Delivery system for targeted inhibition of GDF8 and use thereof
By using a delivery system that targets and inhibits GDF8, and utilizing mammalian organ self-assembly technology to deliver siRNA to muscle tissue, the targeting and safety issues in the treatment of muscular atrophy in existing technologies have been resolved, thus achieving an effective treatment for muscular atrophy.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- NANJING UNIV
- Filing Date
- 2025-10-28
- Publication Date
- 2026-05-07
AI Technical Summary
Existing technologies are unable to effectively target and inhibit GDF8 gene expression, resulting in poor treatment outcomes for muscular atrophy diseases, especially tumor-induced muscular atrophy.
A GDF8-targeting delivery system is employed, utilizing the self-assembly of mammalian organs and tissues to form a composite structure. The RNA that inhibits GDF8 gene expression is delivered to the target tissue via a targeting element, including siRNA and a targeting vector. The endogenous miRNA processing mechanism is used to generate exosomes that encapsulate the siRNA and target muscle tissue.
It achieves efficient and safe targeted delivery of siRNA to muscle tissue, inhibits GDF8 gene expression, significantly improves muscle atrophy symptoms, and is safe, targeted, and scalable, and is easy to industrialize.
Smart Images
Figure CN2025130531_07052026_PF_FP_ABST
Abstract
Description
Delivery systems for targeting and inhibiting GDF8 and their applications Technical Field
[0001] This application relates to the field of biomedical technology, specifically to a delivery system that targets and inhibits GDF8 and its application in the preparation of products for treating muscular dystrophy. Background Technology
[0002] Lewis lung cancer is a cell line (LLC) established from the lungs of C57BL mice carrying tumors resulting from the implantation of primary Lewis lung cancer. It is widely used as a model of metastasis and can be used to study the mechanisms of cancer chemotherapy agents.
[0003] RNAi drugs offer a new direction for research on muscle atrophy. RNA interference (RNAi) is a ubiquitous gene silencing phenomenon in organisms, mediated by small interfering RNA (siRNA) and involving specific enzymes. It blocks gene expression at the transcriptional, post-transcriptional, and translational levels, thereby exerting biological effects. It is now clear that siRNA can be produced endogenously by cells, i.e., cleaved by the endonuclease Dicer from linear long double-stranded RNA, or introduced exogenously to exert its function directly (Figure 2). By designing suitable siRNAs, RNAi can theoretically be used to silence almost all genes. This species-conserved, efficient, and sequence-specific gene silencing technology not only has the potential to knock down specific genes for basic research but also has great potential to become novel drugs used to interfere with the expression of disease-causing genes, thereby exerting gene therapy effects. Summary of the Invention
[0004] To address the aforementioned technical limitations, this application proposes a delivery system for targeting and inhibiting GDF8 and its application in the preparation of products for treating muscular dystrophy; it overcomes the deficiencies and defects mentioned in the background art.
[0005] To achieve the above objectives, this application adopts the following technical solution:
[0006] The inventive point of this application is to provide a delivery system for targeting and inhibiting GDF8, the delivery system comprising: RNA capable of inhibiting GDF8 gene expression and a delivery vector; the delivery vector carrying RNA capable of inhibiting GDF8 gene expression and a targeting element self-assemble in mammalian organs and tissues to form a composite structure, the composite structure using the targeting element to locate and deliver RNA capable of inhibiting GDF8 gene expression into the target tissue, thereby inhibiting GDF8 expression in the target tissue.
[0007] Optionally, in the above-described targeted GDF8 delivery system, the RNA capable of inhibiting GDF8 gene expression includes at least one of: a promoter element and siRNA capable of inhibiting GDF8 gene expression, and siRNA encoding siRNA.
[0008] Optionally, in the above-described delivery system for targeting and inhibiting GDF8, the nucleotide sequence of the siRNA capable of inhibiting GDF8 gene expression is any one of SEQ ID No. 1 to SEQ ID No. 4;
[0009] SEQ ID No. 1:
[0010] SEQ ID No. 2:
[0011] SEQ ID No. 3:
[0012] SEQ ID No.4:
[0013] The nucleotide sequences of the positive strand of the siRNA encoding the GDF8 gene that can inhibit GDF8 gene expression are any one of SEQ ID No. 5 to SEQ ID No. 8;
[0014] SEQ ID No.5: CUACCACGAACAAUCAUUA;
[0015] SEQ ID No.6:CCUACAGACUGACUUUCUA;
[0016] SEQ ID No.7: CGGAUGGCGCCCAAAUGUU;
[0017] SEQ ID No. 8: UGGUAUUUCAGAGUAUUGA.
