Plants having improved traits

By selectively increasing guard cell size in plants, the method addresses the challenges of elevated CO2 and water scarcity, improving growth and yield without adverse effects, thus enhancing water use efficiency and drought resistance.

WO2026087896A1PCT designated stage Publication Date: 2026-04-30WILD BIOSCIENCE LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-10-23
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Modern crops are not adapted to elevated carbon dioxide levels and water-limited conditions, leading to decreased yield and water use efficiency, with existing stomatal engineering methods causing negative effects such as dwarfism and reduced fertility.

Method used

Selectively increase the size of guard cells in plants to reduce stomatal conductance without altering stomatal density or dynamics, using genetic manipulation to enhance guard cell size relative to surrounding cells.

Benefits of technology

Improves plant growth and yield in water-limited conditions with no negative effects, enhancing water use efficiency and drought resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GB2025052322_30042026_PF_FP_ABST
    Figure GB2025052322_30042026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is a method for generating a plant having improved growth and / or yield. The method comprises selectively increasing the size of one or more guard cells in a plant wherein the guard cell size is increased compared to guard cell size in an independent wild type control plant of the same species under the same environmental conditions. The ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant. Also provided is a plant obtainable by the method; a gene construct; a transformed plant part or plant progeny; and a plant part, plant tissue, plant organ, plant cell, plant protoplast, embryo, callus culture, pollen grain or seed, derived or obtained from the plant.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] PLANTS HAVING IMPROVED TRAITS

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to the field of biotechnology, and more specifically to methods and compositions for improving growth and / or yield of plants. Genetically engineered plants are provided, along with their use in various applications. The invention further concerns parts of such engineered plants, such as plant cells, plant parts, plant organs, fruits, seeds, embryos, germplasm and processed plant products.

[0004] BACKGROUND

[0005] Agriculture uses 72% of freshwater withdrawals globally and is one of the most vulnerable sectors to climate-related water risks, such as drought [ref: UN World Water Development Report 2024], Across many regions of the world, climate models consistently project the occurrence and severity of drought to increase, even under simulations that include more aggressive climate mitigation strategies [ref: Cook, B. I., Mankin, J. S., Marvel, K., Williams, A. P., Smerdon, J. E., & Anchukaitis, K. J. (2020). Twenty-first century drought projections in the CMIP6 forcing scenarios. Earth's Future. 8, e2019EF001461 , https: / / doi.Org / 10.1029 / 2019EF0014611. Several regions of the world have been identified as particularly at risk of increased drying, and include Europe, Northern America, Central America, the Mediterranean, the Amazon, southern Africa, China, Southeast Asia, and Australia. Increasingly, crop productivity will be impacted by agricultural drought, putting strain on the ability of global food systems to provide food security. This comes in the face of the need to increase agricultural production by almost 50% by 2050, compared to 2012 levels, to meet growing demand [ref: UN World Water Development Report 2024], With this challenge in mind, there is an urgent need to provide plants that have improved growth and / or yield, particularly in water-limited conditions.

[0006] Modern crops are not adapted to today’s elevated carbon dioxide levels. With this invention we can genetically engineer plants to adapt their stomata for changing climate conditions. Stomata present are the primary way plants lose water via transpiration. Stomata have been engineering targets in the past, following two main modalities:

[0007] 1) Altered opening-closing dynamics such that total stomatai conductance over a given time period is reduced, see for example:

[0008] US 2014 / 0345000 uses hexokinase overexpression in guard cells to alter stomatai conductance. The role of HXK1 in controlling stomatai dynamics has been well described. In the guard cells, HXK1 catalyses the phosphorylation of glucose, producing a signal that triggers stomatai closure. Thus, HXK1 acts to “sense” sugar in the cell and integrate this signal to act in the control of stomatai aperture. However, there is evidence that perturbations to sugar metabolism in the guard cells (e.g. by the specific expression of HXK1) can have unforeseen effects on plant growth and development due to the extensive and well documented crosstalk between sugar sensing and hormonal signalling.

[0009] 2) Altered differentiation of guard cells during leaf development such that the stomata density is reduced and thereby stomatai conductance is reduced. Both approaches comes with significant drawbacks, most importantly decreased yield under well-watered conditions. These effects have limited their use in modern breeding or engineering approaches, see for example:

[0010] Jones, Hamlyn G. "Breeding for stomatai characters." Stomatai function (1987): 431-443;

[0011] Tanaka Y, Sugano SS, Shimada T, Hara-Nishimura I. Enhancement of leaf photosynthetic capacity through increased stomatai density in Arabidopsis. New Phytol. 2013 May;198(3):757-764. doi: 10.1111 / nph.12186;

[0012] Bertolino LT, Caine RS, Gray JE. Impact of Stomatai Density and Morphology on Water-Use Efficiency in a Changing World. Front Plant Sci. 2019 Mar 6; 10:225. doi: 10.3389 / fpls.2019.00225;

[0013] Hepworth, C., Doheny-Adams, T., Hunt, L., Cameron, D.D. and Gray, J.E. (2015), Manipulating stomatai density enhances drought tolerance without deleterious effect on nutrient uptake. New Phytol, 208: 336-341. https: / / doi.Org / 10.1111 / nph.13598;

[0014] Frangois Tardieu, Any trait or trait-related allele can confer drought tolerance: just design the right drought scenario, Journal of Experimental Botany, Volume 63, Issue 1, January 2012, Pages 25-31, https: / / doi.org / 10.1093 / jxb / err269 Therefore, novel ways of engineering crops to better withstand elevated CO2 levels and utilize water more efficiently are urgently needed.

[0015] This invention describes an entirely new stomata engineering modality that is not reliant on altering stomata dynamics or density, thereby avoiding the deleterious effects described above. In doing so we present a broadly applicable water use efficiency upgrades applicable to any plant.

[0016] The present invention selectively increases the size of guard cells, and thereby reduces stomatai conductance, in a plant. Prior to the present invention, guard cells have not been selectively manipulated in size in a plant. There have been some attempts to non-selectively increase the size of cells across the whole plant, however these have resulted in negative effects, see for example visible tissue defects and dwarfism (Larson-Rabin Z, Li Z, Masson PH, Day CD. FZR2 / CCS52A1 expression is a determinant of endoreduplication and cell expansion in Arabidopsis. Plant Physiol.

[0017] 2009 Feb;149(2):874-84. doi: 10.1104 / pp.108.132449). Conventional polyploidy induction methods, using chemical mutagens such as colchicine or trifluralin, have been used to non-selectively increase the size of cells across the whole plant (see for example Shariat and Sefidkon, 2021 (Tetrapioid induction in savory (Satureja khuzistanica): cytological, morphological, phytochemical and physiological changes) and Lei et al. , 2023 (Manipulation of ploidy for blueberry breeding: in vitro chromosome doubling of diploid Vaccinium duclouxii (Levi.) Hand.-Mazz by trifluralin)). Colchicine or trifluralin affect all cell types indiscriminately. Conventional polyploidy induction methods cause tetraploidy in all cell types including both guard cells and surrounding epidermal cells. In such whole-plant polyploidy approaches, while guard cell size increases, epidermal cell size also increases proportionally, meaning the ratio of guard cell size to epidermal cell size remains unchanged. Whole-plant polyploidy methods result in significant negative effects including dwarfism, reduced fertility, developmental abnormalities, and decreased agricultural performance.

[0018] SUMMARY OF INVENTION

[0019] The inventors have unexpectedly found that selectively increasing the size of guard cells in a plant results in improved plant growth and / or yield in water limited conditions. The size of the guard cells is increased relative to the surrounding cells. Since the guard cells now occupy a larger space within the plant, this results in a reduction in the stomatai aperture and decreased stomatai conductance. Prior to the present invention, guard cells have not been selectively manipulated in size in a plant. Thus, the approach used herein is novel. Overall, the present invention achieves enhanced plant growth and / or yield with no observable negative or deleterious anatomical, physiological, biochemical or developmental effects on modified plants. Methods and plants with improved growth and / or yield in water limited conditions are therefore provided based upon this surprising identification.

[0020] The present invention provides a method for generating a plant having improved growth and / or yield, wherein the method comprises selectively increasing the size of one or more guard cells in a plant wherein the guard cell size is increased compared to guard cell size in an independent wild type control plant of the same genus species under the same environmental conditions; wherein the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant.

[0021] Also provided herein is a plant having improved growth and / or yield wherein the plant has a selective increase in size in one or more guard cells relative to the guard cell size in an independent wild type control plant of the same genus species under the same environmental conditions; wherein the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant.

[0022] Also provided herein is a polynucleotide sequence encoding a factor that promotes endoreduplication or entry into the endocycle and a guard cell specific gene expression regulatory element. In some embodiments, there is provided a gene construct comprising a nucleotide sequence encoding a factor that promotes endoreduplication or entry into the endocycle and a guard cell specific gene expression regulatory element.

[0023] Also provided herein is a transformed plant part or plant progeny comprising the polynucleotide or gene construct of the invention. Also provided herein is a plant part, plant tissue, plant organ, plant cell, plant protoplast, embryo, callus culture, pollen grain or seed, derived or obtained from the plant of the invention.

[0024] BRIEF DESCRIPTION OF THE FIGURES

[0025] The invention will be further described by way of reference to the examples and accompanying figures.

[0026] Figure 1 depicts an illustrative diagram of the genetic vector used for maize transformation to express maize CDT1 specifically in the guard cells.

