In vitro production of expanded potential stem cells

Transient use of RAR agonist and NR5A2 in somatic cells generates EPSCs with enhanced pluripotency and stability, addressing integration issues in existing stem cell generation methods.

WO2026086823A1PCT designated stage Publication Date: 2026-04-30CENT FOR TRANSLATIONAL STEM CELL BIOLOGY LTD
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/129223
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-22
Filing Date
2025-10-22
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Current methods for generating human pluripotent stem cells, such as embryonic stem cells and induced pluripotent stem cells, face challenges in achieving a more pluripotent state without permanent integration of heterologous nucleic acids, leading to issues like X chromosome inactivation and epigenetic marker differences.

Method used

A method involving transient introduction and/or activation of a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) in somatic cells, optionally with reprogramming factors like Oct3/4, Sox2, Klf4, and Myc, to generate expanded potential stem cells (EPSCs) without integrating nucleic acids into the genome.

Benefits of technology

The method produces EPSCs with high expression of histone genes, low H3K27me3 levels, high proliferation rate, and expanded developmental potential, suitable for therapeutic and research applications, while maintaining genome stability and efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025129223_30042026_PF_FP_ABST
    Figure CN2025129223_30042026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein is a method making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) or preparing an expanded potential stem cell (EPSC), comprising transiently introducing into and / or activating in the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1). Compositions useful for such method are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

IN VITRO PRODUCTION OF EXPANDED POTENTIAL STEM CELLSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to US Application No. 63 / 710,478, filed October 22, 2024, the content of which is hereby expressly incorporated by reference in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (275162000940SEQLIST. xml; Size: 43,374 bytes; and Date of Creation: October 20, 2025) is herein incorporated by reference in its entirety.FIELD

[0003] The present invention relates to the in vitro conversion of somatic cells into expanded potential stem cells (EPSCs) , which have the ability to differentiate to cells of the embryo proper and extraembryonic tissues.BACKGROUND OF THE INVENTION

[0004] Human pluripotent stem cells (hPSCs) , including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) , hold significant potential for regenerative medicine. The current hPSCs are at different pluripotent states, with standard human ESCs and iPSCs considered to be at the primed state similar to post-implantation epiblast and with restricted potency for trophoblastic differentiation, whereas naive stem cells have molecular characteristics of preimplantation epiblast. The primed and hPSCs still have a number of issues that need to be addressed for wider applications in fundamental and translational research.

[0005] Recently, several researchers have reported conditions for inducing a more pluripotent state in conventional human embryonic stem cells, for example, by culturing in a cocktail of inhibitors (summarised in Theunissen et al 2014) . However, although cells produced by these methods display some characteristics which are comparable to cells, there are also significant differences. For example, Theunissen et al 2014, who use a six inhibitor+LIF+activin (6i / L / A) cocktail to reset pluripotent stem cells to a more state still report X chromosome inactivation. This is in contrast to the cell state where both X chromosomes are active. Takashima et al 2014 also report differences in epigenetic markers in 6i / L / A-cultured cells, and instead propose that a more or ground state may be instated in human pluripotent stem cells following short term expression of NANOG and KLF2 transgenes.

[0006] Human EPSCs (hEPSCs) possess enhanced trophoblast differentiation potency compared to primed stem cells and can generate bona fide human trophoblast stem cells (hTSCs) . The hEPSCs form teratomas with embryonic and extraembryonic cell lineages and readily differentiate into hTSCs in vitro. Human EPSCs (hEPSC) lines have also been demonstrated to differentiate into embryonic lineages such as pancreatic and primordial germ cell-like cells (Gao, X., et al, 2019; Chen, A. et al., 2023) . hEPSCs could form 3D human embryonic organoids recapitulating hematopoiesis in vitro (Chao, Y. et al., Organoid-based single-cell spatiotemporal gene expression landscape of human embryonic development and hematopoiesis. Signal Transduct Target Ther 8, 230, (2023) ; Cao, H. et al., PD-L1 regulates inflammatory programs of macrophages from human pluripotent stem cells. Life Sci Alliance 7, (2024) ) .

[0007] At the molecular level, hEPSCs have unique features, such as high expression of certain histone genes and low H3K27me3 levels that are similar to those in 8-cell / morula stage embryos. Another important feature of hEPSCs is that they express high levels of certain core histone genes, the same genes that are also highly expressed in human 8C-morula embryos (Gao, X., et al, Establishment of porcine and human expanded potential stem cells. Nat Cell Biol 21, 687-699, doi: 10.1038 / s41556-019-0333-2 (2019) ) .

[0008] EPSCs can be valuable for studying early embryonic cell plasticity, for exploring distinct pluripotent states which may be conserved across multiple mammalian species and are thus easier to be captured or maintained in vitro, and for expanding the utility of stem cells in therapies. Furthermore, EPSCs can be useful in research and R&D as well as medicine and agriculture (for example reproduction and cloning of non-human animals) . There exists a need for methods of generating EPSCs with high efficiency without permanently integrating heterologous nucleic acids into the precursor cell.

[0009] The disclosures of all publications, patents, patent applications and published patent applications referred to herein are hereby incorporated herein by reference in their entirety. BRIEF SUMMARY OF THE INVENTION

[0010] The present application in one aspect provides a method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising transiently introducing into and / or activating in the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) .

[0011] The present application in one aspect provides a method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into and / or activating in a somatic cell a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) .

[0012] In some embodiments, the method comprises transiently introducing into the somatic cell an RAR agonist and NR5A2.

[0013] In some embodiments, the method comprises directly introducing the RAR agonist and / or NR5A2 into the somatic cell.

[0014] In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the RAR agonist and / or NR5A2.

[0015] In some embodiments, the method comprises introducing into the somatic cell an agent that activates the RAR agonist and / or NR5A2 in the somatic cell.

[0016] In some embodiments according to any of the embodiments described above, the method further comprises introducing into and / or activating in the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, and Myc.

[0017] In some embodiments, the method comprises directly introducing the one or more reprogramming factors into the somatic cell.

[0018] In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the one or more reprogramming factors.

[0019] In some embodiments, the method comprises introducing into the somatic cell an agent that activates the one or more reprogramming factors.

[0020] In some embodiments, the method comprises introducing nucleic acids encoding the RAR agonist, NR5A2, and optionally the one or more reprogramming factors into the somatic cell. In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are under the control of a promoter. In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2are under the control of different promoters. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are under the control of a promoter. In some embodiments, the nucleic acids encoding one or more reprogramming factors are under the control of different promoters.

[0021] In some embodiments according to any of the embodiments described above, the RAR agonist is RARA, RARB, or RARG. In some embodiments, the RAR agonist is RARG.

[0022] In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, Myc is c-Myc.

[0023] In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are not integrated into the genome of the somatic cell. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are not integrated into the genome of the somatic cell.

[0024] In some embodiments, one or more of the nucleic acids encoding the RAR agonist and NR5A2 and the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via a plasmid and / or a virus. In some embodiments, one or more of the nucleic acids encoding the RAR agonist and NR5A2 and the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via an episomal plasmid. In some embodiments, one or more of the nucleic acids encoding the RAR agonist and NR5A2 and the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via a Sendai virus. In some embodiments, the method comprises electroporating a mixture comprising the somatic cell and the episomal plasmid. In some embodiments, the somatic cell is transfected with Sendai virus at MOI of 1 to 20.

[0025] In some embodiments according to any of the embodiments described above, activating the retinoic acid receptor (RAR) agonist comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: CD1530, MM11253, Palovarotene, CD437, CD2665, CD271, and BMS-209641.

[0026] In some embodiments according to any of the embodiments described above, activating NR5A2 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: RJW100, RR-RJW100, SS-RJW100, Iso-RJW100, and ML-180.

[0027] In some embodiments, activating Oct3 / 4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: Oct4 inducer-1 (compound OAC-3) , OAC2, OAC1, Oct4 inducer-2, O4I2, and O4I4.

[0028] In some embodiments, activating Klf4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: APTO-253 (LOR-253) and DAPM.

[0029] In some embodiments according to any of the embodiments described above, the somatic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the mammalian cell is a cell from a non-human species selected from the group consisting of: a mouse, a rat, a sheep, a pig, a cow, and a primate.

[0030] In some embodiments according to any of the embodiments described above, the somatic cell is a fibroblast.

[0031] In some embodiments according to any of the embodiments described above, the somatic cell is a urinary epithelial cell.

[0032] In some embodiments according to any of the embodiments described above, the somatic cell is a blood cell. In some embodiments, the blood cell is a hematopoietic cell or erythroblast. In some embodiments, the somatic cell is from a blood sample. In some embodiments, the blood sample has a volume of about 1 μL to about 10 mL.

[0033] In some embodiments according to any of the embodiments described above, the somatic cell is neural stem cell (NSC) .

[0034] In some embodiments according to any of the embodiments described above, the method further comprises culturing the somatic cell in a first medium for about 24 hours to about 72 hours after the RAR agonist and NR5A2 are transiently introduced or activated. In some embodiments, the first medium is M10 medium.

[0035] In some embodiments, the method further comprises culturing the somatic cell in a second medium for about 7 days to 21 days after culturing the somatic cell in the first medium. In some embodiments, the second medium is M15 medium supplemented with human LIF and vitamin C.

[0036] In some embodiments, the method further comprises culturing the somatic cell in a third medium after culturing the somatic cell in the second medium. In some embodiments, the third medium is expanded potential stem cell culture medium (EPSCM) . In some embodiments, the EPSCM comprises a basal cell nutrient medium supplemented with inhibitors consisting of a Src family Kinase (SFK) inhibitor, a GSK3 inhibitor and a tankyrase inhibitor. In some embodiments, the EPSCM further comprises one or more of a RAS-ERK inhibitor, a p38 inhibitor and a JNK inhibitor.

[0037] In some embodiments according to any of the embodiments described above, the EPSCs are free of the RAR agonist, NR5A2, and optionally the one or more reprogramming factors after no more than 5 passages. In some embodiments according to any of the embodiments described above, the EPSCs are stable for at least 10 passages.

[0038] In another aspect, provided herein is a method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell nucleic acids encoding reprogramming factors comprising: RARG, NR5A2, Oct3 / 4, Sox2, Klf4, and c-Myc to generate the EPSC. In some embodiments, the nucleic acids encoding Oct3 / 4, Sox2, Klf4, and c-Myc are transiently introduced into the somatic cell via a Sendai virus. In some embodiments, the nucleic acids encoding RARG and NR5A2 are transiently introduced into the precursor cell via an episomal plasmid.

[0039] In another aspect, provided herein is an episomal plasmid comprising one or more nucleic acid sequences, wherein the one or more nucleic acid sequences encode Oct3 / 4, Sox2, Klf4, Myc, an RAR agonist, and / or NR5A2.

[0040] In another aspect, provided herein is an expanded potential stem cell (EPSC) produced by the method of any one of the embodiments described above. In some embodiments, the EPSC has one or more characteristics selected from the group consisting of: i) high expression levels of one or more histone genes selected from the group consisting of HIST1H1C, HIST1H2AC, HIST1H2BD, and HIST1H2BJ; ii) low expression level of H3K27me3; iii) high proliferation rate; iv) high precision genome editing capability; v) expression of pluripotency markers; vi) high genome stability; and vii) expanded developmental potential to derive trophoblast lineage cells. In some embodiments, the EPSC further comprises one or more modifications to the genome.

[0041] In another aspect, provided herein is a composition comprising one or more EPSCs of any one of the embodiments described above and / or cells differentiated therefrom.

[0042] In another aspect, provided herein is a method of treating an individual in need thereof, comprising administering an effective amount of the composition of any one of the embodiments described above to the individual. In some embodiments, the method of treating further comprises obtaining a somatic cell from the individual. In some embodiments, the somatic cell is a fibroblast. In some embodiments, the somatic cell is a urinary epithelial cell. In some embodiments, the somatic cell is a blood cell. In some embodiments, the blood cell is a hematopoietic cell or erythroblast.

[0043] In some embodiments according to any of the embodiments about method of treating described above, the EPSC is genetically modified.

[0044] In some embodiments according to any of the embodiments about method of treating described above, the method further comprises differentiating the EPSC to obtain a skin cell, a blood cell, a neural cell, an immune cell, a liver cell, a lung cell, a pancreatic cell, or a muscle cell.BRIEF DESCRIPTION OF THE DRAWINGS

[0045] FIGs. 1A-1K show establishment of human induced Expanded Potential Stem Cells (hiEPSCs) from human dermal fibroblasts (HDF) . FIG. 1A shows construction of hRL-eGFP overexpression episomal plasmid. FIG. 1B is a schematic diagram showing the procedures of HDF reprogramming into hiEPSCs. FIG. 1C shows representative images of bright field and eGFP fluorescence of electroporated HDFs. Scale bar: 100 um. FIG. 1D shows flow cytometry results of eGFP and hRL-eGFP expression for electroporated HDFs. FIG. 1E shows representative images of bright field and eGFP fluorescence of reprogramming HDFs. Scale bar: 100 um. FIG. 1F shows representative bright field images of primary single colonies formed by reprogramming HDFs. Scale bar: 500 um. FIG. 1G shows quantification of colony numbers formed by reprogramming HDFs in different replicates (top) and a summary of hiEPSC establishment efficiencies (bottom) . FIG. 1H shows representative images of bright field but no green fluorescence of primary colonies. Scale bar: 100 um. FIG. 1I shows representative images of bright field of primary colonies with the selection of picking based on colony size. Scale bar: 500 um.FIG. 1J shows primer design for assessing hRL expression (top) and RT-PCR results of hRL and SeV detection in primary colonies (bottom) . FIG. 1K shows a schematic diagram showing the procedures of colony picking, sub-colony and exogenous hRL and SeV detection (top) , and RT-PCR results of hRL and SeV expression levels in hEPSC lines at passage 5 (bottom) . HDFs on reprogramming day 8 cells were used as control.

[0046] FIGs. 2A-2G show the characterization of hiEPSCs. FIG. 2A shows representative bright field images of hiEPSCs. Scale bar: 500 um. FIG. 2B shows flow cytometric results of cell cycle analysis for hiEPSCs. FIG. 2C shows RT-qPCR analysis of pluripotency, somatic lineage and extra-embryonic lineage marker expressions for hiEPSCs. FIG. 2D shows flow cytometry results of pluripotency marker expression for hiEPSCs. FIG. 2E shows representative immunofluorescence staining of pluripotency marker expressions for hiEPSCs. The nuclei were stained with DAPI. Scale bar: 25 um. FIG. 2F shows representative immunofluorescence staining of H3K27me3 and OCT4 for hiEPSCs and primed stem cells. The nuclei were stained with DAPI. Scale bar: 20 um. FIG. 2G shows RT-qPCR analysis of histone gene expression levels among hEPSCs. Data are mean ± s. d. n=3 biological replicates. Student’s t-test, *P < 0.05; **P < 0.01; **P < 0.001, primed stem cells relative to hEPSC-em4.

