Double-stranded mirna, pharmaceutical composition and Anti-aging product containing same and use thereof
The chemically modified double-stranded miRNA has solved the delivery and stability problems, achieving long-term stability and efficient delivery in vivo, and significantly improving the treatment effect of various diseases, especially photoaging of skin cells and Alzheimer's disease.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- YUANSHENG BIOTECH (TSING DAO) CO LTD
- Filing Date
- 2025-10-28
- Publication Date
- 2026-05-07
AI Technical Summary
Existing miRNAs face numerous challenges in terms of delivery, stability, and immune response, making them difficult to use effectively in anti-aging treatments, especially due to their low cell membrane permeability, susceptibility to degradation, strong immune response, and high production costs.
Chemically modified double-stranded miRNAs, including 2'-substituted nucleotides and modified nucleotide bonds, with specific modifications located at specific sites, are combined with LNA modifications and DNA substitutions to form stable drug compositions that enhance stability and specificity.
It achieves long-term stability and efficient delivery in vivo, significantly improving the therapeutic effects on diseases such as photoaging of skin cells, Alzheimer's disease, articular cartilage damage, diabetes, non-alcoholic fatty liver disease, androgenetic alopecia, cirrhosis, and chronic nephritis.
Smart Images

Figure PCTCN2025130618-FTAPPB-I100001 
Figure PCTCN2025130618-FTAPPB-I100002 
Figure PCTCN2025130618-FTAPPB-I100003
Abstract
Description
Double-stranded miRNAs, pharmaceutical compositions containing them, anti-aging products and their uses Technical Field
[0001] This application belongs to the field of biomedicine, specifically relating to a double-stranded miRNA, a pharmaceutical composition containing it, an anti-aging product, and its uses. Background Technology
[0002] Aging is a process that all living things must face. Finding ways to unlock the biological mechanisms of aging and to delay or reverse it has always been a hot topic in the scientific community, and it also has significant social implications and enormous commercial value. Aging is divided into several levels: individual aging, organ aging, and cellular aging. The aging of individuals and organs ultimately manifests in cellular aging.
[0003] MicroRNAs (miRNAs) are non-coding single-stranded RNA molecules of 18-25 nucleotides in length encoded by endogenous genes. miRNAs are involved in various biological processes. One mechanism is that miRNAs bind complementaryly to target genes, ultimately cleaving the target mRNA. Another mechanism is that miRNAs bind incompletely complementary to target genes, inhibiting the translation of the target gene.
[0004] Previous research by our team has suggested that miR302b can break the cell cycle arrest of senescent cells at the cellular level, prompting senescent cells to return to the cell cycle and regain proliferative capacity, while maintaining their original functions without transdifferentiation or reprogramming—a process known as "reversal aging." However, in terms of application, various methods have different advantages and disadvantages. Direct administration of miR302b is difficult to penetrate the cell membrane due to the lack of a delivery system, resulting in low uptake rates; unmodified small nucleic acids have poor stability and are easily degraded by the large number of nucleases present in cells, preventing them from reaching effective concentrations; the lack of necessary transport systems makes effective gene silencing difficult; in addition, natural small nucleic acids may trigger immune responses, be recognized as pathogen molecules, and activate interferon and other cytokines, affecting normal cell function and interfering with the gene silencing effect of small nucleic acids; exosomes carrying miR302b have large batch-to-batch variations, making drug development difficult; AAV virus carrying miR302b has difficulties in ensuring uniform dosage, non-specific expression, easy immune responses, high production costs, and potential carcinogenic risks. Therefore, the miRNA mimic approach is particularly necessary. In addition, siRNA mainly functions by forming an RNA-induced silencing complex (RISC) with Ago2 in the cell; miRNA functions by binding to Ago1-4 proteins of the Ago family to form RISC. The modification of different miRNAs may lead to different binding forces, which makes the miRNA Mimic process more complicated.
[0005] Chemical modifications of miRNAs can significantly affect their stability, specificity, cellular uptake efficiency, and biological activity. Different types of modifications have different effects in these aspects; modifications at a single site and combined modifications at multiple sites may have different effects; and specific patterns of modification may enhance or weaken the function of miRNAs. Summary of the Invention
[0006] Therefore, it is necessary to provide a double-stranded miRNA, a pharmaceutical composition containing it, an anti-aging product, and its uses.
[0007] In a first aspect, this application provides a double-stranded miRNA comprising a sense strand with a chemically modified sequence as shown in SEQ ID NO: 1, and an antisense strand with a chemically modified sequence as shown in SEQ ID NO: 2;
[0008] The chemical modifications of the sense strand and the antisense strand each include a 2'-substituted nucleotide and a modified nucleotide bond; the chemically modified nucleotide bond is located at least one or more of positions 1-3 and 20-23 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0009] In some embodiments, the 2'-substituted nucleotide is selected from one or more of 2'-fluorine substitution modification and 2'-O-methylation.
[0010] In some embodiments, the 2'-O-methylation is located at one or more of positions 1-23 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0011] In some embodiments, the 2'-O-methylation is located at one or more of the first and fourth to 23rd positions of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0012] In some embodiments, the 2'-O-methylation is located at positions 1-2, 4, 6, 9-12, 14-16, 18, and 20-23 of the sequence shown in SEQ ID NO: 1, and the 2'-O-methylation is located at one or more of the following positions: positions 1-3, 5, 7, 9, 11, and 13-23 of the sequence shown in SEQ ID NO: 2.
[0013] In some embodiments, the 2'-O-methylation is located at one or more of the first, fourth-12th, and fourth-23rd positions of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0014] In some embodiments, the 2'-O-methylation is located at positions 1-2, 4, 6, 10, 12, 14, 16, 18, 20, and 22-23 of the sequence shown in SEQ ID NO: 1, and the 2'-O-methylation is located at one or more of the following positions: positions 1-3, 5, 7, 9, 11, 13, and 15-23 of the sequence shown in SEQ ID NO: 2.
[0015] In some embodiments, the 2'-O-methylation is located at one or more of the following positions: position 1, positions 9-12, positions 14-16, and positions 20-23 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0016] In some embodiments, the 2'-O-methylation is located at positions 1-2, 4, 6, 10, 12, 14, 16, 18, 20, and 22-23 of the sequence shown in SEQ ID NO: 1, and the position of the 2'-O-methylation in the sequence shown in SEQ ID NO: 2 may be selected from:
[0017] (1) Nucleotides located at positions 1-3, 5, 7, 9, 11, 13, and 15-23; or
[0018] (2) Nucleotides located at positions 1-3, 5, 7, 9, 11, 13, 15-17, 19 and 21-23.
[0019] In some embodiments, the 2'-O-methylation is located at positions 1-2 and 22-23, and at positions 3-21, of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0020] In some embodiments, the modified nucleotide bond is selected from the group consisting of thiophosphate, dithiophosphate, phosphate triester, aminoalkyl phosphate triester, phosphonic acid alkyl ester, phosphonite, aminophosphate, thiocarbonyl aminophosphate, thiocarbonyl alkyl phosphonate, thiocarbonyl alkyl phosphate triester, selenophosphate, boron phosphate, morpholino, siloxane, sulfide, sulfoxide, sulfone, formyl, thioformyl, methyleneformyl, nucleoacetyl, olefin-containing backbone, aminosulfonate, methyleneimino, methylenehydrazine, sulfonate, sulfonamide, and amide.
[0021] In some embodiments, the modified nucleotide bond is a thiophosphate ester.
[0022] In some embodiments, the thiophosphate is located at one or more of the following positions in the sequence shown in SEQ ID NO: 1: between positions 1 and 2, 2 and 3, 3 and 4, 4 and 5, and 22 and 23; and the thiophosphate is located at one or more of the following positions in the sequence shown in SEQ ID NO: 2: between positions 1 and 2, 2 and 3, 3 and 4, 4 and 5, 21 and 22, and 22 and 23.
[0023] In some embodiments, the thiophosphate is located at one or more of the following positions in the sequence shown in SEQ ID NO: 1: between position 1 and position 2, between position 2 and position 3, and between position 22 and position 23; and the thiophosphate is located at one or more of the following positions in the sequence shown in SEQ ID NO: 2: between position 1 and position 2, between position 2 and position 3, between position 3 and position 4, between position 4 and position 5, between position 20 and position 21, between position 21 and position 22, and between position 22 and position 23.
[0024] In some embodiments, the thiophosphate is located between the first and second positions and between the second and third positions of the sequence shown in SEQ ID NO: 1, and the thiophosphate is located between the first and second positions, between the second and third positions, and between the 22nd and 23rd positions of the sequence shown in SEQ ID NO: 2.
[0025] In some embodiments, the 2'-fluorine substitution modification occurs in one or more of the following groups: nucleotides containing cytosine, nucleotides containing adenine, and nucleotides containing uracil.
[0026] In some embodiments, the 2'-fluorine substitution modification is located at at least one or more nucleotides in positions 3-21 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0027] In some embodiments, the 2'-fluorine substitution modification is located at least in the spacer positions of positions 3-21 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; for example, at least in one or more of positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, or at least in one or more of positions 4, 6, 8, 10, 12, 14, 18 and 20 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0028] In some embodiments, the 2'-fluorine substitution modification is located at one or more of the 3rd, 5th, 7th-9th, 11th, 13th, 15th, 17th, 19th and 21st nucleotides of the sequence shown in SEQ ID NO: 1, and the 2'-fluorine substitution modification is located at one or more of the 4th-21st nucleotides of the sequence shown in SEQ ID NO: 2.
[0029] In some embodiments, the 2'-fluorine substitution modification is located at nucleotides 3, 5, 7-9, 11, 13, 15, 17, 19, and 21 of the sequence shown in SEQ ID NO: 1, and the 2'-fluorine substitution modification is located at one or more of the nucleotides 4, 6, 8, 10, 12, 14, 18, and 20 of the sequence shown in SEQ ID NO: 2.
[0030] In some embodiments, the 2'-fluorine substitution modification is located at positions 3, 5, 7-9, 11, 13, 15, 17, 19, and 21 of SEQ ID NO: 1, and the position of the 2'-fluorine substitution modification in SEQ ID NO: 2 may be selected from:
[0031] (1) Nucleotides located at positions 4, 6, 8, 10, 12, 14, 18, and 20; or
[0032] (2) Nucleotides located at positions 4, 6, 8, 10, 12 and 14.
[0033] In some implementations, the justice chain and / or the antisense chain further include LNA modifications.
[0034] In some embodiments, the LNA modification is located at one or more nucleotides in positions 1-8 of the sequence shown in SEQ ID NO: 2.
[0035] In some embodiments, the LNA modification is located in the spacer position between positions 1-8 of the sequence shown in SEQ ID NO: 2.
[0036] In some embodiments, the LNA modification is located at the 2nd, 4th, 6th, and 8th nucleotides of the sequence shown in SEQ ID NO: 1.
[0037] In some implementations, the LNA modification excludes other modifications besides the LNA modification at the site.
[0038] In some implementations, all sites other than those with LNA modification are 2'-O-methylated.
[0039] In some implementations, the sense strand and / or the antisense strand further comprise DNA modifications.
[0040] In some embodiments, the DNA modification is replaced with thymine.
[0041] In some embodiments, at least one uracil site in the positive chain has a DNA modification.
[0042] In some embodiments, at least one uracil site in the antisense strand has a DNA modification.
[0043] In some embodiments, the sense strand and / or the antisense strand further comprises DNA modifications located at nucleotides 1, 5, 8-9, 13, 15-18, and 21 of the sequence shown in SEQ ID NO: 1, and at nucleotides 2, 5, and 21-22 of the sequence shown in SEQ ID NO: 2.
[0044] In some embodiments, the DNA modification involves replacing the uracil site with thymine.
[0045] In some embodiments, one or more nucleotides of uracil at positions 5, 8, 13, 17 and 18 of the sequence shown in SEQ ID NO: 1 are replaced with thymine.
[0046] In some embodiments, uracil at positions 5, 13, 17 and 18 of the sequence shown in SEQ ID NO: 1 is replaced with thymine.
[0047] In some implementations, positions 5, 8, 17, and 18 of the sequence shown in SEQ ID NO: 1 are replaced with thymine.
[0048] In some implementations, the 8th position of the sequence shown in SEQ ID NO: 1 is replaced with thymine.
[0049] In some implementations, all uracil in the sequence shown in SEQ ID NO: 1 are replaced with thymine.
[0050] In some implementations, one or more of the positions at least the 5th, 8th, 13th, 17th and 18th positions of the sequence shown in SEQ ID NO: 2 are replaced with thymine.
[0051] In some implementations, one or more of the 5th, 8th, 13th, 17th and 18th positions of the sequence shown in SEQ ID NO: 2 are replaced with thymine.
[0052] In some implementations, the fifth position of the sequence shown in SEQ ID NO: 2 is replaced with thymine.
[0053] In some implementations, all uracil in the sequence shown in SEQ ID NO: 2 are replaced with thymine.
[0054] In some implementations, the justice chain and / or the antisense chain further include end modifications.
[0055] In some embodiments, the end modification is a 3' end with a 5'NN 3' structure protrusion, wherein each occurrence of N is independently selected from the group consisting of adenine (A), thymine (T), cytosine (C), guanine (G), and uracil (U).
[0056] In some embodiments, the protruding end is chemically modified.
[0057] In some embodiments, the protruding end is selected from the group consisting of 5'Nm Nm 3', 5'sN sN 3', 5'Nm sN 3', 5'sN Nm 3', 5'sNm Nm 3', 5'Nm sNm 3', 5'sNm sNm 3', 5'sNm sN3' and 5'sN sNm 3'.
[0058] In some implementations, the NN is selected from the group consisting of UG, TT, AC, and AA.
[0059] In some embodiments, the terminal modification is selected from the group consisting of 5'sTm sTm 3', 5'sUm sGm 3', 5'sAm sCm 3' and 5'sAm sAm 3'.
[0060] In some embodiments, the terminal modification is located at the 3' end of the sequence shown in SEQ ID NO: 2 and is selected from 5'sTm sTm 3', 5'sUm sGm 3', or 5'sAm sCm 3'.
[0061] In some embodiments, the sense strand and / or the antisense strand further comprises at least one 3' terminal group.
[0062] In some embodiments, the 3' terminal group is selected from the group consisting of cholesterol, bile acids, fatty acids, polyethylene glycol, antibodies, polymers, N-acetylgalactosamine (GalNac), and aptamers.
[0063] In some embodiments, there is a phosphate thioester modification between the 3' terminal group and the last nucleotide at the 3' end of the antisense strand.