[0027] Figure 2 Stomatai conductance and photosynthetic efficiency. Representative Wild Water events (green) show a statistically significant decrease in water loss (p<0.05) while maintaining photosynthetic efficiency (OPS 11 ) . For the left figure (instantaneous water use efficiency) the units are mmol / m2 / s as stated in the title. For the right figure, PhiPSII is unitless (quantum efficiency of photosynthesis).

[0028] Figure 3 Estimated yield under varying drought conditions, (a) Multiple Wild Water events show improved yield compared to null segregants under severe drought (40% irrigation), (b) 2 best performing lines exhibit enhanced yield under 40%, 70%, and 100% irrigation conditions, (c) Photos of cobs from best performing line at 100% irrigation.

[0029] DETAILED DESCRIPTION

[0030] The following detailed description conveys exemplary embodiments of the present invention in sufficient detail to enable those of ordinary skill in the art to practice the present invention. Features, or limitations of the various embodiments described do not necessarily limit other embodiments of the present invention, or the present invention as a whole. Hence the following detailed description does not limit the scope of the present invention, which is defined only by the claims.

[0031] Conventional techniques in botany, microbiology, tissue culture, molecular biology, chemistry, biochemistry and recombinant DNA technology and bioinformatics for use in employing the present invention are all readily known and available to a person of average skill in the art. Specific techniques are explained fully in the literature.

[0032] In the present specification the term “genetically engineered' is used and as will be familiar to a person of skill in the art this term may encompass the terms “genetically modified” and “gene edited”, each of which is appreciated in the art as having respectively differing meanings and underlying technical methodology. However, the term “modified” in an unqualified sense herein, may be understood more simply to mean “changed”, “altered” or “different”. The terms “altered”, “changed” and “modified” may be used interchangeably herein. The terms "increase", "improve" or "enhance" are used interchangeably herein.

[0033] The method of the invention generates a plant having a desired phenotype or trait. The plant of the invention has a desired phenotype or trait.

[0034] The desired phenotype or trait is improved growth and / or yield. In one embodiment, the phenotype or trait is improved growth and / or yield in water limited conditions. In one embodiment, the phenotype or trait is improved growth and / or yield in sub-optimal irrigation conditions. Improved growth and / or yield in the plant is as compared to a control plant. Improved growth may be determined by measuring biomass, plant height, leaf area, or leaf mass compared to a control plant. A plant of the invention will have growth, as measured by a defined parameter, that is higher by a measurable amount than the growth of the same parameter in a control plant. Improved yield may be determined by measuring a plant product, for example grain, fruit, seeds, or biomass compared to a control plant. A plant of the invention will have a yield, as measured by a defined plant product, that is higher by a measurable amount than the yield of the same product in a control plant. In some embodiments, the plants have 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more or 100% or more increase in growth and / or yield, as compared to a control plant.

[0035] In one embodiment, the method of the invention generates a plant having improved water use efficiency, optionally photosynthetic water use efficiency, defined as the amount of net carbon assimilated into biomass per unit of water loss (Hatfield and Dold, Water-Use Efficiency: Advances and Challenges in a Changing Climate, Front. Plant Sci . , 19 February 2019 Sec. Plant Physiology). Plants of the invention may have a water use efficiency or photosynthetic water use efficiency that is greater than a control plant. Photosynthetic water use efficiency may also be measured as moles of carbon fixed by photosynthesis divided by the moles of water lost via transpiration. (Nguyen et al., Engineering stomata for enhanced carbon capture and water-use efficiency. Trends in Plant Science, Volume 28, Issue 11 p1290-1309 November 2023). In some embodiments, the plants have 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more or 100% or more increase in water use efficiency, optionally photosynthetic water use efficiency, as compared to a control plant.

[0036] In one embodiment, the water limited condition is drought and therefore the method of the invention generates a plant that is drought resistant or drought tolerant or a plant that has enhanced drought resistance or tolerance. In one embodiment, the plants generated by the method of the invention have enhanced drought resistance, as compared to a control plant. The terms drought resistance and drought tolerance are used interchangeably. Drought resistance describes the ability of a plant to recover from periods of little or no water (i.e. drought), sometime known as drought stress. Drought resistance for a crop may also be defined as the ability of a plant to maintain yield in the absence of water, relative to a control plant. The period of little or no water may be at least 5 days.

[0037] Drought resistance can be determined according to a number of well known techniques, for example growing a plant in drought conditions and assessing various parameters for plant growth and / or yield. A plant with enhanced drought resistance would have better capacity to survive and / or thrive, as determined via improved growth and / or yield, in drought conditions as compared to a control plant exposed to the same water limited conditions. In some embodiments, the plants generated by the method of the invention have 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more or 100% or more increase in resistance to drought, as compared to a control plant. The present invention provides a plant having improved growth and / or yield wherein the plant has a selective increase in size in one or more guard cells relative to the guard cell size in an independent wild type control plant of the same species under the same environmental conditions; wherein the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant. In one embodiment, the guard cell size in the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the guard cell size in the ratio of guard cell size to leaf epidermal cell size in the control plant.

[0038] The plant of the invention may be a genetically modified plant, a genetically enhanced plant, a genome edited plant, a non-naturally occurring plant and / or a genetically engineered plant. The plant of the invention may be generated using new genomic techniques or precision breeding techniques. In some instances, the plant may be transgenic plant.

[0039] Plants in accordance with the invention may be monocots or dicots; in some embodiments they are crop plants, e.g. fruits, vegetables, cereals, oilseed, and legumes, and may commonly be used for food, animal feed, biofuel or biomass production. A crop plant is any plant which is grown on a commercial scale for human or animal consumption or use. The plants may also be trees, particularly those popular in forestry and land management, carbon capture and biofuel or biomass production. The plants may be horticultural plants. In some embodiments, the plants are cover crops which are plants used to cover exposed soil between periods of cultivation. Cover crops are utilised to mitigate soil erosion, increase soil fertility and quality, in the conservation of water, management of weeds / pests and diseases and to maintain biodiversity and wildlife in an agroecosystem. Cover crops may be utilized during a fallow period in arable farming. During a fallow period, arable land is not sown with harvestable seed for at least one or more vegetative cycles. This allows the arable land to recover. Cover crops may be sown during a fallow period to assist in the recovery of the land.

[0040] In some embodiments, the plant, polynucleotide, polypeptide, cell, cell line or progeny disclosed herein may derive from a plant wherein the plant is a crop. In some embodiments the plant is a row or cover crop. In some embodiments, the plant is selected from a maize, corn, sugar cane, miscanthus, soybean, pea, cotton, canola, camelina, potato, tomato, sugar beet, cassava, sweet potato, alfalfa, wheat, barley, sorghum, oat, millet, rye, teff, rice, clover, cress, brassicas, vetch or prairie grasses. In one embodiment, the plant is a soy plant. In one embodiment, the plant is a maize plant. In one embodiment, the plant is a sugar beet plant. Additionally, the polynucleotide, polypeptide, cell, cell line or progeny disclosed herein may derive from a plant wherein the plant is a tree. In some embodiments wherein the tree is poplar, spruce, pine, eucalyptus, oil palm or rubber.

[0041] The method of the invention selectively increases guard cell size in a plant. Plants of the invention have guard cells that are selectively increased in size. Guard cell size can be defined in numerous ways and can be measured according to guard cell volume, guard cell length (pM), guard cell width (pM), stomatai density (mm2) and / or total guard cell area. In one embodiment, guard cell size is measured according to guard cell width (pM). Cell size is generally proportional to the amount of nuclear DNA in a cell (Beaulieu, J.M., Leitch, I. J., Patel, S., Pendharkar, A. and Knight, C.A. (2008), Genome size is a strong predictor of cell size and stomatai density in angiosperms. New Phytologist, 179: 975-986. https: / / doi.Org / 10.1111 / j.1469-8137.2008.02528.x; Franks PJ, Freckleton RP, Beaulieu JM, Leitch IJ, Beerling DJ. Megacycles of atmospheric carbon dioxide concentration correlate with fossil plant genome size. Philos Trans R Soc Lond B Biol Sci. 2012 Feb 19;367(1588):556-64. doi: 10.1098 / rstb.2011.0269). Therefore, in one embodiment, the guard cell size is increased as a result of an increase in DNA content or nuclear size of the cell.

[0042] In some embodiments, the plants generated by the method of the invention have 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more or 100% or more increase in guard cell size.

[0043] As a result of selectively increasing guard cell size, the method of the invention generates a plant wherein the stomatai size, i.e. the aperture defined by the two surrounding guard cells, is decreased. Stomatai size may be defined by length x width (pM2). In some embodiments, the plants generated by the method of the invention have 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more or 100% or more decrease in stomatai size.

[0044] Applying the method of the invention results in a plant wherein the size of the guard cells is selectively increased. Stomatai density (number of stomata per unit area on a plant's leaf surface) may be maintained in the plants of the invention and therefore may be substantially unchanged as compared to a control plant. The present invention does not reduce stomatai density. The method of the invention comprises selectively increasing the size of one or more guard cells in a plant wherein the guard cell size is increased compared to guard cell size in an independent wild type control plant of the same species under the same environmental conditions; wherein the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant. In one embodiment, the guard cell size in the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the guard cell size in the ratio of guard cell size to leaf epidermal cell size in the control plant. In one embodiment, the ratio of guard cell size to leaf epidermal cell size in the modified plant is increased as compared to the ratio observed in the control plant. The effect of this selective increase in guard cell size is to reduce stomatai conductance through the stomatai complex.

