality are structurally identical. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 80%. 85%. 90%. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 95%. In some embodiments, a chirally controlled intemucleotidic linkage hasa diastereopurity of at least 96%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 97%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 98%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 99%. In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and nc is the number of chiral linkage phosphorus as described in the present disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%. 96%. 97%. 98%, 99% or 99.5% or more) and nc is the number of chirally controlled intemucleotidic linkages as described in the present disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is 95%-100%. For example, when DS is 99% and nc is 10, the percentage is or is at least 90% ((99%)100.90 = 90%). In some embodiments, level of a plurality of oligonucleotides in a composition is represented as the product of the diastereopurity of each chiral linkage phosphorus. In some embodiments, level of a plurality of oligonucleotides in a composition is represented as the product of the diastereopurity of each chirally controlled intemucleotidic linkage in the oligonucleotides. In some embodiments, diastereopurity of an intemucleotidic linkage connecting two nucleosides in an oligonucleotide (or nucleic acid) is represented by tire diastereopurity of an intemucleotidic linkage of a dimer connecting the same two nucleosides, wherein the dimer is prepared using comparable conditions, in some instances, identical synthetic cycle conditions (e.g., for the linkage between Nx and Ny in an oligonucleotide ....NxNy , the dimer is NxNy). In some embodiments, not all chiral intemucleotidic linkages are chiral controlled intemucleotidic linkages, and the composition is a partially chirally controlled oligonucleotide composition. In some embodiments, a non-chirally controlled intemucleotidic linkage has a diastereopurity of less than about 80%, 75%, 70%, 65%, 60%, 55%. or of about 50%, as typically observed in stereorandom oligonucleotide compositions (e.g., as appreciated by those skilled in the art, from traditional oligonucleotide synthesis, e.g., the phosphoramidite method). In some embodiments, oligonucleotides (or nucleic acids) of a plurality are of the same type. In some embodiments, a chirally controlled oligonucleotide composition comprises non-random or controlled levels of individual oligonucleotide or nucleic acids types. For instance, in some embodiments a chirally controlled oligonucleotide composition comprises one and no more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises multiple oligonucleotide types. In some embodiments, a chirally controlled oligonucleotide composition is a composition of oligonucleotides of an oligonucleotide type, which composition comprises a non-random or controlled level of a plurality ofoligonucleotides of the oligonucleotide type.
[0074] Comparable: Tire term “comparable” is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to pennit comparison of results obtained or phenomena observed. In some embodiments, comparable sets of conditions or circumstances are characterized by aplurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will appreciate that sets of conditions are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under the different sets of conditions or circumstances are caused by or indicative of the variation in those features that are varied.
[0075] Cycloaliphatic: The term “cycloaliphatic,” “carbocycle,” “carbocyclyl,” “carbocyclic radical,” and “carbocyclic ring,” are used interchangeably, and as used herein, refer to saturated or partially unsaturated, but non-aromatic, cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems, as described herein, having, unless otherwise specified, from 3 to 30 ring members. Cycloaliphatic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbomyL adamantyl, and cyclooctadienyl . In some embodiments, a cycloaliphatic group has 3-6 carbons. In some embodiments, a cycloaliphatic group is saturated and is cycloalkyl. The term “cycloaliphatic” may also include aliphatic rings that are fused to one or more aromatic or nonaromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, a cycloaliphatic group is bicyclic. In some embodiments, a cycloaliphatic group is tricyclic. In some embodiments, a cycloaliphatic group is polycyclic. In some embodiments, “cycloaliphatic” refers to Q-C, monocyclic hydrocarbon, or Cs-Cio bicyclic or polycyclic hydrocarbon, that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule, or a Cs-Cie polycyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.
[0076] Effective amount: As used herein, the term “effective amount” means an amount of a substance (e.g., an oligonucleotide, therapeutic agent, composition, and / or fonnulation) that elicits a desired biological response when administered or delivered. In some embodiments, an effective amount of a substance is an amount that is sufficient, when administered or delivered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition, or to otherwise produce a biological effect (e.g., increasing or reducing level of a target nucleic acid or a product encoded thereby). As will be appreciated by those of ordinary’ skill in the art, an effective amount of a substance may vary depending on such factors as the desired biological effect or endpoint, the substance to be delivered, the target cell or tissue, etc. In some embodiments, an effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver an effective amount.
[0077] Heteroaliphatic: The term “heteroaliphatic”, as used herein, is given its ordinary’ meaning in the art and refers to aliphatic groups as described herein in which one or more carbon atoms are independentlyreplaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). In some embodiments, one or more units selected from C, CH, CH2, and CH3 are independently replaced by one or more heteroatoms (including oxidized and / or substituted forms thereof). In some embodiments, a heteroaliphatic group is heteroalkyl. In some embodiments, a heteroaliphatic group is heteroalkenyl.
[0078] Heteroalkyl: The term “heteroalkyl”, as used herein, is given its ordinary meaning in the art and refers to alkyl groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). Examples of heteroalkyl groups include, but are not limited to, alkoxy, polyethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl. morpholinyl, etc.
[0079] Heteroaryl: The terms “heteroaryl” and “heteroar-”, as used herein, used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), in some embodiments 5, 6, 9, or 10 ring atoms. In some embodiments, each monocyclic ring unit is aromatic. In some embodiments, a heteroaryl group has 6, 10, or 14 7i electrons shared in a cyclic array: and having, in addition to carbon atoms, from one to five heteroatoms. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. In some embodiments, a heteroaryl is a heterobiaryl group, such as bipyridyl and the like. Hie terms “heteroaryl” and “heteroar-”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofiiranyl, dibenzofiiranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-l,4-oxazin-3(4H)-one. A heteroaryl group may be monocyclic, bicyclic or polycyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl group, wherein the alkyl and heteroaryl portions independently are optionally substituted.
[0080] Hctcroatom: The tcmi “hctcroatom", as used herein, means an atom that is not carbon or hy drogen. In some embodiments, a heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including oxidized forms of nitrogen, sulfur, phosphorus, or silicon; charged forms of nitrogen (e.g., quatemized forms, forms as in iminium groups, etc.), phosphorus, sulfur, oxygen; etc.). In some embodiments, a heteroatom is silicon, phosphorus, oxygen, sulfur or nitrogen. In some embodiments, a heteroatom is silicon, oxygen, sulfur or nitrogen. In some embodiments, a heteroatom is oxygen, sulfur or nitrogen.
[0081] Heterocycle: As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring", as used herein, are used interchangeably and refer to a monocyclic, bicyclic or polycyclic ring moiety (e.g., 3-30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, a heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10- membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur and nitrogen, the nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or+NR (as in N-substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofiiranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring.” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be monocyclic, bicyclic or polycyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.
[0082] Identity: As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be perfonned by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. Tire nucleotides at corresponding positions arc then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between tire two sequences is a function of the number of identical positions shared by tire sequences, taking into account tire number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using amathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between tw o nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
[0083] Intemucleotidic linkage: As used herein, the phrase “intemucleotidic linkage” refers generally to a linkage linking nucleoside units of an oligonucleotide or a nucleic acid. In some embodiments, an intemucleotidic linkage is a phosphodiester linkage, as extensively found in naturally occurring DNA and RNA molecules (natural phosphate linkage (-OP(=O)(OH)O-), which as appreciated by those skilled in the art may exist as a salt form). In some embodiments, an intemucleotidic linkage is a modified intemucleotidic linkage (not a natural phosphate linkage). In some embodiments, an intemucleotidic linkage is a “modified intemucleotidic linkage” wherein at least one oxygen atom or -OH of a phosphodiester linkage is replaced by a different organic or inorganic moiety. In some embodiments, such an organic or inorganic moiety is selected from =S, =Se, =NR’, -SR’, -SeR’. -N(R’)2, B(R’)3, -S-. -Se-. and -N(R’)-. wherein each R’ is independently as defined and described in the present disclosure. In some embodiments, an intemucleotidic linkage is a phosphotriester linkage, phosphorothioate linkage (or phosphorothioate diester linkage, -OP(=O)(SH)O-, which as appreciated by those skilled in the art may exist as a salt form), or phosphorothioate triester linkage. In some embodiments, a modified intemucleotidic linkage is a phosphorothioate linkage. In some embodiments, an intemucleotidic linkage is one of, e.g., PNA (peptide nucleic acid) or PMO (phosphorodiamidate Morpholino oligomer) linkage. In some embodiments, a modified intemucleotidic linkage is a non-negatively charged intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is a neutral intemucleotidic linkage (e.g., nOO l in certain provided oligonucleotides). It is understood by a person of ordinary skill in the art that an intemucleotidic linkage may exist as an anion or cation at a given pH due to the existence of acid or base moieties in the linkage. In some embodiments, a modified intemucleotidic linkages is a modified intemucleotidic linkages designated as s, si, s2, s3, s4, s5, s6, s7, s8, s9, slO. si 1, sl2, s 13, sl4, s 15. s!6, s 17 and si 8 as described in WO 2017 / 210647.
[0084] In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, e g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e g., animal, plant and / or microbe).
[0085] In vivo: As used herein, the tcmi “in vivo” refers to events that occur within an organism (e.g., animal, plant and / or microbe).
[0086] Linkage phosphoms: as defined herein, the phrase “linkage phosphorus” is used to indicate that the particular phosphorus atom being referred to is the phosphoms atom present in the intemucleotidic linkage, which phosphoms atom corresponds to the phosphoms atom of a phosphodiester intemucleotidic linkage as occurs in naturally occurring DNA and RNA. In some embodiments, a linkage phosphoms atom is in amodified intemucleotidic linkage, wherein each oxygen atom of a phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, a linkage phosphorus atom is chiral (e.g., as in phosphorothioate intemucleotidic linkages). In some embodiments, a linkage phosphorus atom is achiral (e.g.. as in natural phosphate linkages).
[0087] Modified nucleobase: The terms "modified nucleobase", "modified base" and the like refer to a chemical moiety which is chemically distinct from a nucleobase, but which is capable of performing at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase which comprises a modification. In some embodiments, a modified nucleobase is capable of at least one function of a nucleobase, e.g.. forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases. In some embodiments, a modified nucleobase is substituted A, T, C. G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of oligonucleotides refer to a nucleobase that is not A, T, C, G or U.
[0088] Modified nucleoside: The term "modified nucleoside" refers to a moiety derived from or chemically similar to a natural nucleoside, but which comprises a chemical modification which differentiates it from a natural nucleoside. Non-limiting examples of modified nucleosides include those which comprise a modification at the base and / or the sugar. Non-limiting examples of modified nucleosides include those with a 2’ modification at a sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (which lack a nucleobase). In some embodiments, a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.
[0089] Modified nucleotide: The term “modified nucleotide” includes any chemical moiety which differs structurally from a natural nucleotide but is capable of performing at least one function of a natural nucleotide. In some embodiments, a modified nucleotide comprises a modification at a sugar, base and / or intemucleotidic linkage. In some embodiments, a modified nucleotide comprises a modified sugar, modified nucleobase and / or modified intemucleotidic linkage. In some embodiments, a modified nucleotide is capable of at least one function of a nucleotide, e g., forming a subunit in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.
[0090] Modified sugar. The term “modified sugar” refers to a moiety that can replace a sugar. A modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of a sugar. In some embodiments, as described in the present disclosure, a modified sugar is substituted ribose or deoxyribose. In some embodiments, a modified sugar comprises a 2 ’-modification. Examples of useful 2’- modification are widely utilized in the art and described herein. In some embodiments, a 2’ -modification is 2’-F. In some embodiments, a 2 '-modification is 2 -OR. wherein R is optionally substituted Cuio aliphatic. In some embodiments, a 2 ’-modification is 2’-OMe. In some embodiments, a 2 ’-modification is 2’-MOE. In some embodiments, a modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc ). In some embodiments, in the context of oligonucleotides, a modified sugar is a sugar that is not ribose or deoxyriboseas typically found in natural RNA or DNA.
[0091] Nucleic acid: The term “nucleic acid”, as used herein, includes any nucleotides and polymers thereof. The tenn “polynucleotide”, as used herein, refers to a polymeric fonn of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) or a combination thereof. These terms refer to the primary structure of the molecules and, thus, include double- and single-stranded DNA, and double- and single-stranded RNA. These terms include, as equivalents, analogs of either RNA or DNA comprising modified nucleotides and / or modified polynucleotides, such as, though not limited to, methylated, protected and / or capped nucleotides or polynucleotides. The terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified intemucleotidic linkages. The term encompasses nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified intemucleotidic linkages. Examples include, and are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxyribose moieties, nucleic acids containing both ribose and deoxyribose moieties. nucleic acids containing ribose and modified ribose moieties. Unless otherwise specified, the prefix poly- refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units and wherein the prefix oligo- refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.
[0092] Nucleobase: Tire term “nucleobase” refers to the parts of nucleic acids that are involved in the hydrogen-bonding that binds one nucleic acid strand to another complementary strand in a sequence specific manner. The most common naturally-occurring nucleobases are adenine (A), guanine (G). uracil (U), cytosine (C), and thymine (T). In some embodiments, a naturally-occurring nucleobases are modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a naturally-occurring nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase comprises a heteroaryl ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, a nucleobase comprises a heterocyclic ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, a nucleobase is a “modified nucleobase,” a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a modified nucleobase is substituted A, T, C, G or U. In some embodiments, a modified nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobases is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of the nucleobase and retains the property of hydrogen-bonding that binds one nucleic acid strand to another in a sequence specific manner. In some embodiments, a modified nucleobase can pair with all of the five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes or activity of the oligonucleotide duplex. As used herein, theterm “nucleobase” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, a nucleobase is optionally substituted A, T, C, G, or U. or an optionally substituted tautomer of A, T, C, G, or U. In some embodiments, a “nucleobase” refers to a nucleobase unit in an oligonucleotide or a nucleic acid (e.g., A. T, C. G or U as in an oligonucleotide or a nucleic acid).
[0093] Nucleoside: The term “nucleoside” refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. In some embodiments, a nucleoside is a natural nucleoside, e.g.. adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxy cytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxy cytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxy cytidine. In some embodiments, a “nucleoside” refers to a nucleoside unit in an oligonucleotide or a nucleic acid.
[0094] Nucleotide: The term “nucleotide” as used herein refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more intemucleotidic linkages (e.g., phosphate linkages in natural DNA and RNA). The naturally occurring bases [guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)] are derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included. Hie naturally occurring sugar is the pentose (five- carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included. Nucleotides are linked via intemucleotidic linkages to form nucleic acids, or polynucleotides. Many intemucleotidic linkages are known in the art (such as, though not limited to, phosphate, phosphorothioates, boranophosphates and the like). Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothionates, H- phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates and other variants of tire phosphate backbone of native nucleic acids, such as those described herein. In some embodiments, a natural nucleotide comprises a naturally occurring base, sugar and intemucleotidic linkage. As used herein, the term “nucleotide” also encompasses stmctural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleotides and nucleotide analogs. In some embodiments, a “nucleotide” refers to a nucleotide unit in an oligonucleotide or a nucleic acid.
[0095] Oligonucleotide: The tcnn "oligonucleotide" refers to a polymer or oligomer of nucleotides, and may contain any combination of natural and non-natural nucleobases, sugars, and intemucleotidic linkages.
[0096] Oligonucleotides can be single-stranded or double-stranded. A single-stranded oligonucleotide can have double-stranded regions (formed by two portions of the single-stranded oligonucleotide) and a double -stranded oligonucleotide, which comprises two oligonucleotide chains, can have single-stranded regions for example, at regions where the two oligonucleotide chains are not complementary to each other.Example oligonucleotides include, but are not limited to structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single -stranded and doublestranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA. antisense oligonucleotides, ribozymes, microRNAs. microRNA mimics, supermirs. aptamers, antimirs. antagomirs, U1 adaptors, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.
[0097] Oligonucleotides of tire present disclosure can be of various lengths. In particular embodiments, oligonucleotides can range from about 2 to about 200 nucleosides in length. In various related embodiments, oligonucleotides, single-stranded, double-stranded, or triple-stranded, can range in length from about 4 to about 10 nucleosides, from about 10 to about 50 nucleosides, from about 20 to about 50 nucleosides, from about 15 to about 30 nucleosides, from about 20 to about 30 nucleosides in length. In some embodiments, an oligonucleotide is from about 9 to about 39 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 26 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 27 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 28 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 29 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 30 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 31 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 32 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 60 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 50 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 40 nucleosides in length. In some embodiments, an oligonucleotide is from about 30 to about 40 nucleosides in length. In some embodiments, the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides in length. In some embodiments, an oligonucleotide is at least 4 nucleosides in length. In some embodiments, an oligonucleotide is at least 5 nucleosides in length. In some embodiments, an oligonucleotide is at least 6 nucleosides in length. In some embodiments, an oligonucleotide is at least 7 nucleosides in length. In some embodiments, an oligonucleotide is at least 8 nucleosides in length. In some embodiments, an oligonucleotide is at least 9 nucleosides in length. In some embodiments, an oligonucleotide is at least 10 nucleosides in length. In some embodiments, an oligonucleotide is at least 1 1 nucleosides in length. In some embodiments, an oligonucleotide is at least 12 nucleosides in length. In some embodiments, an oligonucleotide is at least 15 nucleosides in length. In some embodiments, an oligonucleotide is at least 15 nucleosides in length. In some embodiments, an oligonucleotide is at least 16 nucleosides in length. In some embodiments, an oligonucleotide is at least 17 nucleosides in length. In some embodiments, an oligonucleotide is at least 18 nucleosides in length. In some embodiments, an oligonucleotide is at least 19 nucleosides in length. In some embodiments, an oligonucleotide is at least 20 nucleosides in length. In some embodiments, an oligonucleotide is at least 25 nucleosides in length. In some embodiments, an oligonucleotideis at least 26 nucleosides in length. In some embodiments, an oligonucleotide is at least 27 nucleosides in length. In some embodiments, an oligonucleotide is at least 28 nucleosides in length. In some embodiments, an oligonucleotide is at least 29 nucleosides in length. In some embodiments, an oligonucleotide is at least 30 nucleosides in length. In some embodiments, an oligonucleotide is at least 31 nucleosides in length. In some embodiments, an oligonucleotide is at least 32 nucleosides in length. In some embodiments, an oligonucleotide is at least 33 nucleosides in length. In some embodiments, an oligonucleotide is at least 34 nucleosides in length. In some embodiments, an oligonucleotide is at least 35 nucleosides in length. In some embodiments, an oligonucleotide is at least 36 nucleosides in length. In some embodiments, an oligonucleotide is at least 37 nucleosides in length. In some embodiments, an oligonucleotide is at least 38 nucleosides in length. In some embodiments, an oligonucleotide is at least 39 nucleosides in length. In some embodiments, an oligonucleotide is at least 40 nucleosides in length. In some embodiments, an oligonucleotide is 25 nucleosides in length. In some embodiments, an oligonucleotide is 26 nucleosides in length. In some embodiments, an oligonucleotide is 27 nucleosides in length. In some embodiments, an oligonucleotide is 28 nucleosides in length. In some embodiments, an oligonucleotide is 29 nucleosides in length. In some embodiments, an oligonucleotide is 30 nucleosides in length. In some embodiments, an oligonucleotide is 31 nucleosides in length. In some embodiments, an oligonucleotide is 32 nucleosides in length. In some embodiments, an oligonucleotide is 33 nucleosides in length. In some embodiments, an oligonucleotide is 34 nucleosides in length. In some embodiments, an oligonucleotide is 35 nucleosides in length. In some embodiments, an oligonucleotide is 36 nucleosides in length. In some embodiments, an oligonucleotide is 37 nucleosides in length. In some embodiments, an oligonucleotide is 38 nucleosides in length. In some embodiments, an oligonucleotide is 39 nucleosides in length. In some embodiments, an oligonucleotide is 40 nucleosides in length. In some embodiments, each nucleoside counted in an oligonucleotide length independently comprises a nucleobase comprising a ring having at least one nitrogen ring atom. In some embodiments, each nucleoside counted in an oligonucleotide length independently comprises A, T, C, G, or U, or optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G or U.
[0098] Oligonucleotide type: As used herein, the phrase “oligonucleotide type” is used to define an oligonucleotide that has a particular base sequence, pattern of backbone linkages (i.e., pattern of intemucleotidic linkage types, for example, phosphate, phosphorothioate, phosphorothioate triester, etc.), pattern of backbone chiral centers [i.e., pattern of linkage phosphorus stereochemistry (Rp / Sp)], and pattern of backbone phosphorus modifications. In some embodiments, oligonucleotides of a common designated “type” arc structurally identical to one another.
[0099] One of skill in the art will appreciate that synthetic methods of the present disclosure provide for a degree of control during the synthesis of an oligonucleotide strand such that each nucleotide unit of the oligonucleotide strand can be designed and / or selected in advance to have a particular stereochemistry at the linkage phosphorus and / or a particular modification at the linkage phosphorus, and / or a particular base, and / or a particular sugar. In some embodiments, an oligonucleotide strand is designed and / or selected in advance tohave a particular combination of stereocenters at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or determined to have a particular combination of modifications at tire linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of bases. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of one or more of the above structural characteristics. In some embodiments, the present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type (i.e., are structurally identical to one another). In some embodiments, however, provided compositions comprise a plurality of oligonucleotides of different types, typically in pre -determined relative amounts.
[0100] Optionally Substituted: As described herein, compounds of the disclosure may contain optionally substituted, substituted and / or unsubstituted moieties. In general, the term “substituted,” means that one or more hydrogens of the designated moiety are independently replaced with a substituent. Unless otherwise indicated, an “optionally substituted” group may independently have a substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with two or more substituents, the substituents may be either the same or different at every position. In some embodiments, an optionally substituted group is unsubstituted. In some embodiments, an optionally substituted group is substituted. Various substituents are described below.