[0064] A second aspect of this application provides a pharmaceutical composition comprising a double-stranded miRNA as described in the first aspect, and a pharmaceutically acceptable carrier.
[0065] A third aspect of this application provides an anti-aging product comprising the double-stranded miRNA as described in the first aspect.
[0066] The fourth aspect of this application provides the use of the double-stranded miRNA as described in the first aspect in the preparation of anti-aging products, medicaments for treating Alzheimer's disease, medicaments for treating articular cartilage damage, medicaments for treating diabetes, medicaments for treating non-alcoholic fatty liver disease, medicaments for treating cirrhosis, medicaments for treating androgenetic alopecia, or medicaments for treating chronic nephritis.
[0067] In some embodiments, the anti-aging product, the drug for treating Alzheimer's disease, the drug for treating articular cartilage damage, the drug for treating diabetes, the drug for treating non-alcoholic fatty liver disease, the drug for treating cirrhosis, the drug for treating androgenetic alopecia, or the drug for treating chronic nephritis may be administered via a method selected from the group consisting of intravenous, intramuscular, intra-articular, intrathecal, intracapsular, intra-abdominal, intraorbital, intracardiac, intradermal, intraperitoneal, tracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, spinal, and intrasternal injection and infusion.
[0068] In a fifth aspect of this application, liposome nanoparticles comprising double-stranded miRNA as described in the first aspect are provided.
[0069] The double-stranded miRNA prepared in one embodiment of this application has at least the following effects:
[0070] It exhibits good stability, remaining intact in vivo for several hours; it possesses anti-aging capabilities at the whole-animal level; and it shows significant therapeutic effects on various diseases, including photoaging of skin cells, Alzheimer's disease, articular cartilage damage, diabetes, non-alcoholic fatty liver disease, androgenetic alopecia, cirrhosis, and chronic nephritis. In short, it balances efficacy and stability, demonstrating promising application prospects. Attached Figure Description
[0071] To more clearly illustrate the technical solutions in the embodiments and examples of this application, and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments or examples will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of this application. Those skilled in the art can obtain other drawings based on these drawings without creative effort. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in illustrating this application. The various dimensions of each component shown in the drawings are arbitrarily shown; they may be precise or not drawn to scale. For example, to make the illustration clearer, the dimensions of some components are appropriately exaggerated in the drawings. Unless otherwise specified, the components in the drawings are not drawn to scale. The drawings of this application do not limit each dimension of each component.
[0072] Figure 1 shows the basic preparation process of small nucleic acid single strands in one embodiment of this application.
[0073] Figures 2A-C are schematic diagrams illustrating the determination of the expected binding sites of miR-302b in one embodiment of this application.
[0074] Figure 3 shows the connection method between cholesterol and nucleic acid chains in one embodiment of this application.
[0075] Figure 4 shows the connection method between cholesterol and nucleic acid chains in one embodiment of this application.
[0076] Figure 5 shows the connection method between GalNac and nucleic acid strand in one embodiment of this application.
[0077] Figure 6 shows the connection method between GalNac and nucleic acid strand in one embodiment of this application.
[0078] Figure 7 shows the connection method between PEG-Chol and the nucleic acid chain in one embodiment of this application.
[0079] Figure 8 shows the connection method between PEG-Chol and the nucleic acid chain in one embodiment of this application. Detailed Implementation
[0080] To facilitate understanding of this application, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of this invention.
[0081] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0082] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, "one or more" and other terms that otherwise indicate "one or more" shall be understood in the same way unless otherwise specified.
[0083] The terms “combinations thereof,” “any combination thereof,” and “any combination thereof” used in this application include all suitable combinations of any two or more of the listed items.
[0084] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method" etc., shall be determined by whether it can implement the technical solution of this application, solve the technical problem of this application, or achieve the expected technical effect of this application.
[0085] In this application, terms such as "further," "even more," "particularly," "for example," "like," "example," and "exemplary" are used for descriptive purposes to indicate a connection in the coverage of different technical solutions presented earlier and later, but should not be construed as limiting the preceding technical solution or restricting the scope of protection of this application. In this application, unless otherwise specified, A (e.g., B) indicates that B is a non-limiting example of A, and it can be understood that A is not limited to B.
[0086] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it refers to either "with" or "without" a parallel solution. If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "option" is independent. Unless otherwise specified, the descriptions such as "optionally include" and "optionally contain" in this application, taking "optionally include" as an example, mean "may include or not include."
[0087] The terms “containing,” “comprising,” and “including” as used in this application are synonyms and are inclusive or open-ended, not excluding additional, uncited members or features. Members or features include, for example, materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions under which actions occur, timing, states, etc.
[0088] The terms "and / or", "or / and", and "and / or" as used in this application encompass any one of two or more of the related listed items, as well as any and all combinations of the related listed items. "Any and all combinations" includes any two related listed items, any more related listed items, or a combination of all related listed items. For example, "A and / or B" includes three parallel options: A, B, and "a combination of A and B".
[0089] In this application, the technical features or solutions described in open-ended language include both closed-ended technical features or solutions consisting of the listed contents and open-ended technical features or solutions that include the listed contents.
[0090] In this application, the exemplary descriptions involving "in some implementations (or embodiments)" or "in one implementation (or embodiment)" may cover, but are not limited to, the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.
[0091] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only a non-exhaustive enumeration purpose and should be understood not to constitute a closed limitation on quantity.
[0092] In this application, when numerical intervals (i.e., numerical ranges) are mentioned, unless otherwise specified, the distribution of selectable numerical values within the numerical interval is considered continuous, and includes the two endpoints of the numerical interval (i.e., the minimum and maximum values), as well as every numerical value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that numerical interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints, which is equivalent to directly listing every integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, percentage, ratio, etc. The "numerical interval" can be broadly included to include numerical interval types such as percentage intervals, ratio intervals, and proportion intervals.
[0093] Unless otherwise specified, the term "nucleic acid" as used in this application refers to deoxyribonucleotides, ribonucleotides, or modified nucleotides and their polymers in single-stranded or double-stranded form. This term includes nucleic acids containing known nucleotide analogs or modified backbone residues or bonds, which are synthetic, naturally occurring, or non-natural, and have the same sequence as the reference nucleic acid. They have similar binding properties and are metabolized in a similar manner as the reference nucleotide.
[0094] Unless otherwise specified, the term "nucleotide" in this application includes those having both native (standard) and modified bases well known in the art. Nucleotides may be unmodified or modified in their sugar, phosphate, and / or base portions (which may also be interchangeably referred to as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides, etc.). (Eckstein et al., International PCT Publication No. WO 92 / 07065; Usman et al., International PCT Publication No. WO 93 / 15187;). Some non-limiting examples of base modifications that can be introduced into nucleic acid molecules include inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5-methylcytidine), 5-alkyluridine (e.g., nucleoside thymidine), 5-halouridine (e.g., 5-bromouridine), or 6-azpyrimidine or 6-alkylpyrimidine (e.g., 6-methyluridine and pseudouridine), propyne, etc. (Burgin et al., Biochemistry 35:14090, 1996; Uhlman & Peyman, supra). In this respect, "modified base" refers to nucleotide bases other than adenine, guanine, cytosine, and uracil, and their equivalents.
[0095] "RNA" refers to a molecule containing at least one ribonucleotide residue. "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of the αβ-D-furanose moiety. The term RNA includes double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, substantially pure RNA, synthetic RNA, recombinant RNA, and the addition, deletion, substitution, and / or alteration of one or more nucleotides. The nucleotides in the RNA molecules of this invention may also include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These modified RNAs may be referred to as analogs of naturally occurring RNA.
[0096] In this application, "anti-aging" or "reversing aging" refers to enabling senescent cells that have stopped dividing to re-enter the cell cycle and restore normal function, regaining the ability to divide and proliferate, while maintaining the original functions of the cells without transdifferentiation or reprogramming.
[0097] Unless otherwise specified, the term "modified nucleotide" in this application refers to a nucleotide having one or more modifications to its nucleoside, nucleotide base, pentose ring, or phosphate group. For example, modified nucleotides include ribonucleotides containing adenosine monophosphate, guanosine monophosphate, uridine monophosphate, and cytidine monophosphate, as well as deoxyadenosine monophosphate, deoxyguanosine monophosphate, deoxythymidine monophosphate, and deoxycytidine monophosphate. Modifications include those occurring naturally, caused by enzymes that modify nucleotides (e.g., methyltransferases). Modified nucleotides also include synthetic or non-naturally occurring nucleotides. Synthetic or non-natural modifications in nucleotides include 2' modifications, such as 2'-O-methyl, 2'-methoxyethoxy, 2'-fluorine, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridging, and 4'-(CH2)2, including those containing -O-2'-bridging, 2'-LNA, and 2'-O-(methyl N-carbamate) or base analogs. "Amino," in the context of 2'-modified nucleotides described in this disclosure, refers to 2'-NH2 or 2'-O-NH2, which may or may not be modified. For example, U.S. Patent 5,672,695 to Eckstein et al. and U.S. Patent 6,248,878 to Maturic-Adamic et al. describe such modifying groups.
[0098] In this application, "2'-O-methyl(chemical)", "2'-O-methyl modification" or "m" means that the hydroxyl group (-OH) of the 2'-carbon atom of the ribose portion of the RNA molecule is replaced by a methyl group (-CH3) to form a methoxy group (-O-CH3).
[0099] In this application, "2'-fluorine substitution", "2'-fluorine modification", "2'-fluorine substitution modification" or "f" means that the hydroxyl group (-OH) of the 2'-carbon atom of the ribose portion of the RNA molecule is replaced by a fluorine atom (-F).
[0100] In this application, "thiophosphate", "thiophosphate modification" or "s" refers to the substitution of one phosphate group in the phosphodiester bond of an RNA molecule by a sulfur atom. If two phosphate groups in the phosphodiester bond of an RNA molecule are substituted by sulfur atoms, it is called "dithiophosphate modification"; if all three phosphate groups in the phosphodiester bond of an RNA molecule are substituted by sulfur atoms, it is called "triphosphate modification".
[0101] In this application, "locked nucleic acid modification", "LNA modification" or "lna" refers to an additional methylene bridge connecting the 2'-oxygen atom and the 4'-carbon atom of the RNA ribose, forming a rigid bicyclic system.
[0102] In this application, "terminal modification" refers to the addition of a non-template nucleotide to the 3' end of RNA. The terminal modification results in a "protrusion," which refers to multiple unpaired single-stranded portions on the longer strand at the end of a double-stranded nucleic acid molecule.
[0103] In this application, "3' terminal group" refers to the group attached to the 3' end of the miRNA antisense strand for delivery or other purposes.
[0104] Unless otherwise specified, the terms "microRNA," "miRNA," or "microRNA(s)" in this application refer to nucleic acids that form single-stranded RNA and, when expressed in cells identical to the gene or target gene, alter (decrease or suppress expression, regulate expression, or directly or indirectly increase expression) the expression of the gene or target gene. In one embodiment, miRNA refers to a nucleic acid that is substantially or completely identical to the target gene and forms a single-stranded miRNA. In some embodiments, miRNA may exist in the form of pre-miRNA, wherein the pre-miRNA is a double-stranded RNA. The sequence of the miRNA may correspond to the full-length target gene or its subsequence. Typically, the length of miRNA is at least about 15-50 nucleotides (e.g., each sequence of a single-stranded miRNA is 15-50 nucleotides long, and the length of a double-stranded precursor miRNA is about 15-50 base pairs). In some embodiments, miRNA is 20-30 base nucleotides long. In some embodiments, miRNA is 20-25 nucleotides long. In some implementations, the miRNA is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.
[0105] In this application, "miRNA302b", "miR-302b" or "miR303b" refers to a miRNA molecule whose sense strand is shown in SEQ ID NO: 1 and whose antisense strand is shown in SEQ ID NO: 2.
[0106] The exemplary double-stranded miRNAs with preliminary effects prepared in this application are shown in Table 1. Among them, Mimic 5-6, Mimic 10, Mimic 12-19, Mimic 22, Mimic 23, Mimic 24, Mimic 25, Mimic 26, Mimic 27, Mimic 28, Mimic 29, and Mimic 30 showed particularly significant effects.
[0107] Table 1. Modification of double-stranded miRNAs
[0108] Table 1 shows the modifications of double-stranded miRNAs.
[0109] Table 1 shows the modifications of double-stranded miRNAs.
[0110] Note: "sNN'" indicates that there is a phosphate thioester modification between nucleotide N and nucleotide N'; "Nm" indicates that there is a 2'-O-methyl modification between nucleotide X; "Nf" indicates that there is a 2'-fluoro modification between nucleotide X; "Nlna" indicates that there is a locked nucleic acid modification between nucleotide N. N and N' can be selected from A, T, C, G, and U. A, T, C, G, and U represent adenine ribonucleotide, thymine ribonucleotide, cytosine ribonucleotide, guanine ribonucleotide, and uracil ribonucleotide, respectively.
[0111] In a first aspect of this application, a double-stranded miRNA is provided, comprising a sense strand with a chemically modified sequence as shown in SEQ ID NO: 1, and an antisense strand with a chemically modified sequence as shown in SEQ ID NO: 2;
[0112] The chemical modifications of the sense strand and the antisense strand each comprise a 2'-substituted nucleotide and a modified nucleotide bond; the modified nucleotide bond is located at at least one or more positions (on the nucleotide) at the 5' end and 3' end of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0113] Here, "and / or" means that the modified nucleotide bond may be located at at least one or more of the 5' and 3' ends of the sequence shown in SEQ ID NO: 1, and at least one or more of the 5' and 3' ends of the sequence shown in SEQ ID NO: 2; or at least one or more of the 5' and 3' ends of the sequences shown in either SEQ ID NO: 1 or SEQ ID NO: 2. Unless otherwise specified, "and / or" when connecting SEQ ID NO: 1 and SEQ ID NO: 2 shall have at least the above meanings.
[0114] The 5' end may be the first 10 nucleotides (which can be interchanged with "first 10 positions"; the same below), the first 9 nucleotides, the first 8 nucleotides, the first 7 nucleotides, the first 6 nucleotides, the first 5 nucleotides, the first 4 nucleotides, the first 3 nucleotides, the first 2 nucleotides, or the first 1 nucleotide of the 5' end of the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.
[0115] The 3' end may be the first 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides of the 3' end of the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.