[0045] The invention also encompasses plants having guard cells selectively increased in size. The plants of the invention have a selective increase in size in one or more guard cells relative to the guard cell size in an independent wild type control plant of the same species under the same environmental conditions; wherein the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant. In one embodiment, the ratio of guard cell size to leaf epidermal cell size in the modified plant is increased as compared to the ratio observed in the control plant. The effect of this selective increase in guard cell size is that the guard cell occupies a larger space in the leaf epidermis and therefore there is a reduced stomatai conductance through the stomatai complex.

[0046] Selective increase in guard cell size is an increase in guard cell size relative to the other cells of the plant, for example the surrounding leaf epidermis cells. Guard cell enlargement is achieved without corresponding enlargement of surrounding epidermal cells. Plants of the invention do not have cell size enlargement across the whole plant. In one embodiment, the guard cell size is increased without increasing the cell size of the cells surrounding the guard cells. A selective increase in guard cell size enlarges guard cell size without affecting surrounding epidermal cell dimensions. There may be no enlargement of surrounding epidermal cells. Epidermal cell size, and cell size in surrounding tissues, is therefore maintained as in normal development and remains constant. In some embodiments, the epidermal leaf cell size is unchanged and therefore is the same size as in a control plant. The term “selectively” as used herein may also include the meanings of “specifically”, “exclusively” or “strongly preferential”.

[0047] A control plant may be a wild-type plant. A control plant may be an unmodified plant, i.e. the method of the invention has not been applied to the plant. A control plant may be a wild-type plant of the same species as the plant of the invention. A control plant may be a wild-type plant of the same species as the plant of the invention that is grown under the same environmental conditions, for example the same water, light and temperature levels. The control plant function is to provide a reliable reference against which the improved growth and / or yield in water limited conditions can be established as compared to a plant modified by the method of the invention or as compared to a plant of the invention.

[0048] In one embodiment, the method selectively increases guard cell size by modifying the G1 to S phase transition in the guard cell of the plant. In one embodiment, the method comprises modifying the expression and / or activity of Cyclin D genes or RBR genes.

[0049] In one embodiment, the method selectively increases guard cell size by promoting vacuolar expansion and / or cell wall loosening of the guard cell. During cell growth, vacuolar expansion and cell wall loosening occur. These processes could be increased in the guard cells by selective expression of the genes involved in vacuolar expansion and cell wall loosening in the guard cells. For example, expansin proteins mediate cell wall loosening and their overexpression in several plant species has been shown to cause an increase in cell size [Kuluev, B.R., Safiullina, M.G., Knyazev, A.V. et al. Effect of ectopic expression of NtEXPA5 gene on cell size and growth of organs of transgenic tobacco plants. Russ J Dev Biol 44, 28-34 (2013). https: / / doi.org / 10.1134 / S1062360413010049; Ma N, Wang Y, Qiu S, Kang Z, Che S, et al. (2013) Overexpression of OsEXPA8, a Root-Specific Gene, Improves Rice Growth and Root System Architecture by Facilitating Cell Extension. PLOS ONE 8(10): e75997. https: / / doi.org / 10.1371 / journal.pone.0075997). Alternatively, the same effect could be achieved by selective expression in the guard cells of other proteins with the ability to loosen cell walls such as cellulase (Park, Y.W., Tominaga, R., Sugiyama, J., Furuta, Y., Tanimoto, E., Samejima, M., Sakai, F. and Hayashi, T. (2003), Enhancement of growth by expression of poplar cellulase in Arabidopsis thaliana. The Plant Journal, 33: 1099-1106. https: / / doi.Org / 10.1046 / j.1365-313X.2003.01696.x) and Xyloglucan endotransglucosylase / hydrolases (Eva Miedes, Dmitry Suslov, Filip Vandenbussche, Kim Kenobi, Alexander Ivakov, Dominique Van Der Straeten, Ester P. Lorences, Ewa J. Mellerowicz, Jean-Pierre Verbelen, Kris Vissenberg, Xyloglucan endotransglucosylase / hydrolase (XTH) overexpression affects growth and cell wall mechanics in etiolated Arabidopsis hypocotyls, Journal of Experimental Botany, Volume 64, Issue 8, May 2013, Pages 2481-2497, https: / / doi.org / 10.1093 / jxb / ert107). In one embodiment, the method selectively increases guard cell size by modifying the expression and / or activity of an expansin protein in the guard cell, optionally wherein the modification of expression is overexpression. In one embodiment, guard cell size is increased by modifying the expression and / or activity of a protein that results in vacuolar expansion. In one embodiment, the method selectively increases guard cell size by modifying the expression and / or activity of a cellulase protein in the guard cell. In one embodiment, guard cell size is increased by modifying the expression and / or the activity of a protein that functions to loosen a plant cell wall. Modified expression may be increased or decreased expression relative to a control plant. Expression is modified as compared to a control plant. In one embodiment, the modification is overexpression.

[0050] In one embodiment, the method selectively increases guard cell size by modifying the expression and / or activity of the phytosulfokine receptor specifically in the guard cells. In one embodiment, the phytosulfokine receptor is PSKR1. PSKs regulate cell wall loosening and protoplast cell size, and their overexpression has been shown to cause an increase in cell size in several species (Yu, L., Liu, Y., Liu, Y. et al. Overexpression of phytosulfokine-a induces male sterility and cell growth by regulating cell wall development in Arabidopsis. Plant Cell Rep 35, 2503-2512 (2016). https: / / doi.org / 10.1007 / s00299-016-2050-7; Yu L, Liu Y, Zeng S, Yan J, Wang E, Luo L. Expression of a novel PSK-encoding gene from soybean improves seed growth and yield in transgenic plants. Planta. 2019 Apr;249(4):1239-1250. doi: 10.1007 / s00425-019-03101 -w).

[0051] In one embodiment, the method selectively increases guard cell size by increasing nuclear size. In one embodiment, nuclear size is increased by modifying the expression and / or activity of nucleoporins in the guard cell. In one embodiment, the nucleoporin is Nup136. In one embodiment, the nucleoporin is overexpressed in the guard cell.

[0052] In one embodiment, nuclear size is increased by modifying the expression and / or activity of proteins in the lamina-like structure in the nuclear envelope, specifically in the guard cells. In one embodiment, the protein of the lamina-like structure is KAKU4, overexpression of which has been shown to cause nuclear envelope protrusions (Chieko Goto, Kentaro Tamura, Yoichiro Fukao, Tomoo Shimada, Ikuko Hara-Nishimura, The Novel Nuclear Envelope Protein KAKU4 Modulates Nuclear Morphology in Arabidopsis , The Plant Cell, Volume 26, Issue 5, May 2014, Pages 2143-2155, https: / / doi.org / 10.1105 / tpc.113.122168). In one embodiment, the protein of the lamina-like structure is CRWN1 which has been shown to interact with KAKU4 (https: / / doi.Org / 10.1105 / tpc.113.122168).

[0053] In one embodiment, nuclear size is increased by modifying the expression and / or activity of nuclear envelope proteins that connect the nucleoskeleton to the cytoskeleton. The activity of these proteins could be specifically altered in the guard cells. A number of such proteins have been shown to affect nuclear morphology. In one embodiment, the nuclear envelope proteins is Myosin Xl-i (Myosin Xl-i Links the Nuclear Membrane to the Cytoskeleton to Control Nuclear Movement and Shape in Arabidopsis; Tamura, Kentaro et al. Current Biology, Volume 23, Issue 18, 1776 -1781; https: / / doi.Org / 10.1016 / j.cub.2013.07.035). In one embodiment, the nuclear envelope proteins are part of the SUN-WIP complex (Zhou X, Groves NR, Meier I. Plant nuclear shape is independently determined by the SUN-WIP-WIT2-myosin Xl-i complex and CRWN1. Nucleus. 2015;6(2): 144-53. doi: 10.1080 / 19491034.2014.1003512). Nuclear size could be increased by increasing the spacing between the inner and outer nuclear envelope which is regulated by the length of the luminal domain of the protein UNC-84 which forms part of the SUN-WIP complex (Cain NE, Starr DA. SUN proteins and nuclear envelope spacing. Nucleus.

[0054] 2015;6(1):2-7. doi: 10.4161 / 19491034.2014.990857). In one embodiment, nuclear size is increased by modifying the cell size sensors of the guard cell. In one embodiment, the cell size sensors is importin-alpha. In Xenopus egg cells, increasing the concentration (activity) of importin a was shown to increase nuclear size (Nuclear Size Is Regulated by Importin a and Ntf2 in Xenopus; Levy, Daniel L. et al. Cell, Volume 143, Issue 2, 288 -298; https: / / doi.Org / 10.1016 / j.cell.2010.09.012).