[0101] Monovalent substituents are independently halogen; (C 112) i4R° : -(CI I2)l 4OR°: -0(CH2)O-4R°, - O-(CH2)4 4C(O)OR°: -(CH2)OMCH(OR°)2; -(CH2)U4Ph. which may be substituted with R°; -(CH2)o- 40(CH2)o-iPh which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)040(CH2)O-I -pyridyl which may be substituted with R°; -NO2; -CN; -N3; -(CH2)0MN(R°)2; -(CH2)o-4N(R°)C(O)R°; -N(R°)C(S)R°; -(CH2)0MN(R°)C(O)N(R°)2; -N(RO)C(S)N(R°)2; -(CH2)„4N(R°)C(O)OR°; - N(R°)N(R°)C(O)R°; -N(R°)N(R°)C(O)N(R°)2; -N(R°)N(R°)C(O)OR°; -(CH2)OMC(0)R°; -C(S)R°; --SC(S)SR°; -(CH2)0 4SC(0)RO: -(CH2)0MC(O)N(R°)2; -C(S)N(RO)2; -C(S)SR°; -SC(S)SR°, -(CH2)O4OC(O)N(R°)2; -C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)R°; -C(NOR°)R°: -(CH2)„4SSRO: -(CH2)O4S(O)2RO; -(CH2)O 4S(0)20RO: -(CH2)O 40S(0)2RO: -S(0)2N(RO)2; -(CH:),4S(O)RO: -N(R°)S(0)2N(RO)2; - N(R°)S(O)2R°; -N(OR°)R°; C(NH)N(RO)2; -Si(R°)3; -OSi(R°)3; P(R°)2; P(OR°)2; OP(R°)2;-OP(OR°)2: -N(RO)P(R°)2; -B(RO)2; -0B(RO)2; -P(O)(R°)2; -OP(O)(R°)2: -N(R°)P(O)(R°)2; -(CM straight or branched alkylene)O-N(R°)2; or -(CM straight or branched alkylene)C(O)O-N(R°)2; wherein each R° may be independently substituted as defined below and is independently hydrogen, CMO (e.g., Cue, Ci.4, etc.) aliphatic, CMO (e g., Ci-6, Ci-4, etc.) heteroaliphatic having 1-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, Ce-io (e.g., Cs, Cio. etc.) aryl, 5-10 (e.g., 5-9, 5-6, 5, 6, 9. 10, etc.) membered heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur.— CH2— (C6-io (e.g., C6, Cio, etc.) and), -0(CH2)O-I(C6-IO (e.g., C6, Cw, etc.) aryl), -CH2-(5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) membered heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur), -0(CH2)O-I(5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) membered heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur), a 3-10 (e.g., 3-6, 5-6. 3, 4, 5. 6, 7, 8. 9, 10, etc.) membered, monocyclic, bicyclic, or polycyclic, saturated, or partially unsaturated ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3- 10 (e.g., 3-6. 5-6, 3, 4, 5. 6, 7, 8, 9, 10, etc.) membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated or aromatic ring (for aromatic ring. 5-10 (e.g., 5-9, 5-6, 5. 6, 9, 10, etc.) membered) having, in addition to the intervening atom(s), 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which may be substituted as defined below.
[0102] Monovalent substituents on R° (or the ring formed by taking tw o independent occurrences of R° together with their intervening atoms), are independently halogen, -(CH2)o-2R*, -(haloR*), -(CH2)O-2OH, - (CH2)O2OR*, -(CH2)O 2CH(OR*)2; -O(haloR’), -CN, -N3, -(CH2)0 2C(O)R*. -(CH2)0 2C(O)OH. -(CH2)0C(O)OR*. -(CH2)O 2SR*, -(CH2)O 2SH, -(CH2)O 2NH2, -(CH2)O 2NHR", -(CH2)O 2NR’2, -NO2, -SIR*3, - OSiR*3, -C(O)SR* -(Ci 4 straight or branched alkylene)C(O)OR*, or -SSR* wherein each R* is unsubstituted or where preceded by “halo’- is substituted only with one or more halogens, and is independently selected from Ci 4 aliphatic, -CH2Ph, -0(CH2)o-iPh, or a 3-6 (e.g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Divalent substituents on a saturated carbon atom of R° are independently =0 or =S.
[0103] Divalent substituents are independently the following: =0, =S, =NNR*2, =NNHC(O)R*, =NNHC(O)OR*, =NNHS(O)2R*, =NR*, =NOR*, -O(C(R*2))2_3O- or -S(C(R*2))2_3S- wherein each independent occurrence of R* is selected from hydrogen, Ci-6 aliphatic which may be substituted as defined below, or an unsubstituted 3-6 (e.g., 3-5. 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Divalent substituents that are bound to vicinal substitutable carbons of an ’‘optionally substituted” group are independently -O(CR*2)2 3O-, wherein each independent occurrence of R* is selected from hydrogen, Ci-6 aliphatic which may be substituted as defined below, or an unsubstituted 3-6 (e.g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0104] Substituents on the aliphatic group of R are independently halogen, -R*, -(haloR*), -OH, -OR*, -O(haloR’), -CN, -C(O)OH, -C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C i -4 aliphatic, -CH2Ph, -0(CH2)o-iPh, or a 3-6 (e.g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromaticring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0105] Substituents on a substitutable nitrogen are independently -R\ -NR). -C(O)R:. -C(O)OR'. - C(O)C(O)RJ, -C(O)CH2C(O)Rt, -S(O)2Rt, -S(O)2NRf2, -C(S)NRf2, -C(NH)NRt2, or -N(Rt)S(O)2Rt: wherein each R+is independently hydrogen, Ci-6 aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 3-6 (e.g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding tire definition above, two independent occurrences of R'. taken together with their intervening atom(s) form an unsubstituted 3-12 (e.g., 3-10, 3-6, 5-10, 5-6, 3, 4, 5, 6, 7, 8, 9, 10. etc.) membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0106] Substituents on the aliphatic group of R’ are independently halogen, -Re, -(haloR*), -OH, -OR*, -O(haloR*), -CN, -C(O)OH, C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently Ci^j aliphatic, -CH2Ph, -0(CH2)o-iPh, or a 3-6 (e.g., 3-5, 5-6. etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0107] P-modification: as used herein, the term “P-modification” refers to any modification at tire linkage phosphorus other than a stereochemical modification. In some embodiments, a P-modification comprises addition, substitution, or removal of a pendant moiety covalently attached to a linkage phosphorus.
[0108] Partially unsaturated: As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The tenn “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.
[0109] Pharmaceutical composition: As used herein, the temi “pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly;transdermally; or nasally, pulmonary, and to other mucosal surfaces.
[0110] Pharmaceutically acceptable: As used herein, the phrase ‘‘pharmaceutically acceptable” refers to those compounds, materials, compositions and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0111] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmacally-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil. safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol: polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen- free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.
[0112] Pharmaceutically acceptable salt: The term “pharmaceutically acceptable salt”, as used herein, refers to salts of such compounds that are appropriate for use in pharmaceutical contexts, i.e., salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salt include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but arc not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethane sulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2- hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate,persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. In some embodiments, a provided compound comprises one or more acidic groups, e.g.. an oligonucleotide, and a pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium (e.g., an ammonium salt of N(R)s. wherein each R is independently defined and described in the present disclosure) salt. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, a pharmaceutically acceptable salt is a sodium salt. In some embodiments, a pharmaceutically acceptable salt is a potassium salt. In some embodiments, a pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations fonned using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate. In some embodiments, a provided compound comprises more than one acid groups, for example, an oligonucleotide may comprise two or more acidic groups (e.g., in natural phosphate linkages and / or modified intemucleotidic linkages). In some embodiments, a pharmacally acceptable salt, or generally a salt, of such a compound comprises two or more cations, which can be the same or different. In some embodiments, in a pharmacally acceptable salt (or generally, a salt), all ionizable hydrogen (e.g., in an aqueous solution with a pKa no more than about 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2; in some embodiments, no more than about 7; in some embodiments, no more than about 6; in some embodiments, no more than about 5; in some embodiments, no more than about 4; in some embodiments, no more than about 3) in the acidic groups are replaced with cations. In some embodiments, each phosphorothioate and phosphate group independently exists in its salt fonn (e.g., if sodium salt, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O-, respectively). In some embodiments, each phosphorothioate and phosphate intemucleotidic linkage independently exists in its salt fonn (e.g., if sodium salt, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O-, respectively). In some embodiments, a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide. In some embodiments, a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide, wherein each acidic phosphate and modified phosphate group (e.g., phosphorothioate, phosphate, etc.), if any, exists as a salt fonn (all sodium salt).
[0113] Predetermined: By predetermined (or pre -determined) is meant deliberately selected or nonrandom or controlled, for example as opposed to randomly occurring, random, or achieved without control. Those of ordinary skill in the art, reading the present specification, will appreciate that the present disclosure provides technologies that permit selection of particular chemistry and / or stereochemistry features to be incorporated into oligonucleotide compositions, and further permits controlled preparation of oligonucleotide compositions having such chemistry and / or stereochemistry features. Such provided compositions are "‘predetermined” as described herein. Compositions that may contain certain oligonucleotides because they happen to have been generated through a process that are not controlled to intentionally generate the particular chemistry and / or stereochemistry features are not “predetermined” compositions. In some embodiments, a predetermined composition is one that can be intentionally reproduced (e.g., through repetition of a controlledprocess). In some embodiments, a predetermined level of a plurality of oligonucleotides in a composition means that the absolute amount, and / or the relative amount (ratio, percentage, etc.) of the plurality of oligonucleotides in the composition is controlled. In some embodiments, a predetermined level of a plurality of oligonucleotides in a composition is achieved through chirally controlled oligonucleotide preparation.
[0114] Protecting group: The term '‘protecting group,” as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3rdedition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Also included are those protecting groups specially adapted for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06 / 2012. the entirety of Chapter 2 is incorporated herein by reference. Suitable amino-protecting groups include methyl carbamate, ethyl carbamante, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9— (2,7— dibromo)fluoroenylmethyl carbamate, 2,7-di-t-butyl-[9-( 10, 10-dioxo- 10,10,10,10— tetrahydrothioxanthyl)] methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2- trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1- adamantyl)-l-methylethyl carbamate (Adpoc), l,l-dimethyl-2-haloethyl carbamate, 1, l-dimethyl-2,2- dibromoethyl carbamate (DB-t-BOC), l,l-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1 -methyl- 1- (4-biphenylyl)ethyl carbamate (Bpoc), l-(3,5-di-t-butylphenyl)-l-methylethyl carbamate (t-Bumeoc), 2- (2’- and 4’-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1- isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithio carbamate, benzyl carbamate (Cbz), p- methoxybenzyl carbamate (Moz), p-nitobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfmylbenzyl carbamate (Msz), 9-anthiy Imethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p- toluenesulfonyl)ethyl carbamate, [2-(l,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2- triphenylphosphonioisopropyl carbamate (Ppoc), l,l-dimethyl-2-cyanoethyl carbamate, m-chloro-p- acyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2- (trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phcnothiazinyl-(10)-carbonyl derivative, N'-p-tolucncsulfonylaminocarbonyl derivative, N’- phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzyl thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p- decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate, l,l-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl carbamate,isobutyl carbamate, isonicotinyl carbamate, p-(p’-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1 -methylcyclohexyl carbamate, 1-methyl-l-cyclopropylmethyl carbamate, l-methyl-l-(3,5- dimethoxyphenyl)ethyl carbamate, l-methyl-l-(p-phenylazophenyl)ethyl carbamate, 1-methyl-l- phenylethyl carbamate, 1 -methyl- l-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6- trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o-nitophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N’-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o- nitrophenyl)propanamide. 2-methyl-2-(o-nitrophenoxy)propanamide. 2-methyl-2-(o- phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N- acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin- 2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N- 1,1,4,4-tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted l,3-dimethyl-l,3,5- triazacyclohexan-2-one, 5-substituted 1.3-dibenzyl-l,3.5-triazacyclohexan-2-one, 1-substituted 3,5- dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxyJmethylamine (SEM), N-3- acetoxypropylamine, N-(l-isopropyl-4-nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7- dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fem), N-2-picolylamino N'-oxide, N- 1,1-dimethylthiomethyleneamine. N-benzylideneamine, N-p-methoxybenzylideneamine, N- diphenylmethyleneamine, N-t(2-pyridyl)mesitylJmethyleneamine, N-(N ’,N ’- dimethylaminomethylene)amine, N,N’-isopropylidenediamine, N-p-nitrobenzylideneamine, N- salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-l-cyclohexenyl)amine, N-borane derivative, N- diphenylborinic acid derivative, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4- dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphcnylmcthylsulfcnamidc, 3-nitropyridincsulfcnamidc (Npys), p-tolucncsulfonamidc (Ts), benzenesulfonamide, 2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6- trimethoxybenzene sulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2, 3,5,6- tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6- trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2, 2, 5,7,8- pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), P-trimethylsilylethanesulfonamide(SES), 9-anthracenesulfonamide, 4-(4’,8’-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.
[0115] Suitably protected carboxylic acids further include, but are not limited to. silyl-, alkyl-, alkenyl- . aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3, 4-dim ethoxybenzyl, trityl, t-butyl, tetrahydropyran- 2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable ary l groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g.. p-methoxybenzyl (MPM). 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2, 6— di chlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyL
[0116] Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), bcnzyloxymethyl (BOM), p- methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t- butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2- trichloroethoxymethyl, bis(2-chloroethoxy)methyl. 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl. 4- mcthoxytctrahydropyranyl (MTHP), 4-mcthoxytctrahydrothiopyranyl. 4-methoxytetrahydrothiopyranyl S,S- dioxide, l-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), l,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7- methanobenzofuran-2-yl, 1-ethoxyethyl, l-(2-chloroethoxy)ethyl, 1 -methyl- 1-methoxyethyl, 1 -methyl- 1- benzyloxyethyl, l-methyl-l-benzyloxy-2-fluoroethyl, 2.2,2-trichloroethyl, 2-trimethylsilylethyl, 2- (phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyL 2,4-dinitrophenyl, benzyl, p- methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p- cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl, p,p’- dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, a-naphthyldiphenyhnethyl, p- methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4 ’- bromophenacyloxyphenyl)diphenylmethyl, 4,4’.4’'-tris(4.5-dichlorophthalimidophenyl)methyl, 4,4',4’'- tris(levulinoyloxyphenyl)methyl, 4,4’,4”-tris(benzoyloxyphenyl)methyl, 3-(imidazol-l-yl)bis(4’,4”- dimethoxyphenyl)methyl, 1 , l-bis(4-methoxyphenyl)-l ’-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, l,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxido, trimethylsilyl (TMS), tricthylsilyl (TES), triisopropylsilyl (TIPS), dimcthylisopropylsilyl (IPDMS), dicthylisopropylsilyl (DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p- xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2- (trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec), 2-(triphenylphosphonio) ethyl carbonate (Peoc). alkyl isobutyl carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl p- nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4- ethoxy-l-napththyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4- methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4- (methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4- methylphenoxyacetate, 2,6-dichloro-4-( 1.1 ,3,3-tetramethylbutyl)phenoxyacetate. 2,4— bis( 1,1— dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2- butenoate, o-(methoxycarbonyl)benzoate, a-naphthoate, nitrate, alkyl N,N,N’,N’- tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4- dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t- butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2- trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4- dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1-methoxyethylidene ortho ester, 1-ethoxyethylidine ortho ester, 1,2- dimethoxyethylidene ortho ester, a-methoxybenzylidene ortho ester, l-(N.N-dimethylamino)ethylidene derivative. a-(N,N’-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene ortho ester, di— t— butylsilylene group (DTBS), l ,3-( l, l,3,3-tetraisopropyldisiloxanylidene) derivative (TIPDS), tetra-t- butoxydisiloxane-l,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronate, and phenyl boronate.
[0117] In some embodiments, a hydroxyl protecting group is acetyl, t-butyl, tbutoxymethyl, methoxymethyl, tetrahydropyranyl. 1 -ethoxyethyl, 1 -(2-chloroethoxy)ethyl, 2- trimethylsilylethyl, p- chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6- dichlorobenzyl, diphenylmethyl, p- nitrobenzyl, triphenylmethyl (trityl), 4.4'-dimethoxytrityl. trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t- butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifiuoroacctyl, pivaloyl, 9- fluorcnylmcthyl carbonate, mesylate, tosylatc, triflatc, trityl, monomcthoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4"-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2- (trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2- (4-nitrophenylsulfonyl)ethyl, 3, 5 -dichlorophenyl, 2,4-dimethylphenyL 2-nitrophenyl, 4-nitrophenyl, 2,4,6- trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4"-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptrnt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-mcthoxyphcnyl)xanthmc-9-y I (MOX). In some embodiments, each of tire hydroxyl protecting groups is, independently selected from acetyl, benzyl, t- butyldimethylsilyl, t- butyldiphenylsilyl and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4.4'-dimcthoxytrityl group. In some embodiments, a phosphorous linkage protecting group is a group attached to the phosphorous linkage (e.g., an intemucleotidic linkage) throughout oligonucleotide synthesis. In some embodiments, a protecting group is attached to a sulfur atom of an phosphorothioate group. In some embodiments, a protecting group is attached to an oxygen atom of an intemucleotide phosphorothioate linkage. In some embodiments, a protecting group is attached to an oxygen atom of the intemucleotide phosphate linkage. In some embodiments a protecting group is 2- cyanoethyl (CE or Cne). 2-trimethylsilylethyl. 2-nitroethyl, 2-sulfonylethyl. methyl, benzyl, o-nitrobenzyl, 2- (p-nitrophenyl)ethyl (NPE or Npe), 2 -phenylethyl, 3-(N-tert-butylcarboxamido)-l -propyl, 4-oxopentyL 4- methylthio-l-butyl, 2-cyano- 1,1 -dimethylethyl, 4-N-mcthylaminobutyl. 3-(2-pyridyl)-l-propyl, 2-[N-methyl- N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, or 4-[N-methyl-N-(2,2,2- trifluoroacetyl)amino]butyl .
[0118] Subject: As used herein, the term “subject” or “test subject” refers to any organism to which a compound (e.g., an oligonucleotide) or composition is administered in accordance with the present disclosure e g., for experimental, diagnostic, prophylactic and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject is a human. In some embodiments, a subject may be suffering from and / or susceptible to a disease, disorder and / or condition.
[0119] Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. A base sequence which is substantially identical or complementary to a second sequence is not fully identical or complementary to the second sequence, but is mostly or nearly identical or complementary to the second sequence. In some embodiments, an oligonucleotide w ith a substantially complementary sequence to another oligonucleotide or nucleic acid forms duplex with the oligonucleotide or nucleic acid in a similar fashion as an oligonucleotide with a fully complementary sequence. In addition, one of ordinary skill in the biological and / or chemical arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.
[0120] Sugar: The tcmi “sugar” refers to a monosaccharide or polysaccharide in closed and / or open fonn. In some embodiments, sugars are monosaccharides. In some embodiments, sugars are polysaccharides. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term “sugar” also encompasses structural analogs used in lieu of conventional sugar molecules, such as glycol, polymer of which forms the backbone of the nucleic acid analog, glycol nucleic acid (“GNA”), etc. As used herein, the term “sugar” also encompasses structural analogs used in lieu of naturalor naturally-occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, a sugar is a RNA or DNA sugar (ribose or deoxyribose). In some embodiments, a sugar is a modified ribose or deoxyribose sugar, e.g., 2'-modified, 5’-modified, etc. As described herein, in some embodiments, when used in oligonucleotides and / or nucleic acids, modified sugars may provide one or more desired properties, activities, etc. In some embodiments, a sugar is optionally substituted ribose or deoxyribose. In some embodiments, a “sugar” refers to a sugar unit in an oligonucleotide or a nucleic acid.
[0121] Susceptible to: An individual who is “susceptible to” a disease, disorder and / or condition is one who has a higher risk of developing the disease, disorder and / or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition is predisposed to have that disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may not have been diagnosed with the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may exhibit symptoms of the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may not exhibit symptoms of the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.
[0122] Therapeutic agent: As used herein, the term “therapeutic agent” in general refers to any agent that elicits a desired effect (e.g., a desired biological, clinical, or pharmacological effect) when administered to a subject. In some embodiments, an agent is considered to be a therapeutic agent if it demonstrates a statistically significant effect across an appropriate population. In some embodiments, an appropriate population is a population of subjects suffering from and / or susceptible to a disease, disorder or condition. In some embodiments, an appropriate population is a population of model organisms. In some embodiments, an appropriate population may be defined by one or more criterion such as age group, gender, genetic background, preexisting clinical conditions, prior exposure to therapy. In some embodiments, a therapeutic agent is a substance that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of, and / or reduces incidence of one or more symptoms or features of a disease, disorder, and / or condition in a subject when administered to the subject in an effective amount. In some embodiments, a “therapeutic agent” is an agent that has been or is required to be approved by a government agency before it can be marketed for administration to humans. In some embodiments, a “therapeutic agent” is an agent for which a medical prescription is required for administration to humans. In some embodiments, a therapeutic agent is a provided compound, e.g., a provided oligonucleotide.
[0123] Treat: As used herein, the term “treat,” “treatment,” or “treating” refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition. In someembodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and / or condition, for example for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition.
[0124] Unsaturated: Tire term "unsaturated," as used herein, means that a moiety has one or more units of unsaturation.
[0125] Wild-type: As used herein, the term “wild-type” has its art-understood meaning that refers to an entity having a structure and / or activity as found in nature in a “normal” (as contrasted with mutant, diseased, altered, etc.) state or context. Those of ordinary skill in the art will appreciate that wild type genes and polypeptides often exist in multiple different fonns (e.g., alleles).
[0126] As those skilled in the art will appreciate, methods and compositions described herein relating to provided compounds (e.g., oligonucleotides) generally also apply to pharmaceutically acceptable salts of such compounds.Description of Certain Embodiments
[0127] Oligonucleotides are useful in various therapeutic, diagnostic, and research applications. Use of naturally occurring nucleic acids is limited, for example, by their susceptibility to endo- and exo-nucleases. As such, various synthetic counterparts have been developed to circumvent these shortcomings and / or to further improve various properties and activities. These include synthetic oligonucleotides that contain chemical modifications, e.g., base modifications, sugar modifications, backbone modifications, etc., which, among other things, render these molecules less susceptible to degradation and improve other properties and / or activities.
[0128] From a structural point of view, modifications to intemucleotidic linkages can introduce chirality, and certain properties and activities may be affected by configurations of linkage phosphorus atoms of oligonucleotides. For example, binding affinity, sequence specific binding to complementary' RNA, stability' to nucleases, activities, delivery, pharmacokinetics, etc. can be affected by, inter alia, chirality' of backbone linkage phosphorus atoms.
[0129] Among other things, the present disclosure utilizes technologies for controlling various structural elements, e.g., sugar modifications and patterns thereof, nucleobase modifications and patterns thereof, modified intemucleotidic linkages and patterns thereof, linkage phosphorus stereochemistry? and patterns thereof, additional chemical moieties (moieties that are not typically in an oligonucleotide chain) and patterns thereof, etc. With tire capability to fully control structural elements of oligonucleotides, the present disclosure provides oligonucleotides with improved and / or new properties and / or activities for various applications, e.g., as therapeutic agents, probes, etc. For example, as demonstrated herein, provided oligonucleotides and compositions thereof are particularly powerful for editing target adenosine in target nucleic acids to, in some embodiments, correct a G to A mutation by converting A to I.