[0018] The nucleotide sequences encoding the antisense strand of the siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 9 to SEQ ID No. 12;
[0019] SEQ ID No.9: UAAUGAUUGUUUCCGUGGUAG;
[0020] SEQ ID No.10: UAGAAAGUCAGACUCUGUAGG;
[0021] SEQ ID No.11: AACAUUUGGGCUUGCCAUCCG;
[0022] SEQ ID No. 12: UCAAUACUCUGCCAAAUACCA.
[0023] Optionally, in the above-described delivery system for targeting and inhibiting GDF8, the composite structure is an exosome.
[0024] Optionally, in the above-described targeted GDF8 delivery system, the targeting element includes one, two, or more targeting sequences.
[0025] The target sequence was selected as MSP muscle-targeting peptide, and the specific sequence is shown in SEQ ID No. 13.
[0026] SEQ ID No. 13: ASSLNIA;
[0027] The nucleotide sequence encoding the MSP muscle-targeting peptide is shown in SEQ ID No. 14.
[0028] SEQ ID No. 14: gccagcagcctgaacatcgcc.
[0029] Optionally, in the above-described delivery system for targeting and inhibiting GDF8, the delivery vector is a plasmid vector or a viral vector.
[0030] Optionally, in the above-described delivery system for targeting and inhibiting GDF8, the viral vector includes at least one of a retroviral vector, a lentiviral vector, an adenovirus vector, and an adeno-associated virus vector.
[0031] The second inventive point of this application is to provide the application of the above-mentioned targeted GDF8 inhibitory delivery system in the preparation of products for treating muscular dystrophy.
[0032] Optionally, in the above applications, the product for treating muscular dystrophy includes reagents that inhibit GDF8 gene expression and drugs that have preventive and / or therapeutic effects on muscular dystrophy.
[0033] Optionally, in the above application, the muscle atrophy disease is tumor-induced muscle atrophy, preferably Lewis lung cancer cell-induced muscle atrophy.
[0034] The beneficial effects of this application are as follows: This application utilizes the in vivo self-assembly delivery system of siRNA to develop a targeted therapy for tumor-induced muscular atrophy. This method can use the mammal's own organs as a natural bioreactor, utilize the endogenous miRNA secretion mechanism to assemble, process, and secrete siRNA encapsulated in exosomes that can target GDF8 into the circulatory system, and ultimately effectively deliver siRNA drugs into the muscle to treat tumor-induced muscular atrophy.
[0035] The delivery system for targeting and inhibiting GDF8 provided in this application, and its application in the preparation of products for treating muscular dystrophy, have the following advantages compared with the prior art:
[0036] 1) Effectiveness: Based on synthetic biological elements, using human organs as natural bioreactors, and with the help of the miRNA processing and maturation mechanism of eukaryotic cells, siRNA is generated and self-assembled into exosomes, enters the circulatory system and reaches various major organs.
[0037] 2) Safety: This delivery system utilizes a naturally occurring secretion mechanism, thus avoiding the toxicity caused by using various carriers;
[0038] 3) Targeting: Delivery systems with muscle-specific targeting elements can deliver siRNA to muscle tissue, improving delivery efficiency while avoiding potential side effects;
[0039] 4) Upgradeability: The targeting elements and genes can be adjusted according to the needs of different muscle disease treatments to adapt to the needs of personalized treatment;
[0040] 5) Easy to produce: This delivery system is based on plasmid vectors, which are easy to produce and purify industrially. Compared with other siRNA delivery methods, it greatly reduces the difficulty and cost of production. Attached Figure Description
[0041] Figure 1 shows a design diagram of a self-assembly plasmid in one embodiment of this application (the self-assembly plasmid already includes the targeting peptide MSP and siRNA). GDF-8 ).
[0042] Figure 2 shows an embodiment of this application where in vivo self-assembled siRNA is used. GDF-8 A flowchart.