[0055] In one embodiment, the method selectively increases ploidy in the guard cells of the plant. Normal ploidy is maintained in surrounding epidermal cells. In one embodiment, the plant has one or more guard cells having increased ploidy. The ploidy is increased relative to the ploidy of the cells surrounding the guard cells in the leaf. Ploidy in the guard cells is selectively increased as compared to the ploidy of the guard cells in the plant prior to application of the method or to a control plant. In one embodiment, the ploidy of the guard cells of the plant is selectively increased, for example doubled, tripled, quadrupled, etc. In one embodiment, the number of pairs of chromosomes in the guard cell is selectively increased by the method of the invention or in the plant of the invention, as compared to a control plant. In one embodiment, the number of chromosome copies of one or more chromosomes in the guard cell is selectively increased by the method of the invention or in the plant of the invention. The number of chromosome pairs or chromosome copies in cell can be determined using standard methods. As a non-limiting example, an unmodified control plant may have diploid guard cells whereas a plant of the invention may have triploid, tetrapioid or higher ploidy guard cells. In one embodiment, the guard cells of the plants of the invention are polyploid. In one embodiment, the plant generated by the method of the invention or the plant of the invention has extra copies of the genomic DNA as compared to an unmodified or control plant. In one embodiment, guard cells of the plants of the invention have a higher n or an increased multiple of n, wherein n is the normal haploid chromosome number, compared to an unmodified or control plant. For example, applying the method of the invention to a diploid plant (2N) may result in selective increase in ploidy to 3N, 4N, 8N or more. In one embodiment, control of endoreduplication in guard cells is utilised to selectively increase ploidy in guard cells. Endoreduplication is used herein interchangeably with endoreplication. Endoreduplication refers to the process in which additional replication of chromosomes occurs without mitosis resulting in polyploid cells. Endoreduplication results in increased nuclear content and polyploidy. This may directly correlate with increased cell size in guard cells. In one embodiment, the method comprises selectively enhancing endoreduplication in guard cells of the plant. In one embodiment, the plants of the invention selectively have increased nuclear content in guard cells, as compared to a control plant. Normal nuclear content is maintained in surrounding epidermal cells.

[0056] Modifying the expression of various genes in the plant may be employed in the invention to selectively increase the size of guard cells.

[0057] In an embodiment, the method comprises selectively increasing endoreduplication in the guard cells of a plant via modifying the expression and / or activity of a cell-cycle control factor (also known as cell-cycle related factors), optionally a plant specific cellcycle control factor. A cell cycle control factor may be a cyclin, cyclin-dependent kinase or a cyclin-dependent kinase inhibitor. In an embodiment, the method comprises selectively modulating endoreduplication in the guard cells of a plant via modifying the expression and / or activity of a factor that promotes endoreduplication or entry into the endocycle. Expression is specifically targeted to guard cells while leaving surrounding epidermal cells unaffected. Adjacent or surrounding cell types, such as epidermal cells, are not affected. Modifying the expression refers to alteration the expression levels of the gene or the gene product, i.e. the encoded polypeptide, for the factor being expressed in the plant. In the case of the invention, this is selective expression in the guard cells. In an embodiment, the method comprises via modifying the expression and / or activity of a protein that interacts with a cell-cycle control factor, for example SIAMESE, E2F-DPa, LMI1 , ILP, TCP15, KRPs orHB12. In one embodiment, the modification is overexpression. In an embodiment, the method comprises via modifying the expression and / or activity of a protein that supresses endoreduplication, for example MED16, DEL1 or M-phase promoting factor. In one embodiment, the modification of activity is via downregulation of the protein. In one embodiment, the method comprises the step of modifying expression in one or more guard cells of a nucleic acid molecule comprising a nucleotide sequence that encodes a factor that promotes endoreduplication or entry into the endocycle. In one embodiment, the method comprises the step of modifying expression in one or more guard cells of a nucleic acid molecule comprising a nucleotide sequence that encodes a cell cycle control factor.

[0058] In one embodiment, the method comprises the step of altering heritable genetic material of the plant such that a cell-cycle control factor, optionally a plant specific cellcycle control factor, is selectively expressed in the guard cells of the plant. In one embodiment, the method comprises the step of altering heritable genetic material of the plant such that a factor that promotes endoreduplication or entry into the endocycle is selectively expressed in the guard cell(s) of the plant.

[0059] In one embodiment, said modification of expression is enhancing or reducing the expression and / or activity of a nucleic acid molecule comprising a nucleotide sequence. In a preferred embodiment, the modification of expression is overexpression. In one embodiment, the expression of a cell-cycle control factor in the guard cell may be enhanced or reduced. In one embodiment, the cell-cycle control factor may be overexpressed. In one embodiment, the expression of a factor that promotes endoreduplication or entry into the endocycle in the guard cell may be enhanced or reduced. In one embodiment, the factor that promotes endoreduplication or entry into the endocycle may be overexpressed. The term “overexpression” refers to the expression level of the factor that promotes endoreduplication or entry into the endocycle in comparison to endogenous baseline expression.

[0060] Methods for enhancing expression are well known to the skilled person, for example a promoter can be used to overexpress a gene or gene product or a transcription or translation enhancer may be used. Methods for decreasing expression are similarly well known to the skilled person, for example the use of antisense techniques or gene silencing to downregulate expression.

[0061] The term “gene” denotes a polynucleotide sequence which codes for a polypeptide in full or in part comprising introns and exons, and an open reading frame (ORF) to enable transcription. The term code denotes the ability of a nucleotide sequence to act as a template fortranslation, whereby the arrangement of nucleotides represents codons which further represent amino acids. A gene may further comprise additional genetic elements such as a promoter, repressor, terminator, enhancer and / or transcription factor binding elements. A gene may be inserted into the genome of an organism using genetic engineering methods known in the art, such as transformation. A gene may be exogenous (i.e. not native, inserted into the existing genome) or endogenous (i.e. exists within the genome as a native gene).

[0062] In one embodiment, the nucleic acid molecule comprising a nucleotide sequence that encodes a factor that promotes endoreduplication or entry into the endocycle may correspond to any of the polynucleotide sequences of CDT1, ZmCDTI (SEQ ID NO: 1), AtCDTIa (SEQ ID NO:2), AtCDTIb (SEQ ID NO: 3), HB12, HB128, ZmHB128 (SEQ ID NO: 4), ATHB12 (SEQ ID NO: 5) or an active variant, ortholog, derivative, fragment or functional fragment thereof or a sequence of at least 65% identity with any of said sequences; or a sequence of at least 70% identity with any of said sequences; or a sequence of at least 80% identity with any of said sequences, or at least 85%, at least 90%, or at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with any of said sequences. In one embodiment, the phosphorylation sites of the CDT1 have been removed. Active variants, orthologs, derivatives, fragments and functional fragments retain the activity of the full length polynucleotide sequence from which they are obtained and therefore also promote endoreduplication or entry into the endocycle.

[0063] The amino acid sequence encoded by the nucleotide sequence(s) of the invention may correspond to any of the amino acid sequences of CDT 1 , ZmCDT 1 (SEQ ID NO: 36), AtCDTIa (SEQ ID NO:37), AtCDTIb (SEQ ID NO: 38), HB12, HB128, ZmHB128 (SEQ ID NO: 39), ATHB12 (SEQ ID NO: 40) or an active variant, ortholog, derivative, fragment or functional fragment thereof or a sequence of at least 65% identity with any of said sequences; or a sequence of at least 70% identity with any of said sequences; or a sequence of at least 80% identity with any of said sequences, or at least 85%, at least 90%, or at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with any of said sequences. In one embodiment, the nucleic acid molecule comprising a nucleotide sequence that encodes a factor that promotes endoreduplication or entry into the endocycle may correspond to any of the polynucleotide sequences of CDC6 (SEQ ID NO:22), WEE1 (SEQ ID NO:23), CYCA2;3 (SEQ ID NO: 24), SIAMESE (SEQ ID NO:25), FIZZY-RELATED (SEQ ID NO:26), APC (SEQ ID NO:27), Kip related proteins (KRPs) (SEQ ID NO:28), SCL28 (SEQ ID NO:29), E2Fa (SEQ ID NQ:30), CCS52A (SEQ ID NO:31 ), Dpa (SEQ ID NO:32), TCP15 (SEQ ID NO:33), ILP (SEQ ID NO:34), LMI1 ((SEQ ID NO:35) or an active variant, ortholog, derivative, fragment or functional fragment thereof or a sequence of at least 65% identity with any of said sequences; or a sequence of at least 70% identity with any of said sequences; or a sequence of at least 80% identity with any of said sequences, or at least 85%, at least 90%, or at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with any of said sequences. Active variants, orthologs, derivatives, fragments and functional fragments retain the activity of the full length polynucleotide sequence from which they are obtained and therefore also promote endoreduplication or entry into the endocycle.

[0064] In one embodiment, the methods comprising altering the heritable genetic material of the plant such that the size of the guard cells of the plant are selectively increased. The altering of heritable genetic material may comprise inserting at least one polynucleotide into the heritable genetic material of a plant cell. The altering of heritable genetic material may also comprise genetically editing the heritable genetic material of a plant cell.

[0065] In some embodiments, the method is a method for increasing water use efficiency in a plant, the method comprising altering heritable genetic material of the plant such that a gene of interest (GOI) encoding a factor that promotes endoreduplication or entry into the endocycle (for example as described herein), or an active variant (or functional fragment) thereof wherein the variant retains the function of said factor, is specifically expressed in at least one guard cell of the plant. In some embodiments, the GOI is expressed under the control of a gene expression regulatory element, wherein the gene expression regulatory element is specifically active in the at least one guard cell of the plant. The term "active variant" and / or “functional fragment” as used herein in relation to a GOI refers to a variant or fragment of a GOI gene or peptide sequence which retains the function of said GOI. An active variant also comprises a variant of the gene of interest encoding a peptide which has sequence alterations that do not affect the function of the resulting protein, for example in non-conserved residues.