[0130] In some embodiments, an oligonucleotide comprises a sequence that is identical to oris completelyor substantially complementary to 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40. 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57. 58, 59, 60, typically 15, 16, 17. 18, 19, 20, 21, 22, 23, 24, 25. 26. 27, 28, 29, 30, 31, 32, 33, 34. 35, 36, 37, 38. 39, 40, 41, 42, 43. 44. 45, 46, 47, 48, 49. 50, 51, 52, 53, 54. 55. 56, 57, 58, 59, 60 ormore, contiguous bases of a nucleic acid (e.g., DNA, pre-mRNA, mRNA, etc.). In some embodiments, a nucleic acid is a target nucleic acid comprising one or more target adenosine. In some embodiments, a target nucleic acid comprises one and no more than one target adenosine. In some embodiments, an oligonucleotide can hybridize with a target nucleic acid. In some embodiments, such hybridization facilitates modification of A (e.g.„ conversion of A to I) by, e.g., ADAR1, ADAR2, etc., in a nucleic acid or a product thereof.
[0131] In some embodiments, the present disclosure provides an oligonucleotide, wherein the oligonucleotide has a base sequence which is, or comprises about 10-40, about 15-40, about 20-40, or at least27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34 contiguous bases of, an oligonucleotide or nucleic acid disclosed herein (e.g., in tire Tables), or a sequence that is complementary to a target RNA sequence gene, transcript, etc. disclosed herein, and wherein each T can be optionally and independently replaced with U and vice versa. In some embodiments, the present disclosure provides an oligonucleotide or oligonucleotide composition as disclosed herein, e.g., in a Table.
[0132] In some embodiments, an oligonucleotide is a single-stranded oligonucleotide for site-directed editing of a nucleoside (e.g., a target adenosine) in a target nucleic acid, e.g., RNA.
[0133] As described herein, oligonucleotides may contain one or more modified intemucleotidic linkages (non-natural phosphate linkages). In some embodiments, a modified intemucleotidic linkage is a chiral intemucleotidic linkage whose linkage phosphorus is chiral. In some embodiments, a modified intemucleotidic linkage is a phosphorothioate intemucleotidic linkage. In some embodiments, oligonucleotides comprise one or more negatively charged intemucleotidic linkages (e.g., phosphorothioate intemucleotidic linkages, natural phosphate linkages, etc.). In some embodiments, oligonucleotides comprise one or more non-negatively charged intemucleotidic linkage. In some embodiments, oligonucleotides comprise one or more neutral intemucleotidic linkage.
[0134] In some embodiments, oligonucleotides are chirally controlled. In some embodiments, oligonucleotides are chirally pure (or “stereopure”, “stereochemically pure”), wherein the oligonucleotide exists as a single stereoisomeric form (in many cases a single diastereoisomeric (or “diastereomeric”) form as multiple chiral centers may exist in an oligonucleotide, e.g., at linkage phosphoms, sugar carbon, etc.). As appreciated by those skilled in the art, a chirally pure oligonucleotide is separated from its other stereoisomeric forms (to the extent that some impurities may exist as chemical and biological processes, selectivities and / or purifications etc. rarely, if ever, go to absolute completeness). In a chirally pure oligonucleotide, each chiral center is independently defined with respect to its configuration (for a chirally pure oligonucleotide, each intemucleotidic linkage is independently stereodefmed or chirally controlled). In contrast to chirally controlled and chirally pure oligonucleotides which comprise stereodefmed linkage phosphoms, racemic (or“stereorandom”, “non-chirally controlled”) oligonucleotides comprising chiral linkage phosphorus, e.g., from traditional phosphoramidite oligonucleotide synthesis without stereochemical control during coupling steps in combination with traditional sulfurization (creating stereorandom phosphorothioate intemucleotidic linkages), refer to a random mixture of various stereoisomers (typically diastereoisomers (or “diastereomers”) as there are multiple chiral centers in an oligonucleotide; e.g., from traditional oligonucleotide preparation using reagents containing no chiral elements other than those in nucleosides and linkage phosphorus). For example, for A* A* A wherein * is a phosphorothioate intemucleotidic linkage (which comprises a chiral linkage phosphorus), a racemic oligonucleotide preparation includes four diastereomers [22= 4, considering the two chiral linkage phosphorus, each of which can exist in either of two configurations (Sp or / ?p) ] : A * S A * S A, A *S A *R A. A *R A *S A, and A *R A *R A, wherein *S represents a Sp phosphorothioate intemucleotidic linkage and *R represents a Rp phosphorothioate intemucleotidic linkage. For a chirally pure oligonucleotide, e.g., A *S A *S A, it exists in a single stereoisomeric form and it is separated from the other stereoisomers (e.g., the diastereomers A *S A *R A, A *R A *S A, and A *R A *R A).
[0135] In some embodiments, oligonucleotides comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more stereorandom intemucleotidic linkages (mixture of Rp and Sp linkage phosphorus at the intemucleotidic linkage, e.g., from traditional non-chirally controlled oligonucleotide synthesis). In some embodiments, oligonucleotides comprise one or more (e.g., 1-60, 1-50, 1-40, 1-30, 1-25, 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more) chirally controlled intemucleotidic linkages (Rp or Sp linkage phosphorus at the intemucleotidic linkage, e.g., from chirally controlled oligonucleotide synthesis). In some embodiments, an intemucleotidic linkage is a phosphorothioate intemucleotidic linkage. In some embodiments, an intemucleotidic linkage is a stereorandom phosphorothioate intemucleotidic linkage. In some embodiments, an intemucleotidic linkage is a chirally controlled phosphorothioate intemucleotidic linkage.
[0136] Among other things, the present disclosure provides technologies for preparing chirally controlled (in some embodiments, stereochemically pure) oligonucleotides. In some embodiments, oligonucleotides are stereochemically pure. In some embodiments, oligonucleotides of the present disclosure are about 5%- 100%, 10%-100%. 20%-I00%, 30%-100%, 40%-I00%, 50%-I00%, 60%-100%. 70%-I00%, 80-100%, 90-100%. 95-100%, 50%-90%, or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% stereochemically pure.
[0137] In some embodiments, the present disclosure provides various oligonucleotide compositions. In some embodiments, oligonucleotide compositions are stereorandom or not chirally controlled. In some embodiments, there are no chirally controlled intemucleotidic linkages in oligonucleotides of provided compositions. In some embodiments, intemucleotidic linkages of oligonucleotides in compositions comprise one or more chirally controlled intemucleotidic linkages (e.g.,, chirally controlled oligonucleotidecompositions).
[0138] In some embodiments, an oligonucleotide composition comprises a plurality of oligonucleotides sharing a common base sequence, wherein one or more intemucleotidic linkages in the oligonucleotides are chirally controlled and one or more intemucleotidic linkages are stereorandom (not chirally controlled). In some embodiments, an oligonucleotide composition comprises a plurality of oligonucleotides sharing a common base sequence, wherein each intemucleotidic linkage comprising chiral linkage phosphorus in the oligonucleotides is independently a chirally controlled intemucleotidic linkage. In some embodiments, a plurality of oligonucleotides share the same base sequence, and the same base and sugar modification. In some embodiments, a plurality of oligonucleotides share the same base sequence, and the same base, sugar and intemucleotidic linkage modification. In some embodiments, an oligonucleotide composition comprises oligonucleotides of the same constitution, wherein one or more intemucleotidic linkages are chirally controlled and one or more intemucleotidic linkages are stereorandom (not chirally controlled). In some embodiments, an oligonucleotide composition comprises oligonucleotides of the same constitution, wherein each intemucleotidic linkage comprising chiral linkage phosphorus is independently a chirally controlled intemucleotidic linkage. In some embodiments, at least 10%, 20%. 30%. 40%. 50%. 60%. 70%. 75%, 80%, 85%, 90% or 95% of all oligonucleotides, or all oligonucleotides of the common base sequence, are oligonucleotides of the plurality.
[0139] In some embodiments, the present disclosure provides technologies for preparing, assessing and / or utilizing provided oligonucleotides and compositions thereof.
[0140] As used in the present disclosure, in some embodiments, ‘fine or more” is 1-200, 1-150, 1-100, 1- 90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30. or 1, 2. 3, 4, 5, 6, 7, 8, 9. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19. 20. 21, 22, 23, 24, 25. 26. 27. 28. 29, 30, 31, 32, 33, 34, 35, 36. 37. 38. 39. 40. 41, 42, 43, 44, 45, 46, 47, 48. 49. 50. 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60. In some embodiments, “one or more” is one. Tn some embodiments, “one or more” is two. In some embodiments, “one or more” is three. In some embodiments, “one or more” is four. In some embodiments, “one or more” is five. In some embodiments, “one or more” is six. In some embodiments, “one or more” is seven. In some embodiments, “one or more” is eight. In some embodiments, “one or more” is nine. In some embodiments, “one or more” is ten. In some embodiments, “one or more” is at least one. In some embodiments, “one or more” is at least two. In some embodiments, “one or more” is at least three. In some embodiments, “one or more” is at least four. In some embodiments, “one or more” is at least five. In some embodiments, “one or more” is at least six. In some embodiments, “one or more” is at least seven. In some embodiments, “one or more” is at least eight. In some embodiments, “one or more” is at least nine. In some embodiments, “one or more” is at least ten.
[0141] As used in the present disclosure, in some embodiments, “at least one” is one or more.
[0142] Various embodiments are described for variables, e.g., R, RL, L, etc., as examples. Embodiments described for a variable, e.g., R, are generally applicable to all variables that can be such a variable (e g., R’, R”, RL, RL 1, etc.).Oligonucleotides
[0143] Among other things, the present disclosure provides oligonucleotides of various designs, which may comprise various nucleobases and patterns thereof, sugars and patterns thereof, intemucleotidic linkages and patterns thereof, and / or additional chemical moieties and patterns thereof as described in the present disclosure. In some embodiments, provided oligonucleotides can direct A to I editing in target nucleic acids. In some embodiments, oligonucleotides of the present disclosure are single-stranded oligonucleotides capable of site-directed editing of an adenosine (conversion of A into I) in a target RNA sequence.
[0144] In some embodiments, oligonucleotides are of suitable lengths and sequence complementarity to specifically hybridize with target nucleic acids. In some embodiments, oligonucleotide is sufficiently long and is sufficiently complementary to target nucleic acids to distinguish target nucleic acid from other nucleic acids to reduce off-target effects. In some embodiments, oligonucleotide is sufficiently short to facilitate delivery, reduce manufacture complexity and / or cost which maintaining desired properties and activities (e.g., editing of adenosine).
[0145] In some embodiments, an oligonucleotide has a length of about 10-200 (e.g., about 10-20, 10-30, 10-40. 10-50, 10-60, 10-70, 10-80, 10-90. 10-100. 10-120, 10-150, 20-30. 20-40, 20-50, 20-60. 20-70, 20-80. 20-90, 20-100, 20-120, 20-150, 20-200, 25-30, 25-40, 25-50, 25-60, 25-70, 25-80, 25-90, 25-100, 25-120, 25- 150, 25-200, 30-40, 30-50, 30-60, 30-70, 30-80, 30-90, 30-100, 30-120, 30-150, 30-200, 10, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 60, etc.) nucleobases. In some embodiments, the base sequence of an oligonucleotide is about 10-60 nucleobases in length. In some embodiments, a base sequence is about 15-50 nucleobases in length. In some embodiments, a base sequence is from about 15 to about 35 nucleobases in length. In some embodiments, a base sequence is from about 25 to about 34 nucleobases in length. In some embodiments, a base sequence is from about 26 to about 35 nucleobases in length. In some embodiments, a base sequence is from about 27 to about 32 nucleobases in length. In some embodiments, a base sequence is from about 29 to about 35 nucleobases in length. In some embodiments, a base sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34. 35, 36, 37, 38, 39, 40, 41. 42. 43. 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58. 59. or 60 nucleobases in length. In some other embodiments, a base sequence is or is at least 35 nucleobases in length. In some other embodiments, a base sequence is or is at least 34 nucleobases in length. In some other embodiments, a base sequence is or is at least 33 nucleobases in length. In some other embodiments, a base sequence is or is at least 32 nucleobases in length. In some other embodiments, a base sequence is or is at least 31 nucleobases in length. In some other embodiments, a base sequence is or is at least 30 nucleobases in length. In some other embodiments, a base sequence is or is at least 29 nucleobases in length. In some other embodiments, a base sequence is or is at least 28 nucleobases in length. In some other embodiments, a base sequence is or is at least 27 nucleobases in length. In some other embodiments, a base sequence is or is at least 26 nucleobases in length. In some other embodiments, tire base sequence of the complementary portion in a duplex is at least 15, 16, 17,18, 19, 20, 21, 22, 23, 24, 25, 16, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more nucleobases in length. In some other embodiments, it is at least 18 nucleobases in length. In some other embodiments, it is at least 19 nucleobases in length. In some other embodiments, it is at least 20 nucleobases in length. In some other embodiments, it is at least 21 nucleobases in length. In some other embodiments, it is at least 22 nucleobases in length. In some other embodiments, it is at least 23 nucleobases in length. In some other embodiments, it is at least 24 nucleobases in length. In some other embodiments, it is at least 25 nucleobases in length. Among other things, the present disclosure provides oligonucleotides of comparable or better properties and / or comparable or higher activities but of shorter lengths compared to prior reported adenosine editing oligonucleotides.
[0146] In some embodiments, a base sequence of the oligonucleotide is complementary to a base sequence of a target nucleic acid (e.g., complementarity to a portion of the target nucleic acid comprising the target adenosine) with 0-10 (e.g., 0-1, 0-2, 0-3, 0-4, 0-5, 0-6, 0-7, 0-8, 0-9, 0-10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1- 9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) mismatches which are not Watson-Crick base pairs (AT, AU and CG). In some embodiments, there are no mismatches. In some embodiments, there is 1 mismatch. In some embodiments, there are 2 mismatches. In some embodiments, there are 3 mismatches. In some embodiments, there are 4 mismatches. In some embodiments, there are 5 mismatches. In some embodiments, there are 6 mismatches. In some embodiments, there are 7 mismatches. In some embodiments, there are 8 mismatches. In some embodiments, there are 9 mismatches. In some embodiments, there are 10 mismatches. In some embodiments, oligonucleotides may contain portions that are not designed for complementarity (e.g., loops, protein binding sequences, etc., for recruiting of proteins, e.g., ADAR). As those skilled in the art will appreciate, when calculating mismatches and / or complementarity, such portions may be properly excluded. In some embodiments, complementarity, e.g., between oligonucleotides and target nucleic acids, is about 50%-100% (e.g., about 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%- 90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%. 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%- 100%. 90%-95%, 90%-100%. 50%. 60%. 65%. 70%. 75%. 80%. 85%. 90%. 95%. or 100%, etc.). In some embodiments, complementarity is at least about 60%. In some embodiments, complementarity is at least about 65%. In some embodiments, complementarity is at least about 70%. In some embodiments, complementarity is at least about 75%. In some embodiments, complementarity is at least about 80%. In some embodiments, complementarity is at least about 85%. In some embodiments, complementarity is at least about 90%. In some embodiments, complementarity is at least about 95%. In some embodiments, complementarity is 100% across the length of an oligonucleotide. In some embodiments, complementarity is 100% except at a nucleoside opposite to a target nucleoside (e.g., adenosine) across the length of an oligonucleotide. Typically, complementarity is based on Watson-Crick base pairs AT, AU and CG. Those skilled in the art will appreciate that w hen assessing complementarity of two sequences of different lengths (e.g., a provided oligonucleotideand a target nucleic acid) complementarity may be properly based on the length of the shorter sequence and / or maximum complementarity between the two sequences. In many embodiments, oligonucleotides and target nucleic acids are of sufficient complementarity such that modifications are selectively directed to target adenosine sites.
[0147] In some embodiments, one or more mismatches are independently wobbles. In some embodiments, each mismatch is a wobble. In some embodiments, there are 0-10 (e.g., 0-1, 0-2, 0-3, 0-4, 0-5, 0-6, 0-7, 0-8, 0-9, 0-10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) wobbles. In some embodiments, the number is 0. In some embodiments, the number is 1. In some embodiments, the number is 2. In some embodiments, the number is 3. In some embodiments, the number is 4. In some embodiments, the number is 5. In some embodiments, a wobble is G-U, I-A, G-A, I-U, I-C, I-T, A-A, or reverse A-T. In some embodiments, a wobble is G-U, I-A, G-A, I-U, or I-C. In some embodiments, I-C may be considered a match when I is a 3 ’ immediate nucleoside next to a nucleoside opposite to a target nucleoside. In some embodiments, a base that forms a wobble pair (e.g., U which can form a G-U wobble) may replace a base that forms a match pair (e g., C which matches G) and can provide oligonucleotide with editing activity.
[0148] In some embodiments, duplexes of oligonucleotides and target nucleic acids comprise one or more bulges each of which independently comprise one or more mismatches that are not wobbles. In some embodiments, there are 0-10 (e.g., 0-1, 0-2, 0-3, 0-4, 0-5, 0-6, 0-7, 0-8, 0-9, 0-10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. etc.) bulges. In some embodiments, the number is 0. In some embodiments, the number is 1. In some embodiments, the number is 2. In some embodiments, the number is 3. In some embodiments, the number is 4. In some embodiments, the number is 5.
[0149] In some embodiments, distances between two mismatches, mismatches and one or both ends of oligonucleotides (or a portion thereof, e.g., first domain, second domain, first subdomain, second subdomain, third subdomain), and / or mismatches and nucleosides opposite to target adenosine can independently be 0-50, 0-40, 0-30, 0-25, 0-20, 0-15, 0-10 (e.g., 0-1, 0-2, 0-3, 0-4, 0-5, 0-6, 0-7, 0-8, 0-9, 0-10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8. 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8. 2-9, 2-10, 3-4, 3-5, 3-6. 3-7, 3-8, 3-9. 3-10. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases (not including mismatches, end nucleosides and nucleosides opposite to target adenosine). In some embodiments, a number is 0-30. In some embodiments, a number is 0-20. In some embodiments, a number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, a distance between two mismatches is 0-20. In some embodiments, a distance betw een two mismatches is 1-10. In some embodiments, a distance between a mismatch and a 5 ’-end nucleoside of an oligonucleotide is 0-20. In some embodiments, a distance between a mismatch and a 5 ’-end nucleoside of an oligonucleotide is 5-20. In some embodiments, a distance betw een a mismatch and a 3 ’-end nucleoside of an oligonucleotide is 0-40. In some embodiments, a distance between a mismatch and a 3 ’-end nucleoside of an oligonucleotide is 5-20. In someembodiments, a distance between a mismatch and a nucleoside opposite to a target adenosine is 0-20. In some embodiments, a distance between a mismatch and a nucleoside opposite to a target adenosine is 1 - 10. In some embodiments, the number of nucleobases for a distance is 0. In some embodiments, it is 1. In some embodiments, it is 2. In some embodiments, it is 3. In some embodiments, it is 4. In some embodiments, it is 5. In some embodiments, it is 6. In some embodiments, it is 7. In some embodiments, it is 8. In some embodiments, it is 9. In some embodiments, it is 10. In some embodiments, it is 11. In some embodiments, it is 12. In some embodiments, it is 13. In some embodiments, it is 14. In some embodiments, it is 15. In some embodiments, it is 16. In some embodiments, it is 17. In some embodiments, it is 18. In some embodiments, it is 19. In some embodiments, it is 20. In some embodiments, a mismatch is at an end, e.g.. a 5 ’-end or 3 ’-end of a first domain, second domain, first subdomain, second subdomain, or third subdomain. In some embodiments, a mismatch is at a nucleoside opposite to a target adenosine.
[0150] In some embodiments, a mismatch is at Nw. In some embodiments, a nucleoside opposite atarget nucleoside (e.g., adenosine) is the 25thnucleoside from the 5 ’-end and a mismatch is at the 15thnucleoside from the 5’-end. In some embodiments, a mismatch at the 15thnucleoside from tire 5’-end is a wobble base pairing. In some embodiments, a nucleoside opposite a target nucleoside (e.g., adenosine) is tire 25thnucleoside from the 5 ’-end and the complementarity is 100% except at a nucleoside opposite to a target nucleoside (e.g., adenosine) and the 15thnucleoside from the 5’-end. In some embodiments, a nucleoside opposite a target nucleoside (e.g., adenosine) is the 24thnucleoside from the 5 ’-end and the base sequence comprises a mismatch at the 14thnucleoside from the 5’-end. In some embodiments, a mismatch at the 14thnucleoside from the 5’- end is a wobble base pairing. In some embodiments, a nucleoside opposite a target nucleoside (e.g., adenosine) is the 24thnucleoside from the 5 '-end and the complementarity is 100% except at a nucleoside opposite to a target nucleoside (e.g., adenosine) and the 14thnucleoside from the 5 ’-end.
[0151] In some embodiments, provided oligonucleotides can direct adenosine editing (e.g.,, converting A to I) in atarget nucleic acid and has a base sequence which consists of, comprises, or comprises a portion (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous bases) of the base sequence of an oligonucleotide disclosed herein, wherein each T can be independently replaced with U and vice versa, and the oligonucleotide comprises at least one non-naturally-occurring modification of a base, sugar and / or intemucleotidic linkage.
[0152] In some embodiments, a provided oligonucleotide comprises one or more targeting moieties. In some embodiments, a provided oligonucleotide comprises one or more lipid moieties. Non-limiting examples of such additional chemical moieties which can be conjugated to oligonucleotide chain arc described herein.
[0153] In some embodiments, provided oligonucleotides can direct a correction of a G to A mutation in a target sequence, or a product thereof. In some embodiments, a correction of a G to A mutation is or comprises conversion of A to I, which can be read as G during translation or other biological processes. In some embodiments, provided oligonucleotides can direct a correction of a G to A mutation in a target sequence or a product thereof via ADAR-mediated deamination. In some embodiments, provided oligonucleotides can directa correction of a G to A mutation in a target sequence or a product thereof via ADAR-mediated deamination by recruiting an endogenous ADAR (e.g., in a target cell) and facilitating the ADAR-mediated deamination. Regardless, however, the present disclosure is not limited to any particular mechanism. In some embodiments, the present disclosure provides oligonucleotides, compositions, methods, etc., capable of operating via doublestranded RNA interference, single -stranded RNA interference, RNase H-mediated knock-down, steric hindrance of translation, ADAR-mediated deamination or a combination of two or more such mechanisms.
[0154] In some embodiments, an oligonucleotide comprises a structural element or a portion thereof described herein, e.g., in a Table. In some embodiments, an oligonucleotide has a base sequence which comprises the base sequence (or a portion thereof) wherein each T can be independently substituted with U, pattern of chemical modifications (or a portion thereof), and / or a format of an oligonucleotide disclosed herein, e.g., in a Table or in the Figures, or otherwise disclosed herein. In some embodiments, such oligonucleotide can direct a correction of a G to A mutation in a target sequence, or a product thereof.