[0047] FIGs. 3A-3F show karyotyping and expanded potential assessment of hiEPSCs. FIG. 3A shows representative karyotyping results of hiEPSCs. FIG. 3B shows representative H&E staining images of mesoderm, ectoderm, and endoderm lineages in teratoma sections derived from hiEPSCs. Scale bar: 100 um. FIG. 3C shows representative immunofluorescence staining of trophoblast markers on teratoma sections derived from hiEPSCs. The nuclei were stained with DAPI. Scale bar: 100 um. FIG. 3D shows representative bright field images of hiEPSCs differentiating in hTSCM. Scale bar: 100 um. FIG. 3E shows RT-qPCR analysis of trophoblast gene TP63, TEAD4, GATA3 and CDX2 expression levels among hEPSCs. Data are mean ± s. d. n=3 biological replicates. FIG. 3F shows representative bright field images of hTSC-C3 and hTSC-C11 (left) , and representative immunofluorescence staining of KRT7 and GATA2 in hTSC-C3 and hTSC-C11 (right) . The nuclei were stained with DAPI. Scale bar: 100 um.DETAILED DESCRIPTION OF THE INVENTION

[0048] The present application provides a novel method of generating EPSCs by reprogramming somatic cells with a novel combination of agents, namely, a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) , optionally along with reprogramming factors. The human EPSC (hEPSC) cell lines produced by methods disclosed herein proliferate robustly over long-term passaging and are amenable to both simple indels and precision genome editing at up to 100%efficiency. Additionally, methods disclosed herein do not involve integrating heterologous nucleic acids into the genome of the precursor cell, thus making the hEPSCs safer for applications such as clinical uses.

[0049] In one aspect, the present disclosure relates to a method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising transiently introducing into and / or activating in the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) .

[0050] In another aspect, the present disclosure relates to a method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into and / or activating in a somatic cell a retinoic acid receptor (RAR) agonist and NR5A2.

[0051] In another aspect, the present disclosure relates to a episomal plasmid comprising one or more nucleic acid sequences, wherein the one or more nucleic acid sequences encode Oct3 / 4, Sox2, Klf4, Myc, an RAR agonist, and / or NR5A2.

[0052] In another aspect, the present disclosure relates to an expanded potential stem cell (EPSC) produced by the methods disclosed herein.

[0053] In another aspect, the present disclosure relates to a composition comprising one or more EPSCs disclosed herein and / or cells differentiated therefrom.

[0054] In yet another aspect, the present disclosure relates to a method of treating an individual in need thereof, comprising administering an effective amount of the composition disclosed herein to the individual.

[0055] In some embodiments, the invention described herein comprises transiently introducing into signaling molecules and / or activating signaling pathways including RAR agonist, NR5A2, Oct3 / 4, Sox2, Klf4, Myc, and / or Nanog, in a somatic cell. By transiently introducing the signaling molecules or activating the signaling pathways, the somatic cell is reprogrammed to EPSC or made more susceptible to reprogramming to EPSC without integrating any heterologous nucleic acids encoding the signaling molecules into the genome. The present invention can be used to efficiently generate EPSCs that show advantages such as stable long-term proliferation and high precision genome editing capability.

[0056] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0057] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. I. Definitions

[0058] A number of terms and concepts are discussed below. They are intended to facilitate the understanding of various embodiments of the invention in conjunction with the rest of the present disclosure and the accompanying figures. These terms and concepts may be further clarified and understood based on the accepted conventions in the fields of the present invention and the description provided throughout the present disclosure and / or the accompanying figures. Some other terms can be explicitly or implicitly defined in other sections of this disclosure and in the accompanying figures and may be used and understood based on the accepted conventions in the fields of the present invention, the description provided throughout the present disclosure and / or the accompanying figures. The terms not explicitly defined can also be defined and understood based on the accepted conventions in the fields of the present invention and interpreted in the context of the present disclosure and / or the accompanying figures.

[0059] As used herein, the terms “a, ” “an, ” and “the” can refer to “one, ” “one or more” or “at least one, ” unless specifically noted otherwise.

[0060] The terms “about” or “approximately” are used herein to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or simply error-tolerance of a value. For example, the terms “about” or “approximately” may mean±1%, ±5%, ±10%, ±15%or ±20%variation from a predetermined value.

[0061] As used herein, the terms “isolate, ” “separate” or “purify” and the related terms are not used necessarily to refer to the removal of all materials other than the components of interest from a sample. Instead, in some embodiments, the terms are used to refer to a procedure that enriches the amount of one or more components of interest relative to one or more other components present in the sample. In some embodiments, “isolation, ” “separation” or “purification” may be used to remove or decrease the amount of one or more components from a sample. For example, the expression “an isolated cell” can refer to a cell that has been substantially separated or purified away from other cells of a cell culture or an organism.

[0062] The term “derived” and the related expressions referring to cells or a biological sample indicate that the cell or sample was obtained from the stated source at some point in time. For example, a cell derived from an organism can represent a primary cell obtained directly from the individual (that is, unmodified) , or it can be modified, for example, by introduction of a recombinant vector, by exposure to or culturing under particular conditions, or immortalization. In some cases, a cell derived from a given source will undergo cell division and / or differentiation such that the original cell no longer exists, but the continuing cells will be understood to derive from the same source. The term “derive, ” “derivation” and the related terms and expressions can also be used in this disclosure to refer to creation of a cell population, cell, or culture from a different starting or preceding cell population, cell, or culture. For example, a trophoblast stem cell (TSC) described in the present disclosure can be described as being derived from Expanded Potential Stem Cells (EPSCs) .

[0063] The term “comprising” and the related terms ( “comprise, ” “comprises, ” etc. ) , when used in this disclosure to describe various embodiments of the invention, are open-ended, meaning that they do not exclude additional elements and synonymous with terms “including, ” “containing” or “having. ” When an embodiment of the invention is described using the term “comprising, ” it is intended to include the embodiments, in which the term comprising is replaced with the terms “consisting of” or “consisting essentially of. ” In other words, the description of the embodiments of the invention described in this disclosure using the term “comprising” and the related terms also provides the description of the related embodiments that use “consisting of” or “consisting essentially of” instead of “comprising” . The term “consisting of” excludes any elements (steps, ingredient etc. ) not specified in the description. The term “consisting essentially of” is intended to exclude only those elements not specified in the description that do not materially affect the basic and novel characteristics of the embodiment.

[0064] The term “lineage, ” when used in reference to cells, encompasses all of the stages of the development of a cell type, from the earliest precursor cell to a completely mature cell (aspecialized cell) .

[0065] The term “trophoblast” and related terms refer to all the cells of the trophoblast lineage, which includes a group of the extraembryonic lineages (cytotrophoblast, syncytiotrophoblast, intermediate trophoblast) , and hence does not contribute directly to the cells of the fetal body. The extraembryonic lineages consist of chorion (the combination of trophoblast plus underlying extraembryonic mesoderm) , amnion, yolk sac, and allantois. In some contexts, the term “trophoblast” is also used to encompass trophectoderm.

[0066] The term “trophoblast stem cell” and related terms refer to a cell of a subpopulation of trophoblast cells with stem cell properties and the ability to differentiate into either syncytiotrophoblast cells by fusion or extravillous trophoblast cells.

[0067] “Differentiation” is the process by which a less specialized cell becomes a more specialized cell type. For example, early development of a multicellular animal is characterized by the rapid proliferation of embryonic cells, which then differentiate to produce the many specialized types of cells that make up the tissues and organs of the multicellular animal. As cells differentiate, their rate of proliferation usually decreases. Some types of differentiated cells never divide again, but many differentiated cells are able to resume proliferation as required to replace cells that have been lost as a result of injury or cell death. Some cells divide continuously throughout life to replace cells that have a high rate of turnover in adult multicellular animals. Examples of differentiated cells are fibroblasts, hepatocytes, cardiomyocytes, myoblasts, neurons, osteoclasts, and lymphocytes.

[0068] The expression “modified cells” and the related terms and expressions encompass all cells that have been or are derived from the cells that have been artificially modified, by any methods, as compared to the original or cells from which they are derived. Modified cells can be produced from primary cells, secondary cells, stem cells, cultured cells and / or other modified cells. Modifications include, but are not limited to, genetic modification or engineering, in which case modified cells can be referred to as “genetically modified” or “genetically engineered. ” Genetic modification can be accomplished by various methods that result in incorporation of foreign or heterologous nucleic acids into the cells being modified. Some examples of such methods are transduction by a virus or a viral vector, or transfection of isolated nucleic acids into cells through transient pores in the cell membrane. Other modifications include exposing the source cells to biological and non-biological molecules or factors or culture conditions. Some examples of modified cells are genetically modified cells, including those used for gene therapies, one example being gene-edited cells, such as those modified using CRISPR / Cas9, TALENs or ZFNs.

[0069] The term “passage, ” “passaging” and the related terms and expressions used in the context of cell culture refer to subculturing, which typically involves transfer of cells from a previous culture into a fresh growth medium. Passaging is performed to ensure propagation of cells in culture. Cell proliferation in culture reduced or ceases when the cells reduce the capacity of the culture vessels and / or media to support further cell growth. For example, cells in adherent cultures may occupy all the available substrate and have no room left for expansion, while cells in suspension cultures exceed the capacity of the medium to support further growth. To keep cells in a culture at an optimal density for continued growth and to stimulate further proliferation, the culture must be expanded and fresh medium supplied. To divide the culture of adherent cells, for example, a monolayer culture of cells, such as cultures of differentiating EPSCs described on the present disclosure, the cells are first dissociated, for example, by enzymatic dissociation. Enzymatic dissociation can be performed by removing the incubation medium from the plates, adding to the plates a buffer, such as PBS and an enzymatic dissociation reagent, such as Accutase, TrypLE or Trypsin (available, for example, from Thermo Fisher Scientific) , incubating the cells with the buffer and dissociation reagent under appropriate conditions, and harvesting the resulting dissociated cells by centrifugation, sedimentation, filtering or other appropriate methods. The dissociated cells are transferred into similar or equivalent reaction vessels, such as flasks, with fresh media, to result in a lower cell density.

[0070] As used herein, “marker” refers to any molecule that can be observed or detected. For example, a marker can include, but is not limited to, a nucleic acid, such as a transcript of a specific gene, a polypeptide product of a gene, a non-gene product polypeptide, a glycoprotein, a carbohydrate, a glycolipid, a lipid, a lipoprotein or a small molecule (for example, molecules having a molecular weight of less than 10,000 AMU) . When a presence, absence of amount of a marker can be experimentally observed or detected, such a marker or its amount can be described as “observable” or “detectable. ” The presence or absence of the markers, as applied to the embodiments of the preset invention, means detectable presence or absence of the markers as detected by applicable methods for detecting such markers, and may mean certain detectable or undetectable levels of such markers. In other words, the presence may mean the presence above a certain detectable level, while the absence may mean the absence below a certain detectable level and not necessarily zero detectable level. For most markers described herein, the symbols provided are those developed and / or recognized by HUGO Gene Nomenclature Committee of European Bioinformatics Institute.

[0071] In the context of observable or detectable markers, such as markers of cell development or differentiation, “expression” refers to the production of a gene product (which can be a nucleic acid, such as RNA, or a protein) as well as the level or amount of production of a gene product. Thus, determining the expression of a specific marker refers to detecting either the relative or absolute amount of the marker (which can mean detecting expression of RNA or protein) that is expressed or simply detecting (which can mean detecting expression of RNA or protein) the presence or absence of the marker. If expression of RNA or protein corresponding to the marker is detected, the marker can be said to be “detectably expressed. ” Expression of certain markers can be determined by detecting the presence or absence of the marker in cells, cell culture or cell population. Expression of certain markers can also be determined by measuring the level at which the marker is present in cells, cell culture or cell population. Quantitative, qualitative or semi-quantitative techniques can be used to measure marker expression. For example, marker expression can be detected and / or quantitated through the use of techniques detecting nucleic acids, such as PCR-based detection or RNA (for example, real-time reverse-transcriptase PCR) , RNA sequencing (RNA-seq) , or RNA detection by nucleic acid array-based techniques. In another example, immunochemistry can be used to detect and / or quantitate marker proteins. For example, the expression of a marker gene product can be detected by using antibodies specific for the marker gene product of interest using Western blotting, immunofluorescence, flow cytometry analysis, etc. Various techniques of marker detection can be used in in conjunction to effectively and accurately characterize and identify cell types and determine both the amount and relative proportions of such markers in a subject cell type. The expression of certain markers can be determined by measuring the level at which the marker is present in the cells of the cell culture or cell population as compared to a standardized or normalized control marker. Identification and characterization of cells, cell cultures or cell population can be based on expression of a certain marker or different expression levels and patterns of more than one marker (including the presence or absence, the high or low expression, of one or more the markers) . Also, certain markers can have transient expression, when the marker exhibits higher expression during one or more stages of the processes described in this disclosure and lower expression during other stage or stages. II. Method of Preparing Expanded Potential Stem Cells (EPSCs)

[0072] In one aspect, there is provided a method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the RAR agonist and / or NR5A2. In some embodiments, the RAR agonist is RARA, RARB, or RARG. In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are not integrated into the genome of the somatic cell. In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are transiently introduced into the somatic cell via a plasmid and / or a virus. In some embodiments, the EPSCs are free of the RAR agonist and NR5A2 after no more than 5 passages.

[0073] In some embodiments, the method further comprises introducing into the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the one or more reprogramming factors. In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are not integrated into the genome of the somatic cell. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via a plasmid and / or a virus. In some embodiments, the EPSCs are free of the reprogramming factors after no more than 5 passages.

[0074] In some embodiments, there is provided a method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2, and further comprising activating in the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the method comprises introducing into the somatic cell an agent that activates the one or more reprogramming factors. In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, activating Oct3 / 4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: Oct4 inducer-1 (compound OAC-3) , OAC2, OAC1, Oct4 inducer-2, O4I2, and O4I4. In some embodiments, activating Klf4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: APTO-253 (LOR-253) , APTO-253, and DAPM. In some embodiments, the EPSCs are free of the reprogramming factors after no more than 5 passages.