[0043] Figure 3 shows the detection results of mature siRNA in intracellular and supernatant exosomes 24 hours after transfection of 293T cells with the gene loop in one embodiment of this application.
[0044] Figure 4 shows an embodiment of this application, illustrating the screening of effective siRNA gene loops using 293T cells; wherein...
[0045] Figure 4A is the experimental flowchart;
[0046] Figure 4B shows the fluorescence expression results of the overexpression plasmid GDF8-GFP;
[0047] Figure 4C shows the expression level and statistical results of GDF8 protein.
[0048] Figure 5 shows a C2C12 cell screening loop for effective siRNA genes in one embodiment of this application; wherein...
[0049] Figure 5A is the experimental flowchart;
[0050] Figure 5B shows the expression and statistical results of GDF8 protein in cells after transfection with siRNA gene loop;
[0051] Figure 5C shows the effect of the siR4 gene loop obtained by predifferentiation transfection screening on myotube formation and the statistical results.
[0052] Figure 6 shows the identification results of serum exosomes in one embodiment of this application.
[0053] Figure 7 shows the results of the inhibitory effect of mouse liver and serum-derived exosomes on GDF-8 expression in vitro after injection of the gene loop, according to one embodiment of this application; wherein,
[0054] Figure 7A shows the detection process and results of liver-derived exosomes;
[0055] Figure 7B shows the detection process and results of serum-derived exosomes.
[0056] Figure 8 shows the detection process of PKH26-labeled in vivo self-assembled exosomes and their in vivo tracing in one embodiment of this application; wherein,
[0057] Figure 8A shows the detection process of liver-derived exosomes;
[0058] Figure 8B shows the detection process of serum-derived exosomes.
[0059] Figure 9 shows the detection results of PKH26-labeled in vivo self-assembled exosomes and their in vivo tracing in one embodiment of this application; wherein,
[0060] Figure 9A shows the detection results of liver-derived exosomes;
[0061] Figure 9B shows the detection results of serum-derived exosomes.
[0062] Figure 10 shows the treatment results of WT mice with a short-term injection of siRNA gene loop over 2 weeks in one embodiment of this application; wherein,
[0063] Figure 10A is the experimental flowchart;
[0064] Figure 10B shows the weight change curve;
[0065] Figure 10C shows the statistical results of the wet weight of the tibialis anterior (TA) muscle;
[0066] Figure 10D shows the statistical results of the mouse grip strength test;
[0067] Figure 10E shows the anatomical appearance of a mouse.
[0068] Figure 11 shows the therapeutic molecular phenotype of WT mice after a short-term injection of siRNA gene loop over 2 weeks, according to one embodiment of this application; wherein...
[0069] Figure 11A shows the overall immunohistochemical results of GDF8 in the tibialis anterior (TA) muscle;
[0070] Figure 11B shows the expression and statistical results of GDF8 protein in the tibialis anterior muscle (TA) after siRNA gene loop injection;
[0071] Figure 11C shows the expression results of GDF8 mRNA and downstream genes.
[0072] Figure 12 shows the functional validation of in vivo self-assembled exosomal siRNAs in mice with LLC cancer-induced muscle atrophy, according to one embodiment of this application; wherein...
[0073] Figure 12A shows a comparison of statistical data on tumor-free weight, percentage of tibialis anterior (TA) muscle weight, and grip strength in each group of LLC cancer-induced muscle atrophy mice.
[0074] Figure 12B shows the anatomical appearance of mice in each group;
[0075] Figure 12C shows the expression results of GDF8 protein in mice in each group after injection of siRNA gene loop. Detailed Implementation
[0076] To make the objectives, technical solutions, and advantages of this application clearer, a more detailed description is provided below. However, it should be understood that the description herein is merely for explaining this application and is not intended to limit its scope.
[0077] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of this application. All reagents and instruments used herein are commercially available, and the characterization methods involved can be found in relevant descriptions in the prior art, and will not be repeated here.
[0078] To further understand this application, the following detailed description is provided in conjunction with the preferred embodiments.
[0079] Example 1
[0080] A delivery system for targeting and inhibiting GDF8 includes: RNA capable of inhibiting GDF8 gene expression and a delivery vector; the delivery vector carrying RNA capable of inhibiting GDF8 gene expression and a targeting element self-assemble in a mammalian organ tissue to form a composite structure; the composite structure seeks out and delivers RNA capable of inhibiting GDF8 gene expression into the target tissue through the targeting element, thereby inhibiting the expression of GDF8 in the target tissue.