[0155] Among other things, provided oligonucleotides may hybridize to their target nucleic acids (e.g., pre-mRNA, mature mRNA, etc.). In some embodiments, oligonucleotide can hybridize to a target RNA sequence nucleic acid in any stage of RNA processing, including but not limited to a pre-mRNA or a mature mRNA. In some embodiments, oligonucleotide can hybridize to any element of oligonucleotide nucleic acid or its complement, including but not limited to: a promoter region, an enhancer region, a transcriptional stop region, a translational start signal, a translation stop signal, a coding region, a non-coding region, an exon, an intron, an intron / exon or exon / intron junction, the 5' UTR, or the 3' UTR.
[0156] In some embodiments, oligonucleotide hybridizes to tw o or more variants of transcripts derived from a sense strand of a target site (e.g., a target sequence).
[0157] In some embodiments, provided oligonucleotides contain increased levels of one or more isotopes. In some embodiments, provided oligonucleotides are labeled, e.g., by one or more isotopes of one or more elements, e.g., hydrogen, carbon, nitrogen, etc. In some embodiments, provided oligonucleotides in provided compositions, e.g., oligonucleotides of a plurality of a composition, comprise base modifications, sugar modifications, and / or intemucleotidic linkage modifications, wherein the oligonucleotides contain an enriched level of deuterium. In some embodiments, provided oligonucleotides are labeled with deuterium (replacing -!H with -2H) at one or more positions. In some embodiments, one or more1H of an oligonucleotide chain or any moiety conjugated to the oligonucleotide chain (e.g., a targeting moiety, etc.) is substituted with2H. Such oligonucleotides can be used in compositions and methods described herein.
[0158] In some embodiments, oligonucleotides comprise one or more modified nucleobases, one or more modified sugars, and / or one or more modified intemucleotidic linkages as described herein. In some embodiments, oligonucleotides comprise a certain level of modified nucleobases, modified sugars, and / or modified intemucleotidic linkages, e.g., about 5%-100%, about 10%-100%, 20-100%, 30%-100%, 40%- 100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all nucleobases, sugars, and intemucleotidic linkages, respectively, within an oligonucleotide.
[0159] In some embodiments, oligonucleotides comprise one or more modified sugars. In some embodiments, an oligonucleotide comprises about 1-50 (e.g., about 5, 6, 7, 8, 9, or 10 - about 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,19, or 20, etc.) modified sugars. In some embodiments, an oligonucleotide comprises about 1-50 (e.g., about 5, 6. 7, 8, 9. or 10 - about 10. 11. 12, 13, 14, 15, 16, 17, 18, 19, 20. 21. 22. 23, 24, 25, 30, 40 or 50, or about5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc., about 1, 2, 3, 4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) modified sugars with 2’-F modification. In some embodiments, an oligonucleotide comprises about 2-50 (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, or 10 - about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18. 19. 20, 21, 22, 23, 24, 25, 30. 40 or 50, etc., 2-40, 2-30. 2-25. 2-20. 2-15, 2-10, 3-40, 3-30, 3-25, 3-20, 3-15, 3-10, 4-40, 4-30, 4-25, 4-20, 4-15, 4-10, 5-40. 5-30. 5-25. 5-20. 5-15. 5-10. 6-40. 6-30. 6-25. 6-20. 6-15, 6-10, 7-40, 7-30, 7-25, 7-20, 7-15, 7-10, 8-40, 8-30, 8-25, 8-20, 8-15, 8-10, 9-40, 9-30, 9-25, 9-20, 9-15, 9-10, 10-40, 10-30, 10-25, 10-20, 10-15, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) consecutive modified sugars with 2 -F modification. In some embodiments, an oligonucleotide comprises 2 consecutive 2"-F modified sugars. In some embodiments, an oligonucleotide comprises 3 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 4 consecutive 2'-F modified sugars. In some embodiments, an oligonucleotide comprises 5 consecutive 2 -F modified sugars. In some embodiments, an oligonucleotide comprises 6 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 7 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 8 consecutive 2 -F modified sugars. In some embodiments, an oligonucleotide comprises 9 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 10 consecutive 2"-F modified sugars. In some embodiments, an oligonucleotide comprises two or more 2'-F modified sugar blocks, wherein each sugar in a 2’-F modified sugar block is independently a 2’-F modified sugar. In some embodiments, each 2’- F modified sugar block independently comprises or consists of 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive 2’-F modified sugars as described herein. In some embodiments, two consecutive 2’-F modified sugar blocks are independently separated by a separating block which separating block comprises one or more sugars that arc independently not 2’-F modified sugars. In some embodiments, an oligonucleotide comprises one or more (e.g., 1-20, 1-15, 1-14. 1-13. 1-12. 1-11, 1-10, 2-20, 3-15, 4-15, 5-15, 1, 2. 3, 4, 5, 6, 7. 8, 9, 10, 11, 12, 13. 14.15, 16, 17, 18, 19, 20, etc.) 2’ -F blocks and one or more (e.g., 1-20, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 2-20, 3-15, 4-15, 5-15, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) separating blocks. In some embodiments, a first domain comprises one or more (e.g., 1-20, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 2-20,3-15, 4-15, 5-15, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) 2’-F blocks and one or more (e.g., 1-20, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 2-20, 3-15, 4-15, 5-15, 1, 2, 3, 4, 5. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16. 17, 18, 19, 20, etc.) separating blocks. In some embodiments, each first domain block bonded to a first domain 2’-F block is a separating block. In some embodiments, each first domain block bonded to a first domain separating block is a first domain 2’-F block. In some embodiments, each sugar in a separating block is independently not 2’-F modified. In some embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) or all sugars in a separating block are independently not 2’-F modified. In some embodiments, a separating block comprises one or more bicyclic sugars (e.g., LNA sugar, cEt sugar, etc.) and / or one or more 2'-OR modified sugars, wherein R is optionally substituted Ci-6 aliphatic (e.g., 2'-OMe. 2'-MOE. etc.). In some embodiments, a separating block comprises one or more 2’-OR modified sugars, wherein R is optionally substituted Cue aliphatic (e.g., 2’-OMe, 2’-MOE, etc.). In some embodiments, two or more non-2’-F modified sugars are consecutive. In some embodiments, two or more 2’-OR modified sugars wherein R is optionally substituted Ci-e aliphatic (e.g., 2’-OMe, 2’-MOE, etc.) are consecutive. In some embodiments, a separating block comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9. or 10 or more) 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic (e.g., 2'-OMc. 2'-MOE. etc.). In some embodiments, a separating block comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) consecutive 2’-OR modified sugars wherein R is optionally substituted Ci.6 aliphatic (e.g., 2’-OMe, 2’-MOE, etc.). In some embodiments, each 2’-OR modified sugar is independently a 2’-OMe or 2 ’-MOE sugar. In some embodiments, each 2 ’-OR modified sugar is independently a 2’-OMe sugar. In some embodiments, each 2'-OR modified sugar is independently a 2’-MOE sugar. In some embodiments, a separating block comprises one or more 2’-F modified sugars. In some embodiments, none of 2’-F modified sugars in a separating block are next to each other. In some embodiments, a separating block contain no 2’-F modified sugars. In some embodiments, each sugar in a separating block is independently a 2’-OR modified sugar wherein R is optionally substituted Ci.6 aliphatic or a bicyclic sugar. In some embodiments, each sugar in each separating block is independently a 2 ’-OR modified sugar wherein R is optionally substituted Ci-e aliphatic or a bicyclic sugar. In some embodiments, each sugar in a separating block is independently a 2’ -OR modified sugar wherein Ris optionally substituted Ci-6 aliphatic. In some embodiments, each sugar in each separating block is independently a 2' -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, each sugar in a separating block is independently a 2’-OMe or 2’-MOE modified sugar. In some embodiments, each sugar in each separating block is independently a 2’-OMe or 2 ’-MOE modified sugar. In some embodiments, each sugar in a separating block is independently a 2’-OMc modified sugar. In some embodiments, each sugar in a separating block is independently a 2'-MOE modified sugar. In some embodiments, a separating block comprises a 2'-OMe sugar and 2 ’-MOE modified sugar. In some embodiments, each 2’-F block and each separating block independently contains 1, 2, 3, 4, or 5 nucleosides. In some embodiments, each 2’-F block and each separating block independently contains 1, 2, or 3 nucleosides.
[0160] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%- 85%, 75%-90%. 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%. 50%. 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%. or 100%, etc. of all sugars are modified sugars. In some embodiments, about 10%-100%, 20-100%, 30%- 100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%- 95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%. 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%. 65%, 70%, 75%, 80%, 85%. 90%. 95%. or 100%, etc. of all sugars are modified sugars independently selected from 2’-F modified sugars, 2 ’-OR modified sugars wherein R is optionally substituted Ci-e aliphatic, and bicyclic sugars (e.g., LNA sugars, cEt sugars, etc.). In some embodiments, apercentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%.
[0161] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%- 85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%. 65%-95%, 65%-100%. 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%- 85%, 75%-90%. 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%. 50%. 60%. 65%, 70%, 75%, 80%, 85%, 90%. 95%. or 100%, etc. of all sugars are modified sugars independently selected from 2’-F modified sugars and 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%- 90%, 60%-95%. 60%-100%, 65%-80%. 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%. 70%-95%, 70%-100%. 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%- 90%, 80%-95%. 80%-100%, 85%-90%. 85%-95%, 85%- 100%, 90%-95%, 90%-100%, 10%, 20%, 30%. 40%. 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars are modified sugars independently selected from 2’-F modified sugars, 2’-OMe modified sugars and 2’-MOE modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%.
[0162] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%,65%-90%, 65%-95%, 65%-100%. 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%. 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%,85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%. 50%. 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%. or 100%, etc. of all sugars are modified sugars independently selected from 2’-F modified sugars and 2’-OMe modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%.
[0163] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%- 85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%. 65%-95%, 65%-100%. 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%- 85%, 75%-90%. 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%- 100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%. 50%. 60%. 65%, 70%, 75%, 80%, 85%, 90%. 95%. or 100%, etc. of all sugars are 2’-F modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%. In some embodiments, 10 or more (e.g., about or at least about 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more, 10-50, 10-40, 10-30, 10-25, 15-50, 15-40, 15-30, 15-25, 20-50, 20-40, 20-30, 20-25, etc.) sugars are 2 ’-F modified sugars. In some embodiments, an oligonucleotide comprises two or more (e.g., 2-30, 2-25, 2-20, 2-15, 3-10, 3-30, 3-25, 3-20, 3-15, 3-10, 4-30, 4-25, 4-20, 4-15, 4-10, 5-30, 5-25, 5-20, 5-15, 5-10, 2, 3, 4, 5. 6, 7, 8, 9. 10, 11, 12, 13, 14, 15, 16, 17. 18. 19, or 20) consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises one or more 2’-F blocks each independently comprising two or more (e.g., 2-30, 2- 25, 2-20, 2-15, 3-10, 3-30, 3-25, 3-20, 3-15, 3-10, 4-30, 4-25, 4-20, 4-15, 4-10, 5-30, 5-25, 5-20, 5-15, 5-10, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises two or more 2’-F blocks as described herein separated by one or more separating blocks as described herein. In some embodiments, a 2’-F block has 2, 3, 4, 5, 6, 7, 8, 9, or 10 2’-F modified sugars. In some embodiments, a 2'-F block has no more than 2, 3, 4, 5. 6, 7, 8. 9, or 10 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2’- F block independently has 2, 3, 4, 5, 6, 7, 8, 9, or 10 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2’-F block independently has no more than 2, 3, 4, 5, 6,7, 8, 9, or 10 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2'-F block independently has no more than 10 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2'-F block independently has no more than 9 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2 -F modified sugar, and each 2’-F block independently has no more than 8 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2’-F block independently has no more than 7 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2’-F block independently has no more than 6 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2'-F block independently has no more than 5 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2 -F block independently has no more than 4 2’-F modified sugars. In some embodiments, each block bonded to a 2’-F block is independently a block that comprises no 2’-F modified sugar. In some embodiments, each block bonded to a 2’-F block is independently a block that comprises a natural DNA or RNA sugar, a 2’-OR modified sugar wherein R is optionally substituted C i .g aliphatic or a bicyclic sugar. In some embodiments, each block bonded to a 2’-F block is independently a block that comprises a natural DNA or RNA sugar, a 2'-OMc modified sugar, 2 ’-MOE modified sugar or a bicyclic sugar. In some embodiments, each block bonded to a 2’-F block is independently a block that comprises a natural DNA or RNA sugar, a 2’-OMe modified sugar or 2’-MOE modified sugar. In some embodiments, each nucleoside in a first domain bonded to a 2’-F block in a first domain is independently a 2 -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic or a bicyclic sugar. In some embodiments, each nucleoside in a first domain bonded to a 2’-F block in a first domain is independently a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, each nucleoside in a first domain bonded to a 2’-F block in a first domain is independently a 2’- OMe or 2’-MOE modified sugar. In some embodiments, each nucleoside in a second domain bonded to a 2’- F block in a second domain is independently a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic or a bicyclic sugar. In some embodiments, each nucleoside in a second domain bonded to a 2’-F block in a second domain is independently a 2'-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, each nucleoside in a second domain bonded to a 2’-F block in a second domain is independently a 2’-OMe or 2 ’-MOE modified sugar.
[0164] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%- 85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%- 85%, 75%-90%. 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%. 50%. 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%. or 100%, etc. of all sugars are 2’-OR modified sugars, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%,75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%. 70%. 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars are 2’-OMe or 2’-M0E modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%.
[0165] In some embodiments, about 10%-100%, 20-100%. 30%-100%, 40%-100%. 50%-80%, 50%- 85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%,65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%,85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars are 2'-OMe modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%.
[0166] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%. 60%-80%, 60%-85%, 60%-90%, 60%-95%. 60%-100%, 65%-80%, 65%-85%;65%-90%, 65%-95%, 65%- 100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%,85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars are 2’-OR modified sugars, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%,50%-95%. 60%-80%. 60%-85%, 60%-90%, 60%-95%. 60%-100%, 65%-80%, 65%-85%. 65%-90%. 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%,75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars are 2’-M0E modified sugars.
[0167] In some embodiments, sugars of tire first (5'-end) one or several (e.g., 1, 2, 3, 4, 5. 6, 7, 8, 9. 10. or 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3- 4, etc.) and / orthe last (3’-end) one or several (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, etc.) nucleosides areindependently modified sugars. In some embodiments, the first one or several sugars are independently modified sugars. In some embodiments, the last one or several sugars are independently modified sugars. In some embodiments, both the first and last one or several sugars are independently modified sugars. In some embodiments, modified sugars are independently non-2’-F modified sugars, e.g., bicyclic sugars, 2’-OR modified sugars wherein R is as described herein and is not -H (e.g., optionally substituted Ci-6 aliphatic). In some embodiments, they are independently selected from bicyclic sugars and 2 ’-OR modified sugars wherein R is optionally substituted Ci-e aliphatic. In some embodiments, they are independently 2’-ORmodified sugars wherein R is optionally substituted Ci.g aliphatic. In some embodiments, they are independently 2’-0Me modified sugars and 2’-M0E modified sugars. In some embodiments, the first several sugars comprises one or more 2’-OR modified sugars wherein R is optionally substituted Ci-e aliphatic or bicyclic sugars (e.g., LNA. cEt, etc.) as described herein. In some embodiments, the first several sugars comprises one or more 2’-OR modified sugars wherein R is optionally substituted Ci.6aliphatic. In some embodiments, the first several sugars comprises one or more 2’-0Me modified sugars. In some embodiments, the first several sugars comprises one or more 2 ’-MOE modified sugars. In some embodiments, the first several sugars comprises one or more 2’-0Me modified sugars and one or more 2’-M0E modified sugars. In some embodiments, the last several sugars comprises one or more 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic or bicyclic sugars (e.g., LNA, cEt, etc.) as described herein. In some embodiments, the last several sugars comprises one or more 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, the last several sugars comprises one or more 2'-0Me modified sugars. In some embodiments, the last several sugars comprises one or more 2'-M0E modified sugars. In some embodiments, the last several sugars comprises one or more 2’-0Me modified sugars and one or more 2 ’-MOE modified sugars. In some embodiments, the last several sugars are independently 2’-0Me modified sugars. In some embodiments, the first several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive bicyclic sugars or 2 ’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, the first several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, the first several sugars comprise two or more (e.g., 2. 3, 4, 5, 6, 7. 8, 9, or 10, etc.) consecutive modified sugars wherein each modified sugar is independently a 2’-OMe modified sugar or a 2’-MOE modified sugar. In some embodiments, the first several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-OMe modified sugars. In some embodiments, the first several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-MOE modified sugars. In some embodiments, the last several sugars comprise two or more (e.g., 2. 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, the last several sugars comprise two or more (e.g.. 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive modified sugars wherein each modified sugar is independently a 2’-OMe modified sugar or a 2’-MOE modified sugar. In some embodiments, the last several sugars comprise two ormore (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-OMe modified sugars. In some embodiments,the last several sugars comprise three or more consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise four or more consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise five or more consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise six or more consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-MOE modified sugars.
[0168] In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the first several (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars are modified sugars. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the first several (1, 2, 3. 4, 5, 6, 7. 8, 9, or 10) sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic and a bicyclic sugar (e.g.. a sugar comprising 2’-O-CH2-4’, wherein the -CH2- is optionally substituted (e.g., a LNA sugar, a cET sugar (e.g., (S)-cEt))). In some embodiments, modified sugars are independently homo-N-nucleoside sugars (e.g., alpha- homo-N-nucleoside or beta-homo-N-nucleoside sugars as described herein. In some embodiments, two or more of the first several sugars are modified sugars each independently selected from a 2 ’-OR modified sugar wherein R is optionally substituted Cue aliphatic and a bicyclic sugar. In some embodiments, three or more of the first several sugars are modified sugars each independently selected from a 2 ’-OR modified sugar wherein R is optionally substituted Cue aliphatic and a bicyclic sugar. In some embodiments, four or more of the first several sugars are modified sugars each independently selected from a 2 ’-OR modified sugar wherein R is optionally substituted C1-6 aliphatic and a bicyclic sugar. In some embodiments, the one or more sugars are consecutive. In some embodiments, the first one, two. three or four sugars are modified sugars. In some embodiments, the first two sugars are modified sugars each independently selected from a 2 ’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic and a bicyclic sugar. In some embodiments, the first three sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic and a bicyclic sugar. In some embodiments, the first four sugars are modified sugars each independently selected from a 2'-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic and a bicyclic sugar. In some embodiments, each 2’-OR modified sugar is independently a 2’- OMe or 2’-MOE modified sugar. In some embodiments, each bicyclic sugar is independently a LNA sugar or a cEt sugar. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the first several sugars, or the first several (e.g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2’-OR modified sugar wherein R is optionally substituted Ci.6aliphatic. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the first several sugars, or the first several (e.g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2’-OMe or 2'-MOE modified sugar. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the first several sugars, or tire first several (e.g., 1. 2, 3, 4. or 5) sugar(s), is independently a 2’-OMe modified sugar. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the first several sugars, or the first several (e.g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2’-MOE modified sugar. In some embodiments, the first one, two, three, four or more sugars are independently 2’-OMe modified sugars. Insome embodiments, the first sugar is a 2’-OMe modified sugar. In some embodiments, the first two sugars are independently 2’-OMe modified sugars. In some embodiments, tire first three sugars are independently 2’- OMe modified sugars. In some embodiments, the first four sugars are independently 2’-OMe modified sugars. In some embodiments, the first one, two, three, four or more sugars are independently 2’-MOE modified sugars. In some embodiments, the first sugar is a 2’-MOE modified sugar. In some embodiments, the first two sugars are independently 2 ’-MOE modified sugars. In some embodiments, the first three sugars are independently 2 ’-MOE modified sugars. In some embodiments, the first four sugars are independently 2’- MOE modified sugars. In some embodiments, each of such modified sugars is independently the sugar of a nucleoside w hose nucleobase is optionally substituted or protected A, T, C, G, or U, or an optionally substituted or protected tautomer of A, T. C, G. or U. In some embodiments, one or more such sugars are independently bonded to a non-negatively charged intemucleotidic linkage. In some embodiments, one or more such sugars are independently bonded to a neutral intemucleotidic linkage such as nOOl. In some embodiments, a non- negatively charged intemucleotidic linkage or neutral intemucleotidic linkage, e.g., nOOl, is chirally controlled. In some embodiments, it is / ?p. In some embodiments, one or more such sugars are independently bonded to a phosphorothioate intemucleotidic linkage. In some embodiments, a phosphorothioate intemucleotidic linkage is chirally controlled. In some embodiments, it is .S'p. In some embodiments, as described herein, the intemucleotidic linkage between the first and second nucleosides is a non-negatively charged intemucleotidic linkage. In some embodiments, it is a neutral intemucleotidic linkage. In some embodiments, it is a phosphoryl guanidine intemucleotidic linkage. In some embodiments, it is nOOl. In some embodiments, it is chirally controlled. In some embodiments, it is / ?p. hi some embodiments, except the intemucleotidic linkage between the first and second nucleosides, each intemucleotidic linkages bonded to nucleosides comprising the one or more of the first several, or the first several modified sugars are independently phosphorothioate intemucleotidic linkages. In some embodiments, each is chirally controlled. In some embodiments, each is .S'p. In some embodiments, a first nucleoside is connected to an additional moiety, e.g., ModOOl, optionally through a linker, e.g., L001, through its 5’-end carbon (in some embodiments, via a phosphate group).