[0075] In some embodiments, there is provided a method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising activating in the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2. In some embodiments, the method comprises introducing into the somatic cell an agent that activates the RAR agonist and / or NR5A2. In some embodiments, the RAR agonist is RARA, RARB, or RARG. In some embodiments, activating the retinoic acid receptor (RAR) agonist comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: CD1530, MM11253, Palovarotene, CD437, CD2665, CD271, BMS-209641. In some embodiments, activating NR5A2 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: RJW100, RR-RJW100, SS-RJW100, Iso-RJW100, ML-180. In some embodiments, the EPSCs are free of the RAR agonist and NR5A2 after no more than 5 passages.

[0076] In some embodiments, the method further comprises introducing into the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the one or more reprogramming factors. In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are not integrated into the genome of the somatic cell. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via a plasmid and / or a virus. In some embodiments, the EPSCs are free of the reprogramming factors after no more than 5 passages.

[0077] In some embodiments, there is provided a method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising activating in the somatic cell a retinoic acid receptor (RAR) agonist andNR5A2 the method further comprising activating in the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the method comprises introducing into the somatic cell an agent that activates the one or more reprogramming factors. In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. NR5A2In some embodiments, activating Oct3 / 4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: Oct4 inducer-1 (compound OAC-3) , OAC2, OAC1, Oct4 inducer-2, O4I2, and O4I4. In some embodiments, activating Klf4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: APTO-253 (LOR-253) , APTO-253, and DAPM. In some embodiments, the EPSCs are free of the reprogramming factors after no more than 5 passages.

[0078] In some embodiments, there is provided a method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the RAR agonist and / or NR5A2. In some embodiments, the RAR agonist is RARA, RARB, or RARG. In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are not integrated into the genome of the somatic cell. In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are transiently introduced into the somatic cell via a plasmid and / or a virus. In some embodiments, the EPSCs are free of the RAR agonist and NR5A2 after no more than 5 passages.

[0079] In some embodiments, the method further comprises introducing into the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the one or more reprogramming factors. In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are not integrated into the genome of the somatic cell. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via a plasmid and / or a virus. In some embodiments, the EPSCs are free of the reprogramming factors after no more than 5 passages.

[0080] In some embodiments, there is provided a method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2, further comprising activating in the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the method comprises introducing into the somatic cell an agent that activates the one or more reprogramming factors. In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, activating Oct3 / 4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: Oct4 inducer-1 (compound OAC-3) , OAC2, OAC1, Oct4 inducer-2, O4I2, and O4I4. In some embodiments, activating Klf4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of:APTO-253 (LOR-253) , APTO-253, and DAPM. In some embodiments, the EPSCs are free of the reprogramming factors after no more than 5 passages.

[0081] In some embodiments, there is provided a method of preparing an expanded potential stem cell (EPSC) , comprising activating in the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2. In some embodiments, the method comprises introducing into the somatic cell an agent that activates the RAR agonist and / or NR5A2. In some embodiments, the RAR agonist is RARA, RARB, or RARG. In some embodiments, activating the retinoic acid receptor (RAR) agonist comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: CD1530, MM11253, Palovarotene, CD437, CD2665, CD271, BMS-209641. In some embodiments, activating NR5A2 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: RJW100, RR-RJW100, SS-RJW100, Iso-RJW100, ML-180. In some embodiments, the EPSCs are free of the RAR agonist and NR5A2 after no more than 5 passages.

[0082] In some embodiments, the method further comprises introducing into the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the one or more reprogramming factors. In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are not integrated into the genome of the somatic cell. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via a plasmid and / or a virus. In some embodiments, the EPSCs are free of the reprogramming factors after no more than 5 passages.

[0083] In some embodiments, there is provided a method of preparing an expanded potential stem cell (EPSC) , comprising activating in the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2, and further comprising activating in the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the method comprises introducing into the somatic cell an agent that activates the one or more reprogramming factors. In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, activating Oct3 / 4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: Oct4 inducer-1 (compound OAC-3) , OAC2, OAC1, Oct4 inducer-2, O4I2, and O4I4. In some embodiments, activating Klf4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: APTO-253 (LOR-253) , APTO-253, and DAPM. In some embodiments, the EPSCs are free of the reprogramming factors after no more than 5 passages. 1. Transient introduction of signaling molecules

[0084] In some embodiments, the method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) or the method of preparing an expanded potential stem cell (EPSC) comprises transiently introducing into the somatic cell signaling molecules such as an RAR agonist and / or NR5A2. In some embodiments, the methods comprise directly introducing the RAR agonist and / or NR5A2 into the somatic cell. In some embodiments, the methods comprise introducing into the somatic cell a nucleic acid encoding the RAR agonist and / or NR5A2.

[0085] In some embodiments, the RAR agonist is RARA (RARα) , RARB (RARβ) , or RARG (RARγ) . Retinoic acid (RA) signaling is involved in embryonic development, growth and reproduction. RAs regulate target gene expression by binding the retinoic acid receptor (RAR) and the retinoic X receptor (RXR) . There are three known subtypes of the RA receptor subfamily, namely retinoic acid receptor alpha (RARα) , retinoic acid receptor beta (RARβ) , and retinoic acid receptor gamma (RARγ) . Retinoic acid receptor alpha (RARα) , also known as NR1B1 (nuclear receptor subfamily 1, group B, member 1) , is a nuclear receptor that in humans is encoded by the RARA gene. Retinoic acid receptor beta (RARβ) , also known as NR1B2 (nuclear receptor subfamily 1, group B, member 2) is a nuclear receptor that in humans is encoded by the RARB gene. Retinoic acid receptor gamma (RARγ) , also known as NR1B3 (nuclear receptor subfamily 1, group B, member 3) is a nuclear receptor encoded by the RARG gene. Once retinoic acid binds to the RAR, the heterodimer initiates transcription and allows for its target genes to be expressed.

[0086] In some embodiments, the method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) or the method of preparing an expanded potential stem cell (EPSC) comprises transiently introducing into the somatic cell two or more RAR agonists. For instance, in some embodiments, the method comprises transiently introducing into the somatic cell RARα and RARγ.

[0087] NR5A2 (nuclear receptor subfamily 5, group A, member 2) , also known as the liver receptor homolog-1 (LRH-1) , is a protein that in humans is encoded by the NR5A2 gene. NR5A2 is a member of the nuclear receptor family of intracellular transcription factors. NR5A2 plays a critical role in the regulation of development, cholesterol transport, bile acid homeostasis and steroidogenesis.

[0088] In some embodiments, the method further comprises introducing into the somatic cell other signaling molecules including one or more reprogramming factors. In some embodiments, the one or more (such as any of 2, 3, or 4) reprogramming factors comprises an OCT family member, a Klf family member, a MYC family member, and / or a small molecule compound. The OCT family member may be Oct3 / 4. The Klf family member may be Klf1, Klf2, Klf4 or Klf5. The myc family member may be c-myc, n-myc or L-myc or NANOG. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the one or more reprogramming factors. In some embodiments, the method comprises directly introducing the one or more reprogramming factors into the somatic cell.

[0089] In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, and / or Myc. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, and c-Myc (Yamanaka factors) (Takahashi K, Yamanaka S. “Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. ” Cell 2006; 126: 663–676. ) . Yamanaka factors are highly expressed in embryonic stem (ES) cells, and their over-expression can induce pluripotency in both mouse and human somatic cells. Yamanaka factors are disclosed in EP1970446, the content of which is incorporated herein by reference in its entirety. Various factors that can replace components of the Yamanaka factors have been identified. Where the invention is described as using one or more Yamanaka factors, it will be appreciated that the present invention also contemplates the inclusion of the Yamanaka factor replacements for each factor. For example, Esrrb, is reportedly capable of replacing Klf4. Thus in some embodiments, the methods disclosed herein comprise transiently introducing into the somatic cell signaling molecules including an RAR agonist, NR5A2, and one or more reprogramming factors including Oct3 / 4, Sox2, Esrrb, and c-Myc.

[0090] In some embodiments, the method comprises directly introducing the signaling molecules (an RAR agonist, NR5A2, and optionally the one or more reprogramming factors) into the somatic cell. For instance, the signaling molecules can be introduced in their protein form either expressed alone or in the form of fusion proteins. Reference to proteins herein in the context of signaling molecules is not limited to proteins or polypeptides made by expression from nucleic acids, but includes proteins or fragments thereof that may be directly synthesized, for example.

[0091] Methods for introducing proteins or fragments thereof into a cell (e.g., a somatic cell) in culture are known in the art, including electroporation, microinjection, and macromolecular systems. The methods are reviewed in Chau, C., et al., (2020) . (Methods for protein delivery into cells: from current approaches to future perspectives. Biochemical Society Transactions, 48 (2) , 357-365) , which is incorporated herein by reference in its entirety.

[0092] In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding the signaling molecules (an RAR agonist, NR5A2, and optionally the one or more reprogramming factors) .

[0093] In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are under the control of a promoter. In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are under the control of different promoters. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are under the control of a promoter. In some embodiments, the nucleic acids encoding one or more reprogramming factors are under the control of different promoters. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding an RAR agonist, NR5A2, and the one or more reprogramming factors, and the nucleic acids encoding the RAR agonist, NR5A2, and the one or more reprogramming factors are under the control of a promoter. In some embodiments, the method comprises introducing into the somatic cell a nucleic acid encoding an RAR agonist, NR5A2, and the one or more reprogramming factors, and the nucleic acids encoding the RAR agonist, NR5A2, and the one or more reprogramming factors are under the control of different promoters.

[0094] In some embodiments, the RAR agonist, NR5A2 and optionally the one or more reprogramming factors may be encoded on one nucleic acid construct or on different nucleic acid constructs. For instance, in some embodiments, the RAR agonist and NR5A2 are encoded on one nucleic acid construct, and the one or more reprogramming factors are encoded on a different nucleic acid construct.

[0095] In some embodiments, the nucleic acids encoding the RAR agonist and NR5A2 are not integrated into the genome of the somatic cell. In some embodiments, the nucleic acids encoding the one or more reprogramming factors are not integrated into the genome of the somatic cell.

[0096] Nucleic acids encoding one or more of the signaling molecules (an RAR agonist, NR5A2, and optionally the one or more reprogramming factors) can be transiently introduced into the somatic cell via a plasmid and / or a virus.

[0097] In some embodiments, the nucleic acids encoding one or more of the signaling molecules (an RAR agonist, NR5A2, and optionally the one or more reprogramming factors) are transiently introduced into the somatic cell via an episomal plasmid. The episomal vector could be one designed on the basis of viral elements of BK virus (BKV) , bovine papilloma virus 1 (BPV-1) and Epstein–Barr virus (EBV) . Each of these vectors contains a viral origin of DNA replication and a viral early gene (s) , the product of which activates the viral origin and thus allows the episome to reside in the transfected host cell line in a well-controlled manner. There are several advantages of episomal vectors. First, the inserted nucleic acids of interest (e.g., nucleic acids encoding one or more of the signaling molecules) cannot be interrupted or subjected to regulatory constraints which often occur from integration into cellular DNA. Secondly, the presence of the inserted heterologous nucleic acids does not lead to rearrangement or interruption of the cell’s own important regions. Thirdly, episomal vectors persist in multiple copies in the nucleus, resulting in amplification of the nucleic acids of interest, whenever the necessary viral trans-acting factors are supplied. Finally, in stable transfection procedures, the use of episomal vectors often results in a higher transfection efficiency than the use of chromosome-integrating plasmids. Methods for introducing an episomal plasmid to a somatic cell are known in the art. For instance, in some embodiments, the method comprises electroporating a mixture comprising the somatic cell and the episomal plasmid. The introduction of the episomal plasmid can also comprise combinations of the plasmids with cationic liposomes or with liposome particles derived from ‘hemagglutinating virus of Japan’ . Methods for episomal plasmid introduction are described in Cachianes, G., et al., (1993) Biotechniques 15, 255-259; Matthews, J.C., et al, (1997) Anal. Biochem. 254, 208-214; Satoh, E., et al., (1997) Biochem. Biophys. Res. Commun. 238, 795-799; Satoh, E., et al., (1998) FEBS Lett. 441, 39 42, the contents of each of which are incorporated herein by reference in their entireties.

[0098] In some embodiments, the method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) or the method of preparing an expanded potential stem cell (EPSC) may further comprise detecting the reporter molecule to confirm that the plasmid has been successfully delivered into the somatic cell. In some embodiments, the reporter molecule is selected from the group consisting of Green Fluorescent Protein (GFP) , Red Fluorescent Protein (RFP) , Yellow Fluorescent Protein (YFP) , mCherry, tdTomato and photoconvertible fluorescent proteins. When expressed, the reporter molecule can be detected using methods such as fluorescent microscopy and flow cytometry (see, e.g., Kremers et al., J Cell Sci. 2011, 124 (2) : 157–160; Chudakov et al., Physiol Rev. 2010, 90 (3) : 1103-63. ) . Such reporter molecules are further described in section III.

[0099] In some embodiments, the nucleic acids encoding one or more of the signaling molecules (an RAR agonist, NR5A2, and optionally the one or more reprogramming factors) are transiently introduced into the somatic cell via a Sendai virus. The Sendai virus (SeV) is a rodent virus of the paramyxoviridae family causing respiratory infection. It is a single-stranded negative sense RNA virus. Since this virus does not go through a DNA phase, there is no risk of integration into the host genome. This method offers several benefits. First, it provides an efficient system to deliver nucleic acids of interest, at MOI as low as 1 to 3 (Fusaki, N. et al, (2009) . Proceedings of the Japan Academy, Series B, 85 (8) , 348-362) . Next, it can be used to transduce a wide range of cells, as it binds to sialic acid found on glycoproteins at the surface of the cell membrane. Moreover, only one transduction is sufficient since the RNA polymerase from the Sendai virus maintains the RNA synthesis for an extended time. In some embodiments, the somatic cell is transfected with Sendai virus at MOI of 1 to 20.

[0100] Reference herein to nucleic acids encoding the signaling molecules or proteins of the signaling molecules, such as RAR agonist, NR5A2, and / or the one or more reprogramming factors, includes members of the same gene / protein family within one species, family members in different species and variants thereof, such as proteins with substitutions, deletions or additions, suitably that are functionally equivalent in that they are able to promote the formation of EPSCs from somatic cells as disclosed herein, either alone or in combination with other factors. Such genes / proteins can include sequences having at least 70%, at least 80%, 90%or 95%homology or identity to the sequences of the nucleic acids encoding the signaling molecules or proteins of the signaling molecules according to the invention, at the nucleotide level or amino acid level. In some embodiments, the RAR agonist is human full length wild type RARγ sequence. In some embodiments, the NR5A2 is human full length wild type NR5A2 sequence. In some embodiments, the Oct3 / 4 is human full length wild type Oct3 / 4 sequence. In some embodiments, the Sox2 is human full length wild type Sox2 sequence. In some embodiments, the Klf4 is human full length wild type Klf4 sequence. In some embodiments, the Myc is human full length wild type c-Myc sequence. In some embodiments, the nucleic acids encoding the signaling molecules comprise the sequences set forth in SEQ ID NOs: 1-6.