[0116] Modified nucleotide bonds
[0117] In some embodiments, the modified nucleotide bond is located at both the 5' and 3' ends. In some embodiments, the modified nucleotide bond is located only at the 5' end or the 3' end.
[0118] In some embodiments, the 5' end is the first 3 nucleotides (positions 1-3 of the sequence shown in SEQ ID NO: 1 or 2), the first 2 nucleotides (positions 1-3 and 1-2 of the sequence shown in SEQ ID NO: 1 or 2), or the first 1 nucleotide (positions 1-3 and 1 of the sequence shown in SEQ ID NO: 1 or 2).
[0119] In some embodiments, the 3' end is the first 4 nucleotides (positions 20-23 of the sequence shown in SEQ ID NO: 1 or 2), the first 3 nucleotides (positions 21-23 of the sequence shown in SEQ ID NO: 1 or 2), the first 2 nucleotides (positions 22-23 of the sequence shown in SEQ ID NO: 1 or 2), or the first 1 nucleotide (position 23 of the sequence shown in SEQ ID NO: 1 or 2).
[0120] In some embodiments, the modified nucleotide bond is located at at least one or more of positions 1-3 and 20-23 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0121] In some embodiments, the modified nucleotide bond is located at least at positions 1-2 of the sequence shown in SEQ ID NO: 1. In some embodiments, the modified nucleotide bond is located only at positions 1-2 of the sequence shown in SEQ ID NO: 1.
[0122] In some embodiments, the modified nucleotide bond is located at one or more of positions 1-3 and one or more of positions 20-23 of the sequence shown in SEQ ID NO: 1. Exemplarily, the modified nucleotide bond is located at least or only in the sequence shown in SEQ ID NO: 1.
[0123] The first three digits, and the 22nd and 23rd digits; the first three digits, and the 21st and 23rd digits; the first three digits, and the 20th and 23rd digits; the first three digits, and the 21st and 23rd digits; the first three digits, and the 20th and 21st digits; the first three digits, and the 20th and 22nd digits; the first three digits, and the 21st and 22nd digits; the first two digits, and the 22nd and 23rd digits; the first two digits, and the 21st and 23rd digits; the first two digits, and the 20th and 21st digits; the first two digits, and the 20th and 22nd digits; the first two digits, and the 20th and 22nd digits; the first two digits, and the 20th and 22nd digits; the first two digits, and the 20th and 23rd digits. 21-22; 2-3, and 22-23; 2-3, and 21-23; 2-3, and 20-23; 2-3, and 21-23; 2-3, and 23; 2-3, and 23; 2-3, and 20-21; 2-3, and 20-22; 2-3, and 21-22; 1, and 22-23; 1, and 21-23; 1, and 20-23; 1, and 21-23; 1, and 23; 1, and 20-21; 1, and 20-22; or, 1, and 21-22.
[0124] In some embodiments, the modified nucleotide bond is selected from the group consisting of thiophosphate, dithiophosphate, phosphate triester, aminoalkyl phosphate triester, phosphonic acid alkyl ester, phosphonite, aminophosphate, thiocarbonyl aminophosphate, thiocarbonyl alkyl phosphonate, thiocarbonyl alkyl phosphate triester, selenophosphate, boron phosphate, morpholino, siloxane, sulfide, sulfoxide, sulfone, formyl, thioformyl, methyleneformyl, nucleoacetyl, olefin-containing backbone, aminosulfonate, methyleneimino, methylenehydrazine, sulfonate, sulfonamide, and amide.
[0125] In some embodiments, the modified nucleotide bond is a thiophosphate ester.
[0126] In this application, the modified nucleotide and the 2'-substituted nucleotide may be located at the same site in SEQ ID NO: 1 and / or SEQ ID NO: 2, or at different sites.
[0127] 2'-Substituted Nucleotides
[0128] In some embodiments, the 2'-substituted nucleotide is selected from one or more of 2'-fluorine substitution modification and 2'-O-methylation.
[0129] In some embodiments, the 2'-O-methylation is located at one or more of positions 1-23 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0130] In some embodiments, the 2'-O-methylation is located at one or more positions 1 and 4-23 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the 2'-O-methylation is located at positions 1 and 4-23 of the sequence shown in SEQ ID NO: 2. An example is the antisense strand of Mimic 6.
[0131] In some embodiments, the 2'-O-methylation is located at one or more of positions 1, 4-12, and 14-23 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the 2'-O-methylation is located at one or more of positions 1, 4-12, and 14-23 of the sequence shown in SEQ ID NO: 1. Exemplarily, the positive strand of Mimic 6 is visible.
[0132] In some embodiments, the 2'-O-methylation is located at positions 1, 9-12, and 14-16 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; and one or more of positions 20-23. Exemplarily, the 2'-O-methylation is located at positions 1, 9-12, and 14-16 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; and:
[0133] The 20th to 23rd position, the 21st to 23rd position, the 20th to 23rd position, or the 20th to 22nd position.
[0134] In some embodiments, the 2'-O-methylation is located at positions 1, 9-12, and 14-16 of the sequence shown in SEQ ID NO: 1; and positions 21-23.
[0135] In some embodiments, the 2'-O-methylation is located at positions 1, 9-12, and 14-16 of the sequence shown in SEQ ID NO: 2; and positions 20-23, or positions 20-22.
[0136] In some embodiments, the 2'-O-methylation is located at positions 1-2 and 22-23 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; and one or more of the spacer positions in positions 3-21.
[0137] Unless otherwise specified, the term "spacer" in this application refers to a non-contiguous site in a sequence. The spacer referred to can be separated from the site by 1, 2, 3, 4, or more positions, as long as they are not consecutive. For example, the 1st and 3rd positions, or the 4th and 8th positions, are spacers to each other.
[0138] In some embodiments, the spacer positions in positions 3-21 are one or more of positions 4, 6, 8, 10, 12, 14, 16, 18, and 20. Exemplarily, the 2'-O-methylation is located at positions 1-2 and 22-23 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; and positions 4, 6, 10, 12, 14, 16, 18, and 20.
[0139] In some implementations, the 3rd to 21st interval bits are one or more of the 3rd, 5th, 7th, 9th, 11th, 13th, 15th, 17th, 19th and 21st bits.
[0140] In some embodiments, the thiophosphate and the 2'-O-methylation may be located at the same site or at different sites.
[0141] In some embodiments, the sense strand and / or the antisense strand simultaneously comprise thiophosphate modification and 2'-O-methylation modification. The thiophosphate and the 2'-O-methylation may be located at partial sites in the sense strand and / or the antisense strand, respectively, or they may be located at the same site simultaneously.
[0142] In some embodiments, the thiophosphate and the 2'-O-methylation are simultaneously located at the ends of the sense chain and / or the antisense chain, exemplarily at one or more of the 1st, 2nd, 21st, 22nd and 23rd positions.
[0143] In some implementations, the antisense chain contains the following sequence:
[0144] sCmUsAsCUAAAAmCmAmUmGGmAmAmGCACmsUmsUmA (Ansense chain of Mimic 12); or sCmUsAsCUAAAAmCmAmUmGGmAmAmGCACmsUmsUmsAm (Ansense chain of Mimic 13).
[0145] In some embodiments, the 2'-fluorine substitution modification occurs in nucleotides containing various types of bases.
[0146] In some embodiments, the 2'-fluorine substitution modification occurs in the nucleotide containing a subset of the bases. Exemplarily, the 2'-fluorine substitution modification occurs in the nucleotide containing uracil in SEQ ID NO: 1 and / or SEQ ID NO: 2, or in the nucleotide containing adenine, or in the nucleotide containing cytosine.
[0147] In some embodiments, the thiophosphate and the 2'-fluorine substitution modification are located at different sites.
[0148] In some embodiments, the 2'-fluorine substitution modification is located at least in the spacer positions of positions 3-21 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. Exemplarily, it is located at least in one or more of positions 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; or, at least in one or more of positions 4, 6, 8, 10, 12, 14, 18, and 20 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0149] In some embodiments, the 2'-fluorine substitution modification is located at at least one or more of the 3rd, 5th, 7th, 9th, 11th, 13th, 15th, 17th, 19th, and 21st positions of the sequence shown in SEQ ID NO: 1. In some embodiments, the 2'-fluorine substitution modification is located at the 3rd, 5th, 7th, 8th, 9th, 11th, 13th, 15th, 17th, 19th, and 21st positions of the sequence shown in SEQ ID NO: 1.
[0150] In some embodiments, the 2'-fluorine substitution modification is located at positions 4, 6, 8, 10, 12, 14, 18, and 20 of the sequence shown in SEQ ID NO: 2.
[0151] In some embodiments, the 2'-O-methylation and the 2'-fluorine substitution are located at the same or different sites. In some embodiments, the 2'-O-methylation and the 2'-fluorine substitution are located at different sites.
[0152] In some embodiments, the 2'-O-methylation and the 2'-fluorine substitution are alternated at positions 3-21 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. For example, the 2'-O-methylation is located at odd (or even) positions in positions 3-21, and the 2'-fluorine substitution is located at even (or odd) positions in positions 3-21.
[0153] In some embodiments, the 2'-fluorine substitution modification is located at at least one or more of the spacer positions in positions 3-21 of the sequence shown in SEQ ID NO: 1, and the 2'-O-methylation is located at positions 1.2 and 22-23 of the sequence shown in SEQ ID NO: 1; and at one or more of the spacer positions in positions 3-21.
[0154] For example, when the 2'-fluorine substitution modification is located at an odd position in positions 3-21 of the sequence shown in SEQ ID NO: 1, the 2'-O-methylation is located at an even position in positions 3-21 of the sequence shown in SEQ ID NO: 1; or when the 2'-fluorine substitution modification is located at least at an odd position in positions 3-21 of the sequence shown in SEQ ID NO: 1, the 2'-O-methylation is located at a site in positions 3-21 of the sequence shown in SEQ ID NO: 1 that does not contain a 2'-fluorine substitution modification; and,
[0155] One or more of the first two and the second two three positions (e.g., the first two positions) of the sequence shown in SEQ ID NO: 1 contain a thiophosphate.
[0156] In some embodiments, the 2'-fluorine substitution modification is located at at least one or more of the spacer positions in positions 3-21 of the sequence shown in SEQ ID NO: 2, and the 2'-O-methylation is located at positions 1-2 and 22-23 of the sequence shown in SEQ ID NO: 2; and at one or more of the spacer positions in positions 3-21.
[0157] For example, when the 2'-fluorine substitution modification is located at an even position in positions 3-21 of the sequence shown in SEQ ID NO: 2, the 2'-O-methylation is located at an odd position in positions 3-21 of the sequence shown in SEQ ID NO: 2; and one or more positions (e.g., positions 1-2 and 22-23) of positions 1-2 and 22-23 of the sequence shown in SEQ ID NO: 2 contain a thiophosphate.
[0158] For example, the 2'-O-methylation is located at least at odd positions in positions 3-21 of the sequence shown in SEQ ID NO: 2, the 2'-fluorine substitution modification is located at positions 3-21 of the sequence shown in SEQ ID NO: 2 that do not have 2'-O-methylation modification, and one or more positions (e.g., positions 1-2 and 22-23) of positions 1-2 and 22-23 of the sequence shown in SEQ ID NO: 2 contain thiophosphate.
[0159] In some embodiments, the 2'-fluorine substitution modification of the sequence shown in SEQ ID NO: 1 is located at at least one or more of the spacer positions in positions 3-21 of the sequence, and the 2'-O-methylation is located at positions 1-2 and 22-23 of the sequence; and at positions 3-21 without 2'-fluorine substitution modification; and in the sequence shown in SEQ ID NO: 2, the 2'-O-methylation is located at at least one or more of the spacer positions in positions 1-2 and 22-23 of the sequence; and at positions 3-21 without 2'-O-methylation.
[0160] In some embodiments, the 2'-O-methylation is located at positions 1-2 and 22-23, and positions 4, 6, 8, 10, 12, 14, 16, 18, and 20 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; and the 2'-fluorine substitution is located at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21 of SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0161] In some embodiments, the 2'-O-methylation is located at positions 1-2 and 22-23, and positions 4, 6, 10, 12, 14, 16, 18, and 20 of the sequence shown in SEQ ID NO: 1; and the 2'-fluorine substitution is located at positions 3, 5, 7, 8, 9, 11, 13, 15, 17, 19, and 21 of SEQ ID NO: 1.
[0162] In some embodiments, the 2'-O-methylation is located at positions 1-2 and 22-23, and positions 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21 of the sequence shown in SEQ ID NO: 2; and the 2'-fluorine substitution is located at positions 4, 6, 8, 10, 12, 14, 16, 18, and 20 of SEQ ID NO: 2.
[0163] In some embodiments, the 2'-O-methylation is located at positions 1-2 and 22-23, and positions 3, 5, 7, 9, 11, 13, 15, 16, 17, 19, and 21 of the sequence shown in SEQ ID NO: 2; and the 2'-fluorine substitution is located at positions 4, 6, 8, 10, 12, 14, 18, and 20 of SEQ ID NO: 2.
[0164] In some embodiments, the sense chain and / or the antisense chain simultaneously comprise 2'-O-methylation, 2'-fluorine substitution, and a thiophosphate. The thiophosphate, the 2'-O-methylation, and the 2'-fluorine substitution satisfy the above-described limitations.
[0165] In some implementations, the justice chain has the following modified sequence:
[0166] sUmsAmAfGmUfGmCfUmUfCmCfAmUfGmUfUmUfUmAfGmUfAmGm(The Justice Chain of Mimic 23); or sUmsAmAfGmUfGmCfUfUfCmCfAmUfGmUfUmUfUmAfGmUfAmGm(The Justice Chain of Mimic 25).
[0167] In some implementations, the antisense chain has the following modified sequence:
[0168] sCmsUmAfCmUfAmAfAmAfCmAfUmGfGmAfAmGfCmAfCmUfsUmsAm(Ansense chain of Mimic 22); sCmsUmAmCfUmAfAmAfAmCfAmUfGmGfAmAfGmCfAmCfUmsUmsAm(Ansense chain of Mimic 24); or sCmsUmAmCfUmAfAmAfAmCfAmUfGmGfAmAmGmCfAmCfUmsUmsAm(Ansense chain of Mimic 26).
[0169] The sense and antisense strands can be combined arbitrarily to form double-stranded miRNAs. Examples of double-stranded miRNAs are Mimic 23-26.
[0170] LNA modification
[0171] In some implementations, the justice chain and / or the antisense chain further include LNA modifications.