[0169] In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the last several (1, 2. 3, 4, 5, 6, 7. 8, 9, or 10) sugars are modified sugars. In some embodiments, one or more (1, 2. 3, 4, 5, 6, 7, 8, 9, or 10) of the last several (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Ci.6aliphatic and a bicyclic sugar (e.g., a sugar comprising 2’-O-CH2-4’, wherein the -CH2- is optionally substituted (e.g., a LNA sugar, a cET sugar (e.g., (S)-cEt))). In some embodiments, two or more of the last several sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Cu aliphatic and a bicyclic sugar. In some embodiments, three or more of the last several sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic and a bicyclic sugar. In some embodiments, four or more of the last several sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Cue aliphatic and abicyclic sugar. In some embodiments, the one or more sugars are consecutive. In some embodiments, the last one, two, three or four sugars are modified sugars. In some embodiments, the last two sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic and a bicyclic sugar. In some embodiments, the last three sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic and a bicyclic sugar. In some embodiments, the last four sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Cue aliphatic and a bicyclic sugar. In some embodiments, each 2'-OR modified sugar is independently a 2’-0Me or 2’-M0E modified sugar. In some embodiments, each bicyclic sugar is independently a LNA sugar or a cEt sugar. In some embodiments, each of the one or more (e.g.. 1, 2, 3, 4. or 5) sugars of the last several sugars, or the last several (e.g., 1, 2. 3, 4, or 5) sugar(s), is independently a 2’-OR modified sugar wherein R is optionally substituted Cue aliphatic. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the last several sugars, or the last several (e.g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2’-0Me or 2’-M0E modified sugar. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the last several sugars, or the last several (e.g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2’-0Me modified sugar. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the last several sugars, or the last several (e.g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2’-M0E modified sugar. In some embodiments, the last one, two, three, four or more sugars are independently 2’-0Me modified sugars. In some embodiments, the last sugar is a 2’-0Me modified sugar. In some embodiments, the last two sugars are independently 2'-0Me modified sugars. In some embodiments, the last three sugars are independently 2'-0Me modified sugars. In some embodiments, the last four sugars are independently 2'-0Me modified sugars. In some embodiments, the last one, two, three, four or more sugars are independently 2 ’-MOE modified sugars. In some embodiments, the last sugar is a 2’- MOE modified sugar. In some embodiments, the last two sugars are independently 2’-M0E modified sugars. In some embodiments, the last three sugars are independently 2 ’-MOE modified sugars. In some embodiments, the last four sugars are independently 2 ’-MOE modified sugars. In some embodiments, each of such modified sugars is independently the sugar of a nucleoside whose nucleobase is optionally substituted or protected A, T, C, G, or U, or an optionally substituted or protected tautomer of A, T, C, G, or U. In some embodiments, one or more such sugars are independently bonded to a non-negatively charged intemucleotidic linkage. In some embodiments, one or more such sugars are independently bonded to a neutral intemucleotidic linkage such as nOOl. In some embodiments, a non-negatively charged intemucleotidic linkage or neutral intemucleotidic linkage, e.g., nOOl, is chirally controlled. In some embodiments, it is Rp. In some embodiments, one or more such sugars are independently bonded to a phosphorothioate intemucleotidic linkage. In some embodiments, a phosphorothioate intemucleotidic linkage is chirally controlled. In some embodiments, it is .S'p, In some embodiments, as described herein, the intemucleotidic linkage between the last and second last nucleosides is a non-negatively charged intemucleotidic linkage. In some embodiments, it is a neutral intemucleotidic linkage. In some embodiments, it is a phosphoryl guanidine intemucleotidiclinkage. In some embodiments, it is nOOl. In some embodiments, it is chirally controlled. In some embodiments, it is 7?p. In some embodiments, except the intemucleotidic linkage between the last and second last nucleosides, each intemucleotidic linkages bonded to nucleosides comprising the one or more of the last several, or the last several modified sugars are independently phosphorothioate intemucleotidic linkages. In some embodiments, each is chirally controlled. In some embodiments, each is .S'p,
[0170] In some embodiments, a sugar at position +1 is a 2’-F modified sugar. In some embodiments, a sugar at position +1 is a natural DNA sugar. In some embodiments, a sugar at position 0 is a natural DNA sugar (nucleoside at position 0 is opposite to a target adenosine when aligned). In some embodiments, a sugar at position - 1 is a DNA sugar. In some embodiments, a sugar at position -2 is a 2’ -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic or a bicyclic sugar (e.g., a sugar comprising 2’-O-CH2-4’, wherein the -CH2- is optionally substituted (e.g., a LNA sugar, a cET sugar (e.g., (S)-cEt))). In some embodiments, it is a 2’-OR modified sugar wherein R is optionally substituted Ci.6aliphatic. In some embodiments, it is a 2’- OMe modified sugar. In some embodiments, it is a 2 ’-MOE modified sugar. In some embodiments, it is a bicyclic sugar. In some embodiments, it is a LNA sugar. In some embodiments, it is a cEt sugar. In some embodiments, a sugar at position -3 is a 2’-F modified sugar. In some embodiments, each sugar after position -3 (e.g., position -4, -5, -6, etc.) is independently a 2’-OR modified sugar wherein R is optionally substituted Ci.6 aliphatic or a bicyclic sugar (e.g., a sugar comprising 2’-O-CH2-4’, wherein the -CH2- is optionally substituted (e.g., a LNA sugar, a cET sugar (e.g., (S)-cEt))). In some embodiments, each is independently a 2 ’-OR modified sugar wherein R is optionally substituted Ci-e aliphatic or a bicyclic sugar. In some embodiments, each is independently a 2’-OMe or 2’-MOE modified sugar. In some embodiments, each is a 2’-OMe modified sugar. In some embodiments, each is a 2 ’-MOE modified sugar. In some embodiments, one or more are independently 2’-OMe modified sugars, and one or more are independently 2’-MOE modified sugars. In some embodiments, as described herein, the intemucleotidic linkage between nucleosides at positions -1 and-2 is a non-negatively charged intemucleotidic linkage. In some embodiments, it is a neutral intemucleotidic linkage. In some embodiments, it is a phosphoryl guanidine intemucleotidic linkage. In some embodiments, it is nOOl. In some embodiments, it is chirally controlled. In some embodiments, it is .S'p, In some embodiments, it is Rp. In some embodiments, the intemucleotidic linkage between nucleosides at positions -2 and -3 is a natural phosphate linkage. In some embodiments, as described herein, the intemucleotidic linkage between the last and second last nucleosides is a non-negatively charged intemucleotidic linkage. In some embodiments, it is a neutral intemucleotidic linkage. In some embodiments, it is a phosphoryl guanidine intemucleotidic linkage . In some embodiments, it is nOO 1. In some embodiments, it is chirally controlled. In some embodiments, it is Rp. In some embodiments, each intemucleotidic linkages between nucleosides to the 3 '-side of a nucleoside opposite to a target adenosine, except those between nucleosides at positions -1 and -2, and between nucleosides at positions -2 and -3, and between the last and the second last nucleosides, is independently a phosphorothioate intemucleotidic linkages. In some embodiments, each phosphorothioate intemucleotidic linkage is chirally controlled. In some embodiments, each is Sp.
[0171] In some embodiments, the first and / or last one or several sugars are modified sugars, e.g., bicyclic sugars and / or 2 ’-OR modified sugars wherein Ris optionally substituted Ci-6 aliphatic (e.g., 2'-OMe modified sugars, 2’-MOE modified sugars, etc ). In some embodiments, such sugars may increase stability, affinity and / or activity of an oligonucleotide. In some embodiments, when conjugated to one or more additional chemical moieties, sugars at 5’- and / or 3 ’-ends of oligonucleotides are not bicyclic sugars or 2 ’-OR modified sugars wherein R is optionally substituted Ci-e aliphatic. In some embodiments, a 5 ’-end sugar is a bicyclic sugar or a 2’-OR modified sugar wherein R is optionally substituted Ci.g aliphatic. In some embodiments, such a 5 ’-end sugar is not connected to an additional chemical moiety. In some embodiments, a 5 ’-end sugar is a 2'-F modified sugar. In some embodiments, a 5 ’-end sugar is a 2’-F modified sugar conjugated to an additional chemical moiety. In some embodiments, a 3 ’-end sugar is a bicyclic sugar or a 2’-OR modified sugar wherein R is optionally substituted Ci-e aliphatic. In some embodiments, such a 3’-end sugar is not connected to an additional chemical moiety. In some embodiments, a 3 ’-end sugar is a 2’-F modified sugar. In some embodiments, a 3’-end sugar is a 2’-F modified sugar conjugated to an additional chemical moiety. In some embodiments, the last several sugars are 3 ’-side sugars relative to a nucleoside opposite to a target adenosine (e.g., sugars of 3’-side nucleosides such as N.i, N-2, etc.). In some embodiments, the last several sugars or the 3’-side sugars comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2’-F modified sugars. In some embodiments, the last several sugars or the 3’-side sugars comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) consecutive 2’-F modified sugars. In some embodiments, the last several sugars or the 3'-side sugars comprises one or more, or two or more consecutive, 2’-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a bicyclic sugar or a 2’ -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, as described herein a 2’-OR modified sugar is a 2’-OMe modified sugar or a 2 ’-MOE modified sugar; in some embodiments, it is a 2’-OMe modified sugar; in some embodiments, it is a 2’-MOE modified sugar. In some embodiments, the last several sugars or the 3’-side sugars comprises one or more, or two or more consecutive, 2’-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a 2’-OR modified sugar wherein R is optionally substituted Ci-e aliphatic. In some embodiments, tire last several sugars or the 3 '-side sugars comprises one or more, or two or more consecutive. 2’-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a 2’-OMe modified sugar or a 2 ’-MOE modified sugar. In some embodiments, the last several sugars or the 3 ’-side sugars comprises one or more, or two or more consecutive, 2’-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a 2’-OMe modified sugar. In some embodiments, the last several sugars or the 3’-side sugars comprises one or more, or two or more consecutive, 2'-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a 2 ’-MOE modified sugar. In some embodiments, two and no more than two nucleosides at the 3 '-side of a nucleoside opposite to an adenosine independently have a 2’-F modified sugar. In some embodiments, they are at positions -4 and -5. In some embodiments, they are the second and third last nucleosides of an oligonucleotide. In some embodiments, one and no more than one nucleoside at the 3 ’-side of a nucleoside opposite to an adenosine has a 2’-F modified sugar. In some embodiments, it is atposition -3. In some embodiments, it is 4thlast nucleoside of an oligonucleotide.
[0172] In some embodiments, a bicyclic sugar or a 2 -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic is present in a region which comprises one or more (e.g., 1-30, 1-25, 1-20, 1-15, 1- 10, 2-30, 2-25, 2-20, 2-25, 2-10, or 1. 2, 3, 4, 5. 6, 7, 8. 9, 10, 11, 12. 13. 14. 15, 16, 17, 18, 19, 20 or more) sugars are 2’-F modified. In some embodiments, a majority of sugars as described herein in such a region are 2’-F modified sugars. In some embodiments, two or more 2’-F modified sugars are consecutive. In some embodiments, a region is a first domain. In some embodiments, a bicyclic sugar is present in such a region. In some embodiments, a 2 ’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic is present in such a region. In some embodiments, a 2'-OMe modified sugar is present in such a region. In some embodiments, a 2’-MOE modified sugar is present in such a region.
[0173] In some embodiments, one or more sugars at positions -5, -4, -3, +1, +2, +4, +5, +6, +7, and +8 (position 0 being the position of a nucleoside opposite to a target adenosine; “+” is going from a nucleoside opposite to a target adenosine toward 5 ’-end of an oligonucleotide, and is going from a nucleoside opposite to a target adenosine toward 3’-end of an oligonucleotide; for example, in 5'-NiNoN-i-3’, if No is a nucleoside opposite to a target adenosine, it is at position 0, and Ni is at position +1 and N.i is at position -1) are independently 2’-F modified sugars. In some embodiments, a sugar at position +1, and one or more sugars at positions -5, -4, -3, +2, +4, +5, +6, +7, and +8, are independently 2’-F modified sugars. In some embodiments, a sugar at position +1, and one sugar at position -5, -4, -3, +2, +4, +5, +6, +7, and +8, are independently 2’-F modified sugars.
[0174] In some embodiments, an oligonucleotide comprises one or more (e.g., 1. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. 2-10, 3-10, 2-5, 2-4. 2-3, 3-5, 3-4, etc.) natural DNA sugars. In some embodiments, one or more natural DNA sugars are at an editing region, e.g.. positions +1, 0, and / or -1. In some embodiments, a natural DNA sugar is within the first several nucleosides of an oligonucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides). In some embodiments, the first, second, and / or third nucleosides of an oligonucleotides independently have a natural DNA sugar. In some embodiments, a natural DNA sugar is bonded to a modified intemucleotidic linkage such as a non-negatively charged intemucleotidic linkage, a neutral internucleotidic linkage, a phosphoryl guanidine intemucleotidic linkage, nOOl, or a phosphorothioate intemucleotidic linkage (in various embodiments, .S'p). In some embodiments, a natural DNA sugar is at position +11.
[0175] In some embodiments, an oligonucleotide comprises one or more homo-N -nucleoside (e.g., alpha- homo-N-nucleoside or beta-homo-N-nucleoside) sugars as described herein. In some embodiments, a homo- N-nuclcosidc is [mid] as described herein. In some embodiments, a sugar ofN-i is a homo-N-nuclcosidc sugar. In some embodiments, a sugar of N5 is a homo-N-nucleoside sugar. In some embodiments, a sugar of N7 is a homo-N -nucleoside sugar. In some embodiments, a sugar of Nw is a homo-N-nucleoside sugar. In some embodiments, a sugar of Nn is a homo-N-nucleoside sugar. In some embodiments, a sugar of N13 is a homo- N-nucleoside sugar. In some embodiments, a sugar of N» is a homo-N-nucleoside sugar. In some embodiments, a sugar of Nie is a homo-N-nucleoside sugar. In some embodiments, a sugar of N23 is a homo-N-nucleoside sugar. In some embodiments, a sugar of N24 is a homo-N-nucleoside sugar. In some embodiments, a first sugar from the 5 '-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a second sugar from the 5 '-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 9thsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 11thsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 12thsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 14thsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 15thsugar from the 5 '-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 18thsugar from the 5'-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 20thsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 21stsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 22ndsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 23rdsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 28thsugar from the 5 '-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a 29thsugar from the 5 ’-end of an oligonucleotide is a homo-N-nucleoside sugar. In some embodiments, a sugar of N.s is a homo-N-nucleoside sugar. In some embodiments, a sugar of N.4 is a homo-N-nucleoside sugar. In some embodiments, a second sugar from the 3 ’-end of an oligonucleotide is a homo¬N-nucleoside sugar. In some embodiments, a third sugar from the 3’-end of an oligonucleotide is a homo-N- nucleoside sugar.
[0176] In some embodiments, an oligonucleotide comprises one or more abasic sugars. In some embodiments, an abasic sugar is at Nn. In some embodiments, a 13thsugar from the 5’-end of an oligonucleotide is an abasic sugar. In some embodiments, an abasic sugar is at N3. In some embodiments, a 22ndsugar from the 5 ’-end of an oligonucleotide is an abasic sugar.
[0177] In some embodiments, an oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or10 or more) 2’-OR modified sugars, wherein R is optionally substituted C1-6 aliphatic, at a 5’-end. In some embodiments, an oligonucleotide comprises 1 or more 2 -OR modified sugars at a 5 ’-end. In some embodiments, an oligonucleotide comprises 2 or more 2 -OR modified sugars at a 5 ’-end. In some embodiments. an oligonucleotide comprises 3 or more 2 -OR modified sugars at a 5 ’-end. In some embodiments, an oligonucleotide comprises 4 or more 2’-OR modified sugars at a 5 ’-end. In some embodiments, an oligonucleotide comprises 5 or more 2’-OR modified sugars at a 5 ’-end. In some embodiments, an oligonucleotide comprises 6 or more 2’-OR modified sugars at a 5 ’-end. In some embodiments, an oligonucleotide comprises 7 or more 2 -OR modified sugars at a 5 ’-end. In some embodiments, an oligonucleotide comprises 8 or more 2 -OR modified sugars at a 5 ’-end. In some embodiments. an oligonucleotide comprises 9 or more 2 -OR modified sugars at a 5 ’-end. In some embodiments, an oligonucleotide comprises 10 or more 2 ’-OR modified sugars at a 5 ’-end. In some embodiments, as described herein a 2’-OR modified sugar is a 2’-OMe modified sugar or a 2’-MOE modifiedsugar; in some embodiments, it is a 2‘-OMe modified sugar; in some embodiments, it is a 2 ’-MOE modified sugar.
[0178] In some embodiments, an oligonucleotide comprises one or more (e.g., 1, 2, 3, 4. 5, 6, 7, 8, 9, or 10 or more) 2 ’-OR modified sugars, wherein R is optionally substituted Ci-6 aliphatic, within 10 nucleosides at a 5’-end. In some embodiments, an oligonucleotide comprises 1 or more 2’-OR modified sugars within 10 nucleosides at a 5 ’-end. In some embodiments, an oligonucleotide comprises 2 or more 2’-OR modified sugars within 10 nucleosides at a 5’-end. In some embodiments, an oligonucleotide comprises 3 or more 2’-OR modified sugars within 10 nucleosides at a 5 ’-end. In some embodiments, an oligonucleotide comprises 4 or more 2'-OR modified sugars within 10 nucleosides at a 5'-end. In some embodiments, an oligonucleotide comprises 5 or more 2’-OR modified sugars within 10 nucleosides at a 5’-end. In some embodiments, an oligonucleotide comprises 6 or more 2’-OR modified sugars within 10 nucleosides at a 5’-end. In some embodiments, an oligonucleotide comprises 7 or more 2 ’-OR modified sugars within 10 nucleosides at a 5’- end. In some embodiments, an oligonucleotide comprises 8 or more 2’-OR modified sugars within 10 nucleosides at a 5 ’-end. In some embodiments, an oligonucleotide comprises 9 or more 2’-OR modified sugars within 10 nucleosides at a 5’-end. In some embodiments, an oligonucleotide comprises 10 or more 2’-OR modified sugars within 10 nucleosides at a 5’-end. In some embodiments, as described herein a 2’-OR modified sugar is a 2’-OMe modified sugar or a 2’-MOE modified sugar; in some embodiments, it is a 2’-OMe modified sugar; in some embodiments, it is a 2’ -MOE modified sugar.
[0179] Oligonucleotides may contain various types of intemucleotidic linkages. In some embodiments, oligonucleotides comprises one or more modified intemucleotidic linkages. In some embodiments, a modified intemucleotidic linkage is a chiral intemucleotidic linkages. In some embodiments, a modified intemucleotidic linkage is a phosphorothioate intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is a non-negatively charged intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is a neutral intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is a phosphory l guanidine intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is nOOl. hi some embodiments, oligonucleotides comprises one or more natural phosphate linkages. In some embodiments, a natural phosphate linkage bonds to a nucleoside comprising a modified sugar that can improve stability (e.g., resistance toward nuclease). In some embodiments, a natural phosphate linkage bonds to a bicyclic sugar. In some embodiments, a natural phosphate linkage bonds to a 2’- modified sugar. In some embodiments, a natural phosphate linkage bonds to a 2 ’-OR modified sugar, wherein R is optionally substituted Cue aliphatic. In some embodiments, a natural phosphate linkage bonds to a 2’- OMe modified sugar. In some embodiments, a natural phosphate linkage bonds to a 2 ’-MOE modified sugar. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage, a non- negatively charged intemucleotidic linkage, and a natural phosphate linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage, a neutral intemucleotidic linkage, and a natural phosphate linkage. In some embodiments, an oligonucleotide comprises a phosphorothioateintemucleotidic linkage, a phosphoryl guanidine intemucleotidic linkage, and a natural phosphate linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage, nOOl, and a natural phosphate linkage. In some embodiments, each chiral intemucleotidic linkage is independently chirally controlled. In some embodiments, one or more chiral intemucleotidic linkage is not chirally controlled. In some embodiments, each phosphorothioate intemucleotidic linkage is independently chirally controlled. In some embodiments, each chiral intemucleotidic linkage is independently chirally controlled. In some embodiments, a majority or each phosphorothioate intemucleotidic linkage is Sp as described herein. In some embodiments, a majority or each non-negatively charged intemucleotidic linkage, e.g., nOOl, is Rp. In some embodiments, a majority or each non-negatively charged intemucleotidic linkage, e g., nOOl, is Sp.
[0180] In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage and a non-negatively charged intemucleotidic linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage and a neutral intemucleotidic linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage and a phosphoryl guanidine intemucleotidic linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage and nOO 1. In some embodiments, each chiral intemucleotidic linkage is independently chirally controlled. In some embodiments, one or more chiral intemucleotidic linkage is not chirally controlled. In some embodiments, each phosphorothioate intemucleotidic linkage is independently chirally controlled. In some embodiments, each chiral intemucleotidic linkage is independently chirally controlled. In some embodiments, a majority or each phosphorothioate intemucleotidic linkage is Sp as described herein. In some embodiments, one or more (e.g., 1, 2, 3, 4, or 5) phosphorothioate intemucleotidic linkages are Rp. In some embodiments, a majority or each non-negatively charged intemucleotidic linkage, e.g., nOOl, is Rp. In some embodiments, a majority or each non-negatively charged intemucleotidic linkage, e.g., nOOl, is Sp. In some embodiments, an oligonucleotide comprises no natural phosphate linkages. In some embodiments, each intemucleotidic linkage is independently a phosphorothioate or a non-negatively charged intemucleotidic linkage. In some embodiments, each intemucleotidic linkage is independently a phosphorothioate or a neutral charged intemucleotidic linkage. In some embodiments, each intemucleotidic linkage is independently a phosphorothioate or phosphoryl guanidine intemucleotidic linkages. In some embodiments, each intemucleotidic linkage is independently a phosphorothioate or nOOl intemucleotidic linkage. In some embodiments, the last intemucleotidic linkage of an oligonucleotide is a non-negatively charged intemucleotidic linkage, or is a neutral intemucleotidic linkage, or is a phosphoryl guanidine intemucleotidic linkage, or is nOO 1.
[0181] In some embodiments, oligonucleotides of the present disclosure comprise one or more modified nucleobases. In some embodiments, oligonucleotides of the present disclosure comprise one or more modified sugar. In some embodiments, oligonucleotides of the present disclosure comprise one or more modified intemucleotidic linkages. Various modifications can be introduced to a sugar, nucleobase, and / or intemucleotidic linkage in accordance with the present disclosure. For example, in some embodiments, amodification is a modification described in US 9006198. In some embodiments, a modification is a modification described in US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108. US 20180216107, US 9598458, WO 2017 / 062862. WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264. WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073. WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 032612, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, WO 2020 / 191252, WO 2021 / 071858, WO 2022 / 099159, and / or WO 2023 / 201095, the sugars, bases, and intemucleotidic linkages of each of which are independently incorporated herein by reference. In some embodiments, a modification is a modification described in WO 2023 / 152371, WO 2024 / 110565, WO 2024 / 115635, WO 2024 / 121373, WO 2024 / 175550, or WO 2024 / 114908. In some embodiments, a combination or pattern of several modifications in these publications can be utilized in accordance with the present disclosure.
[0182] In some embodiments, a nucleobase in a nucleoside is or comprises Ring BA which has the structure of BA-I, BA-I-a, BA-I-b, BA-I-c, BA-I-d, BA-II, BA-II-a, BA-II-b, BA-II-c, BA-II-d, BA-III, BA- Ill-a, BA-III-b, BA-III-c, BA-III-d, BA-III-e, BA-IV. BA-IV-a, BA-IV-b, BA-V, BA-V-a, BA-V-b, or BA- VI, or a tautomer of Ring BA, wherein the nucleobase is optionally substituted or protected. Many useful nucleobases are described herein. Among other things, the present Examples demonstrate various nucleobases can be utilized to provide target adenosine editing.