[0101] RARG (SEQ ID NO: 1) : ATGGCCACCAATAAGGAGCGACTCTTTGCGGCTGGTGCCCTGGGGCCTGGATCTGGCTACCCAGGGGCAGGTTTCCCCTTCGCCTTCCCAGGGGCACTCAGGGGGTCTCCGCCTTTCGAGATGCTGAGCCCTAGCTTCCGGGGCCTGGGCCAGCCTGACCTCCCCAAGGAGATGGCCTCTCTGTCGGTGGAGACACAGAGCACCAGCTCAGAGGAGATGGTGCCCAGCTCGCCCTCGCCCCCTCCGCCTCCTCGGGTCTACAAGCCATGCTTCGTGTGCAATGACAAGTCCTCTGGCTACCACTATGGGGTCAGCTCTTGTGAAGGCTGCAAGGGCTTCTTTCGCCGAAGCATCCAGAAGAACATGGTGTACACGTGTCACCGCGACAAAAACTGTATCATCAACAAGGTGACCAGGAATCGCTGCCAGTACTGCCGGCTACAGAAGTGCTTCGAAGTGGGCATGTCCAAGGAAGCTGTGCGAAATGACCGGAACAAGAAGAAGAAAGAGGTGAAGGAAGAAGGGTCACCTGACAGCTATGAGCTGAGCCCTCAGTTAGAAGAGCTCATCACCAAGGTCAGCAAAGCCCATCAGGAGACTTTCCCCTCGCTCTGCCAGCTGGGCAAGTATACCACGAACTCCAGTGCAGACCACCGCGTGCAGCTGGATCTGGGGCTGTGGGACAAGTTCAGTGAGCTGGCTACCAAGTGCATCATCAAGATCGTGGAGTTTGCCAAGCGGTTGCCTGGCTTTACAGGGCTCAGCATTGCTGACCAGATCACTCTGCTCAAAGCTGCCTGCCTAGATATCCTGATGCTGCGTATCTGCACAAGGTACACCCCAGAGCAGGACACCATGACCTTCTCCGACGGGCTGACCCTGAACCGGACCCAGATGCACAATGCCGGCTTCGGGCCCCTCACAGACCTTGTCTTTGCCTTTGCTGGGCAGCTCCTGCCCCTGGAGATGGATGACACCGAGACAGGGCTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCATGGACCTGGAGGAGCCCGAAAAAGTGGACAAGCTGCAGGAGCCACTGCTGGAAGCCCTGAGGCTGTACGCCCGGCGCCGGCGGCCCAGCCAGCCCTACATGTTCCCAAGGATGCTAATGAAAATCACCGACCTCCGGGGCATCAGCACTAAGGGAGCTGAAAGGGCCATTACTCTGAAGATGGAGATTCCAGGCCCGATGCCTCCCTTAATCCGAGAGATGCTGGAGAACCCTGAAATGTTTGAGGATGACTCCTCGCAGCCTGGTCCCCACCCCAATGCCTCTAGCGAGGATGAGGTTCCTGGGGGCCAGGGCAAAGGGGGCCTGAAGTCCCCAGCCTGA

[0102] NR5A2 (SEQ ID NO: 2) : atggtgaattactcctatgatgaagatctggaagagctttgtcccgtgtgtggagataaagtgtctgggtaccattatgggctcctcacctgtgaaagctgcaagggattttttaagcgaacagtccaaaataataaaaggtacacatgtatagaaaaccagaactgccaaattgacaaaacacagagaaagcgttgtccttactgtcgttttcaaaaatgtctaagtgttggaatgaagctagaagctgtaagggccgaccgaatgcgtggaggaaggaataagtttgggccaatgtacaagagagacagggccctgaagcaacagaaaaaagccctcatccgagccaatggacttaagctagaagccatgtctcaggtgatccaagctatgccctctgacctgaccatttcctctgcaattcaaaacatccactctgcctccaaaggcctacctctgaaccatgctgccttgcctcctacagactatgacagaagtccctttgtaacatcccccattagcatgacaatgccccctcacggcagcctgcaaggttaccaaacatatggccactttcctagccgggccatcaagtctgagtacccagacccctataccagctcacccgagtccataatgggctattcatatatggatagttaccagacgagctctccagcaagcatcccacatctgatactggaacttttgaagtgtgagccagatgagcctcaagtccaggctaaaatcatggcctatttgcagcaagagcaggctaaccgaagcaagcacgaaaagctgagcacctttgggcttatgtgcaaaatggcagatcaaactctcttctccattgtcgagtgggccaggagtagtatcttcttcagagaacttaaggttgatgaccaaatgaagctgcttcagaactgctggagtgagctcttaatcctcgaccacatttaccgacaagtggtacatggaaaggaaggatccatcttcctggttactgggcaacaagtggactattccataatagcatcacaagccggagccaccctcaacaacctcatgagtcatgcacaggagttagtggcaaaacttcgttctctccagtttgatcaacgagagttcgtatgtctgaaattcttggtgctctttagtttagatgtcaaaaaccttgaaaacttccagctggtagaaggtgtccaggaacaagtcaatgccgccctgctggactacacaatgtgtaactacccgcagcagacagagaaatttggacagctacttcttcgactacccgaaatccgggccatcagtatgcaggctgaagaatacctctactacaagcacctgaacggggatgtgccctataataaccttctcattgaaatgttgca tgccaaaagagcataa

[0103] Oct3 / 4 (SEQ ID NO: 3) : ctgggggttctatttgggaaggtattcagccaaacgaccatctgccgctttgaggctctgcagcttagcttcaagaacatgtgtaagctgcggcccttgctgcagaagtgggtggaggaagctgacaacaatgaaaatcttcaggagatatgcaaagcagaaaccctcgtgcaggcccgaaagagaaagcgaaccagtatcgagaaccgagtgagaggcaacctggagaatttgttcctgcagtgcccgaaacccacactgcagcagatcagccacatcgcccagcagcttgggctcgagaaggatgtggtccgagtgtggttctgtaaccggcgccagaagggcaagcgatcaagcagcgactatgcacaacgagaggattttgaggctgctgggtctcctttctcagggggaccagtgtcctttcctctggccccagggccccattttggtaccccaggctatgggagccctcacttcactgcactgtactcctcggtccctttccctgagggggaagcctttccccctgtctccgtcaccactctgggctctcccatgcattcaaactga

[0104] Sox2 (SEQ ID NO: 4) : atgtacaacatgatggagacggagctgaagccgccgggcccgcagcaaacttcggggggcggcggcggcaactccaccgcggcggcggccggcggcaaccagaaaaacagcccggaccgcgtcaagcggcccatgaatgccttcatggtgtggtcccgcgggcagcggcgcaagatggcccaggagaaccccaagatgcacaactcggagatcagcaagcgcctgggcgccgagtggaaacttttgtcggagacggagaagcggccgttcatcgacgaggctaagcggctgcgagcgctgcacatgaaggagcacccggattataaataccggccccggcggaaaaccaagacgctcatgaagaaggataagtacacgctgcccggcgggctgctggcccccggcggcaatagcatggcgagcggggtcggggtgggcgccggcctgggcgcgggcgtgaaccagcgcatggacagttacgcgcacatgaacggctggagcaacggcagctacagcatgatgcaggaccagctgggctacccgcagcacccgggcctcaatgcgcacggcgcagcgcagatgcagcccatgcaccgctacgacgtgagcgccctgcagtacaactccatgaccagctcgcagacctacatgaacggctcgcccacctacagcatgtcctactcgcagcagggcacccctggcatggctcttggctccatgggttcggtggtcaagtccgaggccagctccagcccccctgtggttacctcttcctcccactccagggcgccctgccaggccggggacctccgggacatgatcagcatgtatctccccggcgccgaggtgccggaacccgccgcccccagcagacttcacatgtcccagcactaccagagcggcccggtgcccggcacggccattaacggcacactgcccctctcacacatgtga

[0105] Klf4 (SEQ ID NO: 5) : atgaggcagccacctggcgagtctgacatggctgtcagcgacgcgctgctcccatctttctccacgttcgcgtctggcccggcgggaagggagaagacactgcgtcaagcaggtgccccgaataaccgctggcgggaggagctctcccacatgaagcgacttcccccagtgcttcccggccgcccctatgacctggcggcggcgaccgtggccacagacctggagagcggcggagccggtgcggcttgcggcggtagcaacctggcgcccctacctcggagagagaccgaggagttcaacgatctcctggacctggactttattctctccaattcgctgacccatcctccggagtcagtggccgccaccgtgtcctcgtcagcgtcagcctcctcttcgtcgtcgccgtcgagcagcggccctgccagcgcgccctccacctgcagcttcacctatccgatccgggccgggaacgacccgggcgtggcgccgggcggcacgggcggaggcctcctctatggcagggagtccgctccccctccgacggctcccttcaacctggcggacatcaacgacgtgagcccctcgggcggcttcgtggccgagctcctgcggccagaattggacccggtgtacattccgccgcagcagccgcagccgccaggtggcgggctgatgggcaagttcgtgctgaaggcgtcgctgagcgcccctggcagcgagtacggcagcccgtcggtcatcagcgtcagcaaaggcagccctgacggcagccacccggtggtggtggcgccctacaacggcgggccgccgcgcacgtgccccaagatcaagcaggaggcggtctcttcgtgcacccacttgggcgctggaccccctctcagcaatggccaccggccggctgcacacgacttccccctggggcggcagctccccagcaggactaccccgaccctgggtcttgaggaagtgctgagcagcagggactgtcaccctgccctgccgcttcctcccggcttccatccccacccggggcccaattacccatccttcctgcccgatcagatgcagccgcaagtcccgccgctccattaccaaggtcagtcccggggatttgtagctcgggctggggagccctgtgtgtgctggccccacttcgggacacacgggatgatgctcaccccaccttcttcacccctagagctcatgccacccggttcctgcatgccagaggagcccaagccaaagaggggaagacgatcgtggccccggaaaaggaccgccacccacacttgtgattacgcgggctgcggcaaaacctacacaaagagttcccatctcaaggcacacctgcgaacccacacaggtgagaaaccttaccactgtgactgggacggctgtggatggaaattcgcccgctcagatgaactgaccaggcactaccgtaaacacacggggcaccgcccgttccagtgccaaaaatgcgaccgagcattttccaggtcggaccacctcgccttacacatgaagaggcatttttaa

[0106] c-Myc (SEQ ID NO: 6) : ctggatttttttcgggtagtggaaaaccagcctcccgcgacgatgcccctcaacgttagcttcaccaacaggaactatgacctcgactacgactcggtgcagccgtatttctactgcgacgaggaggagaacttctaccagcagcagcagcagagcgagctgcagcccccggcgcccagcgaggatatctggaagaaattcgagctgctgcccaccccgcccctgtcccctagccgccgctccgggctctgctcgccctcctacgttgcggtcacacccttctcccttcggggagacaacgacggcggtggcgggagcttctccacggccgaccagctggagatggtgaccgagctgctgggaggagacatggtgaaccagagtttcatctgcgacccggacgacgagaccttcatcaaaaacatcatcatccaggactgtatgtggagcggcttctcggccgccgccaagctcgtctcagagaagctggcctcctaccaggctgcgcgcaaagacagcggcagcccgaaccccgcccgcggccacagcgtctgctccacctccagcttgtacctgcaggatctgagcgccgccgcctcagagtgcatcgacccctcggtggtcttcccctaccctctcaacgacagcagctcgcccaagtcctgcgcctcgcaagactccagcgccttctctccgtcctcggattctctgctctcctcgacggagtcctccccgcagggcagccccgagcccctggtgctccatgaggagacaccgcccaccaccagcagcgactctgaggaggaacaagaagatgaggaagaaatcgatgttgtttctgtggaaaagaggcaggctcctggcaaaaggtcagagtctggatcaccttctgctggaggccacagcaaacctcctcacagcccactggtcctcaagaggtgccacgtctccacacatcagcacaactacgcagcgcctccctccactcggaaggactatcctgctgccaagagggtcaagttggacagtgtcagagtcctgagacagatcagcaacaaccgaaaatgcaccagccccaggtcctcggacaccgaggagaatgtcaagaggcgaacacacaacgtcttggagcgccagaggaggaacgagctaaaacggagcttttttgccctgcgtgaccagatcccggagttggaaaacaatgaaaaggcccccaaggtagttatccttaaaaaagccacagcatacatcctgtccgtccaagcagaggagcaaaagctcatttctgaagaggacttgttgcggaaacgacgagaacagttgaaacacaaacttgaacagctacggaactcttgtgcgtaa

[0107] By way of examples, the method of the present invention may comprise introducing to the somatic cell the following, as proteins, or DNA or RNA encoding said proteins, or a mixture of nucleic acid and protein:

[0108] An RAR agonist (such as RARG) and NR5A2;

[0109] An RAR agonist (such as RARG) , NR5A2, Oct3 / 4, and cMyc;

[0110] An RAR agonist (such as RARG) , NR5A2, Sox2 and Klf4;

[0111] An RAR agonist (such as RARG) , NR5A2, Oct3 / 4, cMyc, Sox2 and Klf4.

[0112] Thus in some embodiments, there is provided a method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell nucleic acids encoding reprogramming factors comprising: RARG, NR5A2, Oct3 / 4, Sox2, Klf4, and c-Myc. In some embodiments, the nucleic acids encoding Oct3 / 4, Sox2, Klf4, and c-Myc are transiently introduced into the somatic cell via a Sendai virus. In some embodiments, the nucleic acids encoding RARG and NR5A2 are transiently introduced into the precursor cell via an episomal plasmid.

[0113] In some embodiments, there is provided a method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell nucleic acids encoding reprogramming factors comprising: RARG, NR5A2, Oct3 / 4, Sox2, Klf4, and c-Myc. In some embodiments, the nucleic acids encoding Oct3 / 4, Sox2, Klf4, and c-Myc are transiently introduced into the somatic cell via a Sendai virus. In some embodiments, the nucleic acids encoding RARG and NR5A2 are transiently introduced into the precursor cell via an episomal plasmid. 2. Activation of signaling pathways

[0114] In some embodiments, the method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) or the method of preparing an expanded potential stem cell (EPSC) comprises activating in the somatic cell one or more RARs agonist and / or NR5A2. In some embodiments, the method comprises introducing into the somatic cell an agent that activates the one or more RAR agonists and / or NR5A2in the somatic cell.

