Compositions and methods for treatment of carbamoyl phosphate synthetase 1 (CPS1) deficiency
A base editing therapy using Cas9 variants and adenosine deaminase domains effectively corrects CPS1 gene mutations, addressing the inadequacies of current treatments for CPS1 deficiency and reducing ammonia levels, thereby alleviating symptoms.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- THE CHILDRENS HOSPITAL OF PHILADELPHIA
- Filing Date
- 2025-09-12
- Publication Date
- 2026-05-15
AI Technical Summary
Current therapeutics are inadequate for effectively treating carbamoyl phosphate synthetase 1 (CPS1) deficiency, a rare autosomal recessive disorder that leads to life-threatening hyperammonemia due to enzymatic blockages in the urea cycle, causing toxic ammonia accumulation and severe neurological symptoms.
A base editing therapy using a base editor complexed with guide polynucleotides targets specific mutations in the CPS1 gene to correct the disease phenotype by altering A to G in the DNA sequence, restoring wild-type function, utilizing Streptococcus pyogenes or Staphylococcus aureus Cas9 variants and adenosine deaminase domains, delivered via lipid nanoparticles or viral vectors to hepatocytes.
The method provides a durable cure for CPS1 deficiency by correcting specific mutations, reducing ammonia levels and alleviating neurological symptoms, as demonstrated in both cell models and animal models.
Smart Images

Figure US2025046114_15052026_PF_FP_ABST
Abstract
Description
[0001] COMPOSITIONS AND METHODS FOR TREATMENT OF CARBAMOYL PHOSPHATE SYNTHETASE 1 (CPS1) DEFICIENCY
[0002] KI RAN MUSUNURU REBECCA AHRENS-NICKLAS
[0003] SARAH GRANDINETTE CROSS REFERENCE TO RELATED APPLICATION
[0004] This application claims priority to US Provisional Application No. 63 / 716,518, filed November 5, 2024, which is incorporated herein by reference as though set forth in full.
[0005] GRANT SUPPORT STATEMENT
[0006] This invention was made with government support under grant numbers U01-TR005355, and U19-NS132301, awarded by the National Institutes of Health. The government has certain rights in the invention.
[0007] INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED IN ELECTRONIC FORM
[0008] The Contents of the electronic sequence listing (CHOP-160PCT.xml; Size: 624,221 bytes; and Date of Creation: September 12, 2025 is herein incorporated by reference in its entirety.
[0009] FIELD OF THE INVENTION
[0010] This invention relates to the fields of genetic engineering and correction of genetic errors using base editing therapies. More specifically, the invention provides compositions and methods for correcting gene mutations that cause CPS1 deficiency.
[0011] BACKGROUND OF THE INVENTION
[0012] Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full.
[0013] Carbamoyl phosphate synthetase 1 (CPS1) deficiency is a rare autosomal recessive disorder of ureagenesis presenting as life-threatening hyperammonemia. CPS1 deficiency is one of the proximal urea cycle defects and is due to a complete or partial deficiency of the mitochondrial enzyme carbamoyl phosphate synthetase 1 (which produces carbamoyl phosphate from ammonia, ATP, and HCO3, as shown below). N-acetylglutamate (formed by the condensation of glutamate with acetyl -CoA in the mitochondria catalyzed by N-acetylglutamate synthase (NAGS)) is an obligatory activator of the CPS1 enzyme. Because CPS1 deficiency is inherited in an autosomal recessive manner, it affects males and females equally.
[0014] There are six enzymes in the urea cycle that act in liver; N-acetylglutamate synthase (NAGS), carbamoyl phosphate synthetase 1 (CPS1), and ornithine transcarbamylase (OTC) are intramitochondrial, whereas arginase, argininosuccinate synthetase (ASS), and argininosuccinate lyase (ASL) are cytosolic. CPS1 deficiency is one of the less frequent of the urea cycle defects (UCDs). The resulting enzymatic block in the urea cycle defect results in the accumulation of excess ammonia that has toxic effects, most severe in the central nervous system causing cerebral edema and even death. Clearly, improved therapeutics for treatment of this devastating disease are urgently needed.
[0015] SUMMARY OF THE INVENTION
[0016] The present invention provides compositions and methods for effecting a durable cure of a subset of patients with carbamoyl phosphate synthetase 1 (CPS1) deficiency via the direct correction of causative mutations for this disease which disrupt essential enzyme function. Such mutations include, without limitation, the c.!003C> T mutation (Q355X), the c.2339G> A mutation (R780H), or the c.478G> A mutation (A160T). In accordance with one aspect of the invention, a method for editing a CPS 1 -encoding polynucleotide comprising a mutation associated with CPS1 deficiency is provided. An exemplary method comprises contacting the CPS1 polynucleotide with a base editor in complex with at least one guide polynucleotide, wherein the base editor comprises a polynucleotide programmable DNA binding domain and an adenosine deaminase domain, and wherein one or more of said guide polynucleotides target said base editor to effect an A»T to G*C alteration of the mutation associated with CPS1 deficiency, thereby restoring the wild-type sequence and correcting the disease phenotype. In certain embodiments, the contacting is done in a cell, a eukaryotic cell, a mammalian cell, or human cell. Contacting may be performed in vitro or in vivo. In particularly preferred embodiments, the mutation is one or more of a c. 1003C> T mutation (Q355X), a c.2339G> A mutation (R780H), or c.478G> A mutation (A160T). The polynucleotide programmable DNA binding domain can be a Streptococcus pyogenes Cas9 (SpCas9) or Staphylococcus aureus Cas9 (SaCas9) or a variant thereof. In certain aspects, the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adjacent motif (PAM) specificity, including without limitation, a modified SpCas9 having specificity for the nucleic acid sequence 5'-NGC-3'. The polynucleotide programmable DNA binding domain may be nuclease-inactive or a nickase variant. In the base editing methods disclosed, the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA). The adenosine deaminase can be a TadA deaminase or a variant thereof. In another embodiment, the base editor is in complex with a single guide RNA (gRNA) comprising a nucleic acid sequence complementary to a nucleic acid sequence comprising the mutation associated with CPS1 deficiency.
[0017] In certain aspects of the methods described above the base editor is in complex with a single guide RNA (gRNA) comprising a nucleic acid sequence complementary' to a nucleic acid sequence comprising the mutation associated with CPSl deficiency selected from CPSl Q335. X: CPS 1-001::::Q335X__gRNA8, NGC-ABE8e-V106W mRNA(SEQ ID NO: 11); CPSl R780H; CPS 1-002 = R780H__gRNA4, NGC-ABE8e-V106W mRNA (SEQ ID NO: 12); CPSl R780H: CPSl-002h - R780H gRNA4 hybl6, NGC-ABE8e-Vl 06W rnRNA(SEQ ID NO: 13); CPSl Al 60 T: CPS1-003 - A160T__gRNA8, ABE8.8 mRNA (SEQ ID NO: 14), and CPSl Al 601': CPS1-00311 = A160T gRNA8 hybl6, ABE8.8 mRNA (SEQ ID NO: 15).
[0018] In other embodiments, methods of producing a cell, or a progenitor thereof, comprising delivering a) a base editor, or a polynucleotide encoding said base editor, to said cell, wherein said base editor comprises a polynucleotide programmable DNA binding domain and an adenosine deaminase domain; and b) one or more guide polynucleotides that target the base editor to effect an A»T to G*C alteration of the mutation associated with CPSl deficiency. Cells so produced also form an aspect of the invention.
[0019] In certain embodiments, the cell is a hepatocyte and the guide polynucleotide and base editor comprise at least one of the following combinations: CPSl Q335X: CPS1-001::::
[0020] Q335X gRNA8, NGC-ABE8e-V106W mRNA (SEQ ID NO: 11); CPSl R780H: CPS 1-002 = R780H_gRNA4, NGC-ABE8e-V106W mRNA (SEQ ID NO: 12), CPSl R780H: CPSl-002h -R780H_gRNA4_hybl6, NGC-ABE8e-V106W mRNA (SEQ ID NO: 13); CPSl A160T: CPS1-003 - A160T gRNA8, ABES.8 mRNA (SEQ ID NO: 14); and CPSl A160T: CPS I -003b -A160T__gRNA8_hybl6, ABE8.8 mRNA (SEQ ID NO: 15). In certain embodiments, the cell is a hepatocyte expressing a CPS 1 polypeptide. In some embodiments, the ceil is from a subject having CPS1 deficiency. The cell can comprise a polynucleotide programmable DNA binding domain from S ir ep tococcm pyogenes Cas9 (SpCas9) or variant thereof The polynucleotide programmable DNA binding domain can comprise a modified SpCas9 having an altered protospacer-adj cent motif (PAM) specificity. In certain embodiments, the modified SpCas9 has specificity for the nucleic acid sequence 5-NGC-3'. The polynucleotide programmable DNA binding domain can be a nuclease-inactive or nickase variant and, or the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA). The cell can comprise the base editor in complex with a single guide RNA (gRNA) comprising a nucleic acid sequence complementary to a CPS1 encoding nucleic acid sequence comprising the mutation associated with CPS1 deficiency.
[0021] Accordingly, also disclosed is an adenosine base editor / guide polynucleotide set that corrects a mutation causing CPS1 deficiency comprising: (i) a modified SpCas9 or SaCas9; (ii) an adenosine deaminase or functional fragment thereof, and iii) a guide polynucleotide that targets the base editor to effect an A»T to G*C alteration of the mutation associated with CPS 1 deficiency. In preferred embodiments, the base editor / guide polynucleotide set described above corrects a mutation in CPS1 and is selected from a C.10030T variant (Q355X), a c2339G> A variant (R780H), or a c.478G> A (A160T) variant in at least one copy of the CPS 1 -encoding polynucleotide and said set is one of the following: CPS1 Q335X: CPS 1 -001 Q335X_gRNA8, NGC-ABE8e-V106W mRNA (SEQ ID NO: 11); CPS7 R780H: CPS1-002 = R780H gRNA4, NGC-ABE8e-V106W RNA (SEQ ID NO: 12); C PS R780H: CPSl-002h -R780H_gRNA4_hyb 16, NGC-ABE8e-V106W mRNA (SEQ ID NO: 13); CPS1 AI60T: CPS1-003 === A160T gRNAS, ABE8 8 mRNA. (SEQ ID NO: 14); and CPS A160T: CPSl-003h -A160T_gRNA8__hyb 16, ABE8.8 mRNA (SEQ ID NO: 15). In certain aspects when the mutation is Q355X, the guide polynucleotide has a sequence of SEQ ID NO: 8. In certain aspects, the base editor / guide polynucleotide set is encapsulated in a lipid nanoparticle formulation and delivered to the liver of said subject. In certain embodiments, the base editor / guide polynucleotide set formulation comprises ionizable cationic lipid, 1,2-distearoyl-sn-glycero-3-phosphocholine, cholesterol, and a PEG-lipid.
[0022] In an alternative delivery method, the base editor / guide polynucleotide set is delivered to hepatocytes in a single or dual AAV vector system as described herein. In yet another approach, the base editor / guide polynucleotide set can be delivered to hepatocytes in vivo or in vitro in virus-like particles.
[0023] Another aspect of the invention includes a method of treating CPS1 deficiency in a subject comprising administering to said subject an effective amount the adenosine base editor / guide polynucleotide sets described above. Subjects to be treated include mammals and humans. The base editor, or polynucleotide encoding said base editor, and said one or more guide polynucleotides described above can be delivered to a cell of the subject, particularly a liver cell.
[0024] Also provided is a transgenic mouse comprising a humanized CPS1 gene comprising a mutation associated with CPS1 deficiency. In certain embodiments, the mutation is selected from a C.10030T mutation (Q355X), a c.2339G> A mutation (R780H), or a c.478G> A mutation (A160T) in at least one copy of the CPS1 gene.
[0025] Also within the scope of the invention is a vector useful for screening effective base editors comprising a vector harboring one, two, three or more approximately 100-bp genomic sequences spanning individual CPS1 variants. In certain embodiments, the vector is a lentiviral vector comprising a ~100-bp CPS1 genomic sequence spanning a Q335X variant, a ~100-bp CPS1 genomic sequence spanning a R780H variant, and a ~ 100-bp CPS1 genomic sequence spanning the A160T variant. The vector can optionally comprise one or more genomic sequences encoding a positive reference control. In certain vectors, the positive reference control is selected from a PAH P28 IL variant and / or a PAH R408W variant. The vector can be present in a HuH-7 cell. In certain embodiment, the vector useful for screening base editors is present in the liver of a test subject. In a preferred embodiment, the test subject is a transgenic mouse.
[0026] BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figures 1A- IB. Generation of lentivirus-transduced HuH-7 cell lines. Fig. 1A) A schematic outlining the strategy by which a variant(s)-containing cell line is generated for screening purposes. (Fig. IB). A schematic showing how an example lentiviral vector might be used to transduce human HuH-7 hepatoma cells with a cassette comprising six adjacent 100-bp genomic segments with four gene variants, including three CPS1 variants, two variants (PAH P28 IL, PAH R408W) serving as positive reference controls, and an additional variant that could be from CPS1 or an additional gene. Figure 2. Schematic of genomic site of CPS1 Q335X variant (SEQ TD NO: 20). Adapted from the UCSC Genome Browser (GRCh38 / hg38). The red arrow and the vertical yellow bar indicate the position of the G altered to A (A8, in red) by the Q335X variant on the antisense strand. The grey arrows indicate the sites of potential bystander editing (AO, A3, A9, A12, and Al 5, in grey). The horizontal bars indicate protospacer (thick) and PAM (thin) sequences targeted by the Q335X_gRNA3 through Q335X_gRNA9 guide RNAs; the number in the name indicates the position of the Q335X variant adenine in that gRNA’s protospacer sequence. The red horizontal bar indicates Q335X_gRNA8, which demonstrated the highest corrective editing activity (see Figure 3). The red box indicates the extended PAM sequence for Q335X_gRNA8 (AGCC). Figures 3A - 3C. Screening of ABE / gRNA combinations for correction of CPS1 Q335X variant. (Figs. 3A-3C) Corrective CPS1 c,1003C> T (Q335X) editing (determined from genomic DNA) following transfection of Q335X / P281L lentivirus-transduced HuH-7 cells with plasmids encoding ABE / gRNA combinations (n = 3 biological replicates), calculated as the proportion of aligned sequencing reads with the indicated type of edits. “Correction + / -synonymous bystander edit(s)” refers to reads in which the CPS1 Q335X adenine variant, or the PAH P28 IL variant, is edited to guanine, with or without base editing of one or more nearby synonymous adenines, with no base editing of any other adenines. The horizontal dotted lines in (Fig. 3B) and (Fig. 3C) indicate the editing level for the validated PKU P281L reference control condition, and the red arrow in (Fig. 3C) indicates the ABE / gRNA combination — designated NGC-ABE8e-V106W / Q335X_gRNA8 — chosen for further development.