[0183] In some embodiments, a sugar is a modified sugar comprising a 2 ’-modification, e.g., 2’-F, 2’-OR wherein R is optionally substituted aliphatic, or a bicyclic sugar (e.g., a ENA sugar), or a acyclic sugar (e.g., a UNA sugar). In some embodiments, a modified sugar comprises a 6-membered or larger ring (e.g., 6-9 membered) than a natural DNA or RNA sugar. Among other things, the present Examples demonstrate various sugars can be utilized to provide target adenosine editing.
[0184] In some embodiments, as described herein, provided oligonucleotides comprise one or more domains, each of which independently has certain lengths, modifications, linkage phosphorus stereochemistry, etc., as described herein. In some embodiments, the present disclosure provides an oligonucleotide comprising one or more modified sugars and / or one or more modified intemucleotidic linkages, wherein the oligonucleotide comprises a first domain and a second domain each independently comprising one or more nucleobases. In some embodiments, the present disclosure provides oligonucleotide comprising one or more domains and / or subdomains as described herein. In some embodiments, the present disclosure provides oligonucleotides comprising a first domain as described herein. In some embodiments, the present disclosure provides oligonucleotides comprising a second domain as described herein. In some embodiments, the present disclosure provides oligonucleotides comprising a first subdomain as described herein. In some embodiments, the present disclosure provides oligonucleotides comprising a second subdomain as described herein. In some embodiments, the present disclosure provides oligonucleotides comprising a third subdomain as described herein. In some embodiments, the present disclosure provides oligonucleotides comprising one or more regions each independently selected from a first domain, a second domain, a first subdomain, a secondsubdomain and a third subdomain, each of which is independently as described herein. In some embodiments, the present disclosure provides an oligonucleotide comprising: a first domain; and a second domain, wherein: the first domain comprises one or more 2’-F modifications; the second domain comprises one or more sugars that do not have a 2’-F modification.
[0185] In some embodiments, an oligonucleotide or a portion thereof (e.g., a first domain, a second domain, a first subdomain, a second subdomain, a third subdomain, etc.) comprises a certain level of modified sugars. In some embodiments, a modified sugar comprises a 2 ’-modification. In some embodiments, a modified sugar is a bicyclic sugar. In some embodiments, a modified sugar is an acyclic sugar (e.g., by breaking a C2-C3 bond of a corresponding cyclic sugar). In some embodiments, a modified sugar comprises a 5 ’-modification. Typically, oligonucleotides of the present disclosure have a free 5 ’-OH at its 5 ’-end and a free 3'-OH at its 3’-end unless indicated otherwise, e.g., by context. In some embodiments, a 5’-end sugar of an oligonucleotide may comprise a modified 5 ’-OH.
[0186] In some embodiments, a level is about e.g., about 5%-100%, about 10%-100%, 20-100%, 30%- 100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%- 95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%. 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars in an oligonucleotide or a portion thereof, respectively. In some embodiments, a percentage is at least about 50%. In some embodiments, a percentage is at least about 55%. In some embodiments, a percentage is at least about 60%. In some embodiments, a percentage is at least about 65%. In some embodiments, a percentage is at least about 70%. In some embodiments, a percentage is at least about 75%. In some embodiments, a percentage is at least about 80%. In some embodiments, a percentage is at least about 85%. In some embodiments, a percentage is at least about 90%. In some embodiments, a percentage is at least about 95%. In some embodiments, a percentage is about 100%.
[0187] In some embodiments, a majority is at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In some embodiments, a majority is about 50%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%,60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%. 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%,75%-100%, 80%-85%, 80%-90%. 80%-95%, 80%-100%, 85%-90%, 85%-95%. 85%-100%, 90%-95%. 90%- 100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments, a majority is about or at least about 50%. In some embodiments, a majority is about or at least about 55%. In some embodiments, a majority is about or at least about 60%. In some embodiments, a majorityis about or at least about 65%. In some embodiments, a majority is about or at least about 70%. In some embodiments, a majority is about or at least about 75%. In some embodiments, a majority is about or at least about 80%. In some embodiments, a majority is about or at least about 85%. In some embodiments, a majority is about or at least about 90%. In some embodiments, a majority is about or at least about 95%.
[0188] In some embodiments, an oligonucleotide or a portion thereof (e.g., a first domain, a second domain, a first subdomain, a second subdomain, a third subdomain, etc.) comprises a certain level of modified intemucleotidic linkages. In some embodiments, an oligonucleotide or a portion thereof (e.g., a first domain, a second domain, a first subdomain, a second subdomain, a third subdomain, etc.) comprises a certain level of chiral intemucleotidic linkages. In some embodiments, a level is about e.g., about 5%-I00%, about I0%- 100%. 20-100%, 30%-100%, 40%-100%. 50%-80%, 50%-85%, 50%-90%. 50%-95%, 60%-80%, 60%-85%.60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%,80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-I00%, 90%-95%, 90%-I00%, 10%, 20%, 30%,40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a percentage is at least about 50%. In some embodiments, a percentage is at least about 55%. In some embodiments, a percentage is at least about 60%. In some embodiments, a percentage is at least about 65%. In some embodiments, a percentage is at least about 70%. In some embodiments, a percentage is at least about 75%. In some embodiments, a percentage is at least about 80%. In some embodiments, a percentage is at least about 85%. In some embodiments, a percentage is at least about 90%. In some embodiments, a percentage is at least about 95%. In some embodiments, a percentage is about 100%.
[0189] In some embodiments, an oligonucleotide or a portion thereof (e.g., a first domain, a second domain, a first subdomain, a second subdomain, a third subdomain, etc.) comprises a certain level of chirally controlled intemucleotidic linkages. In some embodiments, an oligonucleotide or a portion thereof (e.g., a first domain, a second domain, a first subdomain, a second subdomain, a third subdomain, etc.) comprises a certain level of Sp intemucleotidic linkages. In some embodiments, a level is about e.g., about 5%-100%, about I0%- 100%. 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%. 60%-95%. 60%-100%. 65%-80%. 65%-85%, 65%-90%, 65%-95%. 65%-100%, 70%-80%. 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%,80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%,40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a level is about e.g., about 5%-100%, about 10%-100%, 20-100%. 30%-100%, 40%-100%, 50%-80%, 50%-85%. 50%-90%, 50%-95%, 60%-80%.60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%,80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%,20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all chiral intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a percentage is at least about 50%. In some embodiments, a percentage is at least about 55%. In some embodiments, a percentage is at least about 60%. In some embodiments, a percentage is at least about 65%. In some embodiments, a percentage is at least about 70%. In some embodiments, a percentage is at least about 75%. In some embodiments, a percentage is at least about 80%. In some embodiments, a percentage is at least about 85%. In some embodiments, a percentage is at least about 90%. In some embodiments, a percentage is at least about 95%. In some embodiments, a percentage is about 100%.
[0190] In some embodiments, an oligonucleotide or a portion thereof (e.g., a first domain, a second domain, a first subdomain, a second subdomain, a third subdomain, etc.) comprises a certain level of .S'p intemucleotidic linkages. In some embodiments, a level is about e.g., about 5%-l 00%, about 10%- 100%, 20- 100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%,60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%- 90%, 70%-95%. 70%-100%, 75%-80%. 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%. 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%. 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a level is about e.g., about 5%- 100%, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%- 80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%. 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%. 10%, 20%, 30%, 40%. 50%. 60%. 65%, 70%, 75%, 80%, 85%, 90%. 95%. or 100%. etc. of all chiral intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a level is about e.g., about 5%-100%, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%- 95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%. 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%- 95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%. 85%-100%, 90%-95%, 90%-100%. 10%, 20%, 30%, 40%, 50%, 60%, 65%. 70%. 75%. 80%. 85%, 90%. 95%. or 100%, etc. of all chirally controlled intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a percentage is at least about 50%. In some embodiments, a percentage is at least about 55%. In some embodiments, a percentage is at least about 60%. In some embodiments, a percentage is at least about 65%. In some embodiments, a percentage is at least about 70%. In some embodiments, a percentage is at least about 75%. In some embodiments, a percentage is at least about 80%. In some embodiments, a percentage is at least about 85%. In some embodiments, a percentage is at least about 90%. In some embodiments, a percentage is at least about 95%. In some embodiments, a percentage is about 100%. In some embodiments, about 1-50, 1-40, 1-30, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20intemucleotidic linkages are independently Sp chiral intemucleotidic linkages. In many embodiments, it was observed that a high percentage (e.g., relative to 7?p intemucleotidic linkages and / or natural phosphate linkages) of Sp intemucleotidic linkages in an oligonucleotide or certain portions thereof can provide improved properties and / or activities, e.g.. high stability and / or high adenosine editing activity.
[0191] In some embodiments, an oligonucleotide or a portion thereof (e.g., a first domain, a second domain, a first subdomain, a second subdomain, a third subdomain, etc.) comprises a certain level of Rp intemucleotidic linkages. In some embodiments, a level is about e.g., about 5%-100%, about 10%-100%, 20- 100%, 30%-100%, 40%-100%, 50%-80%. 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%,60%-95%. 60%-100%, 65%-80%. 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%- 90%, 70%-95%. 70%-100%, 75%-80%. 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%. 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%- 100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a level is about e.g., about 5%-100%, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%. 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%- 80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%. 75%-80%, 75%-85%, 75%-90%. 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all chiral intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a level is about e.g., about 5%-100%, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%- 95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%. 70%-95%, 70%-100%. 75%-80%, 75%-85%, 75%-90%. 75%- 95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all chirally controlled intemucleotidic linkages in an oligonucleotide or a portion thereof, respectively. In some embodiments, a percentage is at least about 50%. In some embodiments, a percentage is at least about 55%. In some embodiments, a percentage is at least about 60%. In some embodiments, a percentage is at least about 65%. In some embodiments, a percentage is at least about 70%. In some embodiments, a percentage is at least about 75%. In some embodiments, a percentage is at least about 80%. In some embodiments, a percentage is at least about 85%. In some embodiments, a percentage is at least about 90%. In some embodiments, a percentage is at least about 95%. In some embodiments, a percentage is about 100%. In some embodiments, a percentage is about or no more than about 5%. In some embodiments, a percentage is about or no more than about 10%. In some embodiments, a percentage is about or no more than about 15%. In some embodiments, a percentage is about or no more than about 20%. In some embodiments, a percentage is about or no more than about 25%. In some embodiments, a percentage is about or no more than about 30%. In some embodiments, a percentage is about or no more than about 35%. In some embodiments, a percentage is aboutor no more than about 40%. In some embodiments, a percentage is about or no more than about 45%. In some embodiments, a percentage is about or no more than about 50%. In some embodiments, about 1-50, 1-40, 1- 30, e.g., about 1, 2, 3, 4. 5, 6, 7, 8. 9, 10, 11, 12. 13, 14, 15, 16, 17, 18, 19, or 20 intemucleotidic linkages are independently 7?p chiral intemucleotidic linkages. In some embodiments, the number is about or no more than about 1. In some embodiments, the number is about or no more than about 2. In some embodiments, the number is about or no more than about 3. In some embodiments, the number is about or no more than about 4. In some embodiments, the number is about or no more than about 5. In some embodiments, the number is about or no more than about 6. In some embodiments, the number is about or no more than about 7. In some embodiments, the number is about or no more than about 8. In some embodiments, the number is about or no more than about 9. In some embodiments, tire number is about or no more than about 10.
[0192] While not wishing to be bound by theory', it is noted that in some instances Rp and .S'p configurations of intemucleotidic linkages may affect structural changes in helical conformations of double stranded complexes formed by oligonucleotides and target nucleic acids such as RNA, and ADAR proteins may recognize and interact various targets (e.g., double stranded complexes formed by oligonucleotides and target nucleic acids such as RNA) through multiple domains. In some embodiments, provided oligonucleotides and compositions thereof promote and / or enhance interaction profiles of oligonucleotide, target nucleic acids, and / or ADAR proteins to provide efficient adenosine modification by ADAR proteins through incorporation of various modifications and / or control of stereochemistry.
[0193] In some embodiments, an oligonucleotide can have or comprise a base sequence; intemucleotidic linkage, base modification, sugar modification, additional chemical moiety, or pattern thereof; and / or any other structural element described herein, e.g., in Tables.
[0194] In some embodiments, a provided oligonucleotide or composition is characterized in that, when it is contacted with a target nucleic acid comprising a target adenosine in a system (e.g., an ADAR-mediated deamination system), modification of the target adenosine (e.g., deamination of the target A) is improved relative to that observed under reference conditions (e.g., selected from the group consisting of absence of tire composition, presence of a reference oligonucleotide or composition, and combinations thereof). In some embodiments, modification, e.g., ADAR-mediated deamination (e.g., endogenous ADAR-mediated deamination) is increased 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 2. 3, 4, 5, 6. 7, 8, 9. 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 fold or more.
[0195] In some embodiments, oligonucleotides arc provided as salt forms. In some embodiments, oligonucleotides are provided as salts comprising negatively-charged intemucleotidic linkages (e.g., phosphorothioate intemucleotidic linkages, natural phosphate linkages, etc.) existing as their salt forms. In some embodiments, oligonucleotides are provided as pharmaceutically acceptable salts. In some embodiments, oligonucleotides are provided as metal salts. In some embodiments, oligonucleotides are provided as sodium salts. In some embodiments, oligonucleotides are provided as ammonium salts. In someembodiments, oligonucleotides are provided as metal salts, e.g., sodium salts, wherein each negatively-charged intemucleotidic linkage is independently in a salt form (e.g., for sodium salts, -O-P(O)(SNa)-O- for a phosphorothioate intemucleotidic linkage. -O-P(O)(ONa)-O- for a natural phosphate linkage, etc.).
[0196] In some embodiments, oligonucleotides are chiral controlled, comprising one or more chirally controlled intemucleotidic linkages. In some embodiments, provided oligonucleotides are stereochemically pure. In some embodiments, provided oligonucleotides or compositions thereof are substantially pure of other stereoisomers. In some embodiments, tire present disclosure provides chirally controlled oligonucleotide compositions.
[0197] As described herein, oligonucleotides of the present disclosure can be provided in high purity (e.g., 50%-100%). In some embodiments, oligonucleotides of tire present disclosure are of high stereochemical purity (e.g., 50%-100%). In some embodiments, oligonucleotides in provided compositions are of high stereochemical purity (e.g., high percentage (e.g., 50%-100%) of a stereoisomer compared to the other stereoisomers of the same oligonucleotide). In some embodiments, a percentage is at least or about 50%. In some embodiments, a percentage is at least or about 60%. In some embodiments, a percentage is at least or about 70%. In some embodiments, a percentage is at least or about 75%. In some embodiments, a percentage is at least or about 80%. In some embodiments, a percentage is at least or about 85%. In some embodiments, a percentage is at least or about 90%. In some embodiments, a percentage is at least or about 95%.
[0198] In some embodiments, oligonucleotides of the present disclosure are at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% stereochemically pure at linkage phosphorus of chiral intemucleotidic linkages. In some embodiments, oligonucleotides of the present disclosure are prepared stereoselectively and are substantially free of stereoisomers. In some embodiments, in provided compositions comprising a plurality of oligonucleotides which share the same base sequence of the same pattern of chiral linkage phosphorus stereochemistry (e.g., comprising one or more of 7?p and / or .S'p. wherein each chiral linkage phosphorus is independently Rp or Sp), at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all oligonucleotides in the composition that share the same base sequence as oligonucleotides of the plurality share the same pattern of chiral linkage phosphorus stereochemistry or are oligonucleotides of the plurality. In some embodiments, in provided compositions comprising a plurality of oligonucleotides which share the same base sequence of the same pattern of chiral linkage phosphorus stereochemistry, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all oligonucleotides in the composition that share the same constitution as oligonucleotides of the plurality share the same pattern of chiral linkage phosphorus stereochemistry or are oligonucleotides of the plurality. In some embodiments, diastcrcomcric excess of each chiral phosphorus is independently about or at least about 90%. In some embodiments, diastereomeric excess of each chiral phosphorus is independently about or at least about 95%. In some embodiments, diastereomeric excess of each chiral phosphorus is independently about or at least about 97%. In some embodiments, diastereomeric excess of each chiral phosphorus is independently about or at least about 98%. In some embodiments, diastereomeric purity is about or at least about (DS)nc, wherein DS is about 90-100%, and nc is the number of chiral linkage phosphorus. Insome embodiments, DS is about 90% or more. In some embodiments, DS is about 95% or more. In some embodiments, DS is about 96% or more. In some embodiments, DS is about 97% or more. In some embodiments, DS is about 98% or more. In some embodiments, DS is about 99% or more. In some embodiments, diastereomeric purity is represented as the product of the diastereopurity of each chiral linkage phosphorus. Various oligonucleotide designs and features, e.g., sugars, nucleobases, intemucleotidic linkages, and patterns thereof, first domains, second domains, first subdomains, second subdomains, third subdomains, etc., are described in WO 2023 / 201095 and be utilized in accordance with the present disclosure; they are incorporated herein by reference. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide. In some embodiments, diastereopurity of the oligonucleotide in the composition is about or at least about (DS)nc. wherein each of DS and nc is independently as described herein (e.g., DS being about 90-100%, 95-100%, etc.). In some embodiments, diastereomeric excess of one or more (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) chiral linkage phosphorus centers is independently about or at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, diastereomeric excess of each phosphorothioate linkage phosphorus is independently about or at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In some embodiments, diastereomeric excess of each chiral linkage phosphorus centers is independently about or at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.First Domains
[0199] As described herein, in some embodiment, an oligonucleotide comprises a first domain and a second domain. In some embodiments, an oligonucleotide consists of a first domain and a second domain. Certain embodiments are described below as examples.
[0200] In some embodiments, a first domain has a length of about 2-50 (e g., about 5, 6, 7, 8, 9, or 10 - about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc.) nucleobases. In some embodiments, a first domain has a length of about 5-30 nucleobases. In some embodiments, a first domain has a length of about 10-30 nucleobases. In some embodiments, a first domain has a length of about 10-25 nucleobases. In some embodiments, a first domain has a length of about 10 nucleobases. In some embodiments, a first domain has a length of 15 nucleobases. In some embodiments, a first domain has a length of 20 nucleobases. In some embodiments, a first domain has a length of about 20-25 nucleobases.
[0201] In some embodiments, a first domain is about, or at least about, 5-95%, 10%-90%, 20%-80%, 30%-70%. 40%-70%, 40%-60%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of an oligonucleotide. In some embodiments, a percentage is about 30%- 80%. In some embodiments, a percentage is about 30%-70%. In some embodiments, a percentage is about 40%-60%. In some embodiments, a percentage is about 20%. In some embodiments, a percentage is about 25%. In some embodiments, a percentage is about 30%. In some embodiments, a percentage is about 35%.In some embodiments, a percentage is about 40%. In some embodiments, a percentage is about 45%. In some embodiments, a percentage is about 50% or more. In some embodiments, a percentage is about 50%. In some embodiments, a percentage is about 55%. In some embodiments, a percentage is about 60%. In some embodiments, a percentage is about 60% or more. In some embodiments, a percentage is about 55%. In some embodiments, a percentage is about 60%. In some embodiments, a percentage is about 65%. In some embodiments, a percentage is about 70%. In some embodiments, a percentage is about 75%. In some embodiments, a percentage is about 80%. In some embodiments, a percentage is about 85%. In some embodiments, a percentage is about 90%.
[0202] In some embodiments, one or more (e.g., 1-20, 1, 2, 3. 4, 5, 6, 7, 8, 9, or 10, etc.) mismatches exist in a first domain when an oligonucleotide is aligned with a target nucleic acid for complementarity. In some embodiments, one or more (e.g., 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) wobbles exist in a first domain when an oligonucleotide is aligned with a target nucleic acid for complementarity.
[0203] In some embodiments, duplexes of oligonucleotides and target nucleic acids in a first domain region comprise one or more bulges each of which independently comprise one or more mismatches that are not wobbles. In some embodiments, there are 0-10 (e.g., 0-1. 0-2, 0-3, 0-4. 0-5, 0-6, 0-7. 0-8, 0-9, 0-10, 1-2, 1-3, 1-4. 1-5, 1-6, 1-7. 1-8, 1-9, 1-10, 2-3. 2-4, 2-5, 2-6. 2-7, 2-8, 2-9. 2-10. 3-4, 3-5, 3-6. 3-7, 3-8, 3-9. 3-10.0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) bulges.
[0204] In some embodiments, a first domain is fully complementary to a target nucleic acid.
[0205] In some embodiments, a first domain comprises one or more modified nucleobases.
[0206] In some embodiments, a first domain comprises one or more sugars comprising two 2’-H (e.g., natural DNA sugars). In some embodiments, a first domain comprises one or more sugars comprising 2 -OH (e.g., natural RNA sugars). In some embodiments, a first domain comprises one or more modified sugars. In some embodiments, a modified sugar comprises a 2’-modification. In some embodiments, a modified sugar is a bicyclic sugar, e.g., a LNA sugar. In some embodiments, a modified sugar is an acyclic sugar (e.g., by breaking a C2-C3 bond of a corresponding cyclic sugar).