[0115] In some embodiments, the RAR agonist is RARA, RARB, and / or RARG. In some embodiments, activating the RAR agonist comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: AM580, CD1530, MM11253, Palovarotene, CD437, CD2665, Adapalene (CD271) , and BMS-209641.

[0116] In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 0.1 uM to about 10 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 0.1 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 0.5 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 1 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 2 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 3 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 4 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 5 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 6 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 7 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 8 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 9 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist at a concentration of about 10 uM.

[0117] In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist for about 24 hours to about 21 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist for about 24 hours. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist for about 5 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist for about 10 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist for about 15 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist for about 20 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate the RAR agonist for about 21 days.

[0118] In some embodiments, activating NR5A2 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: RJW100, RR-RJW100, SS-RJW100, Iso-RJW100, and ML-180.

[0119] In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 0.1 uM to about 10 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 0.1 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 0.5 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 1 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 2 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 3 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 4 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 5 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 6 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 7 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 8 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 9 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 at a concentration of about 10 uM.

[0120] In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 for about 24 hours to about 21 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 for about 24 hours. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 for about 5 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 for about 10 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 for about 15 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 for about 20 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate NR5A2 for about 21 days.

[0121] In some embodiments, the method further comprises introducing into and / or activating in the somatic cell one or more reprogramming factors. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound. In some embodiments, the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, and Myc.

[0122] In some embodiments, the method comprises introducing into the somatic cell an agent that activates the one or more reprogramming factors.

[0123] In some embodiments, activating Oct3 / 4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: Oct4 inducer-1 (compound OAC-3) , OAC2, OAC1, Oct4 inducer-2, O4I2, and O4I4.

[0124] In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 0.1 uM to about 10 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 0.1 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 0.5 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 1 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 2 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 3 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 4 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 5 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 6 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 7 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 8 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 9 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 at a concentration of about 10 uM.

[0125] In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 for about 7 days to about 21 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 for about 7 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 for about 10 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 for about 13 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 for about 16 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 for about 19 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Oct3 / 4 for about 21 days.

[0126] In some embodiments, activating Klf4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: APTO-253 (LOR-253) and DAPM.

[0127] In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 0.1 uM to about 10 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 0.1 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 0.5 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 1 uM.In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 2 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 3 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 4 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 5 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 6 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 7 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 8 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 9 uM. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 at a concentration of about 10 uM.

[0128] In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 for about 24 hours to about 21 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 for about 24 hours. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 for about 5 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 for about 10 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 for about 15 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 for about 20 days. In some embodiments, the somatic cell is contacted with one or more small molecules that activate Klf4 for about 21 days.

[0129] In some embodiments, the signaling molecules (an RAR agonist, NR5A2, and optionally the one or more reprogramming factors) can be individually transiently introduced into the somatic cell (either as a protein or as a nucleic acid encoding the protein) or activated by an agent. For example, in some embodiments, there is provided a method of preparing an EPSC, comprising activating an RAR agonist by contacting the somatic cell with a small molecule such as CD437, activating NR5A2 by contacting the somatic cell with a small molecule such as RJW100, and transiently introducing to the somatic cell nucleic acids encoding Oct3 / 4 and Sox2, and introducing to the somatic cell Myc and Klf4 proteins. 3. Validation of EPSCs

[0130] Established EPSC lines are functionally and molecularly similar, independent of their derivation origins. EPSCs have distinct transcriptome and histone methylation patterns compared to ESCs, and exhibit partial DNA demethylation at the Cdx2 and Elf5 loci. The transcriptome of EPSCs is also enriched with molecular signature of early blastomeres, although remains distinct from blastomeres. EPSCs express levels of core pluripotency factors (Oct4, Sox2 and Nanog) similar to pluripotent ESCs. Compared to ESCs, EPSCs contain increased bivalent domains at genetic loci of lineage specifiers. It has been suggested that “promiscuous” transcription at bivalent loci is a hallmark of “metastable” ESCs cultured in serum-containing media and these genes are poised for activation upon differentiation induction (Marks et al 2012, Bernstein et al 2006. Cell 125, 315) . On the other hand, bivalent domains are significantly reduced accompanied by stable expression of Nanog and Rex1 in ESCs cultured in 2i / LIF (Marks et al 2012) . In spite of the increased bivalent domains in EPSCs, the transcriptome of EPSCs has reduced expression variation compared to ESCs maintained in serum-containing media (M15) and the expression of Nanog and Rex1 are inherently stable.

[0131] Additionally, the EPSCs can have one or more characteristics selected from the group consisting of: (1) high expression levels of one or more histone genes selected from the group consisting of HIST1H1C, HIST1H2AC, HIST1H2BD, and HIST1H2BJ; (2) low expression level of H3K27me3; (3) high proliferation rate; (4) high precision genome editing capability; (5) high genome stability, and (6) expanded developmental potential to derive trophoblast lineage cells.

[0132] The characteristics of the EPSCs can be assessed by methods known in the art. For example, the expression levels of histone genes and pluripotency factors can be assessed by techniques such as RT-qPCR, in situ hybridization, RNA sequencing, Western blot, immunofluorescent staining, ELISA, proteomics, flowcytometry, and / or immunochemistry. The proliferation rate of the EPSCs can be measured by metabolic activity assays, cell proliferation marker assays, ATP concentration assays, or DNA synthesis assays. Genome stability can be assessed by genome sequencing. Expanded developmental potential to derive trophoblast lineage cells can be assessed by differentiation into trophoblast stem cells (TSCs) in vitro, wherein the differentiated cells express markers of the trophoblast lineages (KRT7, CGB, GATA3 and TFAP2C) . Expanded developmental potential can also be assessed by teratoma formation in vivo, wherein mesodermal cells (such as bone cartilage) , ectodermal cells (such as neural cells) and endodermal cells (such as glandular epithelial cells) , as well as cells expressing markers of the trophoblast lineages are present. 4. Somatic cells and samples

[0133] In some embodiments, the somatic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the mammalian cell is a cell from a non-human species selected from the group consisting of: a mouse, a rat, a sheep, a pig, a cow, and a primate.

[0134] In some embodiments, the somatic cell is a fibroblast, a neural stem cell, an epithelial cell (such as a urinary epithelial cell) , or a blood cell. In some embodiments, the blood cell is a hematopoietic cell or erythroblast.

[0135] In some embodiments, the somatic cell is a hematopoietic cell or erythroblast, and the somatic cell is from a blood sample (such as a peripheral blood sample) . In some embodiments, the methods disclosed herein can efficiently produce EPSCs, thereby requiring a small amount of somatic cells. In some embodiments, the blood sample has a volume of about 1 μL to about 10 mL.In some embodiments, the blood sample has a volume of about 1 μL to about 100 μL. In some embodiments, the blood sample has a volume of about 100 μL to about 200 μL. In some embodiments, the blood sample has a volume of about 200 μL to about 300 μL. In some embodiments, the blood sample has a volume of about 300 μL to about 400 μL. In some embodiments, the blood sample has a volume of about 400 μL to about 500 μL. In some embodiments, the blood sample has a volume of about 500 μL to about 600 μL. In some embodiments, the blood sample has a volume of about 600 μL to about 700 μL. In some embodiments, the blood sample has a volume of about 700 μL to about 800 μL. In some embodiments, the blood sample has a volume of about 800 μL to about 900 μL. In some embodiments, the blood sample has a volume of about 900 μL to about 1 mL. In some embodiments, the blood sample has a volume of about 1 mL to about 2 mL. In some embodiments, the blood sample has a volume of about 2 mL to about 3 mL. In some embodiments, the blood sample has a volume of about 3 mL to about 4 mL. In some embodiments, the blood sample has a volume of about 4 mL to about 5 mL. In some embodiments, the blood sample has a volume of about 5 mL to about 6 mL. In some embodiments, the blood sample has a volume of about 6 mL to about 7 mL. In some embodiments, the blood sample has a volume of about 7 mL to about 8 mL.In some embodiments, the blood sample has a volume of about 8 mL to about 9 mL. In some embodiments, the blood sample has a volume of about 9 mL to about 10 mL.

[0136] In some embodiments, the methods can be customized based on the type of the somatic cell. For instance, in some embodiments, the somatic cell is a neural stem cell (NSC) , such as BRC1019. BRC1019 expresses high levels of endogenous SOX2, so it might be reprogrammed to EPSC by other signaling molecules disclosed herein other than SOX2. For example, in some embodiments, there is provided a method of preparing an EPSC, comprising transiently introducing into and / or activating in a BRC1019 cell a retinoic acid receptor (RAR) agonist, NR5A2, Oct3 / 4, Klf4, and Myc. 5. Culturing conditions

[0137] Upon introduction or activation of the RAR agonist, NR5A2, and optionally the one or more reprogramming factors) , the somatic cells can be further cultured in a first medium, optionally a second medium, and optionally a third medium after the signaling molecules are transiently introduced or activated.

[0138] In some embodiments, the first medium comprises DMEM-high glucose. In some embodiments, the first medium is M10 medium. M10 medium comprises DMEM-high glucose, FBS, Penicillin-Streptomycin-Glutamine, MEM NEAAs, and sodium pyruvate. In some embodiments, the first medium comprises DMEM-high glucose, 10% (vol / vol) FBS, 1% (vol / vol) Penicillin-Streptomycin-Glutamine, 1% (vol / vol) MEM NEAAs, and 1% (vol / vol) sodium pyruvate. In some embodiments, the somatic cell is cultured in the first medium for about 24 hours to about 72 hours. For example, in some embodiments, the somatic cell is cultured in the first medium for about 24 hours. For example, in some embodiments, the somatic cell is cultured in the first medium for about 36 hours. For example, in some embodiments, the somatic cell is cultured in the first medium for about 48 hours. For example, in some embodiments, the somatic cell is cultured in the first medium for about 60 hours. For example, in some embodiments, the somatic cell is cultured in the first medium for about 72 hours.

[0139] In some embodiments, the second medium comprises DMEM. In some embodiments, the second medium is M15 medium supplemented with human LIF and vitamin C. In some embodiments, the second medium comprises DMEM, Glutamine, Fetal Bovine Serum (FBS) , human LIF and vitamin C. In some embodiments, the second medium comprises DMEM, 2mM Glutamine, 10%Fetal Bovine Serum (FBS) , 10 ng / ml human LIF and 50 μg / ml vitamin C. In some embodiments, the somatic cell is cultured in the second medium for about 7 days to 21 days. For example, in some embodiments, the somatic cell is cultured in the first medium for about 7 days. For example, in some embodiments, the somatic cell is cultured in the first medium for about 11 days. For example, in some embodiments, the somatic cell is cultured in the first medium for about 14 days. For example, in some embodiments, the somatic cell is cultured in the first medium for about 17 days. For example, in some embodiments, the somatic cell is cultured in the first medium for about 21 days.

[0140] In some embodiments, the third medium promotes and maintains the growth of EPSCs (EPSCM) . In some embodiments, the third medium comprises N2B27 and small molecules. In some embodiments, the EPSCM is a N2B27-based media (1: 1 DMEM / F12 (Thermo, Cat. 21331020) , Neurobasal Medium (Thermo, Cat. 21103049) , 200× N2, 100× B27, 100x ITS-X, 50.0 μM β-mercaptoethanol, 1%Penicillin-Streptomycin-Glutamine, 100x Non-essential amino acid solution, 50 μg / mL Vitamin C) supplemented with 4 small molecules: 5 μM XAV939, 1 μM CHIR99021 and 0.1 μM A419259 as previously published (Gao, X., et al, (2019) . Establishment of porcine and human expanded potential stem cells. Nat. Cell Biol. 21, 687–699, the content of which is incorporated herein in its entirety) . In some embodiments, the third medium is prepared by supplementing 48 ml DMEM / F12 and 48 ml Neurobasal Medium with 500 μl N2, 1 ml B27, 1 ml ITS-X, 1 ml Penicillin-Streptomycin-Glutamine, 1 ml MEM NEAAs, 100 μl β-mercaptoethanol, 600 μl Bovine Albumin Fraction V, 200 μl Chemically Defined Lipid Concentrate, 100 μl Trace Elements B, 100 μl Trace Elements C, 100 μl L-ascorbic-acid (50 mg / ml stock) , 33 μl L-Glutathione reduced (10 mg / ml stock) , 10 μl XAV-939 (25 mM stock to 2.5 μM) , 5 μl IWR-1-endo (50 mM stock to 2.5 μM) , 5 μl CHIR-99021 (20 mM stock to 1 μM) , 3.3 μl A-419259 (3 mM stock to 0.1 μM) , and 10 μl human LIF (100 μg / ml stock to 10 ng / ml) . In some embodiments, the EPSCM comprises a basal cell nutrient medium supplemented with inhibitors consisting of a Src family Kinase (SFK) inhibitor, a GSK3 inhibitor and a tankyrase inhibitor. In some embodiments, the EPSCM further comprises one or more of a RAS-ERK inhibitor, a p38 inhibitor and a JNK inhibitor. Exemplary molecules that can be used as these inhibitors are described in the art, for example, in US11913018B2, Gao, X. et al. Nat Cell Biol 21, 687-699; and Wilkinson, A. C. et al. Exp Hematol 76, 1-12. e15, the content of each of which is incorporated herein by reference in its entirety.

[0141] In some embodiments, the culture medium (e.g., the first, second, or third medium) further comprises one or more small molecules that activate the one or more signaling molecules as described in section II. 2.

[0142] In some embodiments, the method disclosed herein further comprises validating the identity of the EPSCs by differentiating the cells to cells of the trophoblast lineages (such as trophoblast stem cells (TSCs) ) . Methods for inducing EPSCs to differentiate into TSCs are known in the art. An exemplary protocol is described in Okae et al., 2018, Cell stem cell, 22 (1) , 50-63, the content of which is incorporated herein in its entirety. In some embodiments, methods for inducing EPSCs to differentiate into TSCs comprises culturing the cells in a cell culture medium comprising DMEM / F12, β-mercaptoethanol, FBS, Penicillin-Streptomycin, bovine albumin fraction V (BSA) , Insulin-Transferrin-Selenium-Ethanolamine (ITS-X) supplement, 2-phospho-L-ascorbic-acid (Vc) , EGF, CHIR99021, A83-01, SB431542, Valproic acid (VPA) , and Y27632. In some embodiments, the cell culture medium comprises DMEM / F12 supplemented with 110 μM β-mercaptoethanol, 0.2%FBS, 0.5%Penicillin-Streptomycin, 0.3%BSA, 1x ITS-X supplement, 50.0 μg / mL Vc, 50.0 ng / mL EGF, 2.0 μM CHIR99021, 0.5 μM A83-01, 1.0 μM SB431542, 0.8μM VPA, and 5.0 μM Y27632.