[0081] RNAs capable of inhibiting GDF8 gene expression include: promoter elements and at least one of siRNAs capable of inhibiting GDF8 gene expression and encoding siRNAs.
[0082] The nucleotide sequence of the siRNA that can inhibit GDF8 gene expression is any one of SEQ ID No. 1 to SEQ ID No. 4;
[0083] SEQ ID No. 1:
[0084] SEQ ID No. 2:
[0085] SEQ ID No. 3:
[0086] SEQ ID No.4:
[0087] The nucleotide sequences encoding the sense strand of the siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 5 to SEQ ID No. 8;
[0088] SEQ ID No.5: CUACCACGAACAAUCAUUA;
[0089] SEQ ID No.6:CCUACAGACUGACUUUCUA;
[0090] SEQ ID No.7: CGGAUGGCGCCCAAAUGUU;
[0091] SEQ ID No. 8: UGGUAUUUCAGAGUAUUGA.
[0092] The nucleotide sequences encoding the antisense strand of siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 9 to SEQ ID No. 12;
[0093] SEQ ID No.9: UAAUGAUUGUUUCCGUGGUAG;
[0094] SEQ ID No.10: UAGAAAGUCAGACUCUGUAGG;
[0095] SEQ ID No.11: AACAUUUGGGCUUGCCAUCCG;
[0096] SEQ ID No. 12: UCAAUACUCUGCCAAAUACCA.
[0097] The complex structure is an exosome.
[0098] The targeting element includes one, two, or more targeting sequences.
[0099] The target sequence was selected as MSP muscle-targeting peptide, and the specific sequence is shown in SEQ ID No. 13.
[0100] SEQ ID No. 13: ASSLNIA;
[0101] The nucleotide sequence encoding the MSP muscle-targeting peptide is shown in SEQ ID No. 14.
[0102] SEQ ID No. 14: gccagcagcctgaacatcgcc.
[0103] The delivery vector is a plasmid vector or a viral vector.
[0104] Viral vectors include at least one of retroviral vectors, lentiviral vectors, adenovirus vectors, and adeno-associated virus vectors.
[0105] This application also provides the application of the above-described targeted GDF8 inhibitory delivery system in the preparation of products for treating muscular dystrophy.
[0106] Products used to treat muscular dystrophy include reagents that block GDF8 gene expression and drugs that have preventive and / or therapeutic effects on muscular dystrophy.
[0107] Muscular atrophy is a tumor-induced muscular atrophy, preferably a muscular atrophy induced by Lewis lung cancer cells.
[0108] Example 2
[0109] In vitro assembly and validation of a targeted siRNA self-assembly system:
[0110] 1. Design and effectiveness of self-assembly system:
[0111] A self-assembly system of siRNA was constructed according to the design shown in Figure 1. After the system was introduced into mammalian tissues and cells, it was able to utilize the mammalian's own miRNA processing and secretion mechanisms to self-assemble into exosomes (core gene loops) containing siRNA. In addition, by adding muscle-targeting peptide (MSP) and co-expressing it with the exosome membrane Lamp2b protein, the exosome membrane surface simultaneously expresses the MSP-targeting peptide, which is then secreted into the circulatory system and enriched in muscle cells through targeting elements.
[0112] First, each element was constructed, and the effectiveness of each element was verified in vitro using 293T tool cells (HEK-293T). The transcription efficiency of the self-assembly system for siRNA was detected, and it was tested whether the siRNA was effectively encapsulated into the cell supernatant exosomes.
[0113] The empty vector was treated with restriction endonucleases, and the linear vector was recovered. The GDF8 siRNA sequence was then inserted into the pre-miR-155 backbone using T4 ligase to form an siRNA expression element, which was then ligated into the vector. The FLAG-Lamp2b and MSP-Lamp2b sequences were used as targeting elements and ligated into the vector. The resulting ligation products were transformed and plated on antibiotic plates. Single clones were picked the following day, and sequencing was performed to confirm the correctness of the plasmid sequence.