[0028] Figure 4. Empirical corrective adenine base editing of CPS1 Q335X variant. Standard CRISPResso (http: / / crispresso2.pinellolab.org / submission) next-generation sequencing (NGS) output for the editing in the sample from the NGC-ABE8e-V106W / Q335X_gRNA8 plasmid-treated HuH-7 cells that displayed the highest level of editing (the condition marked by the red arrow in Fig. 3C, also designated Al-ABE8e-V106W / gRNA8). The codons in the vicinity of the Q335X site are indicated; the top-listed amino acid is the baseline / reference identity of the codon, and the bottom-listed amino acid is the one that results from base editing of the adenine in the codon. The red horizontal bar indicates the Q335X_gRNA8 protospacer sequence, and the adjacent thin red box indicates the extended PAM sequence. SEQ ID NOs: 21-22, 21, and 23-37 are shown in descending order. Figure 5. Schematic of genomic site of CPS1 R780H variant (SEQ TD NO: 38). Adapted from the UCSC Genome Browser (GRCh38 / hg38). The red arrow and the vertical yellow bar indicate the position of the G altered to A (A4, in red) by the R780H variant on the sense strand. The black arrows indicate the sites of potential bystander editing (Al and A10, in black). The horizontal bars indicate protospacer (thick) and PAM (thin) sequences targeted by the R780H_gRNA3 through R780H_gRNA9 guide RNAs; the number in the name indicates the position of the R780H variant adenine in that gRNA’s protospacer sequence. The red horizontal bar indicates R780H_gRNA4, which demonstrated efficient corrective editing activity (see Fig.
[0029] 6). The red box indicates the extended PAM sequence for R780H_gRNA4 (AGCC). The grey box indicates the poly(T) sequence that impairs plasmid expression of the gRNAs.
[0030] Figure 6. Identification of ABE / gRNA combinations for correction of the CPS1 R780H and CPS1 A160T variants. Corrective CPS1 c.2339G> A (R780H) or CPSJ c.478G> A (A160T) editing following transfection of Q335X / R780H / A160T / P281L lentivirus-transduced HuH-7 cells with ABE-encoding mRNAs and chemically synthesized guide RNAs (n = 3 biological replicates), calculated as the proportion of aligned sequencing reads with the indicated type of edits. The horizontal dotted line indicates the editing level for the validated PKU P281L reference control condition. The red arrows indicate the combinations of ABE mRNA and the better-performing, hybrid gRNAs for correction of the variants.
[0031] Figure 7. Schematic of genomic site of CPS1 A160T variant (SEQ ID NO: 39). Adapted from the UCSC Genome Browser (GRCh38 / hg38). The red arrow and the vertical yellow bar indicate the position of the G altered to A (A8, in red) by the A160T variant on the sense strand. The black and grey arrows indicate the sites of potential bystander editing (AO and All, in black; A10, in grey). The horizontal bars indicate protospacer (thick) and PAM (thin) sequences targeted by the A160T_gRNA3 through A160T_gRNA9 guide RNAs; the number in the name indicates the position of the A160T variant adenine in that gRNA’s protospacer sequence. The red horizontal bar indicates A160T_gRNA8, which demonstrated efficient corrective editing activity (see Figure 6). The red box indicates the PAM sequence for A160T_gRNA8 (TGG). Figure 8. Founder mouse with humanized CPS1 Q335X allele. Standard CRISPResso nextgeneration sequencing (NGS) output for the editing in a genomic DNA sample from a founder pup derived from a mouse zygote into which CRISPR-Cas9 with a single-strand DNA oligonucleotide with the human Q335X target sequence with homology arms matched to the endogenous Cpsl gene was injected. The codons in the vicinity of the Q335X site are indicated; the top-listed amino acid is the baseline identity of the codon (wild-type mouse ortholog), and the bottom-listed amino acid is the one that results from CRISPR-Cas9-mediated editing (humanized sequence). The grey horizontal bar indicates the span of the humanized sequence targeted by the Q335X_gRNA8 guide RNA, with almost half of the alleles in the mouse sample bearing the humanized sequence in that span. The red square indicates the human pathogenic variant, and the grey squares indicate additional changes that humanize the sequence. SEQ ID NOs: 40-45 are shown in descending order.
[0032] Figure 9. Whole-liver corrective editing in Q>sl-Q335X mice. Corrective and / or bystander editing of the endogenous Q335X variant sequence in Fl C / ?s7-Q335X mice, following a single treatment with the LNP drug product (DP) at the indicated dose (n = 8 liver samples per mouse in juvenile mice treated at 1 month of age, with necropsy several days after treatment).
[0033] Figure 10. Generation of / ? U.$Y / 26-Q335X mice. Schematic showing how a single-strand DNA oligonucleotide cassette harboring the CPS1 Q335X variant sequence and three other variants was inserted into the endogenous mouse Rosa26 locus in mouse zygotes using CRISPR-Cas9 to introduce a double-strand break in the Rosa26 locus, followed by homology-directed repair with the cassette.
[0034] Figures 11A- 11B. Corrective editing in l?os«-Q335X mice and Q335X HuH-7 cells. (Fig. HA) Whole-liver corrective and / or bystander editing of the CPS1 Q335X variant sequence incorporated into the Rosa26 locus in Fl 7?aszz26-Q335X mice, following a single treatment with the LNP drug product (DP) at the indicated dose (n = 8 liver samples per mouse, from juvenile mice treated at 1-2 months of age, with necropsy several days after treatment). (Fig. 1 IB) Corrective and / or bystander editing of the Q335X variant sequence incorporated into HuH-7 cells treated with the LNP DP at a dose range (n = 3 biological replicates per dose).
[0035] Figures 12A -121. Biochemical profile of the patient in Example 3 before and after treatment with the LNP drug product. (Fig. 12A) Protein intake, plasma levels of (Fig. 12B) ammonia, (Fig. 12C) glutamine, (Fig. 12D) alanine aminotransferase (ALT), and (Fig. 12E) aspartate aminotransferase (AST), and (Fig. 12F) weight percentile during the patient’s lifetime through three treatments with the LNP drug product (up to day of life 280). The grey bars from left to right indicate a rhinovirus-positive upper respiratory infection after dose 1 and two viral illnesses after dose 2 (gastroenteritis followed by a new rhinovirus / enterovirus infection with associated viral transaminitis). The horizontal dotted lines indicate upper limits of normal laboratory value ranges. (Figs. 12G, 12H) Pre-treatment and post-treatment ammonia levels and urine orotic acid levels, respectively. The horizontal dotted lines indicate upper limits of normal laboratory value ranges. (Fig. 121) Pre-treatment and post-treatment plasma blood urea nitrogen (BUN) levels. The horizontal dotted line indicates the lower limit of the normal BUN range. * P<0.05; **** P<0.00Ql.
[0036] DETAILED DESCRIPTION OF THE INVENTION
[0037] In vivo gene editing is an emerging therapeutic approach to making DNA modifications in the body of a patient, such as in the liver or other target organs or cells. Gene-editing methods include CRISPR-Cas9 and -Cast 2 nucleases, CRISPR cytosine base editors, CRISPR adenine base editors, and CRISPR prime editors. CRISPR base editors are an attractive gene-editing modality because they function efficiently for introducing precise targeted alterations without the need for double-strand breaks, in contrast to CRISPR-Cas9 and other gene-editing nucleases (e.g., Casl2). Adenine base editors (ABEs) can induce targeted A > G edits in DNA (T > C on the opposing strand). Each ABE uses its core Cas9 nickase protein with a guide RNA (gRNA) to engage a double-strand protospacer DNA sequence, flanked by a protospacer-adjacent motif (PAM) sequence on its 3' end. Because ABEs do not make double-strand breaks, they have only minimal risk of inducing large deletions, chromosomal abnormalities, and chromothripsis (shattering); instead, each ABE uses an evolved deoxyadenosine deaminase domain — typically fused to the N-terminal end of the Cas9 nickase — to chemically modify an adenosine nucleoside on one DNA strand, which (in combination with nicking of the other strand) enables highly precise and efficient A^G transition mutations at the targeted site.
[0038] The activity window of each ABE typically ranges across several positions within the protospacer DNA sequence (e.g., the ABE8.8 window ranges from position 3 to position 9, with peak editing observed at position 6 of the protospacer), with different ABEs having different windows. ABEs have the potential to edit any adenine within the window, which could include a desired target adenine but also undesired additional adenines (bystander edits). Published ABEs with Streptococcus pyogenes Cas9 nickase include so-called eighth-generation ABEs (harboring optimized deaminase domains resulting from eight rounds of molecular evolution) — the most commonly used to date are ABE8.8, ABE8.20, and ABE8e — and circularly permuted or inlaid ABEs, in which the deaminase domain is embedded within a loop of the Cas9 nickase protein, rather than fused to the N-terminal end, which has the effect of shifting the editing window further towards the 3' end of the protospacer sequence. Similar ABEs with Cas9 nickase from other bacterial species (e.g., Staphylococcus aureus') have been reported. As a general rule, ABEs display highly variable levels of activity across different genomic loci in different cell types, and empirical testing is mandatory to determine whether a given ABE with a given gRNA will edit efficiently at a given target site in a given cell type.
[0039] The present invention provides compositions and methods for adenine base editing to permanently correct a number of different pathogenic variants associated with severe UCD symptoms in patients. In some embodiments, a CPS1 variant is caused by a C.10030T (Q335X) mutation. In some embodiments, a CPS1 variant is caused by a c.2339G> A (R780H) mutation. In some embodiments, a CPS1 variant is caused by a c.478G> A (A160T) mutation.
[0040] DEFINITIONS
[0041] As employed above and throughout the disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings.
[0042] In the present disclosure the singular forms "a," "an," and "the" include the plural reference, and reference to a particular numerical value includes at least that particular value, unless the context clearly indicates otherwise. Thus, for example, a reference to "a compound" is a reference to one or more of such compounds and equivalents thereof known to those skilled in the art, and so forth. The term "plurality", as used herein, means more than one. When a range of values is expressed, another embodiment includes from the one particular and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it is understood that the particular value forms another embodiment. All ranges are inclusive and combinable.
[0043] A "monogenic disease" or a "monogenic disorder" is a condition determined by the interaction of a single pair of genes. This is in contrast to a polygenic condition wherein several genes are involved. In humans, monogenic diseases occur less frequently than the polygenic disease. It is also less complicated than the latter and may follow a pattern based on Mendelian inheritance. Monogenic disorders can adversely impact a number of biological systems.
[0044] As used herein, the phrase "carbamoyl phosphate synthetase 1 deficiency" or "CPS ID" refers to an autosomal recessive genetic urea cycle disorder, characterized by hyperammonemia. The morbidity rate is 1 / 50,000 to 1 / 300,000. Mutations in this gene disrupt the urea cycle due to the reduction or lack of carbamoyl phosphate synthetase 1 (CPS1) activity. In these patients, toxic ammonia accumulates in the blood, leading to neural function disturbance. The severity of clinical manifestations of CPS ID mainly depends on the degree of enzymatic activity deficiency. Severe hyperammonemia is common in neonatal-onset patients, with severe clinical manifestations and a poor prognosis. It is often misdiagnosed because of atypical symptoms, sudden onset, rapid progression and low morbidity, especially the neonatal-onset types. Signs of CPS I deficiency can usually be seen within the first few days of life and may include without limitation: weak muscle tone (hypotonia), high levels of ammonia (hyperammonemia), poor feeding, sleepiness or lack of energy (lethargy), vomiting, especially after eating, breathing trouble, and seizures.
[0045] The term "deaminase" or "deaminase domain" refers to a protein or enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenine or adenosine. In some embodiments, the deaminase or deaminase domain is an adenosine deaminase, catalyzing the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, the adenosine deaminase catalyzes the hydrolytic deamination of adenine or adenosine in deoxyribonucleic acid (DNA). The adenosine deaminases (e.g., engineered adenosine deaminases, evolved adenosine deaminases) provided herein may be from any organism, such as a bacterium.
[0046] In some embodiments, the deaminase or deaminase domain is a variant of a naturally-occurring deaminase from an organism. In some embodiments, the deaminase or deaminase domain does not occur in nature. For example, in some embodiments, the deaminase or deaminase domain is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75% at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to a naturally-occurring deaminase. In some embodiments, the adenosine deaminase is from a bacterium, such as E. coli, S. aureus, S. typhi, . putrefaciens, H. influenzae, or C. crescentus. In some embodiments, the adenosine deaminase is a TadA deaminase. In some embodiments, the TadA deaminase is an E. coli TadA deaminase (ecTadA). In some embodiments, the TadA deaminase is a truncated E. coli TadA deaminase. For example, the truncated ecTadA may be missing one or more N-terminal amino acids relative to a full-length ecTadA. In some embodiments, the truncated ecTadA may be missing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 N-terminal amino acid residues relative to the full length ecTadA. In some embodiments, the truncated ecTadA may be missing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 C-terminal amino acid residues relative to the full length ecTadA. In some embodiments, the ecTadA deaminase does not comprise an N-terminal methionine.