[0143] In an exemplary workflow shown in FIG. 1B, the cells are electroporated with the episomal plasmid on Day 0, and transfected with Sendai Virus on Day 1 while culturing in M10 medium. On Day 3, the cells are changed to M15+LIF+vitamin C medium and continue to culture till Day 8, when the cells are plated on feeder cells. The cells continue to culture in M15+LIF+vitamin C medium. The medium is changed to EPSCM on Day 17. EPSC colonies can be picked starting on Day 22.

[0144] As another example, in some embodiments, the method of preparing an EPSC comprises 1) introducing nucleic acids encoding RARG and LRH1 via an episomal plasmid to a somatic cell; 2) introducing nucleic acids encoding Oct3 / 4, Sox2, Klf4, and / or Myc via Sendai Virus to the somatic cell; 3) culturing the cell in a first medium; 4) culturing the cell in a second medium; and 5) culturing the cell in a third medium, thereby obtaining the EPSC. III. Composition for Cell Reprogramming

[0145] The present application in one aspect provides an episomal plasmid comprising one or more nucleic acid sequences, wherein the one or more nucleic acid sequences encode Oct3 / 4, Sox2, Klf4, Myc, an RAR agonist, and / or NR5A2. The methods described above in some embodiments use such episomal plasmid.

[0146] In some embodiments, RAR agonist is RARA (RARα) , RARB (RARβ) , or RARG (RARγ) . In some embodiments, Myc is c-Myc, L-Myc, or N-Myc. In some embodiments, the nucleic acid sequence encoding Oct3 / 4, Sox2, Klf4, c-Myc, RARγ, or NR5A2 comprise sequences set forth in SEQ ID NOs: 1-6.

[0147] In some embodiments, the episomal plasmid further comprises a nucleic acid encoding a reporter molecule. For instance, the reporter molecule could be used to confirm that the plasmid has been successfully introduced, as described in section II. Examples of reporter molecules include physically activated molecules and chemically activated molecules. The reporter molecule could be fluorescent or non-fluorescent. Examples of physically activated molecules include but are not limited to light activated sensing molecules, such as GFP, RFP, mCherry, photoconvertible fluorescent proteins, etc. Examples of chemically activated molecules include but are not limited to: 1) enzyme-activated sensing molecules, such as bioluminescence (e.g., luciferase) and enzyme assays (e.g., β-galactosidase, β-glucuronidase, and β-lactamase) ; 2) antibody-based assays, such as IF antibody assays; 3) chloramphenicol acetyltransferase; and 4) biosensors (e.g., probes) .

[0148] The nucleic acid encoding a reporter molecule may replace the stop codon of the gene of interest (e.g. one or more nucleic acid sequences encode Oct3 / 4, Sox2, Klf4, Myc, an RAR agonist, and / or NR5A2) to create a gene fusion, so that they can be expressed with the gene of interest. Also, in building the reporter gene system, a segment of DNA coding for a flexible polypeptide linker region such as T2A and IRES is usually inserted right in front of the nucleic acid encoding the reporter molecule. This method is an example of using cis-acting elements where the two genes are under the same promoter elements and are transcribed into a single messenger RNA molecule. The mRNA is then translated into protein, and linker region like T2A or IRES mediates co-translational cleavage. In this way, both proteins are able to properly fold into their active conformations instead of becoming a fusion protein. The reporter and the product of the gene of interest will only minimally interfere with one another. IV. Modification of the Cells

[0149] In one aspect, provided herein is an expanded potential stem cell (EPSC) produced by the methods disclosed herein. In some embodiments, the EPSC obtained by reprogramming is further modified to comprises one or more modifications to the genome.

[0150] Suitable methods for genetically modifying a stem cell (e.g., an EPSC) are known in the art, including clustered regularly interspaced short palindromic repeats (CRISPR) -CRISPR-associated protein (Cas) , transcription activator-like effector nucleases (TALENs) , zinc-finger nucleases (ZFNs) , homing endonucleases or mega nucleases, and base editing. The outcomes of the genetic modification might be gene knock-out / knock-in, gene mutations, or gene inversion.

[0151] CRISPR is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria and archaea. These sequences are derived from DNA fragments of bacteriophages that had previously infected the prokaryote. They are used to detect and destroy DNA from similar bacteriophages during subsequent infections. CRISPR-Cas systems are composed of CRISPR repeat-spacer arrays, which can be further transcribed into CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA) , and a set of CRISPR-associated (cas) genes which encode Cas proteins with endonuclease activity. CRISPR-Cas systems can be classified into 2 classes (Class 1 and Class 2) , 6 types (I to VI) and several subtypes, with multi-Cas protein effector complexes in Class 1 systems (Type I, III, and IV) and a single effector protein in Class 2 systems (Type II, V, and VI) . Type II CRISPR-Cas9 system derived from Streptococcus pyogenes (SpCas9) is one of the best characterized and most commonly used categories in numerous CRISPR-Cas systems. The main components of CRISPR-Cas9 system are RNA-guided Cas9 endonuclease and a single-guide RNA (sgRNA) . The Cas9 protein possesses two nuclease domains, named HNH and RuvC, and each cleaves one strand of the target double-stranded DNA. A single-guide RNA (sgRNA) is a simplified combination of crRNA and tracrRNA. The Cas9 nuclease and sgRNA form a Cas9 ribonucleoprotein (RNP) , which can bind and cleave the specific DNA target. Furthermore, a protospacer adjacent motif (PAM) sequence is required for Cas9 protein’s binding to the target DNA.

[0152] ZFNs are fusions between a custom-designed Cys2-His2 zinc-finger protein and the cleavage domain of the FokI restriction endonuclease. ZFNs function as dimers, with each monomer recognizing a specific “half site” sequence -typically nine to 18 base pairs (bps) of DNA -via the zinc-finger DNA-binding domain.

[0153] TALENs are structurally similar to ZFNs. Both methods use the Fokl nuclease to cut DNA and require dimerization to function, however, the DNA binding domains differ. TALENs use transcription activator-like effectors (TALEs) , tandem arrays of 33-35 amino acid repeats. The amino acid repeats possess single-nucleotide recognition, thereby increasing targeting capabilities and specificity compared to ZFNs.

[0154] Homing endonucleases, also known as meganucleases are a collection of naturally occurring enzymes that recognize and cleave long DNA sequences (14 to 40 bps) . These enzymes make extensive sequence-specific contacts with their DNA substrate and thus typically show exquisite specificity.

[0155] Base editing is a relatively new method of genome editing derived from CRISPR-Cas9. Unlike traditional CRISPR systems, base editors (BEs) do not induce double-stranded breaks in the genome. Base editing systems, use a ‘catalytically dead’ Cas9 (dCas9) , which cannot cleave DNA, fused to bacterial enzymes called DNA deaminases. Cytidine deaminases, which induce C to T substitutions, are naturally occurring in bacteria, while adenine deaminases, which induce A to G substitutions, were engineered from bacterial enzymes specifically for base editing purposes. Fusing dCas9 to either a cytidine deaminase (CBEs) or an adenine deaminase (ABEs) and providing a sgRNA to direct it to the target sequence, allows researchers to introduce substitutions in DNA.

[0156] The efficiency of genome editing can be assessed by methods such as genomic DNA PCR, Sanger sequencing, Fluorescence-activated cell sorting (FACS) , etc. In some embodiments, the EPSCs permit efficient precision genome editing at up to 90%efficiency. In some embodiments, the EPSCs permit efficient precision genome editing at up to 92%efficiency. In some embodiments, the EPSCs permit efficient precision genome editing at up to 94%efficiency. In some embodiments, the EPSCs permit efficient precision genome editing at up to 96%efficiency. In some embodiments, the EPSCs permit efficient precision genome editing at up to 98%efficiency. In some embodiments, the EPSCs permit efficient precision genome editing at up to 100%efficiency. V. Method of Treatment

[0157] In one aspect, provided herein is a composition comprising one or more EPSCs disclosed herein and / or cells differentiated therefrom. In some embodiments, the cells differentiated from the EPCS can be skin cells, blood cells, neural cells, immune cells, liver cells, lung cells, pancreatic cells, or muscle cells. In some embodiments, the composition further comprises pharmaceutically acceptable excipient. Suitable excipients include, inter alia, pharmaceutically acceptable buffers, carriers and water.

[0158] In another aspect, provided herein is a method of treating an individual in need thereof, comprising administering an effective amount of the composition comprising one or more EPSCs disclosed herein and / or cells differentiated therefrom to the individual. In some embodiments, the individual is diagnosed with Alzheimer’s disease. In some embodiments, the individual is diagnosed with Parkinson’s disease.

[0159] In some embodiments, the method of treating further comprises obtaining a somatic cell from the individual to be reprogrammed by the methods described in section II. For instance, in some embodiments, the somatic cell is a fibroblast, an epithelial cell, or a blood cell. In some embodiments, the epithelia cell is a urinary epithelial cell. In some embodiments, the blood cell is an peripheral blood cell. In some embodiments, the blood cell is a hematopoietic cell or erythroblast.

[0160] In some embodiments, the method of treating further comprises obtaining a somatic cell from a blood sample of the individual to be reprogrammed by the methods described in section II. In some embodiments, the blood sample has a volume of about 1 μL to about 10 mL. In some embodiments, the blood sample has a volume of about 1 μL to about 100 μL. In some embodiments, the blood sample has a volume of about 100 μL to about 200 μL. In some embodiments, the blood sample has a volume of about 200 μL to about 300 μL. In some embodiments, the blood sample has a volume of about 300 μL to about 400 μL. In some embodiments, the blood sample has a volume of about 400 μL to about 500 μL. In some embodiments, the blood sample has a volume of about 500 μL to about 600 μL. In some embodiments, the blood sample has a volume of about 600 μL to about 700 μL. In some embodiments, the blood sample has a volume of about 700 μL to about 800 μL. In some embodiments, the blood sample has a volume of about 800 μL to about 900 μL. In some embodiments, the blood sample has a volume of about 900 μL to about 1 mL. In some embodiments, the blood sample has a volume of about 1 mL to about 2 mL. In some embodiments, the blood sample has a volume of about 2 mL to about 3 mL. In some embodiments, the blood sample has a volume of about 3 mL to about 4 mL. In some embodiments, the blood sample has a volume of about 4 mL to about 5 mL. In some embodiments, the blood sample has a volume of about 5 mL to about 6 mL. In some embodiments, the blood sample has a volume of about 6 mL to about 7 mL. In some embodiments, the blood sample has a volume of about 7 mL to about 8 mL.In some embodiments, the blood sample has a volume of about 8 mL to about 9 mL. In some embodiments, the blood sample has a volume of about 9 mL to about 10 mL.

[0161] In some embodiments, the EPSCs in the composition are genetically modified as described in section IV.

[0162] In some embodiments, the method of treating further comprises differentiating the EPSCs into a differentiated cell (e.g., a skin cell, a blood cell, a neural cell, an immune cell, a liver cell, a lung cell, a pancreatic cell, or a muscle cell) . For instance, in some embodiments, the method of treating further comprises differentiating the EPSCs into pancreatic cells by methods described in for example, Chen, A. et al. “Expanded Potential Stem Cells from Human Embryos Have an Open Chromatin Configuration with Enhanced Trophoblast Differentiation Ability. ” Advanced science (Weinheim, Baden-Wurttemberg, Germany) 10, e2204797, the content of which is incorporated herein by reference in its entirety. EXEMPLARY EMBODIMENTS

[0163] Embodiment 1. A method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising transiently introducing into and / or activating in the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) .

[0164] Embodiment 2. A method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into and / or activating in a somatic cell a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) .

[0165] Embodiment 3. The method of Embodiment 1 or 2, wherein the method comprises transiently introducing into the somatic cell an RAR agonist and NR5A2.

[0166] Embodiment 4. The method of Embodiment 3, wherein the method comprises directly introducing the RAR agonist and / or NR5A2 into the somatic cell.

[0167] Embodiment 5. The method of Embodiment 3, wherein the method comprises introducing into the somatic cell a nucleic acid encoding the RAR agonist and / or NR5A2.

[0168] Embodiment 6. The method of Embodiment 3, wherein the method comprises introducing into the somatic cell an agent that activates the RAR agonist and / or NR5A2 in the somatic cell.

[0169] Embodiment 7. The method of any one of Embodiments 1-6, further comprising introducing into and / or activating in the somatic cell one or more reprogramming factors.

[0170] Embodiment 8. The method of Embodiment 7, wherein the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound.

[0171] Embodiment 9. The method of Embodiment 8, wherein the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, and Myc.

[0172] Embodiment 10. The method of any one of Embodiments 7-9, wherein the method comprises directly introducing the one or more reprogramming factors into the somatic cell.

[0173] Embodiment 11. The method of any one of Embodiments 7-9, wherein the method comprises introducing into the somatic cell a nucleic acid encoding the one or more reprogramming factors.

[0174] Embodiment 12. The method of any one of Embodiments 7-9, wherein the method comprises introducing into the somatic cell an agent that activates the one or more reprogramming factors.

[0175] Embodiment 13. The method of Embodiment 11, wherein the method comprises introducing nucleic acids encoding the RAR agonist, NR5A2, and optionally the one or more reprogramming factors into the somatic cell.

[0176] Embodiment 14. The method of Embodiment 5 or 13, wherein the nucleic acids encoding the RAR agonist and NR5A2 are under the control of a promoter.

[0177] Embodiment 15. The method of Embodiment 5 or 13, wherein the nucleic acids encoding the RAR agonist and NR5A2 are under the control of different promoters.

[0178] Embodiment 16. The method of Embodiment 11 or 13, wherein the nucleic acids encoding the one or more reprogramming factors are under the control of a promoter.

[0179] Embodiment 17. The method of Embodiment 11 or 13, wherein the nucleic acids encoding one or more reprogramming factors are under the control of different promoters.

[0180] Embodiment 18. The method of any one of Embodiments 1-17, wherein the RAR agonist is RARA, RARB, or RARG.

[0181] Embodiment 19. The method of Embodiment 18, wherein the RAR agonist is RARG.

[0182] Embodiment 20. The method of any one of Embodiments 8-19, wherein Myc is c-Myc, L-Myc, or N-Myc.

