Fungal nematode antagonists

Fungal strains like Trichoderma koningiopsis and Metarhizium anisopliae are used to control soybean cyst nematodes by colonizing eggs and degrading eggshells, addressing SCN infestation challenges and enhancing crop yield.

WO2026107312A1PCT designated stage Publication Date: 2026-05-21OHIO STATE INNOVATION FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
OHIO STATE INNOVATION FOUND
Filing Date
2025-11-14
Publication Date
2026-05-21

AI Technical Summary

Technical Problem

The management of soybean cyst nematode (SCN) infestation in soybean fields is challenging due to its spotty distribution and the breakdown of genetic resistance, leading to late detection and significant economic losses, necessitating improved methods for control and prevention.

Method used

Compositions and methods utilizing naturally occurring fungal strains, such as Trichoderma koningiopsis and Metarhizium anisopliae, and their derivatives, applied through various agricultural formulations to prevent, inhibit, or treat nematode infections by colonizing nematode eggs, degrading the eggshell, or reducing egg hatching.

Benefits of technology

The fungal compositions effectively suppress nematode populations, reduce gall formation, enhance root mass, improve plant vigor, and increase crop yield by acting against a broad range of plant-parasitic nematodes, including soybean cyst nematodes, through multiple modes of action.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000019_0001_TABLE
    Figure IMGF000019_0001_TABLE
  • Figure IMGF000020_0001_TABLE
    Figure IMGF000020_0001_TABLE
  • Figure IMGF000021_0001_TABLE
    Figure IMGF000021_0001_TABLE
Patent Text Reader

Abstract

Compositions and methods for controlling plant-parasitic nematodes using naturally derived fungal strains are provided. The compositions comprise one or more fungi selected from Trichoderma koningiopsis NC.184, Metarhizium NC.244, Clonostachys NC.261, Clonostachys NC.359, Clonostachys NC.297, an unidentified Hypocreales fungus NC.311, Pseudozyma pruni NC.423, Clonostachys rosea NC.480, Metarhizium anisopliae NC.374, Plectosphaerella cucumerina NC.438, or products, isolates, or extracts derived therefrom, optionally in combination with surfactants or additional active ingredients. Formulations include sprays, powders, granules, seed coatings, emulsions, and microencapsulated products. Methods of producing fungal materials and methods of applying the compositions to plants, seeds, or soil to reduce nematode populations are also provided. The compositions are effective against agriculturally important nematodes, including soybean cyst, root-knot, lesion, sting, and corn needle nematodes, and may improve plant health and yield. The invention enables biologically based nematode management for crops such as soybean and corn.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No. 103362-070W01FUNGAL NEMATODE ANTAGONISTSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application No. 63 / 720,484, filed November 14, 2024, incorporated herein by reference in its entirety.REFERENCE TO SEQUENCE LISTING

[0002] The sequence listing submitted on November 14, 2025, as an .XML file entitled “103362-070W01_ST26.xml” created on November 13, 2025, and having a file size of 16,405 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).BACKGROUND

[0003] The soybean cyst nematode (SCN), Heterodera glycines is the most yield-limiting pest of soybean in the US, causing significant economic losses in the absence of above-ground symptoms (Bandara et al. 2020; Wang et al. 2003). Long-term effective management of SCN has relied on an integrated program that includes crop rotation, seed treatments, fertility management, and resistant soybean varieties to mitigate the effects of SCN infestation (Arjoune et al. 2022; Niblack 2005). Moreover, the most common source of genetic resistance against the nematode, PI88788 has been breaking down in recent years (McCarville et al. 2017; Niblack et al. 2008). Yearly soil sampling after harvest allows for the early detection of SCN when these strategies are most effective. However, this process can be time-consuming and might require multiple people to cover fields of the scale of many growing operations. Nevertheless, insufficient scouting coverage can lead to late detection of diseases ultimately causing significant economic losses. SCN is known to have a spotty distribution with hotspots forming across a field (Avendano et al. 2003). Knowledge about what drives the formation of these hotspots can serve as a guide for growers to optimize their scouting efforts during the growing season, reducing the amount of time and resources spent on this task.