[0047] It should be appreciated, however, that additional adenosine deaminases useful in the present application would be apparent to the skilled artisan and are within the scope of this disclosure.
[0048] The term "base editor (BE)" or "nucleobase editor (NBE)" refers to an agent comprising a polypeptide that is capable of making a modification to a base (e.g., A, T, C, G, or U) within a nucleic acid sequence (e.g., DNA or RNA). In some embodiments, the base editor is capable of deaminating a base within a nucleic acid. In some embodiments, the base editor is capable of deaminating a base within a DNA molecule. In some embodiments, the base editor is capable of deaminating an adenine (A) in DNA. In some embodiments, the base editor is a fusion protein comprising a nucleic acid programmable DNA binding protein (napDNAbp) fused to an adenosine deaminase. In some embodiments, the base editor is a Cas9 protein fused to an adenosine deaminase. In some embodiments, the base editor is a Cas9 nickase (nCas9) fused to an adenosine deaminase. In some embodiments, the base editor is a nuclease-inactive Cas9 (dCas9) fused to an adenosine deaminase. In some embodiments, the base editor is fused to an inhibitor of base excision repair, for example, a UGI domain, or a dISN domain. In some embodiments, the fusion protein comprises a Cas9 nickase fused to a deaminase and an inhibitor of base excision repair, such as a UGI or dISN domain.
[0049] "Prime editing" directly introduces new genetic information into a targeted DNA site. Typically editing is effected by a fusion protein, consisting of a catalytically
[0050] impaired Cas9 endonuclease fused to an engineered reverse transcriptase enzyme, and a prime editing guide RNA (pegRNA), capable of identifying the target site and providing the new genetic information to replace the target DNA nucleotides. Using this technique
[0051] targeted insertions, deletions, and base-to-base conversions without the need for double strand breaks (DSBs) or donor DNA templates can be introduced into the targeted nucleic acid molecule.
[0052] The term "linker," as used herein, refers to a bond (e.g., covalent bond), chemical group, or a molecule linking two molecules or moieties, e.g., two domains of a fusion protein, such as, for example, a nuclease-inactive Cas9 domain and a nucleic acid-editing domain (e.g., an adenosine deaminase). In some embodiments, a linker joins a gRNA binding domain of an RNA-programmable nuclease, including a Cas9 nuclease domain, and the catalytic domain of a nucleic-acid editing protein. In some embodiments, a linker joins a dCas9 and a nucleic-acid editing protein. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond, thus connecting the two. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein). In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated.
[0053] As used herein the term "wild-type" is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms. As used herein the term "variant" should be taken to mean the exhibition of qualities that have a pattern that deviates from the wild-type or a comprises non naturally occurring components.
[0054] The term "mutation," as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4. sup. th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (2012)). The term "uracil glycosylase inhibitor" or "UGI," as used herein, refers to a protein that is capable of inhibiting a uracil-DNA glycosylase base-excision repair enzyme. In some embodiments, the UGI proteins provided herein include fragments of UGI and proteins homologous to a UGI or a UGI fragment. In some embodiments, a UGI fragment comprises an amino acid sequence that comprises at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid sequence encoding UGI.
[0055] The term "nuclear localization sequence" or "NLS" refers to an amino acid sequence that promotes import of a protein into the cell nucleus, for example, by nuclear transport. Nuclear localization sequences are known in the art and would be apparent to the skilled artisan. For example, NLS sequences are described in Plank et al., international PCT application, PCT / EP2000 / 011690, fded Nov. 23, 2000, published as WO / 2001 / 038547 on May 31, 2001, the contents of which are incorporated herein by reference for their disclosure of exemplary nuclear localization sequences.
[0056] The term "nucleic acid programmable DNA binding protein" or "napDNAbp" refers to a protein that associates with a nucleic acid (e.g., DNA or RNA), such as a guide nucleic acid, that guides the napDNAbp to a specific nucleic acid sequence. For example, a Cas9 protein can associate with a guide RNA that guides the Cas9 protein to a specific DNA sequence that has complementarity to the guide RNA. In some embodiments, the napDNAbp is a class 2 microbial CRISPR-Cas effector. In some embodiments, the napDNAbp is a Cas9 domain, for example a nuclease active Cas9, a Cas9 nickase (nCas9), or a nuclease inactive Cas9 (dCas9). Examples of nucleic acid programmable DNA binding proteins include, without limitation, Cas9 (e.g., dCas9 and nCas9), CasX, CasY, Cpfl, C2cl, C2c2, C2c3, and Argonaute. It should be appreciated, however, that nucleic acid programmable DNA binding proteins also include nucleic acid programmable proteins that bind RNA. For example, the napDNAbp may be associated with a nucleic acid that guides the napDNAbp to an RNA. Other nucleic acid programmable DNA binding proteins are also within the scope of this disclosure, though they may not be specifically listed in this disclosure.
[0057] The term "Cas9" or "Cas9 domain" refers to an RNA-guided nuclease comprising a Cas9 protein, or a fragment thereof (e.g., a protein comprising an active, inactive, or partially active DNA cleavage domain of Cas9, and / or the gRNA binding domain of Cas9). CRISPR (clustered regularly interspaced short palindromic repeat) is an adaptive immune system that provides protection against mobile genetic elements (viruses, transposable elements and conjugative plasmids). CRISPR clusters contain spacers, sequences complementary to antecedent mobile elements, and target invading nucleic acids. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). In type II CRISPR systems correct processing of pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (me) and a Cas9 protein. The tracrRNA serves as a guide for ribonuclease 3 -aided processing of pre-crRNA. Subsequently, Cas9 / crRNA / tracrRNA endonucleolytically cleaves linear or circular dsDNA target complementary to the spacer. The target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3'-5' exonucleolytically. In nature, DNA-binding and cleavage typically requires protein and both RNAs. However, single guide RNAs ("sgRNA", or simply "gRNA") can be engineered so as to incorporate aspects of both the crRNA and tracrRNA into a single RNA species. See, e.g., Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of which is hereby incorporated by reference. Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or protospacer adjacent motif) to help distinguish self versus non-self. Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g., "Complete genome sequence of an Ml strain of Streptococcus pyogenes." Ferretti et al., J. J., McShan W. M., Ajdic D. I., Savic D.., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P, Qian Y, lia H. G., Najar F. Z, Ren Q., Zhu H., Song L., White T, Yuan X, Clifton S. W., Roe B. A., McLaughlin R. E., Proc. Natl. Acad. Sci. U. S. A. 98:4658-4663(2001); "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III." Deltcheva E., Chylinski K., Sharma C. M., Gonzales K., Chao Y, Pirzada Z. A., Eckert M. R., Vogel I., Charpentier E., Nature 471:602-607(2011); and "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference). Cas9 orthologs have been described in various species, including, but not limited to, S. pyogenes and S. thermophilus. Additional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier, "The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems" (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference. In some embodiments, a Cas9 nuclease has an inactive (e.g., an inactivated) DNA cleavage domain.
[0058] A nuclease-inactive Cas9 protein may interchangeably be referred to as a "dCas9" protein (for nuclease-"dead" Cas9). Methods for generating a Cas9 protein (or a fragment thereof) having an inactive DNA cleavage domain are known (See, e.g., Jinek et al., Science. 337:816-821(2012); Qi et al., "Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression" (2013) Cell. 28; 152(5): 1173-83, the entire contents of each of which are incorporated herein by reference).
[0059] In some embodiments, Cas9 refers to Cas9 from: Corynebacterium ulcerans (NCBI Refs: NC_015683.1, NC_017317.1); Corynebacterium diphtheria (NCBI Refs: NC_016782.1, NC_016786.1); Spiroplasma syrphidicola (NCBI Ref: NC_021284.1); Prevotella intermedia (NCBI Ref: NC_017861.1); Spiroplasma taiwanense (NCBI Ref: NC_021846.1); Streptococcus iniae (NCBI Ref: NC_021314.1); Belliella baltica (NCBI Ref: NC_018010.1); Psychroflexus torquisl (NCBI Ref: NC_018721.1); Streptococcus thermophilus (NCBI Ref: YP_820832.1), Listeria innocua (NCBI Ref: NP_472073.1), Campylobacter jejuni (NCBI Ref:
[0060] YP_002344900.1) or Neisseria meningitidis (NCBI Ref: YP_002342100.1) or to a Cas9 from any other organism.
[0061] In some embodiments, dCas9 corresponds to, or comprises in part or in whole, a Cas9 amino acid sequence having one or more mutations that inactivate the Cas9 nuclease activity. Such Cas9 variants are able to generate a single-strand DNA break (nick) at a specific location based on the gRNA-defmed target sequence, leading to repair of the non-edited strand, ultimately resulting in a T to C change on the non-edited strand. A schematic representation of this process is shown in FIG. IB. Briefly, and without wishing to be bound by any particular theory, the A of a A-T base pair can be deaminated to a inosine (I) by an adenosine deaminase, e.g., an engineered adenosine deaminase that deaminates an adenosine in DNA. Nicking the non-edited strand, having the T, facilitates removal of the T via mismatch repair mechanisms. AUGI domain or a catalytically inactive inosine-specific nuclease (dISN) may inhibit inosine-specific nucleases (e.g., sterically) thereby preventing removal of the inosine (I).
[0062] In some embodiments, the nucleic acid programmable DNA binding protein (napDNAbp) of any of the fusion proteins provided herein may be a CasX or CasY protein. In some embodiments, the napDNAbp is a CasX protein. In some embodiments, the napDNAbp is a CasY protein.
[0063] The term "effective amount," as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response. For example, in some embodiments, an effective amount of a nucleobase editor may refer to the amount of the nucleobase editor that is sufficient to induce mutation of a target site specifically bound and mutated by the nucleobase editor. In some embodiments, an effective amount of a fusion protein provided herein, e.g., of a fusion protein comprising a nucleic acid programmable DNA binding protein and a deaminase domain (e.g., an adenosine deaminase domain) may refer to the amount of the fusion protein that is sufficient to induce editing of a target site specifically bound and edited by the fusion protein. As will be appreciated by the skilled artisan, the effective amount of an agent, e.g., a fusion protein, a nucleobase editor, a deaminase, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide, may vary depending on various factors as, for example, on the desired biological response, e.g., on the specific allele, genome, or target site to be edited, on the cell or tissue being targeted, and on the agent being used.
[0064] The terms "nucleic acid" and "nucleic acid molecule," as used herein, refer to a compound comprising a nucleobase and an acidic moiety, e.g., a nucleoside, a nucleotide, or a polymer of nucleotides. Typically, polymeric nucleic acids, e.g., nucleic acid molecules comprising three or more nucleotides are linear molecules, in which adjacent nucleotides are linked to each other via a phosphodiester linkage. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising three or more individual nucleotide residues. As used herein, the terms "oligonucleotide" and "polynucleotide" can be used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, "nucleic acid" encompasses RNA as well as single and / or doublestranded DNA. Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, siRNA, snRNA, a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule. On the other hand, a nucleic acid molecule may be a non -naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA / RNA hybrid, or including non-naturally occurring nucleotides or nucleosides. Furthermore, the terms "nucleic acid," "DNA," "RNA," and / or similar terms include nucleic acid analogs, e.g., analogs having other than a phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications. A nucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C 5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages).
[0065] The terms "protein," "peptide," and "polypeptide" are used interchangeably herein, and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long. A protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins. One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofamesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc. A protein, peptide, or polypeptide may also be a single molecule or may be a multi -molecular complex. A protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide. A protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof. The term "fusion protein" as used herein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy -terminal (C-terminal) protein thus forming an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein," respectively. A protein may comprise different domains, for example, a nucleic acid binding domain (e.g., the gRNA binding domain of Cas9 that directs the binding of the protein to a target site) and a nucleic acid cleavage domain or a catalytic domain of a nucleic-acid editing protein. In some embodiments, a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain, and an organic compound, e.g., a compound that can act as a nucleic acid cleavage agent. In some embodiments, a protein is in a complex with, or is in association with, a nucleic acid, e.g., RNA. Any of the proteins provided herein may be produced by any method known in the art. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4. sup. th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (2012)), the entire contents of which are incorporated herein by reference.