[0066] Any of the methods described herein may include, in some embodiments, generating may include designing changes that achieve the trait (guard cell size and / or ratio). The designing may include identifying changes (for example nucleotide changes) that will achieve the trait. In other embodiments, generating may not include designing. Any of the methods described herein may include, in some embodiments, generating may include making the desired changes, for example by altering heritable genetic material of the plant and / or plant cell, for example by the method including making one or more gene edits or one or more gene modifications (for example the techniques described herein). In other embodiments, generating may not include making said changes. Any of the methods described herein may include, in some embodiments, plant growth and / or plant transformation. For example, in some embodiments, generating may include plant growth and / or plant transformation. In other embodiments, plant growth and / or plant transformation are excluded. Any of the methods described herein may include one or more of the following:

[0067] a) designing changes that achieve the trait;

[0068] b) making the desired changes altering heritable genetic material of the plant and / or plant cell; and / or

[0069] c) plant growth and / or plant transformation.

[0070] Induction of the selective increase, for example through use of a suitable promoter, enhancer and / or genetic induction system such as the tet-on / off system to trigger the increase are also preferred in some embodiments.

[0071] Heritable genetic material denotes any polynucleotide sequence and any associated genetic elements in any cell or organelle which is capable of being passed from one generation to a subsequent generation through sexual or asexual reproduction. Sexual plant breeding methods may include propagation. Asexual reproduction, also known as clonal propagation, by way of grafting plant cuttings is also considered as the incorporation of heritable genetic material into the genome of the plant. The heritable genetic material may therefore only be present in part of the plant. A method in accordance with the invention may employ classical and well-known techniques of genetic modification, involving a method of transformation, whereby the polynucleotide is incorporated into a plant genome. Any necessary guard cell expression regulatory elements, for example promotors, may be present. In some embodiments this incorporation is stable and heritable so as to permit introduction of the modification into particular lines of crop plants; advantageously for the purposes of crop improvement or breeding programmes. A gene editing method may also be used to incorporate or give rise to the polynucleotide.

[0072] Although various methods for gene editing are known, including TALE Nucleases (TALENs) or Zinc Fingers, a CRISPR system may also be used. For example, a CRISPR system may be used whereby a guide RNA (gRNA) is selected to target the action of a CRISPR protein to a desired genomic locus, which may result in a homologous recombination (HR) event or non-homologous end joining repair, i.e. insertion-deletion of the polynucleotide into the plant genome. Examples of CRISPR systems include CRISPR-Cas and other non-Cas based gene editing, prime editing or base editing systems.

[0073] Therefore, the polynucleotides disclosed herein may include a polynucleotide encoding a CRISPR-Cas protein, optionally also a guide RNA (gRNA), wherein the gRNA directs the CRISPR-Cas protein to the locus of an endogenous cell-cycle control factor coding sequence in the plant cell genome, optionally wherein a regulatory element is inserted so as to direct selective expression of the cell-cycle control factor in the guard cells of the plant.

[0074] As will be readily understood by a person of skill in the art, the methods of the invention are for providing plants with an altered genetic make-up, compared to wild-type plants, or any plants which have not been subjected to a method of the invention. There are now many ways in which the genome of a plant can be altered, and various terms are used to describe these. Each of these terms will be familiar to the skilled reader and include “genetically modified”, “genetically engineered” or “gene edited” and are often used interchangeably. All refer to a plant which has had its genome sequence altered with respect to a non-modified control plant. This alteration could be caused by insertion of one or more polynucleotides into the genome of the target plant though any transformation, transfection, transduction, or genome engineering technique. This alteration may also be caused by nuclease-mediated genome editing, prime editing, and / or base editing.

[0075] Also provided is a method for generating a plant having improved growth and / or yield, the method comprising editing or modifying the genome of a plant or plant cell, for example using the editing tools described herein such a CRISPR (CRISPR-Cas, prime or base editing) or the modifying tool described herein, to thereby provide an edited or modified plant or plant cell. The plant or plant cell will have, or will be able to grow into a plant having, the traits described herein, for example the ability to selectively increase the size of one or more guard cells in that plant wherein the guard cell size is increased compared to guard cell size in an independent wild type control plant of the same species under the same environmental conditions; wherein the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant.

[0076] In one embodiment, the nucleotide sequence is operably controlled by a gene expression regulatory element active in the guard cell. In one embodiment, the gene expression regulatory element is a promotor, optionally a guard cell specific promotor. In one embodiment, the gene expression regulatory element is a promotor active in guard cell progenitor cells. In one embodiment, the gene expression regulatory element is a guard cell progenitor cell promoter. In one embodiment, the gene expression regulatory element is a promoter that is derived from, or consists of, a promoter of a gene expressed, or specifically expressed, in a cell of a plant leaf epidermis, preferably wherein the cell is a guard cell progenitor cell, and more preferably a guard cell. In preferred methods, the gene expression regulatory element is active specifically in at least some of the guard cells of the plant, whereby the polynucleotide sequence under the control of the regulatory element is expressed specifically in at least some of the guard cells of the genetically altered whole plant.

[0077] A promoter active in guard cells is a promoter which is presently enabling expression of a polynucleotide sequence in a guard cell, i.e. it is sufficient for protein production in guard cells. The promoter may be active in other cells of the plant, and in some embodiments comparatively greater in guard cells. The activity of the promoter may be enhanced when compared to a wild-type promoter. The activity of the promoter may be conditionally enhanced. The promoter may be an inducible promoter. The activity of the promoter may vary, such as seasonally, diurnally or in response to an external signal, i.e. temperature, pH, nutrient content of the soil. The promoter may be constitutively active.

[0078] The promoter may be a synthetic promoter comprised of various selected elements. For example, such a synthetic promoter may comprise guard cell specific transcription factor binding element upstream of a promoter element. There may be two or more transcription factor binding elements which may be the same or different. A plurality of such transcription factor binding elements may serve to enhance the activity and / or specificity of the promoter in guard cells. The promoter may be derived from non-plant organisms, such as the 35S promoter.

[0079] In other aspects, the guard cell specific promoter may be derived from a gene that is expressed preferentially or specifically in the guard cell of plants and therefore is a naturally occurring promoter. The gene may be expressed in other plant cell types at endogenous levels. The promoter may be selected based on its predicted function in a particular species. A person of skill in the art is well aware of many guard cell specific promoters. The guard cell specific promoter may be active in some or all other plant cells at some expression level but be highly expressed in the guard cells.

[0080] In one embodiment, the guard cell specific promoter has a sequence selected from SEQ ID NO: 6 (pOsFAMA), SEQ ID NO:7 (pStKSTI), SEQ ID NO: 8 (pZjPCK) ora or an active variant, ortholog, derivative, fragment or functional fragment thereof or a sequence of at least 65% identity with any of said sequences; or a sequence of at least 70% identity with any of said sequences; or a sequence of at least 80% identity with any of said sequences, or at least 85%, at least 90%, or at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with any of said sequences. Active variants, orthologs, derivatives, fragments and functional fragments retain the activity of the full length polynucleotide sequence from which they are obtained and therefore also promote endoreduplication or entry into the endocycle. In one embodiment, the guard cell specific promoter has a sequence selected from the genes pALMT6 (SEQ ID NO:9), pOSP1 SEQ ID NQ:10), pAT1G33811 (SEQ ID NO: 11), pAT3G23840 (SEQ ID NO: 12), pAT3G17070 (SEQ ID NO: 13), pAT5G18430 (SEQ ID NO:14), pKAT1 (SEQ ID NO:15), pKAT3 (SEQ ID NO:16), pMYB60 (SEQ ID NO:17), pGC1 (SEQ ID NO:18), pSCAPI (SEQ ID NO:19), pPME53 (SEQ ID NQ:20), pAPKIb (SEQ ID NO:21) or an active variant, ortholog, derivative, fragment or functional fragment thereof. Active variants, orthologs, derivatives, fragments and functional fragments retain the activity of the full length polynucleotide sequence from which they are obtained and therefore also promote endoreduplication or entry into the endocycle.

[0081] The polynucleotide may correspond to a full-length guard cell specific promoter, or a portion thereof. As mentioned above, it would be expected by a person of ordinary skill in the art that any promoter active in the guard cells of plants would work equivalently in this invention.

[0082] The term “portion”, “variant”, “homolog” or other representative wording in the art as used herein used in relation to a guard cell specific promoter sequence, or a functional fragment thereof, means any guard cell specific promoter ortholog of a differing polynucleotide or polypeptide sequence from any plant species.

[0083] In one embodiment, a gene construct is provided comprising a nucleotide sequence encoding a factor that promotes endoreduplication or entry into the endocycle and a guard cell specific gene expression regulatory element. In one embodiment, the factor that promotes endoreduplication or entry into the endocycle has the polynucleotide sequence of CDT1, ZmCDTI (SEQ ID NO: 1), AtCDTIa (SEQ ID NO:2), AtCDTIb (SEQ ID NO: 3), HB12, HB128, ZmHB128 (SEQ ID NO: 4), ATHB12 (SEQ ID NO: 5) or an active variant, ortholog, derivative, fragment or functional fragment thereof. In one embodiment, the gene expression regulatory element is a promoter, optionally a guard cell specific promoter or a guard cell precursor cell promotor. In one embodiment, the guard cell specific promoter has a sequence selected from SEQ ID NO:6 (pOsFAMA), SEQ ID NO:7 (pStKSTI), SEQ ID NO:8 (pZjPCK) ora or an active variant, ortholog, derivative, fragment or functional fragment thereof. A plant comprising the gene construct, or transformed by the gene construct, is also provided. A transformed plant part or plant progeny comprising the gene construct is also provided.