[0207] In some embodiments, a first domain comprises about 1-50 (e.g., about 5, 6, 7, 8, 9, or 10 - about10, 11, 12, 13. 14. 15, 16, 17, 18, 19, 20, 21, 22. 23. 24, 25, 30, 40 or 50, or about 5, 6, 7, 8. 9, 10, 11, 12. 13.14, 15, 16. 17. 18. 19. 20, 21, 22, 23, 24, 25. 30. 40 or 50, etc., about 1, 2. 3. 4, 5, 6. 7. 8, 9, 10, 11, 12, 13. 14.15, 16, 17, 18, 19, or 20, etc.) modified sugars. In some embodiments, a first domain comprises about 1-50 (e.g., about 5, 6, 7, 8, 9, or 10 - about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) modified sugars widi 2’-F modification. In some embodiments, a first domain comprises about 2-50 (e.g., about 2. 3, 4, 5, 6. 7, 8, 9. or 10 - about 10.11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc., 2-40, 2-30, 2-25, 2-20, 2-15, 2-10, 3-40, 3-30, 3- 25, 3-20, 3-15, 3-10, 4-40, 4-30, 4-25, 4-20, 4-15, 4-10, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 6-40, 6-30, 6-25,6-20, 6-15, 6-10, 7-40, 7-30, 7-25, 7-20, 7-15, 7-10, 8-40, 8-30, 8-25, 8-20, 8-15, 8-10, 9-40, 9-30, 9-25, 9-20, 9-15, 9-10, 10-40, 10-30, 10-25, 10-20, 10-15, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) consecutive modified sugars with 2’-F modification. In some embodiments, a first domain comprises 2 consecutive 2’-F modified sugars. In some embodiments, a first domain comprises 3 consecutive 2’-F modified sugars. In some embodiments, a first domain comprises 4 consecutive 2’-F modified sugars. In some embodiments, a first domain comprises 5 consecutive 2’-F modified sugars. In some embodiments, a first domain comprises 6 consecutive 2’-F modified sugars. In some embodiments, a first domain comprises 7 consecutive 2’-F modified sugars. In some embodiments, a first domain comprises 8 consecutive 2’-F modified sugars. In some embodiments, a first domain comprises 9 consecutive 2'-F modified sugars. In some embodiments, a first domain comprises 10 consecutive 2 -F modified sugars. In some embodiments, a first domain comprises two or more 2’-F modified sugar blocks, wherein each sugar in a 2’-F modified sugar block is independently a 2’-F modified sugar. In some embodiments, each 2’-F modified sugar block independently comprises or consists of 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive 2 -F modified sugars as described herein. In some embodiments, two consecutive 2’-F modified sugar blocks are independently separated by a separating block which separating block comprises one or more sugars that are independently not 2’-F modified sugars. In some embodiments, each sugar in a separating block is independently not 2’-F modified. In some embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) or all sugars in a separating block are independently not 2’-F modified. In some embodiments, a separating block comprises one or more bicyclic sugars (e.g., LNA sugar, cEt sugar, etc.) and / or one or more 2’-OR modified sugars, wherein R is optionally substituted Ci-6 aliphatic (e.g., 2’-OMe, 2'-MOE, etc.). In some embodiments, a separating block comprises one or more 2’-OR modified sugars, wherein R is optionally substituted Ci-6 aliphatic (e g., 2’-OMe. 2'-MOE, etc.). In some embodiments, two or more non-2’-F modified sugars are consecutive. In some embodiments, two or more 2’-OR modified sugars wherein R is optionally substituted Ci.6 aliphatic (e.g., 2’-OMe, 2’-MOE, etc.) are consecutive. In some embodiments, a separating block comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2’-OR modified sugars wherein R is optionally substituted Ci-g aliphatic (e.g., 2’-OMe, 2’- MOE, etc.). In some embodiments, a separating block comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) consecutive 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic (e.g., 2'-OMe, 2’-MOE, etc.). In some embodiments, each 2’-OR modified sugar is independently a 2’-OMe or 2’-MOE sugar. In some embodiments, each 2’-OR modified sugar is independently a 2’-OMe sugar. In some embodiments, each 2’-OR modified sugar is independently a 2’-MOE sugar. In some embodiments, a separating block comprises one or more 2’-F modified sugars. In some embodiments, none of 2’-F modified sugars in a separating block are next to each other. In some embodiments, a separating block contain no 2’-F modified sugars. In some embodiments, each sugar in a separating block is independently a 2 ’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic or a bicyclic sugar. In some embodiments, each sugar in each separating block is independently a 2 ’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic or a bicyclic sugar. In some embodiments, each sugar in a separating block is independently a 2 ’-ORmodified sugar wherein R is optionally substituted Ci-e aliphatic. In some embodiments, each sugar in each separating block is independently a 2 -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, each sugar in a separating block is independently a 2'-0Me or 2’ -MOE modified sugar. In some embodiments, each sugar in each separating block is independently a 2’-0Me or 2 ’-MOE modified sugar. In some embodiments, each sugar in a separating block is independently a 2’-0Me modified sugar. In some embodiments, each sugar in a separating block is independently a 2’-M0E modified sugar. In some embodiments, a separating block comprises a 2’-0Me sugar and 2 ’-MOE modified sugar. In some embodiments, each 2’-F block and each separating block independently contains 1, 2, 3, 4, or 5 nucleosides. In some embodiments, each 2 -F block and each separating block independently contains 1, 2, or 3 nucleosides.
[0208] In some embodiments, about 5%-100%. (e.g.. about 10%-100%, 20-100%, 30%-100%, 40%- 100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%,65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%,85%-90%. 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%,80%, 85%, 90%, 95%, or 100%, etc.) of all sugars in a first domain are independently a modified sugar. In some embodiments, about 5%-100% (e.g., about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%,50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%,75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%- 95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc.) of all sugars in a first domain are independently a 2’-F modified sugar. In some embodiments, a percentage is at least about 40%. In some embodiments, a percentage is at least about 50%. In some embodiments, a percentage is at least about 55%. In some embodiments, a percentage is at least about 60%. In some embodiments, a percentage is at least about 65%. In some embodiments, a percentage is at least about 70%. In some embodiments, a percentage is at least about 75%. In some embodiments, a percentage is at least about 80%. In some embodiments, a percentage is at least about 85%. In some embodiments, a percentage is at least about 90%. In some embodiments, a percentage is at least about 95%. In some embodiments, a percentage is about 100%. In some embodiments, a percentage is about or no more than about 60%. In some embodiments, a percentage is about or no more than about 70%. In some embodiments, a percentage is about or no more than about 80%. In some embodiments, a percentage is about or no more than about 90%.
[0209] In some embodiments, a first domain comprises no bicyclic sugars or 2'-OR modified sugars wherein R is not -H. In some embodiments, a first domain comprises one or more (e.g., 1. 2, 3, 4, 5. 6, 7, 8. 9, or 10) bicyclic sugars and / or 2’-OR modified sugars wherein R is not -H. In some embodiments, a first domain comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) 2’-OR modified sugars wherein R is not -H. In some embodiments, a first domain comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) 2’-ORmodifiedsugars wherein R is optionally substituted Ci-io aliphatic. In some embodiments, levels of bicyclic sugars and / or 2’-OR modified sugars wherein R is not -H, individually or combined, are relatively low compared to level of 2'-F modified sugars. In some embodiments, levels of bicyclic sugars and / or 2’ -OR modified sugars wherein R is not -H, individually or combined, are about 10%— 80% (e.g.. about 10%-75%. 10-70%, 10%- 65%, 10%-60%, 10%-50%, about 20%-60%, about 30%-60%, about 20%-50%, about 30%-50%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%, etc.). In some embodiments, levels of 2’- OR modified sugars wherein R is not H combined (e.g., 2’-OMe and 2’-MOE modified sugars combined, if any) are about 10-70% (e.g., about 10%-60%, 10%-50%, about 20%-60%, about 30%-60%, about 20%-50%, about 30-50%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%, etc.). In some embodiments, no more than about l%-95% (e.g.. no more than about 1%, 5%. 10%. 15%. 20%. 25%. 30%. 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc.) of sugars in a first domain comprises 2’-OMe. In some embodiments, no more than about 50% of sugars in a first domain comprises 2’- OMe. In some embodiments, no more than about l%-95% (e.g., no more than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%. 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. etc.) of sugars in a first domain comprises 2 -OR. wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, no more than about 50% of sugars in a first domain comprises 2 -OR, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, no more than about 40% of sugars in a first domain comprises 2’-OR, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, no more than about 30% of sugars in a first domain comprises 2 -OR, wherein R is optionally substituted Ci-s aliphatic. In some embodiments, no more than about 25% of sugars in a first domain comprises 2’-OR, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, no more than about 20% of sugars in a first domain comprises 2 -OR. wherein R is optionally substituted Cue aliphatic. In some embodiments, no more than about 10% of sugars in a first domain comprises 2’-OR, wherein R is optionally substituted Ci.6 aliphatic. In some embodiments, as described herein, 2’-OR is 2’-MOE. In some embodiments, as described herein, 2’-OR is 2’-MOE or 2’-OMe. In some embodiments, a first domain comprises one or more (e.g., about 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) modified sugars comprising a 2’-N(R)2modification. In some embodiments, a first domain comprises one or more (e.g., about 1-20, 1, 2, 3. 4, 5, 6, 7. 8, 9, 10, 11, 12, 13, 14. 15. 16, 17, 18, 19, 20, etc.) modified sugars comprising a 2’-NH2modification. In some embodiments, a first domain comprises one or more (e.g., about 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) bicyclic sugars, e.g., LNA sugars. In some embodiments, a first domain comprises one or more (e.g., about 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) acyclic sugars (e.g., UNA sugars). In some embodiments, a number of 5’-end sugars in a first domain are independently 2’-ORmodified sugars, wherein R is not -H. In some embodiments, a number of (e.g., 1, 2, 3, 4, 5. 6, 7, 8, 9, 10 or more) 5’-end sugars in a first domain are independently 2 ’-OR modified sugars, wherein R is independently optionally substituted Ci-6 aliphatic. In some embodiments, the first about 1-10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, sugars from the 5’-end of a first domain are independently 2’ -OR modified sugars, w herein R is independently optionally substitutedCi.® aliphatic. In some embodiments, the first one is 2’-OR modified. In some embodiments, the first two are independently 2’-OR modified. In some embodiments, tire first three are independently 2’-OR modified. In some embodiments, the first four are independently 2'-OR modified. In some embodiments, the first five are independently 2 -OR modified. In some embodiments, all 2 -OR modification in a domain (e.g., a first domain), a subdomain (e.g., a first subdomain), or an oligonucleotide are the same. In some embodiments, 2’- OR is 2’-M0E. In some embodiments, 2’-OR is 2’-0Me.
[0210] In some embodiments, no sugar in a first domain comprises 2 ’-OR. In some embodiments, no sugar in a first domain comprises 2’-OMe. In some embodiments, no sugar in a first domain comprises 2’- MOE. In some embodiments, no sugar in a first domain comprises 2'-MOE or 2'-OMe. In some embodiments, no sugar in a first domain comprises 2 ’-OR, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, each sugar in a first domain comprises 2’-F.
[0211] In some embodiments, about 40-70% (e.g., about 40%-70%, 40%-60%, 50%-70%, 50%-60%, etc., or about 40%, 45%, 50%, 55%, 60%, 65%, 70%, etc.) of sugars in a first domain are 2’-F modified, and about 10%-60% (e.g., about 10%-50%, 20%-60%, 30%-60%, 30%-50%, 40%-50%. etc., or about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%) of sugars in a first domain are independently 2’-OR modified wherein R is not -H o...
Claims
CLAIMS1. An oligonucleotide, wherein the oligonucleotide is selected from:RNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] .m(U)|Ssp|.m(C)p.|fl2r|(A)| Ssp|.|fl2r ](C)[n001R].ffl2r](U)fSsp].ffI2r](C)rSsp].m(C)fSsp].ffl2r](A)fn001R].m(A)p.rfl2r](A)fSsp].ffl2r](G)rSsp].rf 12r](G)[Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.[fl2r](C)[Ssp].d(T)[Ssp].m( [3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0RNA1 {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] .m(U)[Ssp].m(C)p.[fl2r](A)[Ssp].[fl2r ](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)[Ssp].[f 12r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp] .m([3nU])[Ss p].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0,RNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] .m(U)[Ssp].[moe]([m5C])p.[fl2r](A)[ Ssp].[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r]( G)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp] .m(C)p.m(C)p.d(T)[Ssp] ,m([ 3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0,RNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].m(U)p.[moe]([m5C])p.[fl2 rJ(A)lSspJ.Lfl2rJ(C)Ln001RJ.Lfl2rJ(U)LSspJ.Lfl2rJ(C)LSsp].m(C)LSspJ.Lfl2rJ(A)Ln001RJ.m(A)p.Lfl2r](G)LSspJ.L fl2r](G)[Ssp].[fl2r](G)[Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.[fl2r](C)[Ss p].d(T)[Ssp].m([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0,RNA1 {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] .m(U)[Ssp].m(C)p.[fl2r](A)[Ssp].[fl2r ](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(A)[n001R].[fl2r](G)[Ssp].[fl2r](G)[Ss p].[fl2r](G)[Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3n UJ)lSspJ.d(C)ln001RJ.m(A)p.|fl2rJ(C)|SspJ.m(U)|n001RJ.m(G)}$$$$V2.0,RNA1 {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] m(U)[Ssp].m(C)p.[fl2r](A)[Ssp].[fl2r ](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)[Ssp].[f 12r](G)[Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3nU])[ Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0,RNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.[fl2r](A)[Ssp].m(U)[Ssp].[moe]([m5C])p.[fl2r](A)LSsp].Lfl2r](C)Ln001R].Lfl2rJ(U)LSspJ.Lfl2rJ(C)LSspJ.m(C)LSspJ.Lfl2rJ(A)Ln001R].m(A)p.Lfl2rJ(G)LSspJ.Lfl 2r](G)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp] .m([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0,RNA1 {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp] m(U)p.[moc]([m5C])p.[fl2 r](A)[Ssp].[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp] .m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[ f!2r](G)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.[fl2r](C)[Ssp].d (T)[Ssp].m([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0,RNAl {m(G)[n001R].m(G)[Ssp].m(U)p.[fl2r](A)[Ssp] .m(U)[Ssp].[moe]([m5C])p.[fl2r](A)[Ssp].[fl2 r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.[fl2r](C)[Ssp].d(T)[Ssp].m ([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[Ssp].m(G)[n001R].m(U)}$$$$V2.0,RNAl {m(G)[n001R].m(G)[Ssp].m(U)p.[fl2r](A)[Ssp] _m( U ) [ Ssp |. m(C )p. | fl2r |( A)| Ssp |. [ fl2r | (C) [ nO 01R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](G) [Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3nU])[Ssp].d(C)[ nOO 1 R] ,m(A)p . [fl2r] (C) [Ssp] ,m(U)[nOO 1 R] ,m(G) } $$$$V2.0, orRNA1 {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].m(U)p.[moe]([m5C])p.[fl2 r](A)[Ssp].[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp] .m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](A)[Ssp].[ fl2r](G) [Ssp] . [fl2r] (G) [Ssp] ,m(U) [Ssp] . [fl2r] (U) [Ssp] . [fl2r] (U) [nOO 1 R] . [fl2r] (U) [Ssp] ,m(C)p . [fl2r] (C) [Ssp] . d(T)[Ssp].m([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0, or a salt thereof, wherein: d represents a natural DNA sugar in a nucleoside; m represents a 2’-OMe modified sugar in a nucleoside;[fl2r] represents a 2'-F modified sugar in a nucleoside;[moe] represents a 2 -MOE sugar in a modified nucleoside;[m5C| represents a nucleoside whose base is 5-methylcytosine;[3nU] represents a nucleoside whose base is l ; p represents a phosphate linkage;[Ssp] represents a phosphorothioate linkage in the Sp configuration: and[nOOIR] representswherein the phosphorus is of the Rp configuration.
2. The oligonucleotide of claim 1, wherein the oligonucleotide isRNAl{m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] .m(U)[Ssp].m(C)p.[fl2r](A)[Ssp].[fl2r](C)[nO 01R].[fl2r](U)[Ssp].[fl2r](C)[SspJ.m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2rJ(A)[Ssp].[fl2r](G)[SspJ.[fl2rJ(G) [Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.[fl2r](C)[Ssp].d(T)[Ssp].m([3nU])[ Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
3. Tire oligonucleotide of claim 1, wherein the oligonucleotide isRNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] .m(U)[Ssp].m(C)p.[fl2r](A)[Ssp].[fl2r](C)[nO01R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](G) [Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3nU])[Ssp].d(C)[ n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
4. Tire oligonucleotide of claim 1, wherein the oligonucleotide isRNA1 {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] .m(U)[Ssp].[moe]([m5C])p.[fl2r](A)[Ssp].[fl2 r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)[Ssp].[ fl2r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3nU])[Ss p].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
5. The oligonucleotide of claim 1, wherein the oligonucleotide isRNA1 {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].m(U)p.[moe]([m5C])p.[fl2r](A)[Ss p].[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G) [Ssp] . [fl2r] (G) [Ssp] ,m(C) [nOO 1 R] . [fl2r] (U) [Ssp] . [fl2r] (U) [nOO 1 R] . [fl2r] (U)[Ssp] ,m(C)p . [fl2r] (C) [Ssp] ,d(T) [ Ssp].m([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
6. The oligonucleotide of claim 1, wherein the oligonucleotide isRNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.m(A)[Ssp] .m(U)[Ssp].m(C)p.[fl2r](A)[Ssp].[fl2r](C)[nO01R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(A)[n001R].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3nU])[Ssp ].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
7. The oligonucleotide of claim 1, wherein the oligonucleotide isRNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(lJ)p.m(A)[Ssp] .m(U)[Ssp].m(C)p.[fl2r|(A)[Ssp].[fl2r](C)[nO 01R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](G) [Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
8. The oligonucleotide of claim 1, wherein the oligonucleotide isRNAl{m(U)[n001R].m(G)[Ssp].m(G)[Ssp].m(U)p.[fl2r](A)[Ssp].m(U)[Ssp].[moe]([m5C])p.[fl2r](A)[Ssp].[ fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)[Ss p].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3nU] )[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
9. Tire oligonucleotide of claim 1, wherein the oligonucleotide isRNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].m(U)p.[moe]([ni5C])p.[fl2r](A)[Ss p].[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)LSspJ Lfl2rJ(G)LSspJ m(C)LSspJ . Lfl2rJ(U)LSspJ Lfl2rJ(U)LnOO 1RJ Lfl2rJ(U)LSspJ .m(C)p.Lfl2rJ(C)LSspJ.d(T)LSsp ].m([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
10. The oligonucleotide of claim 1, wherein the oligonucleotide isRNAl {m(G)[n001R].m(G)[Ssp].m(U)p.[fl2r](A)[Ssp].m(U)[Ssp].[moc]([m5C])p.[fl2r](A)[Ssp].[fl2r](C)[n0 01R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].m(C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.[fl2r](C)[Ssp].d(T)[Ssp].m([3nU])[Ssp] ,d(C) [nOO 1 R] ,m(A)p . [fl2r] (C) [Ssp] ,m(U) [Ssp] ,m(G) [nOO 1 R] ,m(U) } $$$$V2.0 or a salt thereof.
11. The oligonucleotide of claim 1, wherein the oligonucleotide isRNA1 {m(G)[n001R].m(G)[Ssp].m(U)p.[fl2r](A)[Ssp].m(U)[Ssp].m(C)p.[fl2r](A)[Ssp].[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp] .m (C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](U)[Ssp].m(C)p.m(C)p.d(T)[Ssp].m([3nU])[Ssp].d(C)[n001R] ,m(A)p.[fl2r](C)[Ssp] ,m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
12. The oligonucleotide of claim 1, wherein the oligonucleotide is RNAl {m(U)[n001R].m(G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].m(U)p.[moe]([m5C])p.[fl2r](A)[Ss p].[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](A)[Ssp].[fl2r](G) [Ssp] . [fl2r] (G) [Ssp] ,m(U) [Ssp] . [fl2r] (U) [Ssp] . [f!2 r] (U) [nOO 1 R] . [fl2r] (U) [Ssp] .m(C)p . [fl2 r] (C) [Ssp] ,d(T) [Ssp ].m([3nU])[Ssp].d(C)[n001R].m(A)p.[fl2r](C)[Ssp].m(U)[n001R].m(G)}$$$$V2.0 or a salt thereof.
13. An oligonucleotide capable of editing a target adenosine in a nucleic acid encoding a truncated CFTR polypeptide to produce a full-length CFTR polypeptide.
14. The oligonucleotide of claim 13, wherein: the nucleic acid encoding a truncated CFTR polypeptide encodes a W1282X mutation; the nucleic acid encoding a truncated CFTR polypeptide comprises a c.3846G>A mutation; the nucleic acid encoding a truncated CFTR polypeptide comprises rs77010898; and / or the truncated CFTR polypeptide comprises a W1282X mutation.
15. An oligonucleotide, wherein tire base sequence of the oligonucleotide comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 bases of a base sequence that is identical with or complementary to a base sequence of a CFTR gene or a transcript thereof, wherein the oligonucleotide comprises one or more modified sugars, one or more modified nucleobases, and / or one or more modified intemucleotidic linkages.
16. The oligonucleotide of any one of the preceding claims from claim 13, wherein the base sequence of the oligonucleotide comprises at least 10, 11, 12, 13, 14.
15. 16, 17, 18, 19, 20, 21, 22, 23.
24. 25, 26, 27, 28, 29, or 30 contiguous bases of UGGUAUCACUCCAAGGGCUUUCCTUCACUG, UGGUAUCACUCCAAAGGUUUUCCTUCACUG, GGUAUCACUCCAAAGGCUUUCCTUCACUGU, or GGUAUCACUCCAAGGGCUUUCCTUCACUG, wherein each T can be independently replaced with U and vice versa.
17. An oligonucleotide comprising 5’-NiNoN.i-3’, wherein Ni, No, and N.i are each independently a nucleoside and are linked by intemucleotidic linkages, wherein the oligonucleotide is capable of binding to a target nucleic acid with No opposite to a target adenosine; or an oligonucleotide comprising: a first domain; and a second domain, wherein: the first domain comprises one or more 2’-F modifications; the second domain comprises one or more sugars that do not have a 2’-F modification; or an oligonucleotide comprising a modified nucleobase, nucleoside, sugar or intemucleotidic linkage as described in the present disclosure; oran oligonucleotide comprising a second subdomain as described in the present disclosure; or an oligonucleotide comprising one or more modified sugars and / or one or more modified intemucleotidic linkages, wherein the oligonucleotide comprises a first domain and a second domain each independently comprising one or more nucleobases.
18. The oligonucleotide of any one of claims 13-17, wherein: when the oligonucleotide is contacted with a target nucleic acid comprising a target adenosine in a system, a target adenosine in the target nucleic acid is modified; when the oligonucleotide is contacted with a target nucleic acid comprising a target adenosine in a system, level of the target nucleic acid is reduced compared to absence of the product or presence of a reference oligonucleotide: when the oligonucleotide is contacted with a target nucleic acid comprising a target adenosine in a system, level of a product of the target nucleic acid is altered compared to absence of the product or presence of a reference oligonucleotide; level of a product is increased, wherein the product is or is encoded by a nucleic acid which is otherwise identical to the target nucleic acid but the target adenosine is modified; level of a product is increased, wherein the product is or is encoded by a nucleic acid which is otherwise identical to the target nucleic acid but the target adenosine is replaced with inosine; and / or level of a product is increased, wherein the product is or is encoded by a nucleic acid which is otherwise identical to the target nucleic acid but the adenine of the target adenosine is replaced with guanine.
19. The oligonucleotide of any one of the preceding claims from claim 13, wherein the target adenosine is c.3846G>A in a CFTR transcript.
20. The oligonucleotide of any one of the preceding claims from claim 13, wherein the oligonucleotide is capable of forming a double-stranded complex with the target nucleic acid.
21. The oligonucleotide of any one of the preceding claims from claim 13, wherein the oligonucleotide has a length of about 25-200 (e.g., about 25-30, 25-40, 25-50, 25-60, 25-70, 25-80, 25-90, 25-100, 25-120, 25-150, 25-200, 30-40, 30-50, 30-60, 30-70. 30-80, 30-90, 30-100, 30-120, 30-150, 30-200, 10, 20, 25, 26, 27, 28, 29.
30. 31, 32, 33, 34, 35, 36, 37, 38.
39. 40, 45, 50, 60, etc.) nucleobases.
22. The oligonucleotide of any one of the preceding claims from claim 13, wherein the oligonucleotide has a length of about 28-35 nucleobases.