[0172] In some embodiments, the sense strand and / or the antisense strand comprises a thiophosphate, a 2'-O-methylation, and an LNA modification. The thiophosphate, the 2'-O-methylation, and the LNA modification may be located in the same or different nucleotides.
[0173] In some embodiments, the LNA modification excludes other modifications besides the LNA modification at the site. For example, in some embodiments, the thiophosphate and the 2'-O-methylation are located on the same or different nucleotides, and the LNA modification is located on a nucleotide that does not have thiophosphate and / or 2'-O-methylation modifications.
[0174] In some embodiments, the LNA modification is located at one or more positions in positions 1-8 of the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the LNA modification is located at least in the spacer positions in positions 1-8 of the sequence shown in SEQ ID NO: 2. Exemplarily, the LNA modification is located at positions 2, 4, 6, and 8 of the sequence shown in SEQ ID NO: 2; alternatively, the LNA modification excludes other modifications besides the LNA modification at the location.
[0175] In some embodiments, the sense chain and / or the antisense chain simultaneously comprise LNA modification, 2'-O-methylation modification, and thiophosphate as described above.
[0176] In some embodiments, all sites other than those with LNA modification are 2'-O-methylated. For example, except for positions 2, 4, 6, and 8 which are LNA-modified only, all other positions are 2'-O-methylated. In some embodiments, the sites containing LNA and 2'-O-methylation are as shown in the positive strand of Mimic16.
[0177] In some embodiments, the positive chain simultaneously includes LNA modification, 2'-O-methylation modification, and thiophosphate as described above.
[0178] In some implementations, the sequence of the justice chain is as follows: sUmAlnaAGlnaUGlnaCUlnaUmCmCmAmUGmUmUmUUAGUmsAmsGm (justice chain of Mimic 12).
[0179] DNA modification
[0180] In some embodiments, the sense and / or antisense strands of the double-stranded miRNA further contain DNA modifications.
[0181] In some embodiments, the double-stranded miRNA comprises phosphate thioester, 2'-O-methylation, and DNA modification.
[0182] In some embodiments, the double-stranded miRNA comprises phosphate thioester, 2'-O-methylation, LNA modification, and DNA modification.
[0183] In some embodiments, the DNA modification is replaced with thymine.
[0184] In some embodiments, the DNA modification involves replacing uracil with thymine.
[0185] In some implementations, the DNA modification excludes modifications other than LNA modification at the site.
[0186] In some embodiments, at least one uracil site in the sequence shown in SEQ ID NO: 1 has a DNA modification. In some embodiments, one, any two (e.g., positions 5 and 8, 5 and 13), any three (e.g., positions 5, 8, and 13), any four (e.g., positions 8, 13, 17, and 18), or all five positions in the sequence shown in SEQ ID NO: 1 are replaced with thymine. In some embodiments, one or more of the positions 5, 8, 13, 17, or 18 in the sequence shown in SEQ ID NO: 1 are replaced with thymine. In some embodiments, positions 5, 8, 17, and 18 in the sequence shown in SEQ ID NO: 1 are replaced with thymine. In some embodiments, all uracils in the sequence shown in SEQ ID NO: 1 are replaced with thymine. In some embodiments, the positive strand comprises a sequence as shown in the Mimic 14 positive strand.
[0187] In some embodiments, at least one uracil site in the sequence shown in SEQ ID NO: 2 has the DNA modification. In some embodiments, one or more of positions 5, 8, 13, 17, and 18 of the sequence shown in SEQ ID NO: 2 are replaced with thymine. In some embodiments, positions 5, 8, 13, 17, or 18 are replaced with thymine. In some embodiments, all uracils in the sequence shown in SEQ ID NO: 2 are replaced with thymine. In some embodiments, the antisense strand comprises a sequence as shown in the Mimic 14 antisense strand.
[0188] In some embodiments, all uracil in the sequence shown in SEQ ID NO: 1 are replaced with thymine, and all uracil in the sequence shown in SEQ ID NO: 2 are replaced with thymine.
[0189] In some implementations, the justice chain comprises a sequence as shown in the Mimic 14 justice chain, and the antisense chain comprises a sequence as shown in the Mimic 14 antisense chain.
[0190] In some embodiments, the double-stranded miRNA comprises phosphate thioester, 2'-O-methylation, and DNA modification.
[0191] In some implementations, the justice chain comprises the following sequence:
[0192] sUmAsAsGUGCTUmCmCmAmUGmUmUmUUAGUmsAmsGm (Justice Chain of Mimic 10), or sUmAsAsGTGCTUmCmCmAmUGmUmUmTTAGUmsAmsGm (Justice Chain of Mimic 22).
[0193] In some implementations, the antisense chain comprises the following sequence:
[0194] sCmUsAsCTAAAAmCmAmUmGGmAmAmGCACmsUmsUmsAm(Ansense chain of Mimic 10).
[0195] In some embodiments, the double-stranded miRNA comprises a phosphate thioester, 2'-O-methylation, LNA modification, and DNA modification. The phosphate thioester, 2'-O-methylation, LNA modification, and DNA modification are defined as described above.
[0196] In some implementations, the justice chain comprises the following sequence:
[0197] sUmAlnaAGlnaTGlnaCUlnaUmCmCmAmTGmUmUmTTAGUmsAmsGm(Mimic 15's Chain of Justice).
[0198] End modification
[0199] In some embodiments, the sense strand and / or the antisense strand of the double-stranded miRNA further comprises end modifications.
[0200] In some embodiments, the end modification is a 3' end with a 5'NN 3' structure protrusion, wherein each occurrence of N is independently selected from the group consisting of adenine (A), thymine (T), cytosine (C), guanine (G), and uracil (U).
[0201] The protruding end may or may not be decorated.
[0202] For example, the protruding end is selected from the group consisting of 5'Nm Nm 3', 5'sN sN 3', 5'Nm sN 3', 5'sN Nm 3', 5'sNm sNm 3', 5'sNm Nm 3', 5'Nm sNm 3', 5'sNm sNm 3', 5'sNm sN3' and 5'sN sNm 3'; wherein "m" represents 2'-O-methylation and "s" represents thiophosphate.
[0203] The NN can be selected from the group consisting of UG, TT, AC and AA.
[0204] In some specific embodiments, the protruding end is selected from the group consisting of 5'sTm sTm 3', 5'sUm sGm 3', 5'sAm sCm 3', and 5'sAm sAm 3'. For example, the protruding end is 5'sTm sTm 3', 5'sUm sGm 3', 5'sAm sCm 3', or 5'sAm sAm 3'.
[0205] In some implementations, the protruding end is located at the 3' end of the antisense chain.
[0206] In some implementations, the protruding end is located at the 3' end of sCmUsAsCUAAAAmCmAmUmGGmAmAmGCACmsUmsUmsAm (the antisense chain of Mimic 13).
[0207] In some implementations, the antisense chain has the following structure:
[0208] sCmUsAsCUAAAAmCmAmUmGGmAmAmGCACmsUmsUmsAmsUmsGm (Answer chain of Mimic 17), or sCmUsAsCUAAAAmCmAmUmGGmAmAmGCACmsUmsUmsAmsAmsCm (Answer chain of Mimic 19).
[0209] In some embodiments, the protruding end is located at
[0210] The 3' end of sCmsUmAmCfUmAfAmAfAmCfAmUfGmGfAmAmGmCfAmCfUmsUmsAm (the antisense chain of Mimic 26).
[0211] In some implementations, the antisense chain has the following modified sequence:
[0212] sCmsUmAmCfUmAfAmAfAmCfAmUfGmGfAmAmGmCfAmCfUmsUmsAmsUmsGm(Ansense chain of Mimic 27);
[0213] sCmsUmAmCfUmAfAmAfAmCfAmUfGmGfAmAmGmCfAmCfUmsUmsAmsTmsTm(Ansense chain of Mimic 28);
[0214] sCmsUmAmCfUmAfAmAfAmCfAmUfGmGfAmAmGmCfAmCfUmsUmsAmsAmsCm(Ansense chain of Mimic 29); or
[0215] sCmsUmAmCfUmAfAmAfAmCfAmUfGmGfAmAmGmCfAmCfUmsUmsAmsAmsAm(Ansense chain of Mimic 30);
[0216] And the justice chain has the following sequence:
[0217] sUmsAmAfGmUfGmCfUfUfCmCfAmUfGmUfUmUfUmAfGmUfAmGm(Mimic 25's Chain of Justice).
[0218] In some embodiments, the double-stranded miRNA is selected from the group consisting of Mimic 1 to 30 as shown in Table 1 above. In some embodiments, the double-stranded miRNA is Mimic 1. In some embodiments, the double-stranded miRNA is Mimic 2. In some embodiments, the double-stranded miRNA is Mimic 3. In some embodiments, the double-stranded miRNA is Mimic 4. In some embodiments, the double-stranded miRNA is Mimic 5. In some embodiments, the double-stranded miRNA is Mimic 6. In some embodiments, the double-stranded miRNA is Mimic 7. In some embodiments, the double-stranded miRNA is Mimic 8. In some embodiments, the double-stranded miRNA is Mimic 9. In some embodiments, the double-stranded miRNA is Mimic 10. In some embodiments, the double-stranded miRNA is Mimic 11. In some embodiments, the double-stranded miRNA is Mimic 12. In some embodiments, the double-stranded miRNA is Mimic 13. In some embodiments, the double-stranded miRNA is Mimic 14. In some embodiments, the double-stranded miRNA is Mimic 15. In some embodiments, the double-stranded miRNA is Mimic 16. In some embodiments, the double-stranded miRNA is Mimic 17. In some embodiments, the double-stranded miRNA is Mimic 18. In some embodiments, the double-stranded miRNA is Mimic 19. In some embodiments, the double-stranded miRNA is Mimic 20. In some embodiments, the double-stranded miRNA is Mimic 21. In some embodiments, the double-stranded miRNA is Mimic 22. In some embodiments, the double-stranded miRNA is Mimic 23. In some embodiments, the double-stranded miRNA is Mimic 24. In some embodiments, the double-stranded miRNA is Mimic 25. In some embodiments, the double-stranded miRNA is Mimic 26. In some embodiments, the double-stranded miRNA is Mimic 27. In some embodiments, the double-stranded miRNA is Mimic 28. In some embodiments, the double-stranded miRNA is Mimic 29. In some embodiments, the double-stranded miRNA is Mimic 30.
[0219] In some embodiments, the sense chain and / or the antisense chain further comprises at least one or more terminal groups.
[0220] In some embodiments, the terminal group is a 3' terminal group.
[0221] In some embodiments, the 3' terminal group includes, but is not limited to, lipid molecules, cell-penetrating peptides, aptamers, antibodies, antigen-binding fragments, polymers, dendritic macromolecules, and small molecule ligands. The lipid molecules may be selected from tocopherols, fatty acids (such as palmitic acid and stearic acid), phospholipid derivatives (such as phosphatidylethanolamine), bile acids, and cholesterol. The cell-penetrating peptides may be selected from TAT peptides and polyarginine. The antibodies or antigen-binding fragments may be selected from scFv and single-chain variable regions. The polymer may be a cationic polymer. The polymer may be polyethylene glycol (PEG). The dendritic macromolecules may be selected from PAMPAM, PEI, PLL, and PBAEs. The small molecule ligands may be selected from N-acetylgalactosamine (GalNac), folic acid, and carbohydrates (such as mannose).
[0222] I do not wish to be limited by any theory, but I believe that the addition of terminal groups at least facilitates the uptake of miRNA by cells.
[0223] In some embodiments, the terminal group is a fluorescent or biotinylated label at the 3' or 5' end.
[0224] In some embodiments, the 3' terminal group is cholesterol, and there is a thiophosphate modification between the 3' terminal group and the last nucleotide at the 3' end of the positive strand of the miRNA, as shown in Formula 1 or Figure 3.
[0225] In some embodiments, the 3' terminal group is cholesterol, as shown in Formula 2 or Figure 4.
[0226] In some embodiments, the 3' terminal group is GalNac, and there is a phosphate thioester modification between the 3' terminal group and the last nucleotide at the 3' end of the positive strand of the miRNA, as shown in Formula 3 or Figure 5.
[0227] In some embodiments, the 3' terminal group is GalNac, as shown in Formula 4 or Figure 6.
[0228] In some embodiments, the 3' terminal group is PEG-Chol, and there is a phosphate thioester modification between the 3' terminal group and the last nucleotide at the 3' end of the positive strand of the miRNA, as shown in Formula 5 or Figure 7.
[0229] In some embodiments, the 3' terminal group is PEG-Chol, as shown in Formula 6 or Figure 8.
[0230] A second aspect of this application provides a pharmaceutical composition comprising a double-stranded miRNA as described in the first aspect, and a pharmaceutically acceptable carrier.
[0231] In some embodiments, the pharmaceutical composition can achieve targeted therapy to specific tissues or cells. The target site for the targeted therapy can be any tissue or cell of the subject. The target sites for the targeted therapy include, but are not limited to, the liver, tumors, cardiovascular system, central nervous system, musculoskeletal system, eyes, and kidneys.
[0232] In some implementations, the subjects include, but are not limited to, mice, rats, non-human primates, and humans.
[0233] In some embodiments, the excipients of the pharmaceutical composition may be selected from one or more of the following components: (1) stabilizers / buffer salts; (2) lyophilization protectants; and (3) surface modifiers.
[0234] A third aspect of this application provides an anti-aging product comprising the double-stranded miRNA as described in the first aspect.
[0235] In some embodiments, the double-stranded miRNA may be one or more of Mimic10, Mimic12, Mimic13, Mimic17, Mimic19, Mimic22-26, Mimic28, and Mimic29.
[0236] A fourth aspect of this application provides the use of the double-stranded miRNA as described in the first aspect in the preparation of anti-aging products or medicaments for aging-related diseases.
[0237] In some embodiments, "anti-aging" in this application includes anti-skin aging. Skin aging phenomena include, but are not limited to, skin laxity (such as wrinkles, fine lines, etc.), decreased elasticity, uneven skin tone (such as age spots, etc.), dull skin tone, dry skin, enlarged pores, and thinning skin.
[0238] In some embodiments, the double-stranded miRNA may be one or more of Mimic5, Mimic10, Mimic12-15, Mimic17-19, and Mimic22-30.
[0239] In some implementations, the age-related diseases mentioned include Alzheimer's disease.
[0240] In a fifth aspect of this application, the use of the double-stranded miRNA as described in the first aspect is provided in the preparation of a medicament for the treatment of Alzheimer's disease.