[0114] Figure 3 shows that after the designed mature siRNA sequences (SEQ ID No. 1-SEQ ID No. 4) targeting GDF8 were loaded into gene loops, in vitro experiments screened out gene loops that could effectively inhibit GDF8 expression. The results showed that normal expression of the four mature siRNAs could be detected when cells were collected 24 hours after transfection.
[0115] Among them, CMV-MSP-siR-4 was most stably expressed in cells and supernatant exosomes, and the knockdown effect was most significant in 293T cells.
[0116] Figure 4 shows the simultaneous transfection of siRNA gene loops with GDF8 overexpression plasmid (expressing GFP fluorescent protein) in 293T cells to screen for effective siRNA gene loops (Figure 4A). The results show that all four siRNA gene loops can effectively inhibit the fluorescence intensity of GFP expression in 293T cells. Among them, the siR4 gene loop has the strongest inhibitory effect (Figure 4B). Western blot results also show that the siR4 gene loop has a significantly better inhibitory effect on GDF8 expression than other siRNA gene loops (Figure 4C).
[0117] 2. Gene loop screening:
[0118] 293T tool cells were transiently transfected with a GDF8 overexpression plasmid, followed by transfection with four designed siRNA gene loops (with different mature siRNA sequences). The inhibitory effects of different gene loops on transiently overexpressed GDF8 mRNA (qRT-PCR) and protein expression (Western blot) were detected. Using the muscle cell line C2C12, the above four gene loops were transfected (Figure 5) to further verify the inhibitory effects of gene loops on endogenous GDF8 mRNA and protein expression in muscle cells.
[0119] Further validation in the C2C12 muscle cell line is shown in Figure 5A. Different siRNA gene loops were directly transfected into myotube cells differentiated for 3 days. It was found that the siR4 gene loop significantly inhibited endogenous GDF8 expression in C2C12 myotube cells better than other siRNA gene loops (Figure 5B). Furthermore, pre-differentiation transfection with the siR4 gene loop significantly increased the number of myotubes formed (Figure 5C). These results demonstrate that the siR4 gene loop can effectively inhibit GDF8 expression in vitro, thereby effectively promoting myogenesis.
[0120] Subsequent identification and functional verification experiments all used the siR4 gene loop, which had the best performance.
[0121] 3. Exosome identification:
[0122] Twelve hours after injecting the gene loop into mice at a dose of 5 mg / kg, exosomes were extracted from mouse serum. Nanoparticle Tracking Analysis (NTA) revealed no significant differences in the content and particle size distribution of exosomes among the three groups. Electron microscopy analysis showed that the exosomes exhibited intact morphological structures without significant differences. Finally, Western blot analysis of exosome marker proteins showed no significant differences in the content of these marker proteins among the three groups (Figure 6), demonstrating that the gene loop injection does not affect exosome secretion.
[0123] Example 3
[0124] Functional validation of exosomal siRNAs assembled in vivo:
[0125] After injecting the gene loop into mice at a dose of 5 mg / kg, exosomes were extracted from their liver (Fig. 7A) and serum (Fig. 7B) at 6 hours and 12 hours, respectively, and co-cultured with C2C12 myotube cells. The expression level of GDF-8 in the cells was detected by Western blot after 24 hours.
[0126] As shown in Figure 7, exosomes derived from mouse liver and serum after gene loop injection can inhibit GDF-8 expression in vitro.
[0127] Tracing of self-assembled exosomes in vivo:
[0128] After injecting the gene loop into mice at a dose of 5 mg / kg, exosomes were extracted from their liver (Fig. 8A) and serum (Fig. 8B) at 6 hours and 12 hours, respectively. The exosomes were labeled in vitro with PKH26 lipophilic dye and then injected into recipient mice via tail vein injection. Skeletal muscle sections of the mice were stained and observed 24 hours later.
[0129] As can be seen from Figures 8 and 9, exosomes from the liver (Figure 9A) and serum (Figure 9B) after being loaded with the targeting peptide MSP can be effectively delivered to skeletal muscle (TA).