[0004] Thus, there exists a need to control, prevent, and treat SCN and other nematode infections. These needs and others are at least partially satisfied by the present disclosure.SUMMARY

[0005] The present invention provides compositions and methods for controlling plant-parasitic nematodes using naturally occurring fungal strains and products derived therefrom. TheAttorney Docket No. 103362-070W01 compositions comprise one or more fungi selected from Trichoderma koningi opsis NC.184, Metarhizium NC.244, Clonostachys NC.261, Clonostachys NC.359, Clonostachys NC.297, an unidentified Hypocreales fungus NC.311, Pseudozyma pruni NC.423, Clonostachys rosea NC.480, Metarhizium anisopliae NC.374, Plectosphaerella cucumerina NC.438, or combinations thereof. In certain embodiments, the compositions include isolates, extracts, metabolites, culture filtrates, or products derived from such fungi, optionally in combination with at least one surfactant, one or more additional microorganisms, chemical nematicides, or agriculturally acceptable carriers. The fungal component may be viable or non-viable and may be characterized by an internal transcribed spacer (ITS) region having defined sequence identity to SEQ ID NOs: 1-8.

[0006] The invention further provides a variety of formulated products incorporating the fungal compositions, including sprays, powders, granules, seed coatings, emulsions, suspensions, and microencapsulated forms suitable for agricultural use. Also disclosed are methods for producing fungal products by culturing the disclosed strains under conditions promoting sporulation or metabolite production, followed by recovery of spores, my celia, culture supernatant, or other active materials via conventional fermentation and processing techniques.

[0007] The invention additionally provides methods for preventing, inhibiting, treating, reducing, or ameliorating nematode infections in plants by administering the disclosed compositions or formulations to plants, plant parts, seeds, or soil. The methods may involve preventative or curative applications and may be conducted once or multiple times throughout the growing season. Application routes include foliar spray, soil drench, in-furrow delivery, drip irrigation, and seed treatment. The disclosed compositions are effective against a broad range of plant-parasitic nematodes, including soybean cyst nematodes, root-knot nematodes, lesion nematodes, sting nematodes, stubby-root nematodes, and com needle nematodes. The fungal agents may act by colonizing nematode eggs, degrading the eggshell or cuticle, reducing egg hatching, inhibiting nematode motility, or increasing nematode mortality.

[0008] In some embodiments, co-application with additional biological agents or chemical nematicides enhances nematode suppression or generates synergistic activity. Application of the compositions may reduce gall formation, suppress nematode reproduction, increase root mass, improve plant vigor, reduce nematode-associated damage, and increase crop yield. The methods and compositions of the invention are suitable for use on a wide variety of crops, including but not limited to soybean and corn.

[0009] Other systems, methods, features and / or advantages will be or may become apparent to one with skill in the art upon examination of the following drawings and detailed description.Attorney Docket No. 103362-070W01 It is intended that all such additional systems, methods, features and / or advantages be included within this description and be protected by the accompanying claims.BRIEF DESCRIPTION OF DRAWINGS

[0010] FIGURES 1A-1C depict maps of gridded fields B (FIG. 1A), W (FIG. IB), and P (FIG. 1C) from the year 2022. The center of each grid is marked by the diamond shape, where the shape's color denotes the final SCN abundance within the grid. Red indicates samples with the highest SCN abundance in the field, while grids with the lowest nematode abundance are marked with a light-yellow color. Grids from which fungi were isolated have been circled.

[0011] FIGURES 2A-2C depict box plots of paired comparisons of initial and final SCN abundance on each grid sampled included in fungal community analysis. Samples are separated into plots by SCN final abundance. FIG. 2A shows all samples in the group. FIG. 2B shows samples with high SCN abundance (> 1833 eggs per 100 cm3of soil, P= 0.01392). FIG. 2C shows samples with low abundance (>1833 eggs per 100 cm3of soil, P= 0.4908).

[0012] FIGURES 3A-3B depict principal component analysis (PCA) of bulk (FIG.3A) and rhizosphere (FIG. 3B) soil samples based on fungal community composition. Each circle represents a sample, where the color denotes the SCN reproduction level in its grid of origin. Coral represents samples from grids with high SCN reproduction, while blue represents samples with low SCN reproduction. Polygons are drawn to aid the visualization of clusters.

[0013] FIGURE 4 depicts a Venn diagram showing the results of core community composition analysis for bulk soil samples by SCN reproduction. Each ellipse contains the core community members at different levels of SCN reproduction. Unions within the diagram represent shared community members. Core microbiome was defined by a minimum detection of 0.001 relative abundance in at least 90% of the samples and a prevalence of 95%.

[0014] FIGURE 5 depicts indicator species analysis of nematophagous fungi by SCN reproduction P<0.05). On the x-axis, the taxa of the indicator species are shown, while the y-axis displays their relative abundance. The box colors indicate the SCN reproduction level in the sample’s grid of origin. Samples from grids with high SCN reproduction are colored coral, while blue is for samples with low SCN reproduction.