[0241] In some embodiments, the double-stranded miRNA may be one or more of Mimic5, Mimic10, Mimic12-14, Mimic16-19, Mimic22-26, and Mimic27-30.
[0242] In a sixth aspect of this application, the use of the double-stranded miRNA as described in the first aspect is provided in the preparation of a medicament for treating articular cartilage injury.
[0243] In some embodiments, the double-stranded miRNA may be one or more of Mimic5, Mimic19, Mimic22, Mimic26, Mimic28, and Mimic29.
[0244] In a seventh aspect of this application, the use of the double-stranded miRNA as described in the first aspect is provided in the preparation of a medicament for the treatment of diabetes.
[0245] In some embodiments, the double-stranded miRNA may be one or more of Mimic5, Mimic10, Mimic12, Mimic13, Mimic19, Mimic22, Mimic23, Mimic25, Mimic26, Mimic28, and Mimic29.
[0246] In an eighth aspect of this application, the use of the double-stranded miRNA as described in the first aspect is provided in the preparation of a medicament for non-alcoholic fatty liver disease.
[0247] In some embodiments, the double-stranded miRNA may be one or more of Mimic5, Mimic10, Mimic12, Mimic13, Mimic19, Mimic22, Mimic23, Mimic25, Mimic26, Mimic28, and Mimic29.
[0248] In a ninth aspect of this application, the use of the double-stranded miRNA as described in the first aspect is provided in the preparation of a medicament for the treatment of cirrhosis.
[0249] In some embodiments, the double-stranded miRNA may be one or more of Mimic5, Mimic12, Mimic13, Mimic19, Mimic24-26, and Mimic29.
[0250] In a tenth aspect of this application, the use of the double-stranded miRNA as described in the first aspect is provided in the preparation of a medicament for treating androgenetic alopecia.
[0251] In some embodiments, the double-stranded miRNA may be one or more of Mimic5, Mimic6, Mimic10, Mimic12, Mimic13, Mimic19, Mimic22-26, and Mimic28-30.
[0252] In the eleventh aspect of this application, the use of the double-stranded miRNA as described in the first aspect is provided in the preparation of a medicament for treating chronic nephritis.
[0253] In some embodiments, the double-stranded miRNA may be one or more of Mimic5, Mimic12, Mimic13, Mimic17-19, Mimic23-26, Mimic28, and Mimic29.
[0254] In some embodiments, the method of administration of the anti-aging product or the drug is selected from the group consisting of intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, tracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, spinal, and intrasternal injection and infusion.
[0255] In a twelfth aspect of this application, a method is provided for treating Alzheimer's disease, articular cartilage damage, diabetes, non-alcoholic fatty liver disease, cirrhosis, androgenetic alopecia, or chronic nephritis, the method comprising administering to a subject the double-stranded miRNA as described in the first aspect.
[0256] In a thirteenth aspect of this application, a nanocarrier comprising double-stranded miRNA as described in the first aspect is provided. The nanocarrier may be selected from liposome nanoparticles (LNPs), polymer nanoparticles (such as PEI, PBAE), and exosomes.
[0257] Example 1: Selection of miR302 target
[0258] Clipping is a method primarily used to isolate and identify RNAs, microRNAs (miRNAs), and protein complexes in ribonucleoprotein complexes within cells. This method can determine whether certain RBPs (RNA-binding proteins) can bind to specific RNAs and immunoprecipitate the RBPs and their bound RNA. Crosslinking-immunoprecipitation (CLIP) and PAR-CLIP techniques expose living cells to ultraviolet light, causing RNA-protein binding. Specific proteins and their bound RNAs can then be separated using immunoprecipitation, followed by high-throughput sequencing to identify the RNA type. PAR-CLIP-Seq applied to miRNA target gene analysis can significantly reduce the false positive prediction frequency of miRNA binding sites and narrow the search space for miRNA binding sites. It can identify binding sites of the AGO2 protein on different RNAs across the entire genome.
[0259] LO2 cells transfected with miR-302b mimics were irradiated with 254 mJ of ultraviolet light, and cells were scraped from 15 cm plates. Ago2 clip-seq was performed as previously described. Cell lysates were immunoprecipitated with anti-Ago2 antibody (Abcam, ab186733) to enrich Ago2 protein and its binding RNA. Immunoprecipitated RNA was extracted with TRIzol, treated with DNase I, and the purified RNA was reverse transcribed to synthesize cDNA for high-throughput sequencing. Based on sequence alignment analysis, the expected binding site of miR-302b was determined (see Figure 2). The study found that miR-302b has a strong binding affinity to CDKN1A (free energy MEF = -12.84 kcalmol; the lower the MEF value, the stronger the binding affinity). However, when the binding site in the 3'UTR region of CDKN1A is mutated (from GGCACTT to CCGTGAA), the free energy increases to -6.1 kcalmol, and the binding affinity decreases, indicating that miR-302b has a high specificity for binding to CDKN1A.
[0260] CDKN1A is a CDK (cyclin-dependent kinase) inhibitor that maintains cell cycle arrest by binding to CDK2, CDK4, and CDK6, preventing these kinases from phosphorylating cyclins. CDKN1A has been widely used as a major marker of senescent cells. This role of CDKN1A is one of the cell's responses to internal and external stimuli such as DNA damage and oxidative stress. During cellular senescence, p21 expression typically increases, and this elevated CDKN1A level causes cells to arrest in the G1 phase, preventing them from entering the S phase for DNA replication. This cell cycle arrest is a classic characteristic of senescent cells, marking the loss of growth and proliferation capacity after physiological or pathological stress. In addition to maintaining cell cycle arrest in senescent cells, CDKN1A also plays a prominent role in establishing SASP through protein Rb-dependent transcription (including selected SMAD and STAT transcription factors). Although this transcriptional program remains active in senescent cells, CDKN1A initiates this program as the first response to cellular stress occurring concurrently with cell cycle arrest. The resulting immediate early secretory proteome is what they call the CDKN1A-activated secretory phenotype.
[0261] Example 2: Synthesis of miR302b-Mimic
[0262] A series of small nucleic acids with different modifications were designed and synthesized.
[0263] The modification groups are shown in Table 2:
[0264] Table 2. Sequences of miR302b with different modifications and the control group.
[0265] Table 2 shows the sequences of miR302b with different modifications and the control group.
[0266] Table 2 shows the sequences of miR302b with different modifications and the control group.
[0267] Note: "sNN'" indicates a phosphate thioester modification between nucleotide N and nucleotide N'; "Nm" indicates a 2'-O-methyl modification between nucleotide N; "Nf" indicates a 2'-fluorine modification between nucleotide N; "Nlna" indicates a locked nucleic acid modification between nucleotide N. N and N' can be selected from A, T, C, G, and U. A, T, C, G, and U represent adenine ribonucleotide, thymine ribonucleotide, cytosine ribonucleotide, guanine ribonucleotide, and uracil ribonucleotide, respectively. The NC sequence is selected from a commonly used control sequence (Qi, L, Chen, J., Zhou, B. et al. Homeobox C6 promotes metastasis by orchestrating the DKK1 / Wnt / β-catenin axis in right-sided colon cancer. Cell Death Dis 12, 337 (2021).).
[0268] Preparation process:
[0269] The basic preparation process of small nucleic acid single strands is shown in Figure 1.
[0270] Step 1a. Synthesize using an OP100 / OS50 solid-phase synthesizer: including steps such as deprotection, coupling, oxidative / thiolated modification, and capping.
[0271] Specifically:
[0272] Prepare a DCA toluene solution as a deprotecting agent, ETT (0.25M, 5-ethylthiotetrazole N / A acetonitrile) as a coupling agent, a 0.05M iodine-pyridine / aqueous solution as an oxidizing agent, hydroflavin as a thioating agent, and a CH3CN / imidazolium solution containing 20% acetyl chloride as a capping reagent. Place these reagents in the designated positions on the OP100 / OS50 synthesizer. Set the synthesis program, input the specified oligonucleotide base sequence, and begin the cyclic oligonucleotide synthesis. Each coupling step takes 6 minutes, and the coupling time for the L and S monomers corresponding to the galactose ligand is 10-20 minutes. After automatic cycling, the oligonucleotide solid-phase synthesis is complete.
[0273] Step 1b. Ammonolysis and desilication.
[0274] Ammonolysis was performed using 160 mL / mmol AMA at 60 °C for 3 h. Desilication was then carried out using 20 mL / mmol DMSO, 280 mL / mmol TEA, and 93.3 mL / mmol TEA*3HF (≤15 °C) at 40 °C for 4 h. After the desilication reaction was complete, the system was diluted with purified water, and the pH was adjusted to approximately 7.0 with an aqueous acetic acid solution. The system was then centrifuged to allow sedimentation, and the solid was collected.
[0275] Step 1c. Purification.
[0276] The Agilent HPLC purification system was used. The sample was dissolved and loaded with hot ethanol at 45°C. Mobile phase A: 200mM TEAA in H2O, mobile phase B: preparative acetonitrile, elution gradient of 20-80% for 90 min, linear flow rate of 160-200 cm / h (10 mL / min), purification column of C8 or C18, column temperature of 40°C.
[0277] Step 1d. Desalination and freeze-drying.
[0278] Purified water was used for ultrafiltration desalination, and the equipment was a 3kDa TFF membrane-encapsulated ultrafiltration desalination system.
[0279] Finally, double-stranded small nucleic acids were prepared by annealing and freeze-drying.
[0280] Example 3: Validation of target inhibition rate and cell proliferation phenomenon
[0281] 3.1 Verification of target inhibition rate and cell proliferation in LO2 cells
[0282] Based on previous data, a cell senescence model was established using the following method: Well-grown p21-YFP LO2 cells were treated with stress medium (complete medium containing 50 nM Dox) for 48 h, followed by culturing in normal medium for 48 h. Senescent cells expressed p21 protein at high levels and emitted YFP fluorescence. Flow cytometry (FACSCalibur, BD Biosciences) was used to sort individual SnCs (senescent cells) based on p21 expression; the sorted cells were found to be uniformly senescent.
[0283] LO2 cells and senescent LO2 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum at 37°C with 5% CO2. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were transfected with transfection reagents. The experimental group was transfected with Mimic1-30, the blank control group (NC) was transfected with unrelated siRNA / miRNA, the mock transfection reagent control group used the same amount of transfection reagent as the experimental group but without exogenous nucleic acid, the untreated control group received no experimental intervention, the unmodified miRNA control group (miRNA302b) was transfected with the naked sequence of miRNA302b, and the model group consisted of senescent cells without any experimental intervention. The cell concentration was adjusted to 1×10⁻⁶ cells / year. 6 / mL, add 1mL of cell solution and 5μL to each well of a 6-well plate. RNAiMAX Reagent transfection reagent. After standing at room temperature for 5 min, add 5 μL of 10 μM siRNA and incubate at 37°C and 5% CO2 for 48 h. There were three replicates for both the experimental and control groups.
[0284] Real-time quantitative PCR analysis of target mRNA levels:
[0285] 1. Cells were lysed 48 hours after transfection, and total RNA was extracted using the Trizol method.
[0286] 2. Reverse transcription (Takara kit, catalog number 638313).
[0287] 3. Quantitative Real-Time PCR
[0288] Using the GAPDH gene as an internal reference, real-time quantitative PCR was performed using the SYBR Premix (2×) Real-time PCR kit, and the PCR reaction was conducted using a Rotor-Gene-Q real-time PCR instrument (Qiagen, USA). Primers used were:
[0289] CDKN1A:
[0290] Forward Primer ACATCGCCAAGGAAAAACGC (SEQ ID NO: 5)
[0291] Reverse Primer GTCTGTTTCGGTACTGTCATCC (SEQ ID NO: 6)
[0292] GAPDH:
[0293] Forward Primer TGTGGGCATCAATGGATTTGG (SEQ ID NO: 7)
[0294] Reverse Primer ACACCATGTATTCCGGGTCAAT (SEQ ID NO: 8)
[0295] After the PCR reaction, the Ct error for each of the nine replicates (three transfection replicates and three qPCR replicates) was within ±0.5. The relative mRNA expression level of the NC group was 1. The average target gene expression level of each group relative to the NC group was calculated, and the results are shown in Table 3 below.
[0296] Table 3. Relative expression levels of target mRNAs in LO2 cells
[0297] The results showed that, compared with natural miRNA, the inhibitory effect on the target decreased after some modifications, while it increased after other modifications. The addition of thio-modification and methylation modifications had little effect on the knockdown ability of the two targets. Further addition of LNA modification, fluorination modification, replacing part of the RNA sequence with DNA sequence, and adding protective bases to the antisense strand increased the knockdown ability of the target.
[0298] Furthermore, after sorting, the cells were identified as uniformly senescent cells, and the cell concentration was adjusted to 1×10⁻⁶. 6 / mL, add 1mL of cell solution and 5μL to each well of a 6-well plate. RNAiMAX Reagent transfection reagent. After standing at room temperature for 5 min, 5 μL of 100 nM miRNA was added, and the cells were cultured at 37°C and 5% CO2. The re-division of senescent cells was observed using a high-content laser confocal cell imaging system (Opera Phenix, PerkinElmer Enterprise Management Ltd.) (one image was taken every hour, and the data was recorded for 72 h). Cell division events in the field of view were recorded, and the experiment was repeated 3 times. The number of cells in the field of view was summed. The results are shown in Table 4.
[0299] Table 4. Cell proliferation results in LO2 cells.
[0300] The results showed that under low concentrations of small nucleic acids transfected, no cell proliferation events were detected in the NC group, miRNA302b group, Mimic 1-3, Mimic 7-8, and Mimic 21 groups, and the number of cells in the field of view was close to the number of seeded cells, indicating that senescent cells hardly proliferated, and the above modifications failed to achieve the biological functions of small nucleic acids. Mimic 4-6 observed a total of less than 5 cell proliferation events, indicating that some senescent cells under these experimental conditions underwent "reverse aging". Mimic 8-10 were modified based on Mimic 5 by partially replacing U with deoxyribonucleic acid (T). Groups 8-9 showed worse results than the unmodified group, while group 10 observed 10 division events and a significantly increased number of cells in the field of view, indicating that in some cases, replacing ribonucleic acid with deoxyribonucleic acid... It can enhance the biological function of small nucleic acids; furthermore, some bases in Mimic12-20 have been modified with LNA. Compared with Mimic10, some of these modifications further enhance its biological function, such as Mimic19, which adds a modified 5'-AC-3' to the antisense strand of Mimic13. The number of cells exceeded 300 in 5 fields of view, and 17 clear proliferation phenomena were observed, while in other cases, its biological function was reduced; furthermore, Mimic11 and Mimic22-30 have been modified with fluorination at different sites, and some of these modifications further enhance their biological function, such as Mimic26 and 29.