[0066] The term "RNA-programmable nuclease" and "RNA-guided nuclease" are used interchangeably herein and refer to a nuclease that forms a complex with (e.g., binds or associates with) one or more RNA(s) that is not a target for cleavage. In some embodiments, an RNA-programmable nuclease, when in a complex with an RNA, may be referred to as a nuclease: RNA complex. Typically, the bound RNA(s) is referred to as a guide RNA (gRNA). gRNAs can exist as a complex of two or more RNAs, or as a single RNA molecule. gRNAs that exist as a single RNA molecule may be referred to as single guide RNAs (sgRNAs), though "gRNA" is used interchangeably to refer to guide RNAs that exist as either single molecules or as a complex of two or more molecules. Typically, gRNAs that exist as single RNA species comprise two domains: (1) a domain that shares homology to a target nucleic acid (e.g., and directs binding of a Cas9 complex to the target); and (2) a domain that binds a Cas9 protein. In some embodiments, domain (2) corresponds to a sequence known as a tracrRNA, and comprises a stem-loop structure. For example, in some embodiments, domain (2) is identical or homologous to a tracrRNA as provided in Jinek et al., Science 337:816-821(2012), the entire contents of which is incorporated herein by reference. Other examples of gRNAs (e.g., those including domain 2) can be found in U. S. Provisional Patent Application, U. S. S. N. 61 / 874,682, fded Sep. 6, 2013, entitled "Switchable Cas9 Nucleases And Uses Thereof," and U. S. Provisional Patent Application, U. S. S. N. 61 / 874,746, filed Sep. 6, 2013, entitled "Delivery System For Functional Nucleases," the entire contents of each are hereby incorporated by reference in their entirety. In some embodiments, a gRNA comprises two or more of domains (1) and (2), and may be referred to as an "extended gRNA." For example, an extended gRNA will, e.g., bind two or more Cas9 proteins and bind a target nucleic acid at two or more distinct regions, as described herein. The gRNA comprises a nucleotide sequence that complements a target site, which mediates binding of the nuclease / RNA complex to said target site, providing the sequence specificity of the nuclease: RNA complex. In some embodiments, the RNA-programmable nuclease is the (CRISPR-associated system) Cas9 endonuclease, for example, Cas9 (Csnl) from Streptococcus pyogenes (see, e.g., "Complete genome sequence of an Ml strain of Streptococcus pyogenes." Ferretti J. J., McShan W. M., Ajdic D. J., Savic D. J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P., Qian Y, Jia H. G., Najar F. Z., Ren Q., Zhu H., Song L., White J., Yuan X., Clifton S. W., Roe B. A., McLaughlin R. E., Proc. Natl. Acad. Sci. U. S. A. 98:4658-4663(2001); "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III." Deltcheva E., Chylinski K., Sharma C. M., Gonzales K., Chao Y, Pirzada Z. A., Eckert M. R., Vogel J., Charpentier E., Nature 471:602-607(2011); and "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference.
[0067] Because RNA-programmable nucleases (e.g., Cas9) use RNA: DNA hybridization to target DNA cleavage sites, these proteins are able to be targeted, in principle, to any sequence specified by the guide RNA. Methods of using RNA-programmable nucleases, such as Cas9, for site-specific cleavage (e.g., to modify a genome) are known in the art (see e.g., Cong, L. et al., Multiplex genome engineering using CRISPR-Cas systems. Science 339, 819-823 (2013); Mali, P. et al., RNA-guided human genome engineering via Cas9. Science 339, 823-826 (2013);
[0068] Hwang, W. Y. et al., Efficient genome editing in zebrafish using a CRISPR-Cas system. Nature Biotechnology 31, 227-229 (2013); Jinek, M. et al., RNA-programmed genome editing in human cells. eLife 2, e00471 (2013); Dicarlo, J. E. et al., Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Research (2013); Jiang, W. et al. RNA- guided editing of bacterial genomes using CRISPR-Cas systems. Nature Biotechnology 31, 233-239 (2013); the entire contents of each of which are incorporated herein by reference).
[0069] The term "subject," as used herein, refers to an individual organism, for example, an individual mammal. In some embodiments, the subject is a human, including a human fetus in utero. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a rodent. In some embodiments, the subject is a sheep, a goat, a cow, a cat, or a dog. In some embodiments, the subject is a vertebrate, an amphibian, a reptile, a fish, an insect, a fly, or a nematode. In some embodiments, the subject is a research animal. In some embodiments, the subject is genetically engineered, e.g., a genetically engineered non-human subject. The subject may be of either sex and at any stage of development.
[0070] The term "target site" refers to a sequence within a nucleic acid molecule that is deaminated by a deaminase or a fusion protein comprising a deaminase, (e.g., a dCas9-adenosine deaminase fusion protein provided herein).
[0071] As used herein, the terms "component," "composition," "composition of compounds," "compound," "drug," "pharmacologically active agent, " "active agent," "therapeutic," "therapy," "treatment," “drug product” or "medicament" are used interchangeably herein to refer to a compound or compounds or composition of matter which, when administered to a subject (human or animal) induces a desired pharmacological and / or physiologic effect by local and / or systemic action.
[0072] The terms "treatment," "treat," and "treating," refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. As used herein, the terms "treatment," "treat," and "treating" refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have developed and / or after a disease has been diagnosed. In other embodiments, treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to prevent or delay their recurrence.
[0073] The term "recombinant" as used herein in the context of proteins or nucleic acids refers to proteins or nucleic acids that do not occur in nature but are the product of human engineering. For example, in some embodiments, a recombinant protein or nucleic acid molecule comprises an amino acid or nucleotide sequence that comprises at least one, at least two, at least three, at least four, at least five, at least six, or at least seven mutations as compared to any naturally occurring sequence.
[0074] In certain embodiments, the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and / or one or proteins transcribed therefrom, to a host cell. In some aspects, the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells. In some embodiments, a CRISPR enzyme in combination with (and optionally complexed with) a gRNA is delivered to a cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism.
[0075] Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Feigner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10): 1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bihm (eds) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).
[0076] Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, poly cation or lipid-nucleic acid conjugates, lipid nanoparticles, artificial virions, virus-like particles, naked DNA, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U. S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91 / 17424; WO 91 / 16024. Delivery can be to cells (e.g., in vitro or ex vivo administration) or target tissues (e.g., in vivo administration).
[0077] Methods to deliver gene editing agents in vivo as ribonucleoproteins is another approach and provides safety advantages over nucleic acid delivery approaches. Engineered DNA-free virus-like particles (eVLPs) have been developed that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, fourth-generation eVLPs have been developed that mediate efficient base editing in several primary mouse and human cell types. Using different glycoproteins in eVLPs alters their cellular tropism. Single injections of eVLPs into mice support therapeutic levels of base editing in multiple tissues, reducing serum Pcsk9 levels 78% following 63% liver editing, and partially restoring visual function in a mouse model of genetic blindness. In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV or plasmid delivery. Thus, eVLPs provide promising vehicles for therapeutic macromolecule delivery that combine key advantages of both viral and nonviral delivery. See S. Banskota et al. Cell 185: 250-265 (2021).
[0078] The preparation of lipid nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U. S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787). Other lipid nanoparticle formulations are disclosed in 11,066,355; 11,059,807; US patent publications 2021 / 0106538 and 2021 / 0113466.
[0079] The use of RNA or DNA viral based systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo). Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer.
[0080] Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
[0081] The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue.
[0082] Retroviral vectors comprise cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700).
[0083] In applications where transient expression is preferred, adenoviral based systems may be used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
[0084] Adeno-associated virus ("AAV") vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U. S. Pat. No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Several different AAV serotypes have been used to advantage for transduction of mammalian cells, these include, for example AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9 that have different tropisms for cell types of interest. Construction of recombinant AAV vectors is described in a number of publications, including U. S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989). In certain preferred embodiments, the viral vector is a split AAV8 vector or a split AAV9 vector.
[0085] Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include HEK 293 cells, which package adenovirus, and y2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line.
[0086] For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line may also be infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
[0087] In some embodiments, a host cell is transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, a cell is transfected as it naturally occurs in a subject. In some embodiments, a cell that is transfected is taken from a subject. In some embodiments, the cell is derived from cells taken from a subject, such as a cell line.
[0088] In one aspect, the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell, which may be in vivo, ex vivo or in vitro. In some embodiments, the method comprises sampling a cell or population of cells from a human or non-human animal, and modifying the cell or cells. Culturing may occur at any stage ex vivo. The cell or cells may be reintroduced into the human or non-human animal. In one aspect, the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing an adenine base editor (ABE) CRISPR complex to bind to the target polynucleotide to effect correction of a mutation in said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises the ABE CRISPR enzyme complexed with a gRNA hybridized to a target sequence within said target polynucleotide.
[0089] In one aspect, the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions. In some embodiments, the kit comprises a vector system or components for an alternative delivery system such as those described above and instructions for using the kit. In some embodiments, the vector or delivery system comprises an ABE CRISPR enzyme complexed with a gRNA for base editing of a target nucleic acid.
[0090] The kit can contain a lipid nanoparticle formulation encapsulating the appropriate base editor and at least one gRNA. The kit can comprise a drug product containing a finished dosage form that contains at least one of the base editing formulations described herein ready for use by a patient. In some embodiments, the complete, packaged medication, such as a tablet, capsule, or injection is present. Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tube. In some embodiments, the kit includes instructions in one or more languages, for example in more than one language.
[0091] In some embodiments, a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein. Reagents may be provided in any suitable container. For example, a kit may provide one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g., in concentrate or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH from about 7 to about 10. In some embodiments, the kit comprises one or more oligonucleotides corresponding to a gRNA sequence for insertion into a vector so as to operably link the gRNA sequence and a regulatory element. In some embodiments, the kit comprises a homologous recombination template polynucleotide. In one aspect, the invention provides methods for using one or more elements of a CRISPR system. The CRISPR complex of the invention provides an effective means for modifying a target polynucleotide. The CRISPR complex of the invention has a wide variety of utility including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a multiplicity of cell types in methods of gene therapy.
[0092] As used herein, the term “metabolic gene” is defined as an inherited single gene anomaly, i.e., a single gene coding for an enzyme is defective, and that defect causes an enzyme deficiency. The enzyme deficiency produces an inherited metabolic disease or disorder, of which a subtype is an inborn error of metabolism. Carbamoyl phosphate synthetase 1 deficiency (CPS1) as described above, is a urea cycle disorder (urea cycle defect). Most single gene anomalies are autosomal recessive, i.e., two defective copies of the gene must be present for the disease or trait to develop. Non-limiting examples of metabolic disorders include glucose metabolism disorders, lipid metabolism disorders, malabsorption syndromes, metabolic brain diseases, calcium metabolism disorders, DNA repair-deficiency disorders, hyperlactemia, iron metabolism disorders, metabolic syndrome X, inborn error of metabolism, phosphorus metabolism disorders, and acid-base imbalance. Inherited metabolic diseases previously were classified as disorders of carbohydrate metabolism, amino acid metabolism, organic acid metabolism, or lysosomal storage diseases; however new inherited disorders of metabolism have been discovered, and the categories have multiplied. Certain major classes of congenital metabolic diseases include disorders of carbohydrate metabolism, e g., glycogen storage disease, glucose-6-phosphate dehydrogenase (G6PD) deficiency (resulting from a mutation in the G6PD gene); disorders of amino acid metabolism, e.g., phenylketonuria, maple syrup urine disease, glutaric acidemia type 1; disorders of organic acid metabolism (organic acidurias), e.g., alcaptonuria, 2-hydroxyglutaric acidurias; disorders of fatty acid oxidation and mitochondrial metabolism, e.g., medium-chain acyl-coenzyme A dehydrogenase deficiency (often called “MCADD”) (caused by mutations in the AC ADM gene, which results in medium-chain fatty acids not being metabolized properly and leads to lethargy and hypoglycemia); disorders of porphyrin metabolism, e.g., acute intermittent porphyria; disorders of purine or pyrimidine metabolism, e.g., Lesch-Nyhan syndrome (caused by mutations in the hypoxanthine phosphoribosyltransferase 1 [HPRT1] gene and inherited in an X-linked recessive manner); disorders of steroid metabolism, e.g., lipoid congenital adrenal hyperplasia, congenital adrenal hyperplasia; disorders of mitochondrial function, e.g., Keams- Sayre syndrome; disorders of peroxisomal function, e.g., Zellweger syndrome (caused by mutations in genes encoding peroxins, e.g., PEX1, PEX2, PEX3, PEX5, PEX6, PEX10, PEX12, PEX13, PEX14, PEX16, PEX19, or PEX26 genes); and lysosomal storage disorders, e.g., Gaucher’s disease (of which there are three subtypes, all of which are autosomal recessive) and Niemann-Pick disease (has an autosomal recessive inheritance pattern; Niemann-Pick types A and B are caused by a mutation in the Sphingomyelin phosphodiesterase 1 [SMPD1] gene; mutations in NPC 1 gene or NPC2 gene cause Niemann-Pick disease, type C [NPC], which affects a protein used to transport lipids; Niemann-Pick type D shares a specific mutation in the NPC1 gene, patients having type D share a common Nova Scotian ancestry).
[0093] In certain aspects, an adenine base editor (ABE) complex for programming conversion of adenine to guanine in a patient in need thereof is provided where the patient has a target DNA molecule harboring a mutation associated with CPS1 deficiency. An exemplary ABE complex includes a modified TadA enzyme, a catalytically impaired Cas9 protein and at least one single guide RNA (gRNA) that directs said ABE complex to said mutated target DNA molecule, which upon contact converts adenosine in said mutation to inosine, thereby catalyzing an A-T to G-C transition following DNA repair or DNA replication.
[0094] The activity window of each ABE typically ranges across several positions within the protospacer DNA sequence (e.g., the ABE8.8 window ranges from position 3 to position 9, with peak editing observed at position 6 of the protospacer), with different ABEs having different windows (Anzalone et al., 2020). ABEs have the potential to edit any adenine within the window, which could include a desired target adenine but also undesired additional adenines (bystander edits). Published ABEs with Streptococcus pyogenes Cas9 nickase include so-called eighth-generation ABEs (harboring optimized deaminase domains resulting from eight rounds of molecular evolution) — the most commonly used to date are ABE8.8, ABE8.20, and ABE8e — and circularly permuted or inlaid ABEs, in which the deaminase domain is embedded within a loop of the Cas9 nickase protein, rather than fused to the N-terminal end, which has the effect of shifting the editing window further towards the 3' end of the protospacer sequence (Gaudelli et al., 2020; Richter et al., 2020; Chu et al., 2021). Similar ABEs with Cas9 nickase from other bacterial species (e.g., Staphylococcus aureus) have been reported (Gaudelli et al., 2020; Richter et al., 2020). The following materials and methods are provided to facilitate the practice of the present invention. They are not intended to limit the invention in any way.