[0183] Embodiment 21. The method of Embodiment 20, wherein Myc is c-Myc.

[0184] Embodiment 22. The method of any one of Embodiments 5, 13-15 and 18-21, wherein the nucleic acids encoding the RAR agonist and NR5A2 are not integrated into the genome of the somatic cell.

[0185] Embodiment 23. The method of any one of Embodiments 11, 13, 16-17 and 20-21, wherein the nucleic acids encoding the one or more reprogramming factors are not integrated into the genome of the somatic cell.

[0186] Embodiment 24. The method of Embodiment 22 or 23, wherein one or more of the nucleic acids encoding the RAR agonist and NR5A2 and the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via a plasmid and / or a virus.

[0187] Embodiment 25. The method of any one of Embodiments 22-24, wherein one or more of the nucleic acids encoding the RAR agonist and NR5A2 and the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via an episomal plasmid.

[0188] Embodiment 26. The method of any one of Embodiments 22-25, wherein one or more of the nucleic acids encoding the RAR agonist and NR5A2 and the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell via a Sendai virus.

[0189] Embodiment 27. The method of Embodiment 25, comprising electroporating a mixture comprising the somatic cell and the episomal plasmid.

[0190] Embodiment 28. The method of Embodiment 26, wherein the somatic cell is transfected with Sendai virus at MOI of 1 to 20.

[0191] Embodiment 29. The method of any one of Embodiments 1-30, wherein activating the retinoic acid receptor (RAR) agonist comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: CD1530, MM11253, Palovarotene, CD437, CD2665, CD271, and BMS-209641.

[0192] Embodiment 30. The method of any one of Embodiments 1-29, wherein activating NR5A2 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: RJW100, RR-RJW100, SS-RJW100, Iso-RJW100, and ML-180.

[0193] Embodiment 31. The method of any one of Embodiments 8-30, wherein activating Oct3 / 4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: Oct4 inducer-1 (compound OAC-3) , OAC2, OAC1, Oct4 inducer-2, O4I2, and O4I4.

[0194] Embodiment 32. The method of any one of Embodiments 8-31, wherein activating Klf4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: APTO-253 (LOR-253) and DAPM.

[0195] Embodiment 33. The method of any one of Embodiments 1-32, wherein the somatic cell is a mammalian cell.

[0196] Embodiment 34. The method of Embodiment 33, wherein the mammalian cell is a human cell.

[0197] Embodiment 35. The method of Embodiment 33, wherein the mammalian cell is a cell from a non-human species selected from the group consisting of: a mouse, a rat, a sheep, a pig, a cow, and a primate.

[0198] Embodiment 36. The method of any one of Embodiments 1-35, wherein the somatic cell is a fibroblast.

[0199] Embodiment 37. The method of any one of Embodiments 1-35, wherein the somatic cell is a urinary epithelial cell.

[0200] Embodiment 38. The method of any one of Embodiments 1-35, wherein the somatic cell is a blood cell.

[0201] Embodiment 39. The method of Embodiment 38, wherein the blood cell is a hematopoietic cell or erythroblast.

[0202] Embodiment 40. The method of Embodiment 38 or 39, wherein the somatic cell is from a blood sample.

[0203] Embodiment 41. The method of Embodiment 40, wherein the blood sample has a volume of about 1 μL to about 10 mL.

[0204] Embodiment 42. The method of any one of Embodiments 1-35, wherein the somatic cell is neural stem cell (NSC) .

[0205] Embodiment 43. The method of any one of Embodiments 1-42, further comprising culturing the somatic cell in a first medium for about 24 hours to about 72 hours after the RAR agonist and NR5A2 are transiently introduced or activated.

[0206] Embodiment 44. The method of Embodiment 43, wherein the first medium is M10 medium.

[0207] Embodiment 45. The method of Embodiment 43 or 44, further comprising culturing the somatic cell in a second medium for about 7 days to 21 days after culturing the somatic cell in the first medium.

[0208] Embodiment 46. The method of Embodiment 45, wherein the second medium is M15 medium supplemented with human LIF and vitamin C.

[0209] Embodiment 47. The method of Embodiment 45 or 46, further comprising culturing the somatic cell in a third medium after culturing the somatic cell in the second medium.

[0210] Embodiment 48. The method of Embodiment 47, wherein the third medium is expanded potential stem cell culture medium (EPSCM) .

[0211] Embodiment 49. The method of Embodiment 48, wherein the EPSCM comprises a basal cell nutrient medium supplemented with inhibitors consisting of a Src family Kinase (SFK) inhibitor, a GSK3 inhibitor and a tankyrase inhibitor.

[0212] Embodiment 50. The method of Embodiment 49, wherein the EPSCM further comprises one or more of a RAS-ERK inhibitor, a p38 inhibitor and a JNK inhibitor.

[0213] Embodiment 51. The method of any one of Embodiments 1-50, wherein the EPSCs are free of the RAR agonist, NR5A2, and optionally the one or more reprogramming factors after no more than 5 passages.

[0214] Embodiment 52. The method of any one of Embodiments 1-51, wherein the EPSCs are stable for at least 10 passages.

[0215] Embodiment 53. A method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell nucleic acids encoding reprogramming factors comprising: RARG, NR5A2, Oct3 / 4, Sox2, Klf4, and c-Myc to generate the EPSC.

[0216] Embodiment 54. The method of Embodiment 53, wherein the nucleic acids encoding Oct3 / 4, Sox2, Klf4, and c-Myc are transiently introduced into the somatic cell via a Sendai virus.

[0217] Embodiment 55. The method of Embodiment 53 or 54, wherein the nucleic acids encoding RARG and NR5A2 are transiently introduced into the precursor cell via an episomal plasmid.

[0218] Embodiment 56. An episomal plasmid comprising one or more nucleic acid sequences, wherein the one or more nucleic acid sequences encode Oct3 / 4, Sox2, Klf4, Myc, an RAR agonist, and / or NR5A2.

[0219] Embodiment 57. An expanded potential stem cell (EPSC) produced by the method of any one of Embodiments 1-56.

[0220] Embodiment 58. The EPSC of Embodiment 57, wherein the EPSC has one or more characteristics selected from the group consisting of: i) high expression levels of one or more histone genes selected from the group consisting of HIST1H1C, HIST1H2AC, HIST1H2BD, and HIST1H2BJ; ii) low expression level of H3K27me3; iii) high proliferation rate; iv) high precision genome editing capability; v) expression of pluripotency markers; vi) high genome stability; and vii) expanded developmental potential to derive trophoblast lineage cells.

[0221] Embodiment 59. The EPSC of Embodiment 57 or 58, further comprising one or more modifications to the genome.

[0222] Embodiment 60. A composition comprising one or more EPSCs of any one of Embodiments 57-59 and / or cells differentiated therefrom.

[0223] Embodiment 61. A method of treating an individual in need thereof, comprising administering an effective amount of the composition of Embodiment 60 to the individual.

[0224] Embodiment 62. The method of Embodiment 61, further comprising obtaining a somatic cell from the individual.

[0225] Embodiment 63. The method of Embodiment 62, wherein the somatic cell is a fibroblast.

[0226] Embodiment 64. The method of Embodiment 62, wherein the somatic cell is a urinary epithelial cell.

[0227] Embodiment 65. The method of Embodiment 62, wherein the somatic cell is a blood cell.

[0228] Embodiment 66. The method of Embodiment 65, wherein the blood cell is a hematopoietic cell or erythroblast.

[0229] Embodiment 67. The method of any one of Embodiments 61-66, wherein the EPSC is genetically modified.

[0230] Embodiment 68. The method of any one of Embodiments 61-67, further comprising differentiating the EPSC to obtain a skin cell, a blood cell, a neural cell, an immune cell, a liver cell, a lung cell, a pancreatic cell, or a muscle cell. EXAMPLES Example 1: Reprograming of human dermal fibroblasts (HDFs) into hEPSCs (hiEPSC)

[0231] Neonatal human dermal fibroblasts (HDFs) were purchased from Gibico (cat. no. C-004-5C) for reprogramming and hiEPSC establishment. They were maintained in M10 media. Other somatic cells such as erythroblasts from the peripheral blood are also suitable for reprogramming to hiEPSCs.

[0232] We first constructed an episomal plasmid constitutively overexpressing human RARG and LRH1 (hRL) (FIG. 1A) , which was used for electroporation into HDFs followed by infection with Sendai virus (SeV) overexpressing four Yamanaka reprogramming factors and hiEPSC line derivation (FIG. 1B) . Expression of hRL was confirmed by the green fluorescence from the eGFP (FIGs. 1C-1D) . This approach resulted in doom-shaped colonies like those for hEPSC-em to emerge among HDFs after around 3 weeks (FIG. 1E) when colonies were ready to be picked (FIG. 1F) . The colony numbers were consistent between replicates with up to 100%efficiency for stable hiEPSC line establishment (FIG. 1G) . Of note, colonies at picking day usually did not show no bright green fluorescence (FIG. 1H) . Small size colonies (<500 μm) were not picked (FIG. 1I) . During picking, a portion of each colony was kept for RT-PCR analysis to detect exogenous hRL expression using primer sequences set forth in SEQ ID NOs: 7-40 (Table 1) , which indicated these cells were reprogrammed by the 6 factors (FIG. 1J) . RT-PCR analysis was also performed to check for SeV infection and the four Yamanaka factor expression (FIGs. 1J-1K) . Finally, clean hiEPSC lines (> passage 5) were confirmed by the absences of exogenous hRL and SeV expression (FIG. 1K) . Table 1. Primer sequence for RT-PCR

[0233] The detailed protocol for deriving hiEPSC from HDFs is outline below:

[0234] (i) Human dermal fibroblasts (HDFs) electroporation: Timing 6-7 days. Prepare 4 gelatinized wells of a 24-well plate before electroporation.

[0235] (i-1) Observe the HDFs from 1 well of a 6-well plate under a microscope. On the day of electroporation, they should reach around 80%confluence.

[0236] (i-2) Aspirate the media from the well and wash them twice with 1 ml DPBS.

[0237] (i-3) Swirl the well with 1 ml of 0.25%trypsin-EDTA, covering the entire surface. Digest the cells in a TC incubator at 37℃ for 2 min. Observe the cells under the microscope periodically. Once the cells become round and begin to detach from the dish, neutralize trypsin by adding 1 ml of M10 media (vol / vol, 1: 1) .

[0238] (i-4) Pipette up and down across the dish several times to dissociate the cells. Transfer the cells into a 15 ml Falcon tube. Centrifuge the cells at 300 g for 3 min. Count the cells using a cell counter after aspirating the supernatant and resuspending the cells in 5 ml M10 medium.

[0239] (i-5) Pipette 3 x 105 cells from Step (i-4) into a microcentrifuge tube, centrifuge the cells at 300 g for 3 min, aspirate the supernatant and suspend the cells into 50 μl suspension Buffer R.

[0240] Once the cells are suspended in Buffer R, the electroporation should be performed without holding for a long time, as the cell could not survive in Buffer R.

[0241] (i-6) Mix 10 μg of plasmid pCEP4-hRL-eGFP in 50 μl suspension Buffer R, 10 μg of plasmid pCEP4-eGFP in 50 μl suspension Buffer R and prepare two microcentrifuge tubes with 1 ml M10 medium.

[0242] (i-7) Transfer 50 μl cells in Resuspension Buffer R to 50 μl DNA in Resuspension Buffer R as prepared in (i-6) , which makes a total of 100 μl volume for electroporation.

[0243] (i-8) Gently transfer the 100 μl cell / DNA in Resuspension Buffer R to the 100 μl Neon tip at a steady speed, ensuring that there are no air bubbles within the Neon tip. If there are still some air bubbles after the repeated transfer, add 10 μl Respsension Buffer R to the 100 μl cell / DNA mix and transfer again. Transfect HDFs at 1800V, 20 ms, 1 pulse with the NeonTM transfection system.

[0244] (i-9) Immediately transfer the electroporated cells back into the microcentrifuge tube with 1ml M10 medium (1100 μl in total) and mix well to ensure a homogenous suspension of cells.

[0245] (i-10) Transfer 550 μl (1 / 2 vol, around 1.5x105 transfected cells) to each well of a 24-well plate as prepared in Step (i) . Two wells for pCEP4-hRL-eGFP and two wells for control (pCEP4-eGFP) .

[0246] After transfection, it is critical to seed electroporated HDFs into two wells of the prepared 24-well plate. One well will be used to perform a cell count for Sendai virus transduction.

[0247] (i-11) At 24 hours after electroporation, perform Sendai virus transfection by following the manufacturer’s procedures. We transduced the cells using the CytoTuneTM 2.0 Sendai reprogramming vectors at MOI of KOS MOI=5, hc-Myc MOI=5, hKlf4 MOI=5.

[0248] (i-12) At 24 hours after virus transfection, refresh the transfected wells with 500 μl M10 medium.

[0249] (i-13) At 48 hours after virus transfection, replace the M10 medium with 500 μl of M15 media supplemented with 10 ng / ml Human LIF, 50 μg / ml Vc. Change the medium every other day and culture for 5 more days.

[0250] (i-14) Repeat steps (i-2) - (i-4) to dissociate the cells and seed 1-2x 104 cells into each well of a 6-well SNL76 / 7 feeder plate.

[0251] After 7 days post-transfection, it is critical to seed an appropriate number (around 1-2x104) cells onto inactivated SNL76 / 7 feeders. Seeding too many cells will result in very dense cultures. We recommend collecting the rest of the cells for RNA purification and used as positive control cells for detection of exogenous hRL and SeV (FIG. 1K) .

[0252] (i-15) Change the medium every other day and culture for 9 more days. It takes 16 days in total after Sendai virus transfection and before hiEPSC selection.

[0253] (ii) hiEPSC Colony formation and picking: Timing 7-9 days: Replace M15 (LIF, Vc ) with 2 ml hEPSCM for selecting hiEPSC colonies (see FIG. 1B) .

[0254] (ii-1) On the 19th day, prepare gelatinized 24-well plates, seed inactivated SNL76 / 7 feeders in M10 media with a density of 105 cells / 500 μl / well and culture for 3 days.

[0255] (ii-2) On the 22nd day, replace the M10 culture medium in a 24-well feeder plate with 500 μl hEPSCM supplemented with 10 μM Y-27632.

[0256] (ii-3) TrypLE 96 well plate preparation: add 20 μl TrypLE into each well and return the plate to the incubator.