[0301] 3.2 Verification of target inhibition rate and cell proliferation in IMR90 cells
[0302] Based on previous data and the biological characteristics of IMR90 cells (human embryonic lung fibroblasts, a classic senescence research model), a cellular senescence model was established using the following method: Well-grown p21-YFP IMR90 cells were treated with stress medium (high-glucose DMEM complete medium containing 40 nM Dox; IMR90 cells are more sensitive to Dox than LO2 cells) for 48 h, and then cultured in normal medium for 48 h. Single senescent cells (SnCs) were sorted using flow cytometry (FACSCalibur, BD Biosciences) using p21-YFP fluorescence. After sorting, the SA-β-gal staining positivity rate was >90%, confirming the cells as uniformly senescent cells (meeting the classic validation criteria for the IMR90 cell senescence model).
[0303] IMR90 cells and senescent IMR90 cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum and 1% non-essential amino acids at 37°C with 5% CO2. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were transfected with transfection reagents. The experimental group was transfected with Mimic1-30, the blank control group (NC) was transfected with unrelated siRNA, the mock transfection reagent control group used the same amount of transfection reagent as the experimental group but without exogenous nucleic acid, the untreated control group received no experimental intervention, and the unmodified miRNA control group (miRNA302b) was transfected with the naked sequence of miRNA302b. The cell concentration was adjusted to 1×10⁻⁶. 6 / mL, add 1mL of cell solution and 5μL to each well of a 6-well plate. RNAiMAX Reagent transfection reagent. After standing at room temperature for 5 min, add 5 μL of 10 μM siRNA and incubate at 37°C and 5% CO2 for 48 h. There were three replicates for both the experimental and control groups.
[0304] Real-time quantitative PCR analysis of target mRNA levels:
[0305] 1. Cells were lysed 48 hours after transfection, and total RNA was extracted using the Trizol method.
[0306] 2. Reverse transcription (Takara kit, catalog number 638313).
[0307] 3. Quantitative Real-Time PCR
[0308] Using the GAPDH gene as an internal reference, real-time quantitative PCR was performed using the SYBR Premix (2×) Real-time PCR kit, and the PCR reaction was conducted using a Rotor-Gene-Q real-time PCR instrument (Qiagen, USA). The primers used for CDKN1A and GAPDH were the same as those described in section 3.1. Each sample was tested in triplicate.
[0309] After the PCR reaction, the Ct error for each of the nine replicates (three transfection replicates and three qPCR replicates) was within ±0.5. The relative mRNA expression level of the NC group was 1. The average target gene expression level of each group relative to the NC group was calculated, and the results are shown in Table 5 below.
[0310] Table 5. Relative expression levels of target mRNAs in IMR90 cells.
[0311] The results showed that in the IMR90 cell model, compared with the native miRNA302b, some modifications (such as Mimic1 and Mimic21) led to a decrease in target inhibition, while most modifications enhanced the inhibitory ability. This is consistent with the sensitivity of IMR90 cells to small nucleic acid modifications and aligns with the research conclusion reported in *Aging Cell* that "nucleic acid modifications in IMR90 cells can significantly regulate miRNA targeting efficiency." Specifically, the addition of thiomodification and methylation modifications had little effect on target knockdown ability. Further addition of LNA modification, fluorination modification, and replacing part of the RNA sequence with a DNA sequence and adding protective bases to the antisense strand significantly enhanced the inhibitory ability against CDKN1A, which is highly consistent with the results in LO2 cells.
[0312] Further, the sorted cells were homogeneous senescent IMR90 cells (SA-β-gal positivity rate 92%). The cell concentration was adjusted to 1×10⁻⁶. 6 / mL. Add 1mL of cell solution and 5μL to each well of a 6-well plate. RNAiMAX Reagent transfection reagent. After standing at room temperature for 5 min, 5 μL of 100 nM miRNA was added, and the cells were cultured at 37°C and 5% CO2. The re-division of senescent cells was observed using a high-content laser confocal cell imaging system (Opera Phenix, PerkinElmer Enterprise Management Ltd.) (one image was taken every hour, and the data was recorded for 72 h). Cell division events in the field of view were recorded, and the experiment was repeated 3 times. The number of cells in the field of view was summed. The results are shown in Table 6.
[0313] Table 6. Cell proliferation results in IMR90 cells.
[0314] The results showed that when transfected with low concentrations of small nucleic acids, no cell proliferation events were detected in the NC group, miRNA302b group, Mimic1-3, Mimic7-8, and Mimic21 group, and the number of cells in the field of view was close to the seeded number, indicating that senescent IMR90 cells hardly proliferated. These modifications failed to achieve the expected biological function of the small nucleic acids, which is consistent with the characteristic that G1 phase arrest is more stable in senescent IMR90 cells, and is consistent with the research conclusion reported in *Cell Reports* that "IMR90 senescent cell cycle arrest depends on high CDKN1A expression."
[0315] Mimic4-6 showed a cumulative observation of up to 5 cell proliferation events, indicating that some senescent IMR90 cells under these experimental conditions underwent "rejuvenation." Mimic8-10 were modified from Mimic5 by partially replacing U with T DNA. Mimic8-9 showed less effect than the unmodified group, while group 10 observed 11 division events and a significant increase in cell count per field, demonstrating that in some cases, replacing ribonucleic acid with deoxyribonucleic acid can enhance the biological function of small nucleic acids in IMR90 cells. Furthermore, Mimic12-20 incorporated LNA modifications to some bases. Compared to Mimic10, some of these modifications further enhanced their biological function. For example, Mimic19, which added a modified 5'-AC-3' antisense strand to Mimic13, showed over 300 cells per field in 5 fields and 18 clear proliferation events, while in other cases, it reduced their biological function. Furthermore, Mimic11 and Mimic22-30 were fluorinated at different sites, and their biological functions were further enhanced in some of these modifications, such as Mimic26 and 29. The results were completely consistent with the trend in LO2 cells, confirming that the "anti-aging" function of the modified double-stranded miRNAs is universal across cell lines.
[0316] Example 4 Stability Test
[0317] Human serum was obtained by separating peripheral blood from volunteers; C57 mouse serum and SD rat serum were obtained by separating blood from the orbital cavity. Tris-base was purchased from Sigma-Aldrich; hexafluoroisopropanol (HFIP) and diisopropylamine (DIPA) were both products of Sigma-Aldrich; methanol was chromatographically pure and a product of Sigma-Aldrich; other reagents were analytically pure.
[0318] Solution preparation:
[0319] (1) 5% ammonia solution: Take 4 mL of 25% ammonia solution and add it to 16 mL of deionized water;
[0320] (2) 50 μM siRNA solution: Take 46 μL of 10 mg / mL siRNA stock solution (containing 5% methanol) and add it to 660.5 μL of deionized water.
[0321] Stability testing of Mimic in different matrices:
[0322] Take 90 μL of 50 μM siRNA sample solution and add it to 810 μL of deionized water, human serum, rat serum, and mouse serum, respectively. Take 90 μL of 50 μM siRNA control solution and add it to mouse serum. After incubating in a 37℃ water bath for 0, 0.25, 0.5, 1, and 2 h, take 100 μL of each sample for pretreatment. Except for the deionized water sample which was directly injected for analysis, the remaining 100 μL of biological matrix samples were added to 250 μL of 5% ammonia solution, mixed well, and then 100 μL of liquid-liquid extraction buffer (phenol-chloroform-isoamyl alcohol mixture) was added. After mixing well, the samples were centrifuged at 16000×g for 10 min at 4℃. Take 332 μL of supernatant, and then blow the supernatant with nitrogen to about 30 μL at room temperature. Add ultrapure water to 100 μL. After reconstitution, the sample was centrifuged at 16000×g for 10 min at 4℃, and the supernatant was collected for analysis.
[0323] Liquid chromatography-mass spectrometry (LC-MS): Mimic stability was determined using an ultra-high performance liquid chromatography / ion trap mass spectrometry system (Waters Acquity UPLC / Thermo Fisher LTQ).
[0324] The chromatographic column was an Oligonucleotide BEH C18 column (2.5 μm, 2.1 mm × 50 mm). The mobile phases were A (10 mM DIPA, 25 mM HFIP in water) and B (10 mM DIPA, 25 mM HFIP in water / MEOH (50 / 50, v / v)). Gradient elution was used: 0–3 min: 5% B; 3–15 min: 5% → 35% B; 15–18 min: 35% → 5% B; 18–25 min: 5% B. The flow rate was 0.3 mL / min. The column temperature was 80 °C. The detection wavelength was 260 nm. The mass spectrometry conditions were: electrospray ionization (ESI) source; spray voltage: 5 kV; capillary temperature: 350 °C; and scanning mode: negative ion selected ion scanning (SIM).
[0325] Table 7 shows the data on the remaining percentage of positive chain (SS) after incubation for different times in different matrices by Mimic, in relation to the incubation time.
[0326] Table 7. Percentage of Justice Chain Remaining After Mimic Incubation in Different Substrates for Different Times
[0327] The results showed that in pure water, natural miR302b, Mimic10, Mimic19, and Mimic28 were almost unaffected after 5 hours; in mouse, rat, and human serum, natural miR302b was almost undetectable after 1 hour, and the stability of all three modified Mimics was increased, with the fluorinated one being the best.
[0328] Example 5: Different modifications of miR302 for the treatment of aging
[0329] In vivo delivery requires further additions to the Mimic delivery method, such as LNP, with GalNac (L96) or cholesterol added to the 3' end, or polymers such as PAMAM, PEI, PLL, and PBAEs. In this embodiment, the 3' end is modified with cholesterol to increase systemic distribution. The connection between cholesterol and the nucleic acid chain is shown in Figure 3 or Figure 4.
[0330] One hundred and sixty 24-month-old male C57BL / 6 rats were divided into 32 groups of five rats each. They were given NC or Mimic 1-30 via tail vein, 100 μL / time, for a total of 200 μg, once every two weeks for a total of four times.
[0331] Mouse Recording and Statistics: Mouse mortality was recorded for each group, and the number of mice aged 24-28 months was counted. Mice were weighed weekly, and the weights of 24-month-old (24mo) and 28-month-old (28mo) mice were analyzed. Mouse skin was photographed weekly, and ImageJ was used to calculate the area of alopecia areata. The area of alopecia areata in 24-month-old and 28-month-old mice was statistically analyzed.
[0332] Rotating bar experiment: The mouse was placed on a rotating bar and the speed of the rotating bar was kept at 25 rpm. The time the mouse spent on the rotating bar was recorded. After 4 days of learning, the experiment was carried out on the fifth day.
[0333] As shown in Table 8, compared to 24 months of age, approximately 60% of the mice in the control group (NC group) had died by 28 months of age. The average lifespan of C57BL / 6 mice is approximately 26-28 months, which is consistent with their median mortality rate. The average weight decreased from approximately 38g to approximately 24g, indicating weight loss due to aging. The dwell time in the rotarod test decreased from approximately 66 seconds to approximately 44 seconds, showing a significant decline in their balance and motor abilities. Alopecia areata is a common phenomenon in aging C57BL / 6 mice, and it worsened at 28 months of age, increasing in size from approximately 1.5cm. 2 Increased to 3.1cm 2Compared to the aged mice group at 28 months of age, over 80% of the mice in the partially administered Mimic groups (Mimic 10, 12, 13, 14, 17, 19, 22, 23-29) survived at 28 months. The partially administered Mimic groups (Mimic 5, 10, 12, 13, 14-16, 17-19, 22-26, 28, 29) maintained stable body weight, showing a significant difference from the control group. The partially administered Mimic groups spent more time on the rotarod compared to the control group (Mimic 9, 10, 12, 13, 17, 19, 22-30), indicating enhanced motor and balance abilities. The area of bald patches in the partially administered Mimic groups was significantly smaller than that in the control group at 28 months of age (Mimic 10, 12, 13, 17, 19, 22-30), indicating a reversal of hair loss in aging mice. Other Mimic groups showed no difference from the control group, suggesting the mice were still in a state of gradual aging. The above results further suggest that miR-302b Mimic10, 12, 13, 17, 19, 22-26, 28, and 29 have the ability to reverse aging at the whole animal level.
[0334] Table 8 Results of Mimic's anti-aging treatment
[0335] Table 8. Continued results of Mimic's aging treatment.
[0336] Example 6: miR302 Mimic for the treatment of skin aging
[0337] Skin aging is a natural physiological process, and its manifestations include wrinkles, sagging, pigmentation, and dryness. Skin aging is a complex biological process involving multiple factors, including genetics, environment, and lifestyle.
[0338] Currently, strategies for alleviating skin aging include: sun protection, moisturizing, anti-oxidation, exercise, a healthy diet, regular sleep patterns, skin care (cosmetic care, beauty salon care), and medical aesthetics (laser treatment, microneedling, filler injections, etc.). While these strategies all have some effect, they often only address the symptoms, not the root cause.
[0339] A skin photoaging model was constructed: 8-week-old male Balbc mice were used, with 6 mice in each group (see table below). The mice were irradiated with UVB (310nm, 20W) at a distance of 30cm for 20 minutes at a fixed time every day for 4 weeks.
[0340] Four weeks later, the model group mice developed numerous thick wrinkles on their backs, and the skin showed signs of keratinization. The wrinkles were scored using statistical methods, and this was used as the basis for the scoring.
[0341] (1) Wrinkle score: 0 points, no thick wrinkles;
[0342] (2) 2 points: There are very few shallow but thick wrinkles on the back;
[0343] (3) 4 points: There are many shallow and thick wrinkles on the back;
[0344] (4) 6 points: There are deep, long wrinkles on the back.
[0345] In this embodiment, a 'chol' modification is added to the 3' end. The connection between cholesterol and the nucleic acid chain is shown in Figure 3 or Figure 4.
[0346] As shown in Table 9, the wrinkle score in the normal mouse group (without UV exposure) was approximately 0.5, while that in the model group was 2.23. Some Mimic groups (Mimic5, 10, 12-15, 17-19, 22-30) showed significant reduction in wrinkles compared to the model group. These results indicate that Mimic5, 10, 12-15, 17-19, and 22-30 have therapeutic effects on skin cell photoaging and pigmentation.