[0095] For base editing, a variety of adenine base editor (ABE)-expressing plasmids were used: ABE8.8-m ABE8.8, SpG-ABE8.8, SpRY-ABE8.8, ABE8.20, SpG-ABE8.20, SpRY-ABE8.20, ABE8e, SpG-ABE8e, SpG-ABE8e-V106W, and SpRY-ABE8e. (Addgene #136294), ABE8.13-m (Addgene #136296), ABE8.17-m (Addgene #136298), ABE8.20-m (Addgene #136300), ABE8e (Addgene #138489), CP1028-ABE8e (Addgene #138492), or CP1041-ABE8e (Addgene #138493). The pGuide plasmid (Addgene #64711) was used to express each accompanying guide RNA (specific for the CPS1 c.10030T variant) following subcloning of the oligonucleotide-synthesized gRNA sequence.
[0096] HuH-7 human hepatoma cells were obtained from the Japanese Collection of Research Bioresources (JCRB) Cell Bank and maintained in culture with DMEM containing 1g / L glucose and supplemented with 10% FBS (Thermo Fisher). On the day prior to transfection, the cells were split and replated into 6-well dishes at 3.5 xio5cells / well to achieve -80% confluence at the time of transfection. Also see PCT / US2023 / 065536, incorporated herein by reference.
[0097] For base editing experiments, each well of a 6-well plate was transfected with 9 pL TransIT-LTl Transfection Reagent mixed with 2 pg of the AB E-expressing plasmid and 1 pg of the gRNA-expressing plasmid. The cells were removed from the plates by scraping 3 days after transfection, washed with phosphate-buffered saline, and harvested for genomic DNA with the DNeasy Blood & Tissue Kit.
[0098] PCR amplification of the target sequences (endogenous CPS1 locus or heterologous CPS1 sequences introduced to cells by lentiviral transduction) in genomic DNA samples from transfected HuH-7 cells was performed using NEBnext High-Fidelity 2X PCR Master Mix (New England Biolabs) with locus-specific primers containing 5' Nextera adaptor sequences (Illumina), followed by purification of the PCR amplicons with the Sequalprep Normalization Plate kit (Thermo Fisher) or NGS Normalization 96-Well Kit (Norgen Biotek). A second round of PCR with the Nextera XT Index Kit V2 Set A and / or Nextera XT Index Kit V2 Set D (Illumina), followed by purification with the Sequalprep Normalization Plate Kit or NGS Normalization 96-Well Kit, generated barcoded libraries, which were pooled and quantified using a Qubit 3.0 Fluorometer. After denaturation, dilution to 10 pM, and supplementation with 15% PhiX, the pooled libraries underwent paired-end next-generation sequencing on an Illumina MiSeq System. The amplicon sequencing data were analyzed with CRISPResso2 (https: / / crispresso.pinellolab.partners.org / ). In some cases, PCR amplicons were subjected to confirmatory Sanger sequencing, performed by GENEWIZ, with editing frequencies estimated from the chromatograms. MIT specificity scores for gRNAs were determined using CRISPOR. See crispor.tefor.net / .
[0099] A CPS1 mouse model with one or more humanized CPS1 alleles can be generated using in vitro transcribed Cas9 mRNA, a synthetic gRNA, and a synthetic single-stranded DNA oligonucleotide. In one preferred embodiment, the synthetic gRNA has the spacer sequence 5'-GAGAUGCAGAGAAAGAGCAG-3' (SEQ ID NO: 9) and the synthetic single-stranded DNA oligonucleotide has the sequence 5'-AATCTGTGACTCTTTTCTTAAAGTGATTTCCGCGA ACGCTGTTGAAAGTTCTGAATTTGACTTTATGAGTAACATTAACATTCTCTTCACTTTT CCTTCCCCCTGCTCTTTCTCTGCATCTCTCTCCAGAGGACAGAACCAACCTGTTTTGA ATATCACAAACAAACAGGCTTTCATTACTGCTTAGAATCATGGCTATGCTCTGGACAA CACACTCCCTGCTGGCTGGAAACCACTGTTTGTGAATGTCAATGATCAAACAAACGA GGTAAATGCTCTCAACAATCCTG-3' (SEQ ID NO: 10). The mixture of these 3 components was injected into cytoplasm of fertilized oocytes from C57BL / 6J mice at the Penn Vet Transgenic Mouse Core on the world wide web at www.vet.upenn.edu / research / .
[0100] core-resources-facilities / transgenic-mouse-core). Genomic DNA samples from founders can be screened for knock-in of the desired sequence in the CPS1 locus via homology-directed repair as shown in Figure 8. Founders with the humanized CPS1 allele can then be bred through two generations to obtain homozygous mice.
[0101] Different CPS1 mouse models with one or more humanized CPS1 alleles can also be generated through the use of homologous recombination in mouse embryonic stem cells, followed by blastocyst injections, generation of chimeras, and subsequent breeding.
[0102] The following examples are provided to illustrate certain embodiments of the invention. They are not intended to limit the invention in any way. EXAMPLE 1
[0103] TARGETED BASE EDITING OF THE CPS1 GENE FOR THE TREATMENT OF UREA CYCLE DISORDERS
[0104] Carbamoyl phosphate synthetase 1 deficiency (CPS ID) is an autosomal recessive inherited metabolic urea cycle disorder (UCD), with sudden onset, rapid deterioration, atypical symptoms, low morbidity, death before diagnosis, and a poor prognosis for survivors. The incidence of this type of disease is approximately 1 / 50,000 ~ 1 / 300,000 and can be classified as neonatal-onset or late-onset depending on the age of onset. Previous clinical cases have reported that the neonatal type is more common, with severe clinical manifestations and extremely high mortality, with fewer reports of late-onset cases. More importantly, the clinical presentation of children with late-onset disease is more unspecific and can be easily misdiagnosed. Furthermore, as the normal function of the CPS1 enzyme requires N -acetylglutamate as a metabolic activator, deficiency of CPS1 and N-acetylglutamate synthase can exhibit the same biochemical alterations, making genetic testing the gold standard for the diagnosis of CPS ID.
[0105] A challenge in developing corrective base editing therapies is the lack of readily available in vitro models harboring rare patient-specific variants in which to test the efficacy of drug candidates. Accordingly, we sought to generate human hepatocyte cell lines bearing patientspecific variants, using cultured HuH-7 hepatoma cells, a commonly used proxy for primary human hepatocytes (which can only be maintained in culture for several days).
[0106] We found that techniques like nuclease-mediated homology-directed repair (HDR) editing and prime editing do not reliably allow for generation of such cell lines for all variants. Moreover, one disadvantage of using clonal cell lines derived from single cells of a transformed cell line like HuH-7 is that there can be substantial heterogeneity among different clonal cell lines in various characteristics, including transfectability with either plasmids or lipid nanoparticles (LNPs). Thus, the ability to make head-to-head comparative assessments of editing efficiencies of different variants, across different cell lines, is compromised. (For example, it would not be possible to reliably compare the efficiency of a corrective editing solution for the CPS1 Q335X variant in one cell line with the efficiency of a corrective editing solution for the CPSl R780H variant in another cell line, to determine which editing solution is more potent.) Another disadvantage is that even when successful, generating a clonal edited HuH-7 cell line can take several months, time that cannot be afforded for a patient with an infantile-onset urea cycle disorder (UCD), such as CPS1 deficiency, who is at ongoing risk for permanent neurologic injury and even death with any hyperammonemic crisis.
[0107] Accordingly, we have adopted an alternative approach, taking only a few weeks, in which multiple variants are introduced into the same HuH-7 cells. This is achieved using a lentiviral vector with genomic sequences spanning individual variants (Figure 1 A). For example, the lentiviral vector might have a ~100-bp CPS1 genomic sequence spanning the Q335X variant, a ~ 100-bp CPS1 genomic sequence spanning the R780H variant, a ~ 100-bp CPS1 genomic sequence spanning the A160T variant, and:= 100-bp genomic sequences spanning additional UCD gene variants (Figure IB). The vector might also include variants that can serve as positive reference controls, such as the PAH P28 IL variant and the PAH R408W variant, which have well -validated corrective editing solutions that definitively treat phenylketonuria (PKU) in humanized mouse models (Brooks et al., 2023; Brooks et al., 2024). The lentivirus is used to transduce HuH-7 cells.
[0108] Adenine base editor and guide RNA screening in cell models with CPS1 gene variants
[0109] Figures 2 and 3 show corrective adenine base editing of the CPS1 Q335X variant. Figure 2 shows a schematic of the genomic site of the CPS1 c,1003C> T (Q335X) variant, adapted from the UCSC Genome Browser (GRCh38 / hg38). The red arrow and the vertical yellow bar indicate the position of the G altered to A (A8, in red) by the variant on the antisense strand. The grey arrows indicate the sites of potential bystander editing (AO, A3, A9, A12, and A15, in black). The horizontal bars indicate protospacer (thick) and PAM (thin) sequences targeted by the Q335X_gRNA3 through Q335X_gRNA9 guide RNAs; the number in the name indicates the position of the Q335X variant adenine in that guide RNA’s protospacer sequence. The red horizontal bar indicates Q335X_gRNA8, which supported the highest editing activity as shown in Figure 3.
[0110] To expeditiously identify a base editing solution for the CPS1 Q335X variant (CPS1 deficiency variant #1), we generated a lentivirus-transduced HuH-7 cell line harboring the Q335X variant as well as the control PAH variants (as use of prime editing to introduce the Q335X variant into the endogenous CPSl locus in HuH-7 cells was inefficient.) Using the Q335X lentivirus-transduced HuH-7 cell line, we screened a variety of adenine base editor (ABEs) in combination with individual candidate gRNAs in plasmid transfection experiments. Seven gRNAs (designated Q335X gRNA3 through Q335X gRNA9, or simply gRNA3 through gRNA9) shown in Figure 2 and having the sequences listed below)tiling the site of the Q335X variant, such that the variant adenine base ranged from positions 3 through 9 of the protospacer sequence that spanned the ABE editing window (Figure 2), were tested with ABEs compatible with the protospacer-adjacent motifs (PAMs) associated with each of the protospacer sequences: SpG for NGN PAMs, SpRY for all other PAMs (i.e., near-PAMless) (Walton et al., 2020).
[0111] SEQ ID NO: 1) Q335X_gRNA8: 5'-UGAUUCUAAGCAGUAAUGAA-3'
[0112] SEQ ID NO: 2) Q335X_gRNA3: 5’-CUAAGCAGUAAUGAAAGCCU-3';
[0113] SEQ ID NO: 3) Q335X_gRNA4: 5'-UCUAAGCAGUAAUGAAAGCC-3';
[0114] SEQ ID NO: 4) Q335X_gRNA5: 5'-UUCUAAGCAGUAAUGAAAGC-3';
[0115] SEQ ID NO: 5) Q335X_gRNA6: 5'-AUUCUAAGCAGUAAUGAAAG-3';
[0116] SEQ ID NO: 6) Q335X_gRNA7: 5'-GAUUCUAAGCAGUAAUGAAA-3'; and
[0117] SEQ ID NO: 7) Q335X_gRNA9: 5'-AUGAUUCUAAGCAGUAAUGA-3'.
[0118] A full guide sequence for correction of the Q355X mutation is shown in SEQ ID NO: 8. 5'-UGAUUCUAAGCAGUAAUGAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' ABEs with three different deaminase domains were tested: ABE8.8, with the narrowest editing window, ABE8.20, with an intermediate editing window, and ABE8e, with the broadest window (Gaudelli et al., 2020; Richter et al., 2020). In the initial screen (Figure 3A), the SpG-ABE8e / Q335X gRNA8 combination had the highest corrective editing efficiency for the Q335X variant.
[0119] In a secondary transfection screen (Figure 3B), we assessed three engineered ABEs with a preference for NGC PAMs (the extended PAM sequence for Q335X_gRNA8 is AGCC), designated Al, A2, and A3. All versions of the ABE8e editor with Q335X_gRNA8 displayed highly efficient corrective editing. In the same transfection experiment, the well-established solution for the PAH P281L variant (ABE8.8 with the P281L-specific gRNA, designated “PAH1”) had similar or less corrective editing efficiency for the P281L variant compared to the ABE8e editors with Q335X_gRNA8 for the Q335X variant. Because ABE8e has been reported to have gRNA-independent off-target RNA and DNA editing, the ABE8e-V106W variant, which largely eliminates this off-target editing of ABE8e (Richter et al., 2020) was used in a final transfection screen (Figure 3C). The SpG, Al, A2, and A3 ABE8e editors, without and with the V106W variant, in combination with Q335X gRNA8 were tested. Among the V106W-containing editors, Al-ABE8e-V106W most closely matched the efficiency of the corresponding editor without the V106W variant, with the other VI 06W-containing editors showing reduced efficiency. In the same transfection experiment, the validated solution for the PAH P28 IL variant (ABE8.8 with “PAH1”) had similar corrective editing efficiency for the P28 IL variant compared to the Al-ABE8e-V106W editor with Q335X_gRNA8 for the Q335X variant. The Al-ABE8e-V106W editor is also designated NGC-ABE8e-V106W. NGC-ABE8e-V106W has a more restricted PAM preference relative to SpG: NGC(A / C) versus NGN (Silverstein et al., 2025; in this reference, the Cas9 domain is called “LWKYQS”). We performed individual amplicon sequencing and next-generation sequencing (NGS) of the lentiviral cassette with a genomic DNA sample from NGC-ABE8e-V106W / Q335X_gRNA8 plasmid-treated Q335X lentivirus-transduced HuH-7 cells (Figure 4). Although there was substantial bystander editing, it predominantly resulted in synonymous changes not expected to affect protein function. Aversion of Q335X_gRNA8 with full chemical modifications was designated CPS1-001 (see Table 1).