[0257] (ii-4) After 5 days of culturing in hEPSCM for selection, pick hiEPSC colonies from the 6-well reprogramming plate using a pipette tip P-10. Transfer a single colony to a 96-well plate filled with 20 μl TrypLE Express Enzyme. Transfer 10 μl picked single colony into 20 μl TrypLE 96-well plate and incubate on a 38.5 ℃ heating pad for 3-5 min. Divide each picked colony into 2 parts. Use one part (15 μl) for expansion by transferring the cell aggregates to a well of the 24-well feeder plate (hEPSCM supplemented with 10 μM Y-27632) prepared in Step (ii-2) . Return the 24-well feeder plate to the incubator. Use the other part (15 μl) for exogenous hRL and SeV detection.

[0258] Rather than picking a single colony of hiEPSC, we break colonies down into small clumps, which helps them survive and recover.

[0259] (ii-5) Transfer the 15 μl part using a pipette tip P-10 into 100 μl TRIzol reagent for RNA purification followed by reverse transcription to prepare cDNA.

[0260] (ii-6) Use cDNA for RT-PCR to detect exogenous hRL and SeV expression.

[0261] It is essential to detect exogenous hRL expression from each picked single colony to confirm the cells’ identify from 6-factor reprogramming (FIG. 1J) .

[0262] (ii-7) Switch the media to fresh hEPSCM without Y-27632 after 24 hours for the 24-well plate. (ii-8) Culture for 5 days and perform single cell passage by proceeding to the next step to expand hiEPSC colonies.

[0263] (iii) hiEPSC expansion: Timing 10-14 days. Three days before passaging prepare gelatinized 24-well plates and seed inactivated feeder cells in M10 media with a cell density of 100,000 cells per 500 μl  / well. Culture for 3-day.

[0264] (iii-1) After three days, aspirate the media and wash the hiEPSC cells once with 500 μl PBS. Add 250 μl of TrypLE Express enzyme into each well of a 24-well plate and incubate the plate for 3 min at 37℃. It is possible to dissociate attached cells by using different volumes of TrypLE Express Enzyme. Normally we use 250 μl for a well of the 24-well plate, 1 ml for a well of the 6-well plate and 3 ml for a 10-cm dish.

[0265] (iii-2) Detach the cells from the plate by tapping it on the side. Add fresh M10 medium of equal volume to that of TrypLE Express Enzyme (eg 250 μl for a 24-well plate) . Pipette up and down across the well to dissociate hiEPSC cells.

[0266] (iii-3) Transfer the cell suspension to a new 15 ml Falcon tube. Centrifuge the tube at 300 g for 3 min. Resuspend the cell pellet in 500 μl fresh hEPSCM supplemented with 10 μM Y-27632 after carefully removing the supernatant.

[0267] (iii-4) Transfer the suspension of the cells (500 μl) to new SNL76 / 7 feeder plates (splitting ratio, 1: 1) . After 24 hours of culture, switch to 500 μl hEPSCM without Y-27632. Changing the media daily.

[0268] (iii-5) Monitor cells daily. Once the cells have covered 70 to 80%of the well surface, repeat Steps (iii-1) to (iii-3) and passage them onto the new 24-well feeder plate.

[0269] (iii-6) As soon as cells reach ~80%confluence (2-3 days) in the 24-well feeder plate, passage them into 1 well of a 6-well SNL76 / 7 feeder plate.

[0270] (iv) hiEPSC sub-colony: Timing 10-14 days. Three days before picking colonies, prepare a 24-well plate of SNL76 / 7 feeder cells at the density of 100,000 cells per 500 μl  / well. Culture for 3-day.

[0271] (iv-1) On the day of picking colonies, replace the M10 culture medium in a 24-well feeder plate with 500 μl hEPSCM supplemented with 10 μM Y-27632.

[0272] (iv-2) After culturing in hEPSCM for 3 passages, pick hiEPSC colonies from the 6-well plate using a pipette tip P-10. Transfer a single colony to a 96-well plate filled with 20 μl TrypL Express Enzyme. Transfer 10 μl picked single colony into 20 μl TrypLE 96-well plate and incubate on a 38.5 ℃ heating pad for 3-5 min. Transfer the cell aggregates (30 μl) to a well of the 24-well feeder plate (hEPSCM supplemented with 10 μM Y-27632) prepared in Step (iv-1) . Return the 24-well feeder plate to the incubator.

[0273] Rather than picking a single colony of hiEPSC, we break colonies down into small clumps, which helps them survive and recover.

[0274] (iv-3) Switch the media to fresh hEPSCM without Y-27632 after 24 hours.

[0275] (iv-4) Culture for 5 days and perform single-cell passage at a splitting ratio of 1: 1.

[0276] (iv-5) Monitor cells daily. As soon as cells reach ~80%confluence (2-3 days) in the 24-well feeder plate, passage them into 1 well of a 6-well SNL76 / 7 feeder plate at splitting ratio 1: 100.

[0277] (iv-6) After 5 days of culturing in hEPSCM, pick hiEPSC colonies into Eppendorf tubes from the 6-well plate using a pipette tip P-10 for RNA purification and then exogenous hRL and SeV detection.

[0278] (iv-7) The expression of exogenous hRL and reprogramming factors (SeV) should be silenced in hiEPSCs for the successful establishment of hiEPSC lines (FIG. 1K) . Example 2: Validation of hiEPSCs

[0279] The established lines of hiEPSC maintained their doom-shaped colonies over prolonged passage (FIG. 2A) with consistent cell-cycle dynamics (FIG. 2B) . RT-qPCR (FIG. 2C) , flow cytometry (FIG. 2D) and immunofluorescence (FIG. 2E) analyses confirmed the homogenous expression of pluripotency markers by hiEPSC lines (hiEPSC-C3 and C11) . Meanwhile, H3K27me3 levels were significantly lower in hiEPSCs than primed human stem cells cultured on feeder cells (FIG. 2F) . Furthermore, selective histone genes were highly expressed by both hiEPSC and hEPSC-em (FIG. 2G) , which is consistent with our previous establishment of hEPSC lines (Gao, X. et al. Establishment of porcine and human expanded potential stem cells. Nat Cell Biol 21, 687-699, doi: 10.1038 / s41556-019-0333-2 (2019) ) .

[0280] The genome stability of hiEPSCs was also maintained over prolonged culture as confirmed by whole genome sequencing (FIG. 3A) . Their pluripotency is confirmed by the formation of teratoma with tissues resembling lineages from ectoderm, mesoderm, and endoderm (FIG. 3B) . Additionally, the expanded developmental potential is confirmed by the immunofluorescence detection of trophoblast lineage cells in the teratoma tissues (FIG. 3C) . Furthermore, hTSC lines were derived from hiEPSCs (FIGs. 3D-3F) .

Claims

1.A method of making a somatic cell more susceptible to reprogramming into an expanded potential stem cell (EPSC) , comprising transiently introducing into and / or activating in the somatic cell a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) .2.A method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into and / or activating in a somatic cell a retinoic acid receptor (RAR) agonist and NR5A2 (LRH1) .3.The method of claim 1 or 2, wherein the method comprises transiently introducing into the somatic cell an RAR agonist and NR5A2.4.The method of claim 3, wherein the method comprises directly introducing the RAR agonist and / or NR5A2 into the somatic cell.5.The method of claim 3, wherein the method comprises introducing into the somatic cell a nucleic acid encoding the RAR agonist and / or NR5A2.6.The method of any one of claims 1-5, wherein the method comprises introducing into the somatic cell an agent that activates the RAR agonist and / or NR5A2 in the somatic cell.7.The method of any one of claims 1-6, further comprising introducing into and / or activating in the somatic cell one or more reprogramming factors.8.The method of claim 7, wherein the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, Myc, Nanog, and / or a small molecule compound.9.The method of claim 8, wherein the one or more reprogramming factors comprises Oct3 / 4, Sox2, Klf4, and Myc.10.The method of any one of claims 7-9, wherein the method comprises directly introducing the one or more reprogramming factors into the somatic cell.11.The method of any one of claims 7-9, wherein the method comprises introducing into the somatic cell a nucleic acid encoding the one or more reprogramming factors, optionally wherein the method comprises introducing nucleic acids encoding the RAR agonist, NR5A2, and optionally the one or more reprogramming factors into the somatic cell.12.The method of any one of claims 7-9, wherein the method comprises introducing into the somatic cell an agent that activates the one or more reprogramming factors.13.The method of claim 5 or 11, wherein the nucleic acids encoding the RAR agonist and NR5A2 are under the control of a promoter.14.The method of claim 5 or 11, wherein the nucleic acids encoding the RAR agonist and NR5A2 are under the control of different promoters.15.The method of claim 11, wherein the nucleic acids encoding the one or more reprogramming factors are under the control of a promoter.16.The method of claim 11, wherein the nucleic acids encoding one or more reprogramming factors are under the control of different promoters.17.The method of any one of claims 1-16, wherein the RAR agonist is RARA, RARB, or RARG, optionally wherein the RAR agonist is RARG.18.The method of any one of claims 8-17, wherein Myc is c-Myc, L-Myc, or N-Myc, optionally wherein Myc is c-Myc.19.The method of any one of claims 5 and 7-18, wherein the nucleic acids encoding the RAR agonist and NR5A2 are not integrated into the genome of the somatic cell.20.The method of any one of claims 11 and 13-19, wherein the nucleic acids encoding the one or more reprogramming factors are not integrated into the genome of the somatic cell.21.The method of claim 19 or 20, wherein one or more of the nucleic acids encoding the RAR agonist and NR5A2 and the nucleic acids encoding the one or more reprogramming factors are transiently introduced into the somatic cell(i) via a plasmid and / or a virus;(ii) via an episomal plasmid, optionally wherein the method comprises electroporating a mixture comprising the somatic cell and the episomal plasmid; and / or(iii) via a Sendai virus, optionally wherein the somatic cell is transfected with Sendai virus at MOI of 1 to 20.22.The method of any one of claims 1-21, wherein:(i) activating the retinoic acid receptor (RAR) agonist comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: CD1530, MM11253, Palovarotene, CD437, CD2665, CD271, and BMS-209641; and / or(ii) activating NR5A2 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: RJW100, RR-RJW100, SS-RJW100, Iso-RJW100, and ML-180.23.The method of any one of claims 8-22, wherein:(i) activating Oct3 / 4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: Oct4 inducer-1 (compound OAC-3) , OAC2, OAC1, Oct4 inducer-2, O4I2, and O4I4; and / or(ii) activating Klf4 comprises contacting the somatic cell with one or more small molecules selected from the group consisting of: APTO-253 (LOR-253) and DAPM.24.The method of any one of claims 1-23, wherein the somatic cell is a mammalian cell, optionally wherein the mammalian cell is a human cell or a cell from a non-human species selected from the group consisting of: a mouse, a rat, a sheep, a pig, a cow, and a primate.25.The method of any one of claims 1-24, wherein the somatic cell is a fibroblast, a urinary epithelial cell, a neural stem cell (NSC) , or a blood cell, optionally wherein the blood cell is a hematopoietic cell or erythroblast.26.The method of claim 25, wherein the somatic cell is from a blood sample, optionally wherein the blood sample has a volume of about 1 μL to about 10 mL.27.The method of any one of claims 1-26, further comprising culturing the somatic cell in a first medium for about 24 hours to about 72 hours after the RAR agonist and NR5A2 are transiently introduced or activated, optionally wherein the first medium is M10 medium.28.The method of claim 27, further comprising culturing the somatic cell in a second medium for about 7 days to 21 days after culturing the somatic cell in the first medium, optionally wherein the second medium is M15 medium supplemented with human LIF and vitamin C.29.The method of claim 28, further comprising culturing the somatic cell in a third medium after culturing the somatic cell in the second medium, optionally wherein the third medium is expanded potential stem cell culture medium (EPSCM) , optionally wherein the EPSCM comprises a basal cell nutrient medium supplemented with inhibitors consisting of a Src family Kinase (SFK) inhibitor, a GSK3 inhibitor and a tankyrase inhibitor, optionally wherein the EPSCM further comprises one or more of a RAS-ERK inhibitor, a p38 inhibitor and a JNK inhibitor.30.The method of any one of claims 1-29, wherein:(i) the EPSCs are free of the RAR agonist, NR5A2, and optionally the one or more reprogramming factors after no more than 5 passages; and / or(ii) the EPSCs are stable for at least 10 passages.31.A method of preparing an expanded potential stem cell (EPSC) , comprising transiently introducing into the somatic cell nucleic acids encoding reprogramming factors comprising: RARG, NR5A2, Oct3 / 4, Sox2, Klf4, and c-Myc to generate the EPSC.32.The method of claim 31, wherein(i) the nucleic acids encoding Oct3 / 4, Sox2, Klf4, and c-Myc are transiently introduced into the somatic cell via a Sendai virus; and / or(ii) the nucleic acids encoding RARG and NR5A2 are transiently introduced into the precursor cell via an episomal plasmid.33.An episomal plasmid comprising one or more nucleic acid sequences, wherein the one or more nucleic acid sequences encode Oct3 / 4, Sox2, Klf4, Myc, an RAR agonist, and / or NR5A2.34.An expanded potential stem cell (EPSC) produced by the method of any one of claims 1-32, optionally wherein the EPSC has one or more characteristics selected from the group consisting of:i)high expression levels of one or more histone genes selected from the group consisting of HIST1H1C, HIST1H2AC, HIST1H2BD, and HIST1H2BJ;ii) low expression level of H3K27me3;iii) high proliferation rate;iv) high precision genome editing capability;v)expression of pluripotency markers;vi) high genome stability; andvii) expanded developmental potential to derive trophoblast lineage cells, and optionally wherein the EPSC comprises one or more modifications to the genome.35.A composition comprising one or more EPSCs of claim 34 and / or cells differentiated therefrom.36.A method of treating an individual in need thereof, comprising administering an effective amount of the composition of claim 35 to the individual, optionally wherein the method further comprises obtaining a somatic cell from the individual, optionally wherein the somatic cell is a fibroblast, a urinary epithelial cell, or a blood cell.37.The method of claim 36, wherein the EPSC is genetically modified.38.The method of claim 36 or 37, further comprising differentiating the EPSC to obtain a skin cell, a blood cell, a neural cell, an immune cell, a liver cell, a lung cell, a pancreatic cell, or a muscle cell.

Citation Information

Patent Citations

  • Novel ips cell inducing method

    CN109913494A

  • Culture medium for mammalian expanded potential stem cells, composition, and methods thereof

    CN113966393A

  • Bovine induced expansion pluripotent adult stem cells, line establishment method and culture solution

    CN114369577A

  • Enhancers of induced pluripotent stem cell reprogramming

    US20140154805A1

  • In vitro production of expanded potential stem cells

    US20180201904A1