[0347] Table 9 Results of Mimic's Skin Aging Treatment
[0348] Example 7 miR302 Mimic Treatment of Alzheimer's Disease
[0349] Alzheimer's disease (AD) is complex, and the most commonly used model is the 5xFAD model. These mice carry five mutated genes associated with Alzheimer's, including three APP gene mutations (Swedish, Florida, and London mutations) and two PSEN1 gene mutations (M146L and L286V mutations). This model encompasses almost all neuropathological features of AD, including amyloid plaques, glial cell proliferation, neurotransmission defects, synaptic loss, and neurodegenerative changes, making it an important model for studying Aβ production and toxicity. Similar to AD patients, the AD-like pathology in 5xFAD mice can be divided into three stages: an asymptomatic period around 2 months of age, during which Aβ plaques begin to appear in the cortex and hippocampus; a symptomatic period around 6 months of age, characterized by extensive amyloid pathology, neuroinflammation, significant cognitive deficits, and neurotransmission impairment; and a late-symptomatic period around 9 months of age, characterized by synaptic and neuronal loss, accompanied by severe cognitive and behavioral impairments. The level of αβ42 in the blood is closely related to the early diagnosis and progression of Alzheimer's disease (AD), and usually shows that the level of αβ42 in the blood is elevated in patients with early AD.
[0350] Using 5xFAD mice, 3-month-old mice were injected intracerebroventricularly with the corresponding drugs (3' end modified with cholesterol) according to the groups in Table 10. The dosage was 200 μg / mouse, dissolved in 50 μL of physiological saline. The drugs were administered once a month for a total of 3 months. The mice were then tested at 6 months of age.
[0351] The results showed that, compared with the model group, the escape latency was significantly shortened in some Mimic groups (Mimic5, 6, 10-19, 22-26, 28-30) during the water maze experiment; and the blood αβ42 content was significantly reduced in some Mimic groups (Mimic5, 10, 12-14, 16-19, 22-30). These results suggest that Mimic5, 10, 12-14, 16-19, and 22-30 have a therapeutic effect on Alzheimer's disease.
[0352] Table 10. Results of Mimic's AD treatment
[0353] Example 8: Treatment of articular cartilage damage with miR302 Mimic
[0354] Articular cartilage injury and lesions are very common clinical conditions. Trauma and cartilage degeneration are the main factors contributing to articular cartilage damage. Articular cartilage is composed of chondrocytes and extracellular matrix, and is a milky-white connective tissue that covers the joint surface. It is elastic and primarily functions to cushion impact and lubricate the joint. Because articular cartilage lacks blood vessels, nerves, and lymphatic tissue, its self-repair capacity is limited, and once damaged, it is difficult to repair itself.
[0355] Experimental animals: SD rats; weighing 250-280g; male.
[0356] Modeling Method: After experimental anesthesia, the hair around the knee joint was shaved, and the patient was placed supine on the operating table. The area was disinfected and draped. A 4cm incision was made on the medial side of the knee joint. The subcutaneous fascia was separated, revealing the white ligamentous tissue (patellar ligament). A small incision was gently made along the upper medial side. The patella was everted to expose the femoral-knee joint. A 4mm diameter, 3mm deep hole was drilled into the medial condyle articular surface, penetrating the subchondral bone, allowing fresh blood to seep into the joint cavity, resulting in damage to the articular cartilage throughout the procedure. The patella was repositioned, and the wound was sutured layer by layer.
[0357] At 3 months of age, the corresponding drugs in the table below were injected into the joint cavity according to the groups in Table 11 (3 animals per group). The drugs were modified with cholesterol at the 3' end. The dosage was 400 μg / animal, dissolved in 50 μL of physiological saline. The drugs were administered once every two weeks for a total of 4 times. Samples were collected at 5 months of age for testing.
[0358] The Modified Mankin Score was used to score the degree of damage to articular cartilage. It mainly assessed four aspects: cartilage structure (0-6 points), chondrocytes (0-3 points), matrix staining (0-4 points), and tidal line integrity (0-1 points). The total score was 0-14 points, with higher scores indicating more severe damage.
[0359] The proportion of Col2α1-positive cells represents the expression level of type II collagen in chondrocytes. Type II collagen is a major component of the extracellular matrix of chondrocytes and is crucial for maintaining the structure and function of cartilage. The proportion of Col2α1-positive cells reflects the activity of chondrocytes and the repair capacity of cartilage tissue, and is an important indicator for assessing cartilage damage and repair outcomes. A higher proportion of Col2α1-positive cells generally indicates better cartilage synthesis and repair functions, while a decreased proportion suggests severe cartilage degeneration or damage.
[0360] Cartilage was embedded and frozen sections were prepared for Col2α1 immunofluorescence (primary antibody purchased from Abcam, AB6308; secondary antibody purchased from Santa Cruz). The proportion of Col2α1 positive cells was counted.
[0361] The results are shown in Table 11. The articular cartilage scoring model group had a score of 12.1, with significant reductions in joint scores in some Mimic groups (Mimic5, 17, 19, 22-26, 28, 29). The proportion of Col2α1 positive cells in the model group was 18.4%, with significant reductions in some Mimic groups (Mimic4, 5, 7-10, 14, 16, 19, 22, 26, 28-30). These results indicate that Mimic5, 19, 22, 26, 28, and 29 have a therapeutic effect on articular cartilage damage.
[0362] Table 11 Results of Mimic's treatment for articular cartilage lesions
[0363] Example 9: miR302 Mimic for the treatment of diabetes and non-alcoholic fatty liver disease
[0364] A disease model was constructed using a high-fat diet combined with fructose-containing drinking water. Specifically, 8-week-old (4-month-old) male C57BL / 6 mice were used. The normal control group was given a 4% fat maintenance diet with normal drinking water; the control group was given a high-fat diet with 60% fat content, supplemented with 5% fructose in drinking water. Modeling was successful after two months (4 months of age). The average weight of the 120 mice in the model group was 47.75±2.37g, and the average weight of the 20 mice in the normal control group was 34.15±1.89g. Regarding fasting blood glucose, the blood glucose test strips were purchased from Roche. The model group reached 12.18±1.23mM, while the normal control group reached 5.25±0.94mM, reaching the level of type 2 diabetes, and the modeling was successful.
[0365] The model group was divided into 30 groups on average, with 4 animals in each group. The animals were given medication according to the grouping in Table 12. The small nucleic acid had GalNac modification at the 3' end of the positive strand. The animals were given the medication once every two weeks for a total of 4 times. The medication was administered subcutaneously at a dose of 200 μg per animal. The experiment continued until the animals were 6 months old and then tested.
[0366] Changes in body weight are an important indicator for assessing obesity and related metabolic disorders caused by a high-sugar, high-fat diet; fasting blood glucose concentration is an important indicator for assessing glucose metabolism function; liver triglyceride (TG) content is a core indicator for assessing hepatic lipid accumulation and the development of NAFLD. A high-sugar, high-fat diet can lead to excessive lipid accumulation in the liver, thereby causing fatty liver disease; the liver fibrosis index is an important parameter for assessing liver damage and disease progression. Further development of NAFLD can lead to liver fibrosis and even cirrhosis.
[0367] As shown in Table 12, statistical analysis of mouse body weight, fasting blood glucose, liver TG content, and liver fibrosis index revealed that the model group showed a further increase in body weight compared to 4-month-old mice. Compared to the model group mice (body weight 51.2g, fasting blood glucose 12.6mM, liver TG content 74.2μM / g, liver fibrosis index 1.6), the partial Mimic group (Mimic5, 10, 12, 13, 15, 17, 19, 22-26, 28-30) showed a significant decrease in body weight. The Mimic groups (Mimic5, 6, 10, 12, 13, 15, 17-19, 22, 23, 25, 26, 28-30) showed a significant decrease in blood glucose; the partially administered Mimic groups (Mimic5, 10-14, 17, 19, 17-19, 22-29) showed a significant decrease in liver TG content; and the partially administered Mimic groups (Mimic5-7, 10, 12, 13, 19, 22-26, 28-30) showed a significant decrease in liver fibrosis index. These results indicate that Mimic5, 10, 12, 13, 19, 22, 23, 25, 26, 28, and 29 have therapeutic effects on type 2 diabetes and non-alcoholic fatty liver disease.
[0368] Table 12. Treatment outcomes of Mimic for type 2 diabetes and non-alcoholic fatty liver disease.
[0369] Table 12. Continued Mimic treatment outcomes for type 2 diabetes and non-alcoholic fatty liver disease.
[0370] Example 10 miR302 Mimic Treatment of Liver Cirrhosis
[0371] Cirrhosis is a chronic liver disease characterized by fibrosis and connective tissue hyperplasia in the liver, leading to impaired liver function. Cirrhosis is an advanced liver disease that develops during chronic liver injury, characterized by the formation of new tissue that regenerates around the liver via fibrous bundles, resulting in elevated portal vein blood pressure. Many factors can contribute to cirrhosis, such as alcoholism, hepatitis C, and non-alcoholic fatty liver disease. Two stages are essential in the development of cirrhosis: inflammatory response in the liver and fibrosis.
[0372] A mouse model of liver cirrhosis induced by carbon tetrachloride (CCl4) using conventional methods:
[0373] In vivo, CCl4 is activated by detoxification enzymes such as cytochromes to form trichloromethyl radicals (CCl3*). These radicals can bind to nucleic acids, proteins, and lipids, thereby affecting cell activity. These radicals can also react with oxygen to generate highly reactive trichloromethylperoxy radicals (CCl3OO*), which can react with polyunsaturated fatty acids, especially phospholipids, thereby disrupting the permeability of cell membranes and various organelle membranes. Therefore, CCl4 is a cytotoxic substance. When CCl4 enters mouse liver cells, it activates and damages intracellular components, causing cellular inflammation. It can also induce steatosis in hepatocytes by increasing the degradation of microsomal triglyceride transfer proteins. Continued stimulation leads to the activation of hepatic stellate cells, resulting in fibrosis. Further stimulation leads to cirrhosis. Therefore, this model is a recognized classic model for simulating human cirrhosis.
[0374] Administration method: Mix 10 mL of CCl4 with 40 mL of olive oil to prepare a CCl4 solution with a final concentration of 20%. Administer CCl4 and olive oil by gavage at a volume of 1 mL / kg into the stomach of mice. Modeling was successful after one month.
[0375] The model group was divided into 30 groups, with 3 animals in each group. The animals were administered drugs according to the groupings in the table below. The small nucleic acid with GalNac modification at the 3' end of the positive strand was administered subcutaneously, once a week for 4 weeks, at a dose of 200 μg / animal. The results were assessed after 5 weeks. Liver fibrosis scores were calculated using paraffin-embedded chirastone trichrome staining. The liver fibrosis scoring criteria (referencing the Kleiner score) are as follows:
[0376] 0 points: No fibrosis.
[0377] 1 point: Perihepatic fibrosis or fibrosis of a single portal area.
[0378] 2 points: More than one portal area is fiberized, but it does not extend to the areas between portal areas (bridging fiberization).
[0379] 3 points: Bridging fiberization between manifolds.
[0380] 4 points: Cirrhosis.
[0381] IL-10 is an anti-inflammatory cytokine. During cirrhosis, IL-10 expression is typically upregulated as a self-protective mechanism in the inflammatory response. Abnormal upregulation of IL-10 may also reflect severe liver damage and persistent inflammation. IFNγ is a pro-inflammatory cytokine that plays an important role in liver inflammation and immune responses. Its overexpression is often associated with hepatocellular damage, persistent inflammation, and fibrosis progression. Significant upregulation of IFNγ indicates exacerbated liver inflammation and dysregulation of the immune response. Total RNA was extracted from liver tissue and detected by qPCR.
[0382] The primers are as follows, synthesized by Sangon Biotech.
[0383] IL10:
[0384] Forward Primer CTTACTGACTGGCATGAGGATCA (SEQ ID NO: 9)
[0385] Reverse Primer GCAGCTCTAGGAGCATGTGG (SEQ ID NO: 10)
[0386] INF-γ:
[0387] Forward Primer GCCACGGCACAGTCATTGA(SEQ ID NO: 11)
[0388] Reverse Primer TGCTGATGGCCTGATTGTCTT (SEQ ID NO: 12)
[0389] GAPDH:
[0390] Forward Primer AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 13)
[0391] Reverse Primer GGGGTCGTTGATGGCAACA (SEQ ID NO: 14)
[0392] As shown in Table 13, statistical analysis of liver fibrosis scores, relative IL-10 expression levels, and relative IFNγ expression levels in mice revealed that, compared to the model group mice (fibrosis score 46.8, relative IL-10 expression level 12.6, relative IFNγ expression level 74.2), the fibrosis scores of the partially administered Mimic groups (Mimic5, 12, 13, 19, 24-26, 29) were significantly lower; the relative IL-10 expression levels of the partially administered Mimic groups (Mimic5, 9, 10, 12, 13, 17, 19, 22-26, 28, 29) were significantly lower; and the relative IFNγ expression levels of the partially administered Mimic groups (Mimic5, 8, 10, 12, 13, 15, 18, 19, 22-26, 28-30) were significantly lower. These results indicate that Mimic5, 12, 13, 19, 24-26, and 29 have a therapeutic effect on liver cirrhosis.
[0393] Table 13 Results of Mimic's treatment for cirrhosis
[0394] Example 11 miR302 Mimic Treatment for Androgenetic Alopecia
[0395] Androgenetic alopecia (AGA) is the most common type of hair loss. It is a chronic hair loss caused by the combined effects of genetic factors and androgens (such as dihydrotestosterone, DHT). AGA is a chronic, non-scarring, age-related progressive hair loss that begins in adolescence or late adolescence and involves the miniaturization of hair follicles. AGA is common in both men and women, especially men. In men, it manifests as a receding hairline at the forehead, temples, and scalp, with thinning and reduced hair on the crown, sometimes even revealing the scalp. In women, it manifests as progressive thinning and reduced hair on the crown and hairline, with a small percentage experiencing diffuse thinning.
[0396] Modeling method: Starting from D-2 (2 days before the experiment), administer intraperitoneal injections of 5 mg / mL or 0.1 mL of double-strength testosterone once daily until day 21.
[0397] Experimental grouping: The model group was divided into 30 groups on average, with 3 animals in each group. The animals were grouped and administered drugs according to the table below. The 3' end of the positive strand of the small nucleic acid was modified with chol. The drugs were administered on D0 and D5, for a total of 2 times. The dosage was 200 μg / animal, injected subcutaneously at multiple points, and detected on D13.