[0084] In some embodiments, the gene construct is a polynucleotide sequence and so references provided herein to a gene construct comprising a polynucleotide may be understood as simply a polynucleotide. Therefore, in one embodiment, there is provided a nucleotide sequence encoding a factor that promotes endoreduplication or entry into the endocycle and a guard cell specific gene expression regulatory element. The features described herein for the gene construct may also apply to the polynucleotide.

[0085] Additionally provided is a plant part, plant tissue, plant organ, plant cell, plant protoplast, embryo, callus, cell culture, pollen grain or seed, derived or obtained from the plant disclosed herein.

[0086] Also provided herein are plant cells, cell lines or progeny thereof comprising the polynucleotide sequence or polypeptide sequence disclosed herein. The term “plant” encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, fruit, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each comprise the polynucleotide of the invention. The term "plant" also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, wherein each comprise the polynucleotide of the invention.

[0087] Also provided herein are vectors comprising the polynucleotide sequence of the invention. In some embodiments, the vector is a plasmid. The plasmid may comprise an origin of replication, a T-DNA right border repeat of a Ti or Ri plasmid, a left border repeat of a Ti or Ri plasmid and at least one bacterial selectable marker. The plasmid may also comprise an enhancer, a plant selectable marker, a multicloning site and / or a recombination site.

[0088] Compositions for transformation of plant cells comprising the polynucleotide of the invention or the vector comprising the polynucleotide of the invention are also provided herein. The vector may comprise microparticles coated with said polynucleotide or said vector.

[0089] Transformation of plants is a routine technique in many species. Any of several transformation methods may be used to introduce a gene of interest into a suitable ancestor cell. According to the various aspects of the invention, the polynucleotide of the invention is introduced into a plant and expressed as a transgene through transformation. The term "introduction" or "transformation" as referred to herein encompasses the transfer of an exogenous polynucleotide into a host cell, irrespective of the method used for transfer. The methods described for the transformation and regeneration of plants from plant tissues or plant cells may be utilized for transient or for stable transformation. Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, floral dipping, biolistics, transformation using viruses or pollen and microinjection. Methods may be selected from electroporation, microinjection, RNA-coated particle bombardment or viral transfection, but are not limited to those methods recited here. The transformation method is usually dependent on the species of choice. The polynucleotide may be transiently or stably introduced into a host cell and may be maintained non-integrated, for example, as a plasmid. Alternatively, it may be integrated into the host genome. The resulting transformed plant cell may then be used to regenerate a transformed plant. To select transformed plants, plant material obtained in the transformation is, as a rule, subjected to selective conditions so that transformed plants can be distinguished from untransformed plants. For example, seeds obtained in the above-described manner can be planted and, after an initial growing period, subjected to a suitable selection and screening.

[0090] Also provided herein are bacteria comprising the polynucleotide of the invention, or a vector comprising the polynucleotide of the invention. In some embodiments, the bacterium is E coli. or Agrobacterium sp., and in some embodiments A. tumefaciens. Any suitable cloning system may be used. Genetically modified plants, including crop plants, are in some embodiments produced via Agrobacterium tumefaciens mediated transformation. Such routine methods are also used to introduce gene editing proteins such as CRISPR-Cas nucleases and base editors, which can be used to edit native sequences. Also provided herein are processed plant products obtained from the plant or the plant part, plant tissue, plant organ, plant cell, plant protoplast, embryo, callus culture, pollen grain or seed disclosed herein. The processed plant product may comprise a detectable nucleic acid sequence of (i) a nucleotide sequence encoding a factor that promotes endoreduplication or entry into the endocycle downstream of a guard cell specific gene expression regulatory element, or (ii) a nucleotide sequence or at least a portion of a nucleotide sequence of the invention which is present in the product. Processing may involve chemical or physical manipulation of the product in order to form a product with desirable properties suited to a particular function, i.e. pelleting.

[0091] It will be understood that in jurisdictions where plant varieties or plants per se may be excluded from patentability, the present invention encompasses and is directed to the underlying methods of genetic modification and transformation, the gene constructs and vectors described herein, the transformed plant cells and plant parts, and the uses and applications of such compositions and methods. The invention further encompasses the processes for producing plants with the desired traits, the molecular tools and techniques for achieving selective guard cell modification, and the industrial and agricultural applications of the resulting plant materials. Where plant varieties or plants themselves may not be patentable subject matter, the invention specifically covers the biotechnological methods, compositions, and processes that enable the production of plants with improved water use efficiency through selective guard cell engineering. In some embodiments, the method does not comprise or encompass an essentially biological process for the production of plants, such as crossing and selection. In some embodiments, the plant is not a plant variety right. The present invention is directed to plants obtained through technical means and is not concerned with the breeding or selection of plant varieties per se.

[0092] EXAMPLES

[0093] The present invention will now be described with reference to specific examples, which should not be construed as limiting. Example 1: Expression of an endoreduplication promoting factor specifically in guard cells results in reduced stomatai conductance

[0094] To demonstrate the impact of the guard cell specific expression of an endoreduplication promoting factor on stomatai conductance the Zea mays CDT1 gene [SEQ ID NO: 1] was cloned into a plant transformation vector. Two versions of this vector were made. In the first version the CDT1 gene is expressed under the control of the Solanum tuberosum KST1 promoter [SEQ ID NO: 7], In the second version the CDT 1 gene is expressed under the control of the Oryza sativa FAMA promoter [SEQ ID NO: 6] (Figure 1). Zea mays plants were transformed with each of these two vectors using agrobacterium-mediated transformation. Multiple independent single insertion transgenic lines were obtained and propagated to the T2 generation. Heterozygous T2 plants were then grown along-side non-modified control plants in controlled environment conditions and subject to stomatai conductance analysis using a LICOR LI600. This revealed that plant lines expressing the endoreduplication promoting factor had reduced stomatai conductance compared to non-modified control plants by more than 20% (Figure 2A). Importantly, this reduction in stomatai conductance did not impact photosynthetic efficiency as there was no significant difference in operating efficiency of photosystem II (Figure 2B). Additionally, biomass measurements taken after a period of mild drought treatment showed a 10% increase. DAPI fluorescence measurements of the stomatai complex reveal increases in guard cell size, and specifically an increase in the ratio of the guard cell to the subsidiary cell, in comparison to the azygous control plants.

[0095] Example 2: Expression of an endoreduplication promoting factor specifically in guard cells results in enhanced yield compared to non-modified control plants

[0096] To demonstrate the impact of the guard cell specific expression of an endoreduplication promoting factor on plant yield the above plants were grown in a replicated block design field trial. In this trial, plants transgenic plants of the invention and non-modified control plants were subject to different watering regimens ranging from 100% water to 40% water. Consistent with the stomatai conductance data above, plants that were specifically expressing the endoreduplication factor in the guard cells accumulated more biomass, exhibiting a remarkable 200+% increase in yield under heavy drought conditions with only 40% irrigation (Figure 3A) and produced more seed (Figure 3B) than non-modified control plants. This increase was observed irrespective of what watering regimen was applied. Even under optimal irrigation conditions (100% irrigated), there was a noticeable 10-15% increase in yield. Furthermore, drought stress indicators showed improvement, with a decrease in the anthesis-silking interval and an increase in plant height.

[0097] Materials and methods for Examples 1 and 2

[0098] Trait design

[0099] The strategy is to drive expression of the maize CDT 1 protein (gene 1) and a version of the maize CDT1 protein with its CDK phosphorylation sites removed (gene 2) in mature guard cells. Three promoters have been designed to do this (promoter 1, promoter 2, and promoters)

[0100] Genes

[0101] Gene 1: ZmCDTI

[0102] • CDT 1 functions by recruiting the DNA helicase MCM to the origins of replication in chromosomes as part of the initiation of DNA synthesis during the cell cycle. • There is one maize CDT1 protein (ZmCDTI) with two orthologs in Arabidopsis (AtCDTIa and AtCDTIb). The Arabidopsis orthologs appear to have redundant functions with CDT1b being less active than CDT1a (Castellano, M. et al. DNA replication licensing affects cell proliferation or endoreplication in a cell typespecific manner. Plant Cell (2004)). ZmCDT 1 will be used in the constructs for this trait.

[0103] • ZmCDTI contains two protein domains: a CDT1 domain and a CDT1 C-terminal domain. This domain architecture appears to be conserved across plants and maps onto the ‘central domain’ and ‘MCM domain’, respectively, of other eukaryote CDT 1 proteins (Pozo, P. N. & Cook, J. G. Regulation and Function of Cdt1 ; A Key Factor in Cell Proliferation and Genome Stability. Genes (2017)).

[0104] • Between these two domains there is a linker sequence which has previously been shown to contain cyclin dependent kinase (CDK) phosphorylation sites; phosphorylation of which targets CDT 1 for proteolytic degradation. Gene 2: ZmHB128

[0105] • A further exemplary gene has been identified which is similarly predicted to positively regulate endoreduplication upon overexpression.