[0120]
[0121] SEQ ID NOS: 11-15 are shown in descending order. Abbreviations: A= adenosine; a = 2'-O-methyladensosine; dA = deoxy adenosine; C = cytidine; c = 2'-O-methy Icy tidine; dC = deoxycytidine; G = guanosine; g = 2'-O- methylguanosine; dG = deoxy guanosine; U = uridine, u = 2'-O-methyhiridine; dT = deoxy thymidine; s = phosphorothioate (PS) backbone linkage. Underline indicates spacer sequence. As described in Example 3, this NGC-ABE8e-V106W / CPSl-001 (SEQ ID NO: 11) combination was used for an LNP drug product that was administered to a patient.
[0122] To identify a base editing solution for the CPS1 R780H variant (CPS1 deficiency variant #2), we used a lentivirus-transduced HuH-7 cell line with the CPSl Q335X, R780H, and A160T variants, as well as the PKU PAH P281L variant that serves as a positive reference control (ABE8.8 with the P281L-specific gRNA, designated “PAH1”). It was not possible to use plasmid transfection to screen ABE / gRNA combinations for correction of the CPSl R780H variant, since all possible spacer sequences spanned a UUUU element (Figure 5), which acts as a termination signal for RNA polymerase III transcripts (i.e., resulting in a truncated gRNA when expressed from a plasmid). It was noted that the gRNA designated R780H_gRNA4 (i.e., with the variant adenine base being in position 4 of the protospacer sequence) has the PAM sequence AGCC (Figure 5), making it compatible with the use of the NGC-ABE8e-V106W editor. Accordingly, transfections were performed with in vitro transcribed ABE mRNAs and chemically synthesized gRNAs (i.e., RNA transfection) (Figure 6). Although some nonsynonymous bystander editing was evident (red portions of bars in Figure 6), the desired corrective editing with the NGC-ABE8e-V106W7R780H_gRNA4 combination of the R780H variant (using NGC-ABE8e-V106W mRNA) matched that of the desired corrective editing of the Q335X variant (using the same NGC-ABE8e-V106W mRNA) in the same cells (grey portions of bars in Figure 6), predicting that an LNP drug product specific for the R780H variant would have similar in vivo potency as an analogous LNP drug product specific for the Q335X variant. A version of R780H_gRNA4 with full chemical modifications was designated CPS 1-002 (see Table 1).
[0123] To identify a base editing solution for the CPS1 A160T variant (CPS1 deficiency variant #3), we used the same lentivirus-transduced HuH-7 cell line harboring the CPSl Q335X, R780H, and A160T variants and the PKU PAH P28 IL positive reference control. A variety of ABE / gRNA combinations were screened, with the ABE8.8 editor and the gRNA designated A160T_gRNA8 (i.e., with the variant adenine base being in position 8 of the protospacer sequence) — which has the PAM sequence TGG (Figure 7) — having a similar degree of desired corrective editing of the CPSl A160T variant as the desired corrective editing of the CPSl Q335X variant and the desired corrective editing of the CPSl R780H variant in the same cells (albeit with a different mRNA encoding an ABE with a different deaminase domain), predicting that an LNP drug product specific for the A160T variant would have similar in vivo potency to analogous LNP drug products specific for the Q335X variant and the R780H variant (Figure 6). A version of A160T_gRNA4 with full chemical modifications was designated CPS1-003 (see Table 1).
[0124] We have found that substituting DNA nucleotides for RNA nucleotides in certain empirically determined positions in the spacer sequence of a chemically synthesized gRNA (“hybrid” gRNA) can (1) substantially reduce or even eliminate detectable off-target editing, (2) reduce bystander editing at the on-target site, and (3) increase the desired on -target corrective editing, both in vitro and in vivo (Whittaker et al., 2025). We have also found that although empirical testing of hybrid configurations is needed to optimize gRNA properties, the “hybl6” configuration, in which spacer positions 3, 4, and 5 are substituted with DNA nucleotides, generally performs well with respect to both on-target and off-target editing when tested at a wide variety of loci (Whittaker et al., 2025). Accordingly, for the CPS1 R780H and A160T variants, we tested the “hybl6” configurations of the lead gRNAs (indicated by the red arrows in Figure 6). Both the “hybl6” configurations had similar or more efficient on-target corrective editing while reducing bystander editing. Aversion of R780H_gRNA_hybl6 with full chemical modifications was designated CPSl-002h, and a version of A160T_gRNA_hybl6 with full chemical modifications was designated CPSl-003h (see Table 1).
[0125] Based on these data, the following configurations for mRNA and gRNA drug substances could be used in patient-specific LNP drug products (correlating with the sequences shown in Table 1 and Table 2):
[0126] • CPS1 Q335X: CPS1-001 = Q335X_gRNA8; NGC-ABE8e-V106W mRNA
[0127] • CPS1 R780H: CPS 1-002 = R780H_gRNA4; NGC-ABE8e-V106W mRNA
[0128] • CPSJ R780H: CPS 1 -002h = R780H_gRNA4_hyb 16; NGC-ABE8e- VI 06W mRNA • CPS1 A160T: CPS1-003 = A160T_gRNA8; ABE8.8 mRNA
[0129] • CPS1 A160T: CPSl-003h = A160T_gRNA8_hybl6; ABE8.8 mRNA
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136] EXAMPLE 2
[0137] VALIDATION IN HUMANIZED MOUSE MODELS
[0138] To perform in vivo testing of an investigational LNP drug product prior to administration of the drug product to the patient described in Example 3, who had neonatal -onset CPS1 deficiency caused by the CPS1 C.10030T (Q335X) variant and the CPS1 c.2140G> T (E714X) variant, we wished to generate humanized mice with the CPS1 Q335X variant. This allowed the NGC-ABE8e-V106W mRNA drug substance and CPS 1-001 gRNA drug substance, rather than mouse-specific surrogates, to be directly tested in vivo. However, we were operating within a limited timeframe (several months) presented by the acuity of the patient’s CPS1 deficiency and his continuing hyperammonemic episodes. Accordingly, we attempted to rapidly generate two genetically modified mouse models that could serve the purpose of in vivo testing. First, we microinjected mouse zygotes with Cas9, a gRNA targeting the endogenous mouse Cpsl gene near the orthologous site of the CPS1 Q335X variant, and a single-strand DNA oligonucleotide intended to knock in a humanized segment spanning the Q335X variant and the protospacer / PAM sequences matched to the CPS 1-001 gRNA. We obtained a single female founder mouse in which close to 50% of the alleles in a sample of genomic DNA had the desired humanized segment (Figure 8). The first litter born from this founder mouse did not have any Fl offspring with the humanized Q335X allele. The second litter had multiple offspring heterozygous for the humanized Q335X allele (these offspring were designated C / AS / -Q335X knock-in mice); however, these mice were not born by the time the patient was 6 months of age. We subsequently performed a limited dose-response study of the LNP drug product comprising the NGC-ABE8e-V106W mRNA drug substance and CPS1-001 gRNA drug substance. There was substantial corrective editing in two mice treated at a dose of 3 mg / kg (mean 52% wholeliver editing) and in two mice treated at a dose of 1 mg / kg (mean 35% whole-liver editing) (Figure 9). Attempts at breeding heterozygous mice to generate homozygous C? 7-Q335X mice were unsuccessful; all homozygotes either passed away pre-term or on day of life 0, consistent with past efforts to generate Cpsl knockout mice (Schofield et al., 1999; Khoji et al., 2019) as well as other mouse models of neonatal-onset UCDs (Patejunas et al., 1994; Reid Sutton et al., 2003; Senkevitch et al., 2012; Wang et al., 2017). This phenomenon of perinatal lethality across UCD genes makes it prohibitive to use UCD mice to model biological responses to LNP drug products with respect to functional endpoints (i.e., prolonged survival, reduced blood ammonia levels, etc.).
[0139] Second, we microinjected mouse zygotes with Cas9, a well-validated gRNA targeting the Rosa26 safe harbor locus, and a single-strand DNA oligonucleotide with ~ l OO-bp genomic sequences spanning the patient’s CPS1 Q335X and E714X variants, as well as the PAH P281L and R408W variants (the two PKU positive reference controls) (Figure 10). We obtained two founder mice, both female, in which the genomic segment was introduced into the Rosa26 locus in some alleles. Both Rosa26 founder mice achieved germline transmission in their first litters, with multiple Fl offspring in each litter harboring the transgenic allele (these offspring were designated 7?oscz26-Q335X mice). We used these heterozygous offspring for a limited doseresponse study of the LNP drug product comprising the NGC-ABE8e-V106W mRNA drug substance and CPS 1-001 gRNA drug substance. Corrective editing was observed in two mice treated at a dose of 3 mg / kg, two mice treated at a dose of 1 mg / kg, and two mice treated at a dose of 0.1 mg / kg (Figure 11 A); these data were generated within 6 months of the patient’s birth. A dose-response study was also performed in lentivirus-transduced HuH-7 cells (Figure 11B), thereby establishing an in vitro-in vivo correlation. Of note, although these 7? O5«26-Q335X mice could be considered a patient-specific model because they harbored one copy each of the patient’s two variants (Q335X and E714X), the two variants were on the same Rosa26 allele, and the two copies of the endogenous wild-type Cpsl locus were intact. Thus, these mice would not have had a CPS1 deficiency phenotype even if bred to homozygosity, and so they could be used only to model in vivo hepatic editing efficiency of LNP drug products.
[0140] EXAMPLE 3
[0141] CLINICAL VALIDATION
[0142] An infant with the CPS1 Q335X variant presented with lethargy and poor feeding in the neonatal period. On day of life 2, he was observed to have a blood ammonia level above the quantification range of the clinical laboratory assay (>1,000 pmol / L, normal range 9-33 pmol / L). He was found to have elevated plasma glutamine, undetectable plasma citrulline, and absent urine orotic acid, consistent with a biochemical diagnosis of CPS1 deficiency.
[0143] Subsequently he was found to harbor biallelic pathogenic variants in CPS1, a maternally inherited c.2140G> T (E714X) allele and a paternally inherited Q335X allele. Despite receiving standard-of-care therapy, he had multiple episodes of hyperammonemia requiring urgent escalation of care including initiation of a sick day diet and administration of IV ammonia scavenger medications.
[0144] An LNP drug product, comprising the NGC-ABE8e-V106W mRNA drug substance (see Table 2) and the CPS1-001 gRNAdrug substance (see Table l; SEQ ID NO: 11), was administered to the patient under a single patient expanded access Investigational New Drug (IND) application to the U. S. Food and Drug Administration (FDA). The drug product used a LNP composition comprising the ionizable lipid ALC-0307, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol, and PEG-lipid ALC-0159. We submitted the IND application to FDA, and it was approved 1 week later, before the patient was 7 months old. On day of life 208, the patient received an intravenous infusion of the LNP drug product, comprising a total RNA dose of 0.1 mg / kg. After treatment, it was possible to liberalize his dietary protein intake (as he was bom at 35 weeks gestation, at times his prescribed protein goal was above the chronological recommended dietary allowance) (Figure 12A-C). He recovered from a viral respiratory infection without experiencing an illness-associated hyperammonemic crisis; however, he received intravenous fluids as is standard during illness and was on a protein-free diet for one day (day of life 225). The nitrogen scavenger medication, glycerol phenylbutyrate, could not be weaned (reduced from 10.1 to 8.1 mL / m2 / day but restored to the original dose due to rising glutamine levels).
[0145] Given the incomplete biochemical correction, and according to the clinical protocol, the patient received a second dose of the LNP drug product, 0.3 mg / kg, 22 days after the first dose (day of life 230). The only adverse event was a coughing episode during the second infusion that resolved with nasal suctioning. Transient alanine aminotransferase (ALT) and aspartate aminotransferase (AST) elevations occurred a few days following the second dose, with recurrence a few weeks later in the setting of viral illness (Figure 12D-E). He tolerated a halving of glycerol phenylbutyrate (5 mL / m2 / day) 2 weeks after the second dose. In the 4 weeks following the second infusion, the patient developed two viral infections, each with vomiting and diarrhea. In contrast to a gastroenteritis infection that occurred prior to treatment with the LNP drug product, he recovered from the illnesses without suffering a hyperammonemic crisis and was able to continue his full-protein diet during the illnesses. Blood ammonia levels before the first dose (median 23 pmol / L), between the first and second doses (9 pmol / L), and after the second dose (13 pmol / L) support a treatment-related difference (Figure 12G). CPS1 contributes to orotic acid synthesis, and CPS1 deficiency patients often have low-normal urine orotic acid levels (pre-treatment median 1.7 mmol / mol-Cr); following the two treatments, levels were often high-normal or above-normal (median 2.4 mmol / mol-Cr; median 2.6 mmol / mol-Cr) (Figure 12H).
[0146] In light of the continued need for glycerol phenyl butyrate, and according to the clinical protocol, the patient received a third and final dose of the LNP drug product, 0.45 mg / kg, 40 days after the second dose (day of life 270). The only adverse events were a coughing episode during the third infusion, similar to the cough that occurred with the second infusion, and then mild rash and fever in the evening following the infusion, which resolved by the following morning. There were slightly higher though still transient ALT and AST elevations a few days after the third dose, compared to the second dose. The patient subsequently had an uncomplicated hospital course, and he was discharged home on day of life 306, for the first time since his birth. The patient’s weight increased from <10th percentile for his age prior to the first dose to >40th percentile for his age at the time of discharge (Figure 12F). After receiving the third dose, the patient’s blood urea nitrogen (BUN) levels significantly increased, indicative of a more active urea cycle and consistent with some degree of restoration of CPS1 function in the liver (Figure 121).