[0015] FIGURE 6 is a heatmap summarizing Spearman's correlation analysis of edaphic factors and nematophagous fungi relative abundance. Individual heat maps are split by edaphic factor where each column shows the results from samples with high or low SCN abundance. Each row summarizes the results of individual fungal ASV. Colors represent the strength of the correlation, where bright yellow denotes a strong positive correlation while dark purple indicatesAttorney Docket No. 103362-070W01 a strong negative correlation. A red asterisk indicates that the correlation is statistically significant (P< 0.05).

[0016] FIGURE 7 is a Sankey chart showing the workflow of isolates through a high-throughput isolation process and in vitro testing of the fungal collection for nematophagous activity.

[0017] FIGURE 8 depicts microscopic pictures of nematode eggs at lOOx magnification. The picture to the left shows a healthy nematode egg. The picture to the right shows a nematode egg that has been colonized by isolate NC.423.

[0018] FIGURE 9 depicts the results of the egg colonization assay. The x-axis shows the isolate ID, where the ID for the negative control is "cntrl-". Two positive controls were used: Metarhizium brunneum (Mr bru) and Purpureocillium lilacinum (P_lil). The y-axis shows the percentage colonization for each isolate.

[0019] FIGURE 10 depicts the results of the egg hatching and motility assay. The x-axis shows the isolate ID, where the ID for the negative control is "cntrl-". Two positive controls were used: Metarhizium brunneum (Mr bru) and Purpureocillium lilacinum (P lil). The y-axis shows the percentage of eggs that hatched and moved from the hatching mesh into the water.DETAILED DESCRIPTION

[0020] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate aspects, can also be provided in combination with a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, can also be provided separately or in any suitable subcombination. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure.DEFINITIONS

[0021] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:

[0022] As used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by”, “comprising,” “comprises”, “comprised of,” “including,” “includes,”Attorney Docket No. 103362-070W01 “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, nonlimiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of’ and “consisting of.” Similarly, the term “consisting essentially of’ is intended to include examples encompassed by the term “consisting of.

[0023] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound”, “a composition”, or “a cancer”, includes, but is not limited to, two or more such compounds, compositions, or cancers, and the like.

[0024] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It can be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it can be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0025] When a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g. the phrase “x to y” includes the range from ‘x’ to ‘y’ as well as the range greater than ‘x’ and less than ‘y’. The range can also be expressed as an upper limit, e.g. ‘about x, y, z, or less’ and should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of Tess than x’, less than y’, and Tess than z’ . Likewise, the phrase ‘about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x’, greater than y’, and ‘greater than z’. In addition, the phrase “about ‘x’ to ‘y’”, where ‘x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’”.

[0026] It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range isAttorney Docket No. 103362-070W01 explicitly recited. To illustrate, a numerical range of “about 0.1% to 5%” should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the sub-ranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.

[0027] As used herein, the terms “about,” “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about,” “approximate,” or “at or about” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0028] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired modification of a physical property of the composition or material. For example, an “effective amount” of a monomer refers to an amount that is sufficient to achieve the desired improvement in the property modulated by the formulation component, e.g. desired antioxidant release rate or viscoelasticity. The specific level in terms of wt% in a composition required as an effective amount will depend upon a variety of factors including the amount and type of monomer, amount and type of polymer, e.g., acrylamide, amount of antioxidant, and desired release kinetics.

[0029] As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of theAttorney Docket No. 103362-070W01 treatment; drugs used in combination or coincidental with the specific compound employed and like factors within the knowledge and expertise of the health practitioner and which may be well known in the medical arts. In the case of treating a particular disease or condition, in some instances, the desired response can be inhibiting the progression of the disease or condition. This may involve only slowing the progression of the disease temporarily. However, in other instances, it may be desirable to halt the progression of the disease permanently. This can be monitored by routine diagnostic methods known to one of ordinary skill in the art for any particular disease. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.

[0030] For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. It is generally preferred that a maximum dose of the pharmacological agents of the invention (alone or in combination with other therapeutic agents) be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

[0031] A response to a therapeutically effective dose of a disclosed drug delivery composition can be measured by determining the physiological effects of the treatment or medication, such as the decrease or lack of disease symptoms following administration of the treatment or pharmacological agent. Other assays will be known to one of ordinary skill in the art and can be employed for measuring the level of the response. The amount of a treatment may be varied for example by increasing or decreasing the amount of a disclosed compound and / or pharmaceutical composition, by changing the disclosed compound and / or pharmaceutical composition administered, by changing the route of administration, by changing the dosage timing and so on. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.