[0106] Promoters

[0107] Promotor 1 : pOsFAMA

[0108] • The first is the promoter sequence for the rice transcription factor FAMA (OsFAMA). This transcription factor promotes terminal guard cell differentiation in dicots and monocots (Guo, X. et al. Establishing asymmetry: stomatai division and differentiation in plants. New Phytologist (2021)). The promoter sequence (pOsFAMA) was taken as the 2.5kb region upstream of the OsFAMA CDS.

[0109] Promotor 2: pStKSTI

[0110] • The second promoter (pStKSTI) is a mature guard cell specific promoter from Solanum tuberosum which has been shown to drive expression in mature guard cells in several different plant species including one monocot (Barley) (Kelly, G. et al. The Solanum tuberosum KST1 partial promoter as a tool for guard cell expression in multiple plant species. Journal of Experimental Botany (2017)).

[0111] Promotor 3: pZjPCK

[0112] A third promoter (pZjPCK) has also been identified and is best known for its ability to drive expression in rice bundle sheath cells (Nomura, M. et al. Differential Expression Pattern of C4 Bundle Sheath Expression Genes in Rice, a C3 Plant. Plant Cell Physiology (2005)).

[0113] Final construct design and event number

[0114] Constructs will be made to drive CDT1 expression by each of the three promoters described here (pOsFAMA (SEQ ID NO:6), pStKSTI (SEQ ID NO:7), and pZjPCK(SEQ ID NO:8)). In addition, a construct will made to drive CDT1 expression ubiquitously from a 35S promoter (p35S). This will validate that it is the guard cell / bundle sheath specific expression of CDT1 that confers any trait improvement rather than general overexpression of CDT 1.

[0115] Methods Maize transformation

[0116] Maize was transformed using Agrobacterium tumefaciens-mediated methods. The selection marker used was BASTA (bar gene).

[0117] Genotyping / QC

[0118] Background information on Maize lines:

[0119] TO plants: were all backcrossed to WT LH244 to ensure the production of T 1 seed [due to the tissue culture process, there is a risk of self-pollination not occurring in the TO plants and not producing seed],

[0120] T 1 plants: all the 1 -insertion events (lines) for constructs StKST (pWB0154 -pStKST1::ZmCDT1::tNOS - pRUBQ2P5Ui::BARPIus::tRUBQ2) (2 lines) and OsFAMA (pWB0153 - pOsFAMA::ZmCDT1 ::tNOS -pRUBQ2P5Ui::BARPIus::tRUBQ2) (5 lines) were grown out and genotyped by basta leaf painting to identify heterozygous plants. For each line, heterozygous plants were backcrossed (to LH244) oroutcrossed (to PHP02).

[0121] As a result, T 1 seed and T2 seed batches are always a mix of Heterozygous and Azygous seeds. Each time plants were grown out for phenotyping they were genotyped to differentiate between the two genotypes.

[0122] Genotyping:

[0123] Genotyping was carried out by dPCR singleplex (no probes) to determine the zygosity (copy number) of the plants. The Bar+ resistance gene was used as the Target gene (with primers V0296 / V0297), and the ZmADHI gene, a single copy gene in the soybean genome, is used as the Reference gene (with primers V0294 / V0295) (see Table 1 ).

[0124] Table 1. Primers used fordPCR genotyping

[0125] Primer Name Primer Sequence

[0126] V0296_Bar+_F1 TGGATCTGTGAACCTCCACT

[0127] V0297_Bar+_R1 CTCCATCAAGGTCAAGCCAA

[0128] V0294_ZmADH1_F1 GAATGTGTGTTGGGTTTGCAT

[0129]

[0130] | V0295_ZmADH1_R1 | TCCAGCAATCCTTGCACCTT |

[0131]

[0132] To confirm the presence of the gene of interest (GOI) in the heterozygous and absence in the azygous, PCR and gel band visualization were performed. Primers used for PCRs are listed in Table 2.

[0133] Table 2. Primers used for PCR genotyping

[0134] Primer Primer sequence

[0135] Construct name

[0136] V0354 CACTCAAATTCCATCCTTGCAATA StKST: pWB0154

[0137] V0355 AGTTTCTTGGAAAGGCAATGTG V0348 TCTGTGAAACGACTGCTCTGC OsFAMA: pWB0153

[0138] V0349 ATCTTCTTCGCGGCCTTATCC StKST: pWB0154 and

[0139] OsFAMA:pWB0153 V0353 AGAACGGCGAAGAGATCAGC

[0140]

[0141] LI-6800 Portable Photosynthesis System

[0142] T1. Phenotyping (LICOR) for Proof of Mechanism

[0143] Maize leaves were analyzed using the LI-6800 Infrared Gas Analyzer (IRGA) from LICOR Biosciences to measure stomatai conductance. Additional data collected included assimilation rate, internal CO2concentration (Ci), stomatai conductance to water vapor (gsw), electron transport rate (ETR), non-photochemical quenching (NPQ), and quantum efficiencies for Photosystem II (PhiPS2) and CO2assimilation (PhiCO2).

[0144] Plant Growth & grow room conditions: Maize plants were grown under fullspectrum white LED light. Initially sown into peat compost in small plugs, the seedlings were transplanted to pots containing a mix of blended loam, peat, perlite, sand, and Osmocote 19:9:12 +TE slow-release fertilizer. These plants were grown until they were large enough to undergo glufosinate ammonium (BASTA) testing to distinguish between wild-type and heterozygous plants, allowing for subsequent measurements. The plants were kept well watered for the whole duration of the experiment. Growroom Conditions: Photoperiod: 16 hours of light and 8 hours of dark.Light Intensity (Qambient): 600-800 pmol / m2 / s at pot height. Day Temperature:

[0145] Maintained at25°C. Night Temperature: Maintained at 21 °C. Relative Humidity:

[0146] Not controlled.

[0147] Measurement Window, Leaf Selection and number of plants: Measurements were performed 21 days after sowing (DAS) during the vegetative growth stage. For all measurements, the second top most fully elongated leaf which was mostly parallel to light source was chosen and carefully clamped to avoid the mid-rib, ensuring complete coverage of the 6 sq cm aperture. Measurements were taken between 9:00 AM and 12:30 PM, starting one hour after the lights were turned on and completed within a 3.5-hour window. Based on Basta selection and genotyping, a minimum of three and up to a maximum of nineteen plants were measured for each azygous or homozygous type.

[0148] Environmental Constants for LI6800: The experiment maintained the following environmental conditions in LI6800 :

[0149] CO2 concentration: 400 ppm

[0150] Leaf Temperature (Tleaf): 26°C

[0151] Relative Humidity (RH): 55%

[0152] Quantum Light Input (Qin): 1800 pmol / m2 / s

[0153] Flow Rate: 500 pmol / s

[0154] Measurement Protocol: A stabilization period of 12 minutes was observed before logging data. Both water vapor and CO2 data were logged without a light flash. The CO2 control was set using the command SETCONTROL 'CO2_r, 400, float. A loop was executed 17 times to log data, with a 15-second wait before recording data. Measurements incorporated a rectangular light flash and returned to the main program after the loop's completion.

[0155] LI-600 Porometer / fluorometer

[0156] T2. Phenotyping (Porometer) for Proof of Mechanism • Stomatai conductance to water (transpiration) measurements were taken with the LI-600 Porometer / Fluorometerfrom LICOR Biosciences. Photosystem II efficiency was also automatically logged by the LI-600.

[0157] • Measurements were taken over the span of 90 minutes, beginning two hours after lights were turned on in the Controlled Environment Room.

[0158] • Measurements were conducted on the most recently fully expanded mature leaf. Depending on the line, measurements were conducted on the 3rd-8th leaf. No significant difference in stomatai conductance to water was noted between different leaf numbers.

[0159] • Four measurements were taken on the upper middle section of the leaf. The mean of the four measurements was taken.

[0160] • Leaves with broken midribs were ignored. Shaded sections of leaves were ignored.

[0161] • Environmental setup:

[0162] • Phenotyping Room: PR 2

[0163] • Light intensity: 100%

[0164] • Photoperiod: 08:00 - 00:00

[0165] • Day temperature: 25°C

[0166] • Night temperature: 21 °C

[0167] • Relative humidity: Not controlled

[0168] • Fan speed: 40%

[0169] • Plants were well-watered for the first week of measurements. During this time, water was increased as necessary to supply the maize plants. After one week, water was completely shut off, and plants were measured with the LI-600 again.

[0170] Biomass

[0171] T1. Phenotyping (LICOR) for Proof of Mechanism

[0172] Following the completion of LICOR measurements on ~3-week-old plants, irrigation was discontinued to impose drought stress. Two weeks after witholding of water, the above ground part of plant was harvested and weighed to assess aboveground fresh biomass. T2. Phenotyping (Microscopy and RNAseq) for Proof of Mechanism

[0173] After four weeks of being watered, plants were draughted fora full week. One week after the complete stoppage of water, plants were harvested for aboveground fresh biomass. The biomass was then heated in a Carbolite Gero AX060 oven for 48 hours at 80°C before dry biomass data was collected.