[0147] Conclusion
[0148] The invention comprises a base-editing therapy that provides a durable cure for a subset of patients with CPS1 deficiency. In one embodiment, the mutation is caused by a c,1003C> T variant in at least one copy of the CPS1 gene. To date there is currently no durable medical treatment for this UCD. In certain approaches, the base editor messenger RNA and a guide RNA can be encapsulated within a lipid nanoparticle formulation encapsulating a base editor messenger RNA that can then be administered to a patient as an intravenous infusion and delivered to the liver. The base editor and guide strand then mediate correction of the causative mutation for CPS1 deficiency in many if not most of the hepatocytes. In other approaches, the base-editing treatment would be delivered to the liver via AAV viral vectors or virus-like particles.
[0149] The editing technology and delivery methods (especially lipid nanoparticle technology) for long-term correction of genetic disorders is viable for the first time. A durable medical treatment of patients with CPS1 deficiency — a disease for which there is presently no durable treatment of any kind except liver transplantation — via the direct correction of a causative mutation (c.l003C> T, also known as Q335X) can now be achieved. Besides being an entirely new approach for the treatment of CPS1 deficiency, it would be one of the first examples of a novel class of therapies targeting other life-threatening mutations associated with inborn errors of metabolism, such as UCDs.
[0150] REFERENCES
[0151] Anzalone AV, Koblan LW, Liu DR. Genome editing with CRISPR-Cas nucleases, base editors, transposases and prime editors. Nat Biotechnol. 2020 Jul;38(7):824-844. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature. 2019 Dec;576(7785): 149-157.
[0152] Brooks DL, Carrasco MJ, Qu P, Peranteau WH, Ahrens-Nicklas RC, Musunuru K, Alameh MG, Wang X. Rapid and definitive treatment of phenylketonuria in variant-humanized mice with corrective editing. Nat Commun. 2023 Jun 10; 14(1):3451. doi: 10.1038 / s41467-023-39246-2. PMID: 37301931; PMCID: PMC10257655.
[0153] Brooks DL, Whittaker MN, Said H, Dwivedi G, Qu P, Musunuru K, Ahrens-Nicklas RC, Alameh MG, Wang X. A base editing strategy using mRNA-LNPs for in vivo correction of the most frequent phenylketonuria variant. HGGAdv. 2024 Jan 11;5(1): 100253. doi:
[0154] 10.1016 / j.xhgg.2023.100253. Epub 2023 Nov 2. PMID: 37922902; PMCID: PMC10800763. Banskota S, Raguram A, Suh S, Du SW, Davis JR, Choi EH, Wang X, Nielsen SC, Newby GA, Randolph PB, Osborn MJ, Musunuru K, Palczewski K, Liu DR. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell. 2022 Jan 20;185(2):250-265.el6. Blau N, van Spronsen FJ, Levy HL. Phenylketonuria. Lancet. 2010 Oct 23;376(9750): 1417-27. Cancellieri S, Zeng J, Lin LY, Masillo F, Nguyen A, Bombieri N, Ciuculescu F, Katta V, Tsai SQ, Armant M, Giugno R, Bauer DE, Pinello L. Human genetic diversity modifies therapeutic gene editing off-target potential. bioRxiv. 2021 May 21.
[0155] Chadwick AC, Evitt NH, Lv W, Musunuru K. Reduced Blood Lipid Levels With In Vivo CRISPR-Cas9 Base Editing of ANGPTL3. Circulation. 2018 Feb 27;137(9):975-977.
[0156] Chadwick AC, Wang X, Musunuru K. In Vivo Base Editing of PCSK9 (Proprotein Convertase Subtilisin / Kexin Type 9) as a Therapeutic Alternative to Genome Editing. Arterioscler Thromb Vase Biol. 2017 Sep;37(9):1741- 1747. doi: 10.1161 / ATVBAHA.117.309881. Epub 2017 Jul 27. Chu SH, Packer M, Rees H, Lam D, Yu Y, Marshall J, Cheng LI, Lam D, Olins J, Ran FA, Liquori A, Gantzer B, Decker J, Bom D, Barrera L, Hartigan A, Gaudelli N, Ciaramella G, Slaymaker IM. Rationally Designed Base Editors for Precise Editing of the Sickle Cell Disease Mutation. CRISPR J. 2021 Apr;4(2): 169-177.
[0157] Davis JR, Wang X, Witte IP, Huang TP, Levy JM, Raguram A, Banskota S, Seidah NG, Musunuru K, Liu DR. Efficient in vivo base editing via single adeno-associated viruses with size-optimized genomes encoding compact adenine base editors. Nat Biomed Eng. 2022 Nov;6(ll):1272-1283.
[0158] Donohoue PD, Pacesa M, Lau E, Vidal B, Irby MJ, Nyer DB, Rotstein T, Banh L, Toh MS, Gibson J, Kohrs B, Baek K, Owen ALG, Slorach EM, van Overbeek M, Fuller CK, May AP, Jinek M, Cameron P. Conformational control of Cas9 by CRISPR hybrid RNA-DNA guides mitigates off-target activity in T cells. Mol Cell. 2021 Sep 2;81(17):3637-3649.e5. Essalmani R, Weider E, Marcinkiewicz J, Chamberland A, Susan-Resiga D, Roubtsova A, Seidah NG, Prat A. A single domain antibody against the Cys- and His-rich domain of PCSK9 and evolocumab exhibit different inhibition mechanisms in humanized PCSK9 mice. Biol Chem.
[0159] 2018 Nov 27;399(12): 1363- 1374.
[0160] Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR. Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature. 2017 Nov 23;551(7681):464-471.
[0161] Gaudelli NM, Lam DK, Rees HA, Sola-Esteves NM, Barrera LA, Born DA, Edwards A, Gehrke JM, Lee SJ, Liquori AJ, Murray R, Packer MS, Rinaldi C, Slaymaker IM, Yen J, Young LE, Ciaramella G. Directed evolution of adenine base editors with increased activity and therapeutic application. NatBiotechnol. 2020 Jul;38(7):892- 900.
[0162] Gillmore JD, Gane E, Taubel J, Kao J, Fontana M, Maitland ML, Seitzer J, O’Connell D, Walsh KR, Wood K, Phillips J, Xu Y, Amaral A, Boyd AP, Cehelsky JE, McKee MD, Schiermeier A, Harari O, Murphy A, Kyratsous CA, Zambrowicz B, Soltys R, Gutstein DE, Leonard J, Sepp-Lorenzino L, Lebwohl D. CRISPR-Cas9 In Vivo Gene Editing for Transthyretin Amyloidosis. N Engl J Med. 2021 Aug 5;385(6):493-502.
[0163] Grisch-Chan HM, Schwank G, Harding CO, Thbny B. State-of-the-Art 2019 on Gene Therapy for Phenylketonuria. Hum Gene Ther. 20190ct;30(10): 1274-1283.
[0164] Hillert A, Anikster Y, Belanger-Quintana A, Burlina A, Burton BK, Carducci C, Chiesa AE, Christodoulou J, Dordevic M, Desviat LR, Eliyahu A, Evers RAF, Fajkusova L, Feillet F, Bonfim-Freitas PE, Gizewska M, Gundorova P, Karall D, Kneller K, Kutsev SI, Leuzzi V, Levy HL, Lichter-Konecki U, Muntau AC, Namour F, Oltarzewski M, Paras A, Perez B, Polak E, Polyakov AV, Porta F, Rohrbach M, Scholl-Burgi S, SpecolaN, Stojiljkovic M, ShenN, Santana-da Silva LC, Skouma A, van Spronsen F, Stoppioni V, Thbny B, Trefz FK, Vockley J, Yu Y, Zschocke J, Hoffmann GF, Garbade SF, Blau N. The Genetic Landscape and Epidemiology of Phenylketonuria. Am J Hum Genet. 2020 Aug 6;107(2):234-250.
[0165] Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012 Aug 17;337(6096):816-2L
[0166] Kasiewicz LN, Biswas S, Beach A, Ren H, Dutta C, Mazzola AM, Rohde E, Chadwick A, Cheng C, Musunuru K, Kathiresan S, Malyala P, Rajeev KG, Bellinger AM. Lipid nanoparticles incorporating a GalNAc ligand enable in vivo liver ANGPTL3 editing in wild-type and somatic LDLR knockout non-human primates. bioRxiv. 2021 Nov 8.
[0167] Khoja S, Nitzahn M, Truong B, Lambert J, Willis B, Allegri G, Rtifenacht V, Haberle J, Lipshutz GS. A constitutive knockout of murine carbamoyl phosphate synthetase 1 results in death with marked hyperglutaminemia and hyperammonemia. J Inherit Metab Dis. 2019 Nov;42(6):1044-1053. doi: 10.1002 / jimd.12048. Epub 2019 Mar 5. PMID: 30835861; PMCID: PMC6728231. Kim D, Kim DE, Lee G, Cho SI, Kim JS. Genome-wide target specificity of CRISPR RNA-guided adenine base editors. Nat Biotechnol. 2019 Apr;37(4):430-435.
[0168] Kingwell K. Base editors hit the clinic. Nat. Rev. Drug Discov. 21, 545-547 (2022).
[0169] Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. 2016 May 19;533(7603):420-4. Leuders S, Wolfgart E, Ott T, du Moulin M, van Teeffelen-Heithoff A, Vogelpohl L, Och U, Marquardt T, Weglage J, Feldmann R, Rutsch F. Influence of PAH Genotype on Sapropterin Response in PKU: Results of a Single-Center Cohort Study. HMD Rep. 2014; 13: 101-9.
[0170] Levy HL, Sarkissian CN, Scriver CR. Phenylalanine ammonia lyase (PAL): From discovery to enzyme substitution therapy for phenylketonuria. Mol Genet Metab. 2018 Aug; 124(4): 223 -229. Levy JM, Yeh WH, Pendse N, Davis JR, Hennessey E, Butcher R, Koblan LW, Comander J, Liu Q, Liu DR. Cytosine and adenine base editing of the brain, liver, retina, heart and skeletal muscle of mice via adeno-associated viruses. Nat Biomed Eng. 2020 Jan;4(l):97-110.
[0171] Liang P, Xie X, Zhi S, Sun H, Zhang X, Chen Y, Chen Y, Xiong Y, Ma W, Liu D, Huang J, Songyang Z. Genome-wide profiling of adenine base editor specificity by EndoV-seq. Nat Commun. 2019 Jan 8; 10(l):67.
[0172] Musunuru K, Chadwick AC, Mizoguchi T, Garcia SP, DeNizio JE, Reiss CW, Wang K, Iyer S, Dutta C, Clendaniel V, Amaonye M, Beach A, Berth K, Biswas S, Braun MC, Chen HM, Colace TV, Ganey JD, Gangopadhyay SA, Garrity R, Kasiewicz LN, Lavoie J, Madsen JA, Matsumoto Y, Mazzola AM, Nasrullah YS, Nneji J, Ren H, Sanjeev A, Shay M, Stahley MR, Fan SHY, Tam YK, Gaudelli NM, Ciaramella G, Stolz LE, Malyala P, Cheng CJ, Rajeev KG, Rohde E, Bellinger AM, Kathiresan S. In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature. 2021 May;593(7859):429-434.
[0173] Patejunas G, Bradley A, Beaudet AL, O’Brien WE. Generation of a mouse model for citrullinemia by targeted disruption of the argininosuccinate synthetase gene. Somat Cell Mol Genet. 1994 Jan;20(l):55-60. doi: 10.1007 / BF02257486. PMID: 8197477.
[0174] Petri K, Kim DY, Sasaki KE, Canver MC, Wang X, Shah H, Lee H, Homg JE, Clement K, Iyer S, Garcia SP, Guo JA, Newby GA, Pinello L, Liu DR, Aryee MJ, Musunuru K, Joung JK, Pattanayak V. Global-scale CRISPR gene editor specificity profiling by ONE-seq identifies population-specific, variant off-target effects. bioRxiv. 2021 Apr 5.
[0175] Reid Sutton V, Pan Y, Davis EC, Craigen WJ. A mouse model of argininosuccinic aciduria: biochemical characterization. Mol Genet Metab. 2003 Jan;78(l):ll-6. doi: 10.1016 / sl096-7192(02)00206-8. PMID: 12559843.
[0176] Regier DS, Greene CL. Phenylalanine Hydroxylase Deficiency. 2017 Jan 5. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Gripp KW, Mirzaa GM, Amemiya A, editors. GeneReviews® [Internet], Seattle (WA): University of Washington, Seattle; 1993-2022. Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW, Zeng J, Bauer DE, Doudna JA, Liu DR. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. NatBiotechnol. 2020 Jul;38(7):883-891.
[0177] Rossi dis AC, Stratigis JD, Chadwick AC, Hartman HA, Ahn NJ, Li H, Singh K, Coons BE, Li L, Lv W, Zoltick PW, Alapati D, Zacharias W, Jain R, Morrisey EE, Musunuru K, Peranteau WH. In utero CRISPR-mediated therapeutic editing of metabolic genes. Nat Med. 2018 Oct;24(10):1513-1518.
[0178] Rothgangl T, Dennis MK, Lin PJC, Oka R, Witzigmann D, Villiger L, Qi W, Hruzova M, Kissling L, Lenggenhager D, Borrelli C, Egli S, Frey N, Bakker N, Walker JA 2nd, Kadina AP, Victorov DV, Pacesa M, Kreutzer S, Kontarakis Z, Moor A, Jinek M, Weissman D, Stoffel M, van Boxtel R, Holden K, Pardi N, Thbny B, Haberle J, Tam YK, Semple SC, Schwank G. In vivo adenine base editing of PCSK9 in macaques reduces LDL cholesterol levels. Nat Biotechnol. 2021 Aug;39(8):949-957.
[0179] Schofield JP, Cox TM, Caskey CT, Wakamiya M. Mice deficient in the urea-cycle enzyme, carbamoyl phosphate synthetase I, die during the early neonatal period from hyperammonemia. Hepatology. 1999 Jan;29(l):181-5. doi: 10.1002 / hep.510290112. PMID: 9862865.