23. The oligonucleotides of any one of the preceding claims from claim 13, wherein: among the first 3, 4, 5, 6, 7, 8, 9, 10 or more sugars from the 5’-cnd of the oligonucleotide, about one or no more than about 1. 2, or 3 sugars comprise a 2’-F modified sugar; the first 3. 4, 5, 6, 7. 8, 9, 10 or more sugars from the 5 ’-end of the oligonucleotide independently comprise a 2’-OR modification, wherein R is optionally substituted Ci-6 aliphatic; and / or the first 1, 2, 3 or more sugars from the 3’-end of the oligonucleotide independently comprise a 2’- OR modification, wherein R is optionally substituted Cue aliphatic; optionally wherein:each 2’-OR modification is independently a 2’-OMe or a 2’-M0E modification.
24. Tire oligonucleotide of any one of the preceding claims from claim 13, wherein the oligonucleotide does not contain a block of 2'-F modified sugars, wherein each sugar in the block is a 2’-F modified sugar and the number of 2 -F modified sugars in the block is about or more than about 4, 5, 6. 7, 8, 9, or 10.
25. The oligonucleotide of any one of the preceding claims from claim 13, wherein: the percentage of 2’-F modified sugars for all sugars at the 5’ side of No is about or no more than about 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%; the percentage of 2 ’-OR modified sugars for all sugars at the 5’ side of No is about or at least 20%, 30%, 40%, 50%, or 60%, wherein each R is optionally substituted Cns aliphatic; and / or the percentage of 2’-OMe modified sugars for all sugars at the 5’ side of No is about or at least about 20%, 30%, 40%, 50%, or 60%.
26. The oligonucleotide of any one of the preceding claims from claim 13, wherein the sugars of one or more of N19, Nis, N13, Nn, N7, and N3 (each N is independently a nucleoside and the numbering increases from No toward the 5 ’-end, and decrease from No toward tire 3 ’-end) are each independently a 2’-OR modified sugar, wherein R is optionally substituted C1-6 aliphatic.
27. The oligonucleotide of any one of the preceding claims from claim 13, wherein the sugars of one or more of N19, Nis, N13, Nn, N7, and N3 are each independently a 2’-OMe or 2’-MOE modified sugar.
28. The oligonucleotide of any one of the preceding claims from claim 13, wherein the sugar of each of N19, Nis, N13, Nn, N7, and N3 is independently a 2’-OR modified sugar, wherein R is optionally substituted C1-6 aliphatic.
29. The oligonucleotide of any one of the preceding claims from claim 13, wherein the sugar of each of N19. Nis, N13, Nn, N7, and N3 is independently a 2’-OMe or 2’-M0E modified sugar.
30. The oligonucleotide of any one of claims 26-29, wherein no more than 1, 2, 3, 4 or 5 of N19, Nis, N13, Nn, N7, and N3 have a 2’-M0E modified sugar.
31. The oligonucleotide of any one of claims 26-29, wherein no more than one of N19, Nis, N13, Nn, N7, and N3 has a 2 ’-MOE modified sugar.
32. The oligonucleotide of any one of claims 26-29. wherein no more than one of N19 to N3 has a 2’- MOE modified sugar.
33. The oligonucleotide of any one of claims 26-32, wherein the sugar of Nis is a 2’-M0E modified sugar.
34. The oligonucleotide of claim 33, wherein the nuclcobasc of Nis is 5-mcthylcytosinc.
35. The oligonucleotide of any one of claims 13-32. wherein the sugar of each of N19, Nis, N13, Nn, N7, and N3 is independently a 2’-OMe modified sugar.
36. The oligonucleotide of any one of the preceding claims from claim 13, wherein the sugars of one or more or all (e.g., 1-10, 1-5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, etc.) of N4, N5, N6, N8, N9, Nw, Nn, NI4, N15, Nis, and N17 are each independently a 2’-F modified sugar.
37. The oligonucleotide of any one of the preceding claims from claim 13, wherein one or more or all intemucleotidic linkages between N2 and Ns, N10 and Nn, and N17 and Nis are each independently a natural phosphate linkage.
38. The oligonucleotide of any one of the preceding claims from claim 13, wherein one or more or all (e.g., 1-3, 1-2, 1, 2, 3, 4, 5, etc.) intemucleotidic linkages between N4 and N5, Ne and N7, N10 and Nn, Nn and N12, and N15 and Nie are each independently a PN intemucleotidic linkage or a non-negatively charged intemucleotidic linkage.
39. Tire oligonucleotide of claim 38, wherein the PN intemucleotidic linkage is a phosphoramidate intemucleotidic linkage.
40. The oligonucleotide of claim 38, wherein the PN intemucleotidic linkage is a phosphoryl guanidine intemucleotidic linkage.
41. The oligonucleotide of claim 38, wherein the PN intemucleotidic linkage is MsPA.
42. Tire oligonucleotide of claim 38, wherein the PN intemucleotidic linkage is nOOl.
43. The oligonucleotide of claim 38, wherein the PN intemucleotidic linkage is Rp 11OOI.
44. The oligonucleotide of any one of clams 38-43, wherein the non-negatively charged intemucleotidic linkage is a methylphosphonate intemucleotidic linkage.
45. The oligonucleotide of any one of the preceding claims from claim 13, wherein the number of PS linkages between N2 and N20 is about 10-15.
46. Tire oligonucleotide of any one of the preceding claims from claim 13, wherein the number of PS linkages between N2 and N20 is about 11 or 12.
47. The oligonucleotide of any one of claims 45-46. wherein each PS intemucleotidic linkage is independently a phosphorothioate intemucleotidic linkage.
48. The oligonucleotide of any one of claims 45-46, wherein each PS intemucleotidic linkage is independently a .S'p phosphorothioate intemucleotidic linkage.
49. Tire oligonucleotide of any one of claims 45-46, wherein each PS intemucleotidic linkage is independently a Sp phosphorothioate intemucleotidic linkage.
50. The oligonucleotide of any one of the preceding claims from claim 13, wherein: the oligonucleotide consists of a first domain and a second domain; the first domain has a length of about 2-50 (e.g., about 5, 6, 7, 8, 9, or 10 - about 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc.) nuclcobascs; and / or the second domain has a length of about 2-50 (e.g., about 5, 6, 7, 8, 9, or 10 - about 10, 11, 12, 13,14, 15, 16.
17. 18, 19, 20, 21, 22, 23, 24, 25.
30. 40 or 50, or about 5, 6, 7. 8, 9, 10, 11, 12, 13.
14. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc.) nucleobases.
51. The oligonucleotide of any one of the preceding claims from claim 13, wherein the oligonucleotide comprises a targeting moiety that targets lung.
52. The oligonucleotide of any one of the preceding claims from claim 13, wherein the nucleobase of No is optionally substituted or protected U, C. or A, or is an optionally substituted or protected tautomer of U, C or A, or is optionally substitutedf formula BA-III-e:wherein:X1is -N(-)- or-C(-)=;WX2is 0, S or Se;RB4is halogen, -CN, -N02, or -LB4-RB41;RB41is R’;LB4is LB;RB5is halogen, -CN, -N02. or -LB5-RB51;RB51is -R’, -N(R’)2, -OR’, or -SR’;LB5is LB;WX6is 0, S, or Se; each LBis independently a covalent bond, or an optionally substituted bivalent CMO saturated or partially unsaturated chain having 0-6 heteroatoms, wherein one or more methylene unit is optionally and independently replaced with -Cy-, -O-, -S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(0)N(R')-, -N(R’)C(0)N(R’)- -N(R’)C(0)0- -S(0)- -S(0)2- -S(O)2N(R’)-, -C(O)S- or -C(0)0-; each -Cy- is independently an optionally substituted, 3-20 membered, monocyclic, bicyclic or polycyclic ring having 0-10 heteroatoms; each R’ is independently -R, -C(O)R, C(O)OR, -C(0)N(R)2, or -SO2R; and each R is independently -H, or an optionally substituted group selected from C1.20 aliphatic, Ci.2o heteroaliphatic having 1-10 heteroatoms, Ce-2o aryl, Ce-2o arylaliphatic. Ce-2o arylheteroaliphatic having 1-10 heteroatoms, 5-20 membered heteroaryl having 1-10 heteroatoms, and 3-20 membered heterocyclyl having 1-10 heteroatoms, or: two R groups are optionally and independently taken together to form a covalent bond, or: two or more R groups on the same atom are optionally and independently taken together with the atom to form an optionally substituted, 3-20 membered, monocyclic, bicyclic or polycyclic ring having, in addition to the atom, 0-10 heteroatoms; or: two or more R groups on two or more atoms are optionally and independently taken together withtheir intervening atoms to form an optionally substituted, 3-30 membered, monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-10 heteroatoms.
53. The oligonucleotide of any one of the preceding claims from claim 13, wherein the nucleobase of No54. The oligonucleotide of any one of the preceding claims from claim 13, wherein the nucleobase of No55. The oligonucleotide of any one ofthe preceding claims from claim 13, wherein the sugar of Nois a 2’-F modified sugar, a natural RNA sugar, or a natural DNA sugar.
56. Tire oligonucleotide of any one of claims 13-54, wherein the sugar of No is a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic.
57. The oligonucleotide of any one of claims 13-54. wherein the sugar of No is a 2'-OMe modified sugar.
58. The oligonucleotide of any one ofthe preceding claims from claim 13, wherein sugar of N2 is a 2’-b modified sugar.
59. The oligonucleotide of any one of claims 13-57, wherein sugar of No is a 2’-OR modified sugar, wherein R is optionally substituted Cue aliphatic.
60. The oligonucleotide of any one of claims 13-57. wherein sugar of N2 is a 2’-0Me modified sugar.
61. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between Ni and N2 is a phosphorothioate intemucleotidic linkage.
62. The oligonucleotide of any one ofthe preceding claims from claim 13, wherein the intemucleotidic linkage between Ni and N2is a .S'p phosphorothioate intemucleotidic linkage.
63. Tire oligonucleotide of any one of claims 13-60, w herein the intemucleotidic linkage betw een Ni and N2 is a .Sp phosphorothioate intemucleotidic linkage.
64. The oligonucleotide of any one of the preceding claims from claim 13, wherein the sugar of Ni is a natural DNA sugar.
65. The oligonucleotide of any one ofthe preceding claims from claim 13, wherein the intemucleotidic linkage between No and Ni is a phosphorothioate intemucleotidic linkage.
66. Tire oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between No and Ni is a Sp phosphorothioate intemucleotidic linkage.
67. The oligonucleotide of any one of the preceding claims from claim 13, wherein the sugar of N.i is a natural DNA sugar.
68. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidiclinkage between No and N.i is a phosphorothioate intemucleotidic linkage.
69. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between No and N.i is a Sp phosphorothioate intemucleotidic linkage.
70. The oligonucleotide of any one of the preceding claims from claim 13, wherein sugar of N.2is a 2’- OR modified sugar wherein R is optionally substituted Ci-6 aliphatic or a bicyclic sugar.
71. The oligonucleotide of any one ofthe preceding claims from claim 13, wherein sugar of N-2 is a 2’- OMe modified sugar.
72. Tire oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.i and N.2is a non-negatively charged intemucleotidic linkage.
73. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.i and N.2is a PN intemucleotidic linkage.
74. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.i and N_2is a phosphoramidate intemucleotidic linkage.
75. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.i and N.2is a phosphoryl guanidine intemucleotidic linkage.
76. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.i and N.2is nOOl .
77. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.i and N_2is 7?p nOOl .
78. The oligonucleotide of any one of claims 13-71. w herein the intemucleotidic linkage betw een N.i and N.2 is a methylphosphonate linkage.
79. The oligonucleotide of any one of claims 13-71. wherein the intemucleotidic linkage between N.i and N.2 is MsPA.
80. The oligonucleotide of any one ofthe preceding claims from claim 13, wherein sugar of N.s is a 2’-F modified sugar.
81. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.2and N.3is a natural phosphate linkage.
82. The oligonucleotide of any one of the preceding claims from claim 13, wherein sugar of N.4is a 2’- OR modified sugar wherein R is optionally substituted Ci.6aliphatic or a bicyclic sugar.
83. The oligonucleotide of any one ofthe preceding claims from claim 13, wherein sugar of N.4is a 2’- OMc modified sugar.
84. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.3and N.4is a phosphorothioate intemucleotidic linkage.
85. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N_3and N_4is a Sp phosphorothioate intemucleotidic linkage.
86. Tire oligonucleotide of any one ofthe preceding claims from claim 13, wherein sugar of N.s is a 2’-OR modified sugar wherein R is optionally substituted Ci-e aliphatic or a bicyclic sugar.
87. Tire oligonucleotide of any one of the preceding claims from claim 13, wherein sugar of N.s is a 2’- OMe modified sugar.
88. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.4 and N.s is a non-negatively charged intemucleotidic linkage.
89. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.4 and N.s is a PN intemucleotidic linkage.
90. Tire oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.4and N.5is a phosphoramidate intemucleotidic linkage.
91. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.4 and N.s is a phosphoryl guanidine intemucleotidic linkage.
92. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.4 and N.s is a nOOl intemucleotidic linkage.
93. The oligonucleotide of any one of the preceding claims from claim 13, wherein the intemucleotidic linkage between N.4 and N.s is a / ?p nOOl intemucleotidic linkage.
94. The oligonucleotide of any one of claims 13-87. wherein the intemucleotidic linkage between N.4 and N.s is a methylphosphonate intemucleotidic linkage.
95. The oligonucleotide of any one of claims 13-87, wherein the intemucleotidic linkage between N.4 and N.s is MsPA.
96. The oligonucleotide of any one of claims 13-87. w herein the intemucleotidic linkage betw een N.4 and N.s is a phosphorothioate intemucleotidic linkage.
97. The oligonucleotide of any one of claims 13-87. wherein the intemucleotidic linkage between N.4 and N.s is a Sp phosphorothioate intemucleotidic linkage.
98. The oligonucleotide of any one of claims 13-97, wherein N.s is the first nucleoside from the 3’-end.
99. Tire oligonucleotide of any one of claims 13-97, w herein sugar of N.g is a 2'-OR modified sugar wherein R is optionally substituted C1.6 aliphatic or a bicyclic sugar.
100. The oligonucleotide of any one of claims 13-97. wherein sugar of N.6is a 2’-OMc modified sugar.
101. The oligonucleotide of any one of claims 13-97 and 99-100, wherein the intemucleotidic linkage between N.5 and N_6is a non-negatively charged intemucleotidic linkage.
102. The oligonucleotide of any one of claims 13-97 and 99-100, wherein the intemucleotidic linkage between N.5 and N.g is a PN intemucleotidic linkage.
103. The oligonucleotide of any one of claims 13-97 and 99-100, wherein the intemucleotidic linkage between N.5 and N.6 is a phosphoramidate intemucleotidic linkage.
104. The oligonucleotide of any one of claims 13-97 and 99-100, wherein the intemucleotidic linkage between N.s and N.6 is a phosphoryl guanidine intemucleotidic linkage.
105. Tire oligonucleotide of any one of claims 13-97 and 99-100, wherein the intemucleotidic linkagebetween N.5 and N-e is a nOOl intemucleotidic linkage.
106. The oligonucleotide of any one of claims 13-97 and 99-100, wherein the intemucleotidic linkage between N.5 and N.6 is a / ?p nOOl intemucleotidic linkage.
107. The oligonucleotide of any one of claims 13-97 and 99-100, wherein the intemucleotidic linkage between N.s and N.e is a methylphosphonate intemucleotidic linkage.
108. The oligonucleotide of any one of claims 13-97, and 99-100 wherein the intemucleotidic linkage between N.5 and N-e is MsPA.
109. Tire oligonucleotide of any one of claims 13-97, and 99-108, wherein N-e is the first nucleoside from the 3' -end.
110. The oligonucleotide of any one of the preceding claims from claim 13, comprising 5’-NINON.IN.2N. 3-3’, wherein the sugar of N.i is anatural DNA sugar, the sugar ofN.2 is a 2’-OMe modified sugar, and the sugar of N-3 is a 2’-F modified sugar.
111. Tire oligonucleotide of any one of the preceding claims from claim 13, comprising 5’-NiNoN-iN-2N- 3-3’, wherein the intemucleotidic linkage between No and Ni is a Sp phosphorothioate intemucleotidic linkage, the intemucleotidic linkage between N.i and N-2 is 7?p nOOl, and the intemucleotidic linkage between N.2 and N.3 is anatural phosphate linkage.
112. The oligonucleotide of any one of the preceding claims from claim 13, wherein the number of nucleosides at the 3’ side of No is 5, 6 or more.
113. An oligonucleotide comprising a duplexing region and a targeting region, wherein a targeting region is or comprises a second region of any one of tire preceding claims, or 5’-NiNoN-i-3’ of any one of tire preceding claims.
114. The oligonucleotide of any one of the preceding claims from claim 13, wherein each intemucleotidic linkage is independently selected from a natural phosphate linkage, nOO l, MsPA, methylphosphonate intemucleotidic linkage and a phosphorothioate intemucleotidic linkage.
115. Tire oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is a pharmacally acceptable salt.
116. The oligonucleotide of any one of the preceding claims, wherein the diastereopurity of the oligonucleotide is about or at least about (DS)nc, wherein DS is about 85%- 100% (e.g., about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and nc is the number of chiral linkage phosphoms, and / or diastereomeric excess of each chiral linkage phosphorus centers is independently about or at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
117. A pharmaceutical composition comprising an oligonucleotide of any one of the preceding claims and a pharmacally acceptable carrier.
118. A chirally controlled oligonucleotide composition comprising an oligonucleotide of any one of the preceding claims.
119. Tire composition of any one of the preceding claims, wherein the oligonucleotide is apharmaceutically acceptable salt.
120. Tire composition of any one of the preceding claims, wherein tire diastereopurity of the oligonucleotide is about or at least about (DS)nc, wherein DS is about 85%- 100% (e.g., about 85%, 86%, 87%, 88%, 89%, 90%, 91%. 92%. 93%. 94%. 95%. 96%, 97%, 98%, 99% or 99.5% or more) and nc is the number of chiral linkage phosphorus, and / or diastereomeric excess of each chiral linkage phosphorus centers is independently about or at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
121. An oligonucleotide, wherein the oligonucleotide is otherwise identical to an oligonucleotide of any one of the preceding claims, except that at a position of a modified intemucleotidic linkage is a linkage having the structure of -O5-PL(RCA)-O3-, wherein:PLis P, or P(=W);W is O, S, or WN;RCAis or comprises an optionally substituted or capped chiral auxiliary moiety, O5is an oxygen bonded to a 5 ’-carbon of a sugar, and O’ is an oxygen bonded to a 3 ’-carbon of a sugar.
122. A method for preparing an oligonucleotide or composition of any one of the preceding claims, comprising coupling a -OH group of an oligonucleotide or a nucleoside with a phosphoramidite, and / or removing a chiral auxiliary moiety from an oligonucleotide.
123. A method, wherein the method is: a method for modifying a target adenosine in a target nucleic acid, comprising contacting the target nucleic acid with an oligonucleotide or composition of any one of the preceding claims; a method for deaminating a target adenosine in a target nucleic acid, comprising contacting the target nucleic acid with an oligonucleotide or composition of any one of the preceding claims; a method for producing, or restoring or increasing level of a product of a particular nucleic acid, comprising contacting a target nucleic acid with an oligonucleotide or composition of any one of the preceding claims, wherein the target nucleic acid comprises a target adenosine, and the particular nucleic acid differs from tire target nucleic acid in that the particular nucleic acid has an I or G instead of the target adenosine; or a method for reducing level of a product of a target nucleic acid, comprising contacting a target nucleic acid with an oligonucleotide or composition of any one of the preceding claims, wherein the target nucleic acid comprises a target adenosine.
124. A method for preventing a condition, disorder or disease, comprising administering or delivering to a subject susceptible thereto an effective amount of an oligonucleotide or composition of any one of the preceding claims.
125. A method for treating a condition, disorder or disease, comprising administering or delivering to a subject suffering therefrom an effective amount of an oligonucleotide or composition of any one of the preceding claims.
126. The method of any one of claims 124-125, wherein the condition, disorder or disease is a lung condition, disorder or disease.
127. The method of any one of claims 124-125, wherein the condition, disorder or disease is cystic fibrosis associated with the CFTR c.3846G>A mutation.
128. A method, wherein the method is: a method for modulating level of a nucleic acid in a system, comprising contacting the nucleic acid with an oligonucleotide or composition of any one of the preceding claims, wherein an adenosine in tire nucleic acid is edited; a method for modulating level of a nucleic acid in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims, wherein an adenosine in the nucleic acid is edited; a method for modifying a target adenosine in a target nucleic acid in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; a method for deaminating a target adenosine in a target nucleic acid in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims: a method for producing, or restoring or increasing level of a product of a particular nucleic acid in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims, wherein the target nucleic acid comprises a target adenosine, and the particular nucleic acid differs from the target nucleic acid in that the particular nucleic acid has an I or G instead of the target adenosine; a method for reducing level of a product of a target nucleic acid in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims, wherein the target nucleic acid comprises a target adenosine; a method for modulating level, structure, and / or activity of a nucleic acid and / or a product encoded thereby in a system, comprising contacting the nucleic acid with an oligonucleotide or composition of anyone of the preceding claims, wherein an adenosine in the nucleic acid is edited; a method for modulating level, structure, and / or activity of a nucleic acid and / or a product encoded thereby in a system, comprising administering or delivering to tire system an oligonucleotide or composition of any one of the preceding claims, wherein an adenosine in tire nucleic acid is edited; a method for modulating level of chloride conductance in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; a method for producing a nucleic acid comprising CAGUGIAGGAAAGCCCUUGGAGUGAUACCA in a system, comprising contacting the nucleic acid with an oligonucleotide or composition of any one of the preceding claims, wherein the system comprises orexpresses a nucleic acid comprising CAGUGAAGGAAAGCCCUUGGAGUGAUACCA; or a method for modulating level of chloride flux in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims.
129. The method of any one of the preceding claims from claim 123. comprising administering or delivering the oligonucleotide or composition via subcutaneous, intravenous or intratracheal administration.
130. An oligonucleotide or an oligonucleotide composition of any one of the preceding claims, for use in a method of any one of the preceding claims.
131. An oligonucleotide or an oligonucleotide composition of any one of the preceding claims, for manufacturing a medicament for a method of any one of the preceding claims.
132. Use of an oligonucleotide or an oligonucleotide composition of any one of the preceding claims, for a method of any one of the preceding claims.
133. Use of an oligonucleotide or an oligonucleotide composition of any one of the preceding claims, for manufacturing a medicament for a method of any one of the preceding claims.
134. A technology described in the specification, including an oligonucleotide, compound, phosphoramidite, composition, method, nucleic acid, or use of any one of Embodiments 1-1152.