[0174] Stomatai density counting

[0175] T2. Phenotyping (Microscopy and RNAseq) for Proof of Mechanism

[0176] The fourth true leaf of the plant was harvested when the collar was fully exposed. 2cm2samples were taken from 2cm, 12cm and 22cm from the collar. A thin layer of clear nail polish was applied to the abaxial surface of the leaf. The polish was left to dry for 20 minutes. Using a scalpel, the nail polish was gently separated from the leaf and place on a drop of water on a slide before being visualised under a microscope at 20X magnification. The number of visible stomata was counted within the view, and ten separate locations of the leaf were viewed.

[0177] T2. Phenotyping (Microscopy and RNAseq) for Proof of Mechanism

[0178] • The fourth true leaf of the plant was harvested when the collar was fully exposed. 2cm2samples were taken from 0cm, 10cm and 20cm from the collar. Small (2-3mm) vertical strips were torn from the leaf, resulting in the edge of the strip having a small section exclusively composed of epidermis and no other cell layers.

[0179] • This tissue was fixed using a solution of three parts 95% ethanol to one part glacial acetic acid. Fixing was done overnight at room temperature on an orbital shakerat 150 rpm.

[0180] • Fixed tissue was washed for 30 minutes in type II water, followed by 0.5M EDTA.

[0181] • Epidermal peels were then placed in opaque black microfuge tubes to protect the samples from light. A 10 ug / mL solution of 4',6-diamidino-2-phenylindole (DAPI) in Mcllvaine's buffer (60 mL 0.1 mol / L citric acid with 40 mL 0.2 mol / L Na2HPO4) was added to the epidermal peels.

[0182] • Samples were vacuum infiltrated three times, with three minutes of time under a vacuum each time. Samples were then incubated for 4-6 hours at 4°C. • Epidermal peels were mounted on glass slides and visualised using a UV fluorescence filter at 100X using oil immersion.

[0183] • Images were collected from the microscope, nuclear outlines traced, and the total fluorescence measured using Imaged.

[0184] RNA extraction / sequencing / analysis

[0185] T2 plants

[0186] Sampling

[0187] StKST (pWB0154 - pStKSTI ::ZmCDT1 ::tNOS - pRUBQ2P5Ui::BARPIus::tRUBQ2): Maize plants were grown in 3L pots. For each genotype, three plants were harvested for leaf samples and pooled together. Each genotype was sampled in duplicate. Samples were immediately put into liquid nitrogen after sampling.

[0188] Leaf samples were taken from the leaf base (at ligule), middle (15cm from base of ligule) and tip (30cm from base of ligule) of the fourth true leaf. Samples were taken as the fourth leaf's ligule became fully exposed. Sampling at multiple parts of the leaf was to ensure an even expression profile of the leaf.

[0189] Samples were taken using a leaf disc puncher.

[0190] OsFAMA (pWB0153 - pOsFAMA::ZmCDT1 ::tNOS -pRUBQ2P5Ui::BARPIus::tRUBQ2):

[0191] For each genotype, three plants were harvested for leaf samples and pooled together. Two separate parts of the plant's anatomy were sampled, each in duplicate. Samples were immediately put into liquid nitrogen after sampling.

[0192] Leaf samples were taken as described above for StKST lines. For tiller leaf base samples, tillers were cut using a scalpel at the base of the tiller, just above the soil. The outer layers of the tiller were excised, revealing developing leaf tissue at the core. Approximately 100mg of tissue just above the scalpel cut were used for the sample.

[0193] RNA Extraction RNA was extracted using the RNease Plant Mini Kit (QIAGEN), with DNAsel treatment performed on column during extraction process. The Nanodrop (RTM) was used to obtain concentration (ng / uL) and purity of RNA samples.

[0194] Samples were then sent to Novogene for Eukaryotic mRNA-Sequencing (strand specific library).

[0195] mRNAseq analysis method

[0196] Raw reads (fastq data) from Novogene were trimmed with Trimmomatic v0.39 (Bolger et al. 2014), with settings ‘LEADING: 20, TRAILING: 20, SLIDINGWINDOW: 5:20, MINLEN: 35’. Transcript counts and effective lengths were then quantified using the gene models from the maize genome (Zmays_493_RefGen_V4, Phytozome genome ID: 493) with the addition of the transformed ZmCDTI gene model which has a different 5’ and 3’ untranslated region, as well as two cloning domestication SNPs, compared to the native ZmCDTI . Quantification was performed using Salmon v1.9.0 (Patro et al. 2017) with settings (-I A -gcBias -validateMappings). Transcript counts from all gene models corresponding to the same gene were summed to generate abundance estimates for the primary transcript of each gene.

Claims

CLAIMS1. A method for generating a plant having improved growth and / or yield, wherein the method comprises selectively increasing the size of one or more guard cells in a plant wherein the guard cell size is increased compared to guard cell size in an independent wild type control plant of the same species under the same environmental conditions; wherein the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant.

2. The method of claim 1 , wherein the guard cell has an increased cell volume, increased width and / or increased nuclear cell content.

3. The method of claims 1 or 2, wherein the plant has improved growth and / or yield in water limited conditions.

4. The method of claims 1 to 3, wherein the plant has improved water use efficiency, photosynthetic water use efficiency, drought resistance or drought tolerance.

5. The method of any preceding claim, wherein the guard cell size is increased by increasing ploidy in the guard cell.

6. The method of any one of claims 1 to 4, wherein the guard cell size is increased by promoting vacuolar expansion and / or cell wall loosening of the guard cell.

7. The method of any preceding claim, wherein the guard cell size is increased without increasing the cell size of the cells surrounding the guard cells.

8. The method of claims 4 and 5, wherein the method of increasing ploidy is via increasing endoreduplication.

9. The method of claim 8, wherein the method comprises the step of modifying expression in one or more guard cells of a nucleic acid molecule comprising anucleotide sequence that encodes a factor that promotes endoreduplication or entry into the endocycle.

10. The method of claim 9, wherein the expression of the nucleotide sequence is operably controlled by a gene expression regulatory element active in the guard cell.

11. The method of claim 9 or claim 10, wherein the said expression is overexpression.

12. The method of any one of claims 9 to 11 , wherein the nucleic acid molecule comprising a nucleotide sequence that encodes a factor that promotes endoreduplication or entry into the endocycle has the polynucleotide sequence of CDT1, ZmCDTI (SEQ ID NO: 1), AtCDTIa (SEQ ID NO:2), AtCDTIb (SEQ ID NO: 3), HB12, HB128, ZmHB128 (SEQ ID NO: 4), ATHB12 (SEQ ID NO: 5) or an active variant, ortholog, derivative, fragment or functional fragment thereof.

13. The method of any one of claims 10 to 12, wherein the gene expression regulatory element is a promoter that is derived from, or consists of, a promoter of a gene expressed, or specifically expressed, in a cell of a plant leaf epidermis, preferably wherein the cell is a guard cell progenitor cell, and more preferably a guard cell.

14. The method of claim 13, wherein the promoter has a sequence selected from SEQ ID NO:6 (pOsFAMA), SEQ ID NO:7 (pStKSTI), SEQ ID NO:8 (pZjPCK) ora or an active variant, ortholog, derivative, fragment or functional fragment thereof.

15. The method of any one of the preceding claims, wherein the plant is a crop a row or cover crop, optionally selected from a corn, soybean, pea, cotton, canola, camelina, potato, tomato, sugar beet, cassava, sweet potato, alfalfa, wheat, barley, sorghum, oat, sorghum, millet, rye, teff, rice, orclover, cress, brassicas, vetch and prairie grasses.

16. A plant obtainable by the method of any one of claims 1 to 15.

17. A plant having improved growth and / or yield wherein the plant has a selective increase in size in one or more guard cells relative to the guard cell size in an independent wild type control plant of the same species under the same environmental conditions; wherein the ratio of guard cell size to leaf epidermal cell size in the plant is increased as compared to the ratio in the control plant.

18. The plant of claim 17 wherein one or more guard cells has increased ploidy.

19. A gene construct comprising a nucleotide sequence encoding a factor that promotes endoreduplication or entry into the endocycle and a guard cell specific gene expression regulatory element.

20. The gene construct of claim 19, wherein the factor that promotes endoreduplication or entry into the endocycle has the polynucleotide sequence of CDT1, ZmCDTI (SEQ ID NO: 1), AtCDTIa (SEQ ID NO:2), AtCDTIb (SEQ ID NO: 3), HB12, HB128, ZmHB128 (SEQ ID NO: 4), ATHB12 (SEQ ID NO: 5) or an active variant, ortholog, derivative, fragment or functional fragment thereof.

21. The gene construct of claim 19 or claim 20, wherein the gene expression regulatory element is a promoter, optionally a guard cell specific promoter or a guard cell precursor cell promotor.

22. The gene construct of claim 22, wherein the guard cell specific promoter has a sequence selected from SEQ ID NO:6 (pOsFAMA), SEQ ID NO:7 (pStKSTI), SEQ ID NO:8 (pZjPCK) or a or an active variant, ortholog, derivative, fragment or functional fragment thereof.

23. A transformed plant part or plant progeny comprising the gene construct of any one of claims 19 to 22.

24. The plant as claimed in any of claims 16 to 23, wherein growth and / or yield in water limited conditions is greater than in a control unmodified plant grown under the same conditions.

25. A plant part, plant tissue, plant organ, plant cell, plant protoplast, embryo, callus culture, pollen grain or seed, derived or obtained from the plant of any of claims 16 to 24.

Citation Information

Patent Citations

  • Methods of modulating stomata conductance and plant expression constructs for executing same

    US20140345000A1