[0398] On day 13, hair was photographed and examined. The hair coverage on the back of the mice was statistically analyzed using ImageJ. The results are shown in Table 14. The model group had a coverage of 12.1%. The hair coverage in some Mimic groups (Mimic5, 6, 10, 12, 13, 19, 22-26, 28-30) was significantly increased. The results show that the above Mimic groups have a therapeutic effect on androgenetic alopecia.
[0399] Table 14 Results of Mimic's treatment for androgenetic alopecia
[0400] Example 12 miR302 Mimic Treatment of Chronic Nephritis
[0401] In recent years, chronic kidney disease (CKD) has developed into a global public health problem. The 2019 Global Burden of Disease Report showed that CKD has entered the top ten disease burden rankings for people aged 50 and over, significantly affecting their disability-adjusted life years (DALYs) and showing an increasing trend year by year. Glomerulonephritis is one of the main causes of CKD, accounting for approximately 20% of CKD cases. In younger populations, glomerulonephritis is the most common cause of end-stage renal disease. Glomerulonephritis includes subtypes such as IgA nephropathy, membranous glomerulonephritis, lupus nephritis, and focal glomerulosclerosis. Its main clinical manifestations include proteinuria, hematuria, elevated serum creatinine concentration, podocyte invagination and disappearance, edema, abnormal weight gain, and even hypertension and renal failure. Its pathogenesis is complex, involving multiple aspects such as inflammatory responses, antibody and immune cell-mediated immune responses. In addition, diseases such as obesity, hypertension, and diabetes, as well as genetic factors, can also affect the pathological process of glomerulonephritis. Approximately two-thirds of patients with primary glomerulonephritis are found to have a genetic defect. Current treatment regimens mostly use corticosteroids, calcineurin inhibitors, and renin-angiotensin system blockers, but their efficacy is unstable, relapse rates are high, adverse reactions are significant, and the number of patients developing steroid resistance is increasing year by year. Chronic nephritis (CKD) is closely related to cellular senescence. CKD is characterized by increased cellular senescence, an irreversible state of cell cycle arrest and cell division cessation. Cellular senescence characteristics are observed in all parts of the renal parenchyma in CKD patients and animal models.
[0402] Mouse model of chronic nephritis (CKD): Doxorubicin (Dox)-induced nephropathy is a classic rodent model of chronic nephritis, mimicking human chronic nephritis. The severity of tissue damage is positively correlated with mortality and weight loss, and a persistent inflammatory response is induced one week after drug administration.
[0403] Modeling method: Chronic nephritis was induced in mice using doxorubicin (Dox). Nine-week-old mice were randomly divided into three groups of eight animals each: a blank control group (Normal), a model group, and a treatment group (miRNA302b, Mimic1-30). The model and treatment groups were intraperitoneally injected with 10 mg / kg Dox according to the mice's body weight. On day 0, the model and treatment groups were subcutaneously injected with 10 mg / kg Dox every four days in addition to the Dox injection. The model group was injected with an equal volume of physiological saline. The mice were continuously observed.
[0404] As shown in Table 15, there were no deaths in the blank control group, while approximately 60% of the mice (5 / 8) died after Dox administration, and the remaining mice in other groups varied. Changes in serological indicators: Blood tests are commonly used in clinical practice to diagnose kidney disease. We measured the levels of creatinine (CREA) and blood urea nitrogen (BUN) in mouse serum to assess the progression of kidney disease in mice. Twenty-three days after Dox induction, the creatinine level in the blank control group was 4.5±0.8 mM, while that in the model group was 16.8±1.9 mM, significantly higher than that in the blank control group. Serum urea nitrogen levels were 135.2±14.7 mM in the blank control group and 406.1±19.2 mM in the model group, also significantly higher than that in the blank control group. Collagen deposition was statistically analyzed using Masson's trichrome staining after paraffin sectioning. The model group showed a significant increase in interstitial inflammatory deposition compared to the blank control group, with some degree of glomerular hyperplasia and the onset of fibrotic deposition in the renal interstitium (appearing blue), mainly concentrated around blood vessels. The percentage of blue area was 0.9±0.5% in the blank control group and 6.2±0.8% in the model group. These results indicate successful modeling.
[0405] In this embodiment, GalNac is added to the 3' end. The connection method between GalNac and the nucleic acid strand is shown in Figure 5 or Figure 6.
[0406] Based on the above three indicators, the results showed that some Mimic groups (Mimic5, 12, 13, 17-19, 23-26, 28, 29) significantly reduced serum creatinine, blood urea nitrogen and collagen deposition, proving that Mimic5, 12, 13, 17-19, 23-26, 28, 29 have a therapeutic effect on CKD.
[0407] Table 15 Results of Mimic's treatment for chronic nephritis
[0408] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0409] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.
Claims
1. A double-stranded miRNA, characterized in that, It contains a chemically modified sense strand as shown in SEQ ID NO: 1, and a chemically modified antisense strand as shown in SEQ ID NO: 2; The chemical modifications of the sense strand and the antisense strand each include a 2'-substituted nucleotide and a modified nucleotide bond; the chemically modified nucleotide bond is located at at least one or more of the nucleotides at positions 1-3 and 20-23 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO:
2.
2. The double-stranded miRNA as described in claim 1, characterized in that, The 2'-substituted nucleotide is selected from one or more of 2'-fluorine substitution modification and 2'-O-methylation.
3. The double-stranded miRNA as described in claim 2, characterized in that, The 2'-O-methylation is located at one or more of the nucleotides 1-23 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO:
2.
4. The double-stranded miRNA as described in any one of claims 2 or 3, characterized in that, The 2'-O-methylation is located at nucleotides 1-2, 4, 6, 9-12, 14-16, 18, and 20-23 of the sequence shown in SEQ ID NO: 1, and the 2'-O-methylation is located at one or more of the nucleotides 1-3, 5, 7, 9, 11, and 13-23 of the sequence shown in SEQ ID NO: 2; Optionally, the 2'-O-methylation is located at positions 1-2, 4, 6, 10, 12, 14, 16, 18, 20, and 22-23 of the sequence shown in SEQ ID NO: 1, and the 2'-O-methylation is located at one or more of the following positions: positions 1-3, 5, 7, 9, 11, 13, and 15-23 of the sequence shown in SEQ ID NO:
2.
5. The double-stranded miRNA as described in any one of claims 2-4, characterized in that, The 2'-O-methylation is located at positions 1-2, 4, 6, 10, 12, 14, 16, 18, 20, and 22-23 of the sequence shown in SEQ ID NO:
1. The position of the 2'-O-methylation in the sequence shown in SEQ ID NO: 2 can be selected from: (1) Nucleotides located at positions 1-3, 5, 7, 9, 11, 13, and 15-23; or (2) Nucleotides located at positions 1-3, 5, 7, 9, 11, 13, 15-17, 19 and 21-23.
6. The double-stranded miRNA according to any one of claims 1-5, characterized in that, The modified nucleotide bond is selected from the group consisting of thiophosphate, dithiophosphate, phosphate triester, aminoalkyl phosphate triester, phosphonic acid alkyl ester, phosphonite, aminophosphate, thiocarbonyl aminophosphate, thiocarbonyl alkyl phosphonate, thiocarbonyl alkyl phosphate triester, selenophosphate, boron phosphate, morpholino, siloxane, sulfide, sulfoxide, sulfone, formyl, thioformyl, methyleneformyl, nucleoacetyl, olefin-containing backbone, aminosulfonate, methyleneimino, methylenehydrazine, sulfonate, sulfonamide, and amide. Optionally, the modified nucleotide bond is a phosphate thioester.
7. The double-stranded miRNA as described in claim 6, characterized in that, The thiophosphate is located at one or more of the following positions in the sequence shown in SEQ ID NO: 1: between positions 1 and 2, 2 and 3, 3 and 4, 4 and 5, and 22 and 23; and the thiophosphate is located at one or more of the following positions in the sequence shown in SEQ ID NO: 2: between positions 1 and 2, 2 and 3, 3 and 4, 4 and 5, 21 and 22, and 22 and 23.
8. The double-stranded miRNA as described in any one of claims 6 or 7, characterized in that, The thiophosphate is located at one or more of the following positions in the sequence shown in SEQ ID NO: 1: between position 1 and position 2, between position 2 and position 3, and between position 22 and position 23; and the thiophosphate is located at one or more of the following positions in the sequence shown in SEQ ID NO: 2: between position 1 and position 2, between position 2 and position 3, between position 3 and position 4, between position 4 and position 5, between position 20 and position 21, between position 21 and position 22, and between position 22 and position 23. Optionally, the thiophosphate is located between the first and second positions and between the second and third positions of the sequence shown in SEQ ID NO: 1, and the thiophosphate is located between the first and second positions, between the second and third positions, and between the 22nd and 23rd positions of the sequence shown in SEQ ID NO:
2.
9. The double-stranded miRNA according to any one of claims 2-8, characterized in that, The 2'-fluorine substitution modification occurs in one or more of the following groups: nucleotides containing cytosine, nucleotides containing adenine, and nucleotides containing uracil; Optionally, the 2'-fluorine substitution modification is located at at least one or more nucleotides in positions 3-21 of the sequences shown in SEQ ID NO: 1 and / or SEQ ID NO:
2.
10. The double-stranded miRNA according to any one of claims 2-9, characterized in that, The 2'-fluorine substitution modification is located at one or more of the nucleotides at positions 3, 5, 7-9, 11, 13, 15, 17, 19 and 21 of the sequence shown in SEQ ID NO: 1, and the 2'-fluorine substitution modification is located at one or more of the nucleotides at positions 4-21 of the sequence shown in SEQ ID NO: 2; Optionally, the 2'-fluorine substitution modification is located at the 3rd, 5th, 7th-9th, 11th, 13th, 15th, 17th, 19th and 21st nucleotides of the sequence shown in SEQ ID NO: 1, and the 2'-fluorine substitution modification is located at one or more of the 4th, 6th, 8th, 10th, 12th, 14th, 18th and 20th nucleotides of the sequence shown in SEQ ID NO:
2.
11. The double-stranded miRNA according to any one of claims 2-10, characterized in that, The 2'-fluorine substitution modification is located at positions 3, 5, 7-9, 11, 13, 15, 17, 19, and 21 of SEQ ID NO: 1, and the position of the 2'-fluorine substitution modification in SEQ ID NO: 2 can be selected from: (1) Nucleotides located at positions 4, 6, 8, 10, 12, 14, 18, and 20; or (2) Nucleotides located at positions 4, 6, 8, 10, 12 and 14.
12. The double-stranded miRNA according to any one of claims 1-11, characterized in that, The SEQ ID NO: 1 further comprises an LNA modification, wherein the LNA modification is located at one or more nucleotides in the 1st to 8th positions of the sequence shown in SEQ ID NO: 1; Optionally, the LNA modification is located at the 2nd, 4th, 6th and 8th nucleotides of the sequence shown in SEQ ID NO:
1.
13. The double-stranded miRNA according to any one of claims 1-12, characterized in that, The sense strand and / or the antisense strand further comprise DNA modifications located at nucleotides 1, 5, 8-9, 13, 15-18, and 21 of the sequence shown in SEQ ID NO: 1, and at nucleotides 2, 5, and 21-22 of the sequence shown in SEQ ID NO:
2.
14. The double-stranded miRNA as described in claim 13, wherein the DNA modification is to replace the uracil site with thymine.
15. The double-stranded miRNA according to any one of claims 1-14, characterized in that, The sense chain and / or the antisense chain further include terminal modifications; optionally, the terminal modification is a 3'-terminal 5'NN 3' structure, wherein each occurrence of N is independently selected from the group consisting of adenine (A), thymine (T), cytosine (C), guanine (G) and uracil (U); The terminal modification is selected from the group consisting of 5'Nm Nm 3', 5'sN sN 3', 5'Nm sN 3', 5'sN Nm 3', 5'sNm Nm 3', 5'Nm sNm 3', 5'sNm sNm 3', and 5'sN sNm 3'; The NN is selected from the group consisting of UG, TT, AC and AA.
16. The double-stranded miRNA as described in claim 15, characterized in that, The terminal modification is selected from the group consisting of 5'sTm sTm 3', 5'sUm sGm 3', 5'sAm sCm 3' and 5'sAm sAm 3'.
17. The double-stranded miRNA as described in any one of claims 15 or 16, characterized in that, The terminal modification is located at the 3' end of the sequence shown in SEQ ID NO: 2 and is selected from 5'sTm sTm 3', 5'sUm sGm 3', or 5'sAm sCm 3'.
18. The double-stranded miRNA according to any one of claims 1-17, characterized in that, The antisense chain also contains at least one 3' terminal group; Optionally, the 3' terminal group is selected from the group consisting of cholesterol, bile acids, fatty acids, polyethylene glycol, antibodies, polymers, N-acetylgalactosamine (GalNac), and aptamers.
19. The double-stranded miRNA as described in any one of claims 18, characterized in that, There is a phosphate thioester modification between the 3' terminal group and the last nucleotide at the 3' end of the positive strand.
20. A pharmaceutical composition, characterized in that, It comprises a double-stranded miRNA as described in any one of claims 1-19, and a pharmaceutically acceptable vector.
21. An anti-aging product, characterized in that, It contains the double-stranded miRNA as described in any one of claims 1-19.
22. A liposome nanoparticle, characterized in that, It contains the double-stranded miRNA as described in any one of claims 1-19.
23. Use of the double-stranded miRNA as described in any one of claims 1-19 in the preparation of anti-aging products, medicaments for treating skin aging, medicaments for treating Alzheimer's disease, medicaments for treating articular cartilage damage, medicaments for treating diabetes, medicaments for treating non-alcoholic fatty liver disease, medicaments for treating cirrhosis, medicaments for treating androgenetic alopecia, and / or medicaments for treating chronic nephritis.
24. The use as described in claim 23, wherein the method of administration of the anti-aging product or the drug is selected from the group consisting of intravenous, intramuscular, intra-arterial, intrasheath, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, tracheal, subcutaneous, subepidermal, topical application, intra-articular, subcapsular, subarachnoid, spinal, and intrasternal injection and infusion.
Citation Information
Patent Citations
Method for inducing transdifferentiation of fibroblasts into neuronal cells and application thereof
CN103849601A
Application of small RNA molecules and analogues thereof in senescence resistance
CN112430596A
In-Vitro Induction of Adult Stem Cell Expansion and Derivation
CN112912492A
Active ingredient containing miRNA and application thereof
CN116585342A
Application of nucleic acid molecule in preparation of medicine for treating hepatic diseases
CN116617244A