[0130] Functional validation of in vivo self-assembled exosomal siRNAs in wild-type mice:
[0131] Mice were injected with the gene loop at a dose of 5 mg / kg, every other day, for two weeks (Figure 10A). Body weight was monitored during this period. One day after the last injection, a grip strength test was performed and the tibialis anterior (TA) muscle was weighed. The results indicate that the CMV-MSP-siRNA injection... GDF-8 A group of mice showed significant increases in body weight (Fig. 10B), TA weight (Fig. 10C), and grip strength (Fig. 10D), and muscle imaging also clearly showed a significant increase in the circumference of their hind leg calf muscles (Fig. 10E). Immunohistochemistry of mouse TA (Fig. 11A) and Western blot experiments (Fig. 11B) also indicated that CMV-MSP-siRNA... GDF-8 The level of GDF-8 in the TA tissue of a group of mice was significantly reduced. RT-qPCR detection of gene expression in mouse TA tissue revealed that the expression levels of GDF-8 and its downstream genes were significantly reduced (Figure 11C).
[0132] As can be seen from Figures 10 and 11, CMV-MSP-siRNA GDF-8 It showed significant effects in short-term treatment of WT mice.
[0133] Functional validation of in vivo self-assembled exosomal siRNAs in LLC cancer mice:
[0134] With 1×10 5 LLC tumor cells were implanted into the axilla of mice, and gene loop injections were administered three days later, followed by injections every other day for one month. A grip strength test was performed one day after the last injection, and the tibialis anterior (TA) muscle was weighed. The results showed that the CMV-MSP-siRNA injection... GDF-8In a group of mice, tumor-free body weight, TA weight, and grip strength all showed significant increases (Figure 12A), and muscle imaging also clearly showed a significant increase in the circumference of the hind leg calf muscles (Figure 12B). Western blot analysis of mouse TA tissue also indicated the presence of CMV-MSP-siRNA. GDF-8 The level of GDF-8 in the TA of a group of mice was significantly reduced (Figure 12C).
[0135] As can be seen from Figure 12, CMV-MSP-siRNA GDF-8 It showed significant therapeutic effects in LLC-induced muscle atrophy.
[0136] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. A delivery system for targeting and inhibiting GDF8, characterized in that, The delivery system includes: RNA capable of inhibiting GDF8 gene expression and a delivery vector; the delivery vector carrying RNA capable of inhibiting GDF8 gene expression and a targeting element self-assemble in mammalian organs and tissues to form a composite structure, the composite structure using the targeting element to locate and deliver RNA capable of inhibiting GDF8 gene expression into the target tissue, thereby inhibiting GDF8 expression in the target tissue.
2. The delivery system for targeting and inhibiting GDF8 according to claim 1, characterized in that, The RNA capable of inhibiting GDF8 gene expression includes: promoter elements and at least one of siRNA capable of inhibiting GDF8 gene expression and encoding siRNA.
3. The delivery system for targeting and inhibiting GDF8 according to claim 2, characterized in that, The nucleotide sequence of the siRNA that can inhibit GDF8 gene expression is any one of SEQ ID No. 1 to SEQ ID No. 4; The nucleotide sequences of the positive strand of the siRNA encoding the GDF8 gene that can inhibit GDF8 gene expression are any one of SEQ ID No. 5 to SEQ ID No. 8; The nucleotide sequences encoding the antisense strand of siRNA that can inhibit GDF8 gene expression are any one of SEQ ID No. 9 to SEQ ID No.
12.
4. The delivery system for targeting and inhibiting GDF8 according to claim 1, characterized in that, The composite structure is an exosome.
5. The delivery system for targeting and inhibiting GDF8 according to claim 1, characterized in that, The targeting element includes one, two, or more targeting sequences.
6. The delivery system for targeting and inhibiting GDF8 according to claim 1, characterized in that, The delivery vector is a plasmid vector or a viral vector.
7. The delivery system for targeting and inhibiting GDF8 according to claim 6, characterized in that, The viral vector includes at least one of retroviral vectors, lentiviral vectors, adenovirus vectors, and adeno-associated virus vectors.
8. The use of a delivery system for targeting and inhibiting GDF8 according to any one of claims 1-7 in the preparation of a product for treating muscular dystrophy.
9. The application according to claim 8, characterized in that, The products for treating muscular dystrophy include reagents that inhibit GDF8 gene expression and drugs that have preventive and / or therapeutic effects on muscular dystrophy.
10. The application according to claim 9, characterized in that, The muscle atrophy disease is a tumor-induced muscle atrophy, preferably a muscle atrophy induced by Lewis lung cancer cells.