[0180] Senkevitch E, Cabrera-Luque J, Morizono H, Caldovic L, Tuchman M. A novel biochemically salvageable animal model of hyperammonemia devoid of N-acetylglutamate synthase. Mol Genet Metab. 2012 Jun;106(2):160-8. doi: 10.1016 / j.ymgme.2012.03.004. Epub 2012 Mar 17. PMID: 22503289; PMCID: PMC3356441.
[0181] Silverstein RA, Kim N, Kroell AS, Walton RT, Delano J, Butcher RM, Pacesa M, Smith BK, Christie KA, Ha LL, Meis RJ, Clark AB, Spinner AD, Lazzarotto CR, Li Y, Matsubara A, Urbina EO, Dahl GA, Correia BE, Marks DS, Tsai SQ, Pinello L, De Ravin SS, Liu Q, Kleinstiver BP. Custom CRISPR-Cas9 PAM variants via scalable engineering and machine learning. Nature. 2025 Jul;643(8071):539-550. doi: 10.1038 / s41586-025-09021-y. Epub 2025 Apr 22. PMID: 40262634.
[0182] Strecker J, Jones S, Koopal B, Schmid-Burgk J, Zetsche B, Gao L, Makarova KS, Koonin EV, Zhang F. Engineering of CRISPR-Casl2b for human genome editing. Nat Commun. 2019 Jan 22;10(l):212. doi: 10.1038 / s41467-018-08224-4.
[0183] van Spronsen FJ, Blau N, Harding C, Burlina A, Longo N, Bosch AM. Phenylketonuria. Nat Rev Dis Primers. 2021 May 20;7(l):36.
[0184] Villiger L, Grisch-Chan HM, Lindsay H, Ringnalda F, Pogliano CB, Allegri G, Fingerhut R, Haberle J, Matos J, Robinson MD, Thbny B, Schwank G. Treatment of a metabolic liver disease by in vivo genome base editing in adult mice. Nat Med. 2018 Oct;24(10):1519-1525. Walton RT, Christie KA, Whittaker MN, Kleinstiver BP. Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants. Science. 2020 Apr 17;368(6488):290-296. doi: 10.1126 / science.aba8853. Epub 2020 Mar 26. PMID: 32217751; PMCID: PMC7297043.
[0185] Wang L, Bell P, Morizono H, He Z, Pumbo E, Yu H, White J, Batshaw ML, Wilson JM. AAV gene therapy corrects OTC deficiency and prevents liver fibrosis in aged OTC-knock out heterozygous mice. Mol Genet Metab. 2017 Apr;120(4):299-305. doi:
[0186] 10.1016 / j.ymgme.2017.02.011. Epub 2017 Mar 2. PMID: 28283349; PMCID: PMC5423267. Whittaker MN, Testa LC, Brooks DL, Quigley A, Said H, Dwivedi G, Jindal I, Volpp D, Qu P, Wang JZ, Levine MA, Ahrens-Nicklas RC, Li Q, Musunuru K, Alameh MG, Peranteau WH, Wang X. Improved specificity and efficacy of in vivo adenine base editing therapies with hybrid guide RNAs. bioRxiv [Preprint], 2025 Apr 9:2024.04.22.590531. doi:
[0187] 10.1101 / 2024.04.22.590531.
[0188] Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. Cpfl is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 2015 Oct 22;163(3):759-71.
[0189] Zheng Z, Liebers M, Zhelyazkova B, Cao Y, Panditi D, Lynch KD, Chen J, Robinson HE, Shim HS, Chmielecki J, Pao W, Engelman JA, lafrate AJ, Le LP. Anchored multiplex PCR for targeted next-generation sequencing. Nat Med. 2014 Dec;20(12): 1479-84.
[0190] While certain features of the invention have been described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the full scope of the invention.
Claims
WHAT IS CLAIMED IS:1 A method for editing a carbamoyl phosphate synthetase 1 (CPSl)-encoding polynucleotide comprising a mutation associated with CPS1 deficiency, the method comprising contacting the CPS1 polynucleotide with a base editor in complex with at least one guide polynucleotide, wherein the base editor comprises a polynucleotide programmable DNA binding domain and an adenosine deaminase domain, and wherein one or more of said guide polynucleotides target said base editor to effect an A*T to G»C alteration of the mutation associated with CPS I deficiency, thereby treating CPS1 deficiency symptoms.
2. The method of claim 1, wherein the contacting is in a ceil, a eukaryotic cell, a mammalian cell, or human cell3. The method of cl im 1 or 2, wherei the cell is in vivo.
4. The method of claim 1 or 2, wherein the cell is ex vivo5. The method of any one of claims 1-4, wherein the mutation is a C.10030T variant in at least one copy of the CPS1 gene.
6. The method of any one of claims 1-5, wherein the polynucleotide programmable DNA binding domain is a Streptococcus pyogenes Cas9 (SpCas9) or Staphylococcus aureus Cas9 (SaCas9) or a variant thereof.
7. The method of any one of claims 1-6, wherein the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adjacent motif (PAM) specificity.
8. The method of any one of claims 1 -7, wherein the polynucleotide programmable DNA binding domain is a nuclease inactive or nickase variant9. The method of any one of claims 1-8, wherein the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA).
10. The method of claim 9, wherein the adenosine deaminase is a TadA deaminase or a variant thereof.
11. The method of any one of claims I -10, wherein the base editor is in complex with a single guide RNA (gRN ) comprising a nucleic acid sequence complementary to a nucleic acid sequence comprising the mutation associated with CPS I deficiency selected from CAST Q335X: CPS I -001 - Q335X gRNA8, NGC-ABE8e-V106W mRNA (SEQ ID NO: 11), CPS7 R780H: ( PS I -002 - R780H_gRNA4, NGC-ABE8e-V106W mRNA (SEQ ID NO: 12); CPS1 R780H; CPS1-002H = R780H gRNA4 hybl6, NGC-ABE8e-V106W mRNA (SEQ ID NO: 13); CPS1 A160T: CPS 1-003 =- A160T__gRNA8, ABE8.8 mRNA (SEQ ID NO: 14); and CPS / A160T: CPS 1 -003h = A160T gRNA8 hyb!6, ABE8.8 mRNA (SEQ ID NO: 15).
12. A cell produced by introducing into the cell, or a progenitor thereof:a) a base editor, or a polynucleotide encoding said base editor, to said cell, wherein said base editor comprises a polynucleotide programmable DNA binding domain and an adenosine deaminase domain; andb) one or more guide polynucleotides that target, the base editor to effect an A«T to G*C alteration of the mutation associated with CPS1 deficiency.
13. The cell of claim 12, wherein the cel! is a hepatocyte and the guide polynucleotide and base editor comprises at least one of the following combinations: C’ S’. / Q335X: CPS 1-001 ~ Q335X__gRNA8, NGC-ABE8e-V106W mRNA (SEQ ID NO: 11); C 57 R780H: CPS 1-002 = R780H gRNA4, NGC-ABE8e-VI06W mRNA (SEQ ID NO: 12); CPS R780H; CPS1-002h -R780H__gRNA4_hybl6, NGC-ABE8e-V106 mRNA (SEQ ID NO: 13); CPS A160T: CPS1-003 = A160T gRNA8, ABE8.8 mRNA (SEQ ID NO: 14); and CPS1 A160T: CPS1-00311 = A160T__gRNA8_hybl6, ABE8.8 mRNA (SEQ ID NO: 15).
14. The cell of claim 12 or 13, wherein the hepatocyte expresses a CPS! polypeptide.
15. The cell of any one of claims 12-14, wherein the cell is from a subject having CPS1 deficiency.
16. The cell of any one of claims 12-15, wherein the polynucleotide programmable DNA binding domain is a Streptococcus pyogenes Cas9 (SpCas9) or variant thereof.
17. The cell of any one of claims 12-16, wherein the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adj cent motif (PAM) specificity.
18. The cell of claim 17, wherein the modified SpCas9 has specificity for the nucleic acid sequence 5'-NGC-3'.
19. The cell of any one of claims 12-18, wherein the polynucleotide programmable DNA binding domain is a nuclease-inactive or nickase variant.
20. The cell of any one of claims 12-18, wherein the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA).
21. The cell of any one of claims 12-20, wherein the base editor is in complex with a single guide RNA (gRNA) comprising a nucleic acid sequence complementary to a CPS1 encoding nucleic acid sequence comprising the mutation associated with CPS1 deficiency.
22. An adenosine base editor / guide polynucleotide set that corrects a mutation causing CPS1 d efi ci ency com pri si ng:(i) a modified SpCas9 or SaCas9;(ii) an adenosine deaminase or functional fragment thereof; andiii ) a guide polynucleotide that targets the base editor to effect an A»T to G»C alteration of the mutation associated with CPS1 deficiency.
23. The base editor / guide polynucleotide set of claim 22, wherein said mutation in CPS1 is selected from a c.10030T variant (Q355X), a c2339G> A variant (R780H), or a c.478G> A (A160T) variant in at least one copy of the CPS 1 -encoding polynucleotide and said set is one of the following: CPSJ Q335X: CPSl-001 = Q335X gRNA8, NGC-ABE8e-V106W mRNA (SEQ ID NO: 11); CPS1 R780H: CPS 1 -002 === R780H_gRNA4, NGC-ABE8e-V106W mRNA (SEQ ID NO: 12); CP57 R780H: CPSI-002h = R780H gRNA4 hyb!6, NGC-ABE8e-V106W mRNA (SEQ ID NO: 13); CPS1 A160T: CPS 1-003 - A160T_gRNA8, ABE8.8 mRNA (SEQ ID NO:14); and CPS A 160T: CPSl-003h - A160T_gRNA8_hybl6, ABE8.8 mRNA (SBQ ID NO: 15).
24. The base editor / guide polynucleotide set of claims 22-23 wherein said guide polynucleotide has a sequence of SEQ ID NO:
825. The base editor / guide polynucleotide set of claims 22-24, wherein said base editor / guide polynucleotide set are encapsulated in a lipid nanoparticle formulation and delivered to the liver of said subject.
26. The base editor / guide polynucleotide set of claims 25, wherein said formulation comprises ionizable cationic lipid, l,2-distearoyl-sn-glycero-3 -phosphocholine, cholesterol, and a PEG-lipid.
27. The base editor / guide polynucleotide set of claims 22-24, wherein said base editor and guide polynucleotide are present in a single or dual AAV vector system for delivery to the liver.
28. The base editor / guide polynucleotide set of claims 22-24, wherein said base editor and guide polynucleotide are present in virus-like particles for delivery to hepatocytes.
29. A method of treating CPS1 deficiency in a subject comprising administering to said subject an effective amount the adenosine base editor / guide polynucleotide set of any of claims 22 to 2830. The method of claim 29, wherein the subject is a mammal or a human.
31. The method of claim 29 or 30, comprising delivering the base editor, or polynucleotide encoding said base editor, and said one or more guide polynucleotides to a cell of the subject32. The method of any one of claims 29 to 31, wherein the cell is a liver cell.339 The method of any one of claims 29-32, wherein said base editor / guide polynucleotide set are encapsulated in a lipid nanoparticle formulation and delivered to the liver of said subject.
34. The method of claim 33 wherein said formulation comprises ionizable cationic lipid, 1,2-distearoyl-sn-glycero-3-phosphocholine, cholesterol, and aPEG-lipid.
35. The method of any one of claims 29-32, wherein said base editor and guide polynucleotide are delivered to hepatocytes in a single or dual AAV vector system.
36. The method of any one of claims 29-32, wherein said base editor and guide polynucleotide are delivered to hepatocytes in virus-like particles.
37. A transgenic mouse comprising a humanized CPS1 gene comprising a mutation associated with CPS 1 deficiency.
38. The transgenic mouse of claim 37, wherein the mutation is a c,1003C> T variant in at least one copy of the CPS1 gene.
39. The transgenic mouse of claim 37, wherein the mutation is a c.2339G> A variant in at least one copy of the CPS1 gene.
40. A vector comprising a one, two, three or more approximately 100-bp genomic sequences spanning individual CPS1 variants.
41. The vector of claim 40, which is a lentiviral vector comprising a -100-bp CPS1 genomic sequence spanning a Q335X variant, a ~100-bp CPSJ genomic sequence spanning aR780H variant, and a « 100-bp CPS I genomic sequence spanning the A160T variant.
42. The vector of any one of claims 40 to 41, further comprising genomic sequences encoding a positive reference control.43 The vector of any one of claims 40 to 42, wherein said positive reference control is selected from a PAH P28 IL variant and / or a PAH R408W variant.
44. The vector of any one of claims 40 to 43 present in a HuH-7 cell wherein said vector is a lentiviral vector.
45. A cell comprising any one of the vectors of claims 40 to 44.
46. The cell of claim 45, present in the liver of a test subject.
47. The cell of claim 46, wherein said test subject is a transgenic mouse.
48. A drug product for treatment of CPSl deficiency caused by a Q335X mutation, comprising a LNP composition comprising the ionizable lipid ALC-0307, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol, and PEG-lipid ALC-0159 and SEQ ID NO: 11 in a pharmaceutically carrier.
49. A drug product for treatment of CPSl deficiency caused by a R.780H mutation, comprising a LNP composition comprising the ionizable lipid ALC-0307, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol, and PEG-lipid ALC-0159 and SEQ ID NO: 13 in a pharmaceutically carrier.
50. A drug product for treatment of CPSl deficiency caused by an A160T mutation, comprising a LNP composition comprising the ionizable lipid ALC-0307, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol, and PEG-lipid ALC-0159 and SEQ ID NO: 15 in a pharmaceutically carrier.