[0032] As used herein, the term “prophylactically effective amount” refers to an amount effective for preventing onset or initiation of a disease or condition.Attorney Docket No. 103362-070W01

[0033] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.

[0034] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0035] As used interchangeably herein, “subject,” “individual,” or “patient” can refer to a vertebrate organism, such as a mammal (e.g. human). "Subject" can also refer to a cell, a population of cells, a tissue, an organ, or an organism. “Subject” can also refer to a plant.

[0036] As used herein, “dose,” “unit dose,” or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of a disclosed compound and / or a pharmaceutical composition thereof calculated to produce the desired response or responses in association with its administration.COMPOSITIONSFungal Components

[0037] In one aspect, provided is a composition including: a fungus selected from the group consisting of Trichoderma koningiopsis NC.184, Metarhizium NC.244, Clonostachys NC.261, Clonostachys NC.359, Clonostachys NC.297, unidentified Hypocreales fungus NC.311, Pseudozyma pruni NC.423, Clonostachys rosea NC.480, Metarhizium anisopliae NC.374, Plectosphaerella cucumerina ^iC.438, or any combination thereof; and at least one surfactant.

[0038] In another aspect, provided is a composition including: an isolate, extract, or product derived from a fungus selected from the group consisting of Trichoderma koningiopsis NC.184, Metarhizium NC.244, Clonostachys NC.261, Clonostachys NC.359, Clonostachys NC.297, unidentified Hypocreales fungus NC.311, Pseudozyma pruni NC.423, Clonostachys rosea NC.480, Metarhizium anisopliae NC.374, Plectosphaerella cucumerina NC.438, or any combination thereof; and at least one surfactant.

[0039] These fungi may be provided in the form of living cells, spores (including conidia, chlamydospores, or resting spores), hyphal fragments, mycelial biomass, or mixtures thereof. In some embodiments, the fungus is viable and capable of germination, growth, sporulation, colonization, or infection of nematodes or nematode eggs. In other embodiments, the fungus is non-viable, for example heat-killed, chemically inactivated, irradiated, lysed, or otherwise non-replicative, while still retaining nematocidal or nematistatic properties.Attorney Docket No. 103362-070W01

[0040] In some aspects, the isolate, extract, or product can include a protein, lipid, carbohydrate, small molecule, or any combination thereof.

[0041] The present disclosure provides compositions comprising one or more fungi, fungal isolates, fungal extracts, fungal metabolites, or products derived therefrom, optionally formulated together with at least one surfactant and, in some embodiments, one or more additional agriculturally acceptable ingredients. The compositions described herein exhibit nematocidal, nematistatic, and / or nematode-suppressive activity and are suitable for application to plants, plant seeds, or soil for the prevention, inhibition, reduction, treatment, and / or amelioration of nematode infections.Internal Transcribed Spacer Region

[0042] In certain embodiments, the fungal component of the compositions described herein is defined or characterized, at least in part, by an internal transcribed spacer (ITS) region sequence. The ITS region, which includes ITS1, 5.8S rRNA, and ITS2, is the primary molecular barcode used for fungal identification and classification and is widely accepted in the mycological and taxonomic communities as the universal DNA barcode for fungi. The ITS region is flanked by highly conserved portions of the fungal ribosomal RNA operon, enabling amplification using universal primers (e.g., ITS1, ITS4, ITS5), while the ITS1 and ITS2 subregions themselves exhibit sufficient sequence variability to discriminate among species and even among closely related strains. As such, ITS sequencing provides a reliable, reproducible, and widely recognized method for distinguishing the fungal isolates described herein from known strains and for identifying naturally occurring variants that retain comparable biological activity.

[0043] Accordingly, in certain embodiments, the fungal component comprises an ITS region having at least 80% sequence identity to any one of SEQ ID NOs: 1-8. In other embodiments, the ITS region comprises at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOs: 1-8. Percent identity may be calculated using any suitable alignment algorithm, including but not limited to BLASTN, ClustalW, MUSCLE, MAFFT, or other standard alignment programs, using default or otherwise acceptable parameters known in the art. ITS sequences falling within these identity thresholds are encompassed herein, including sequences that differ from SEQ ID NOs: 1-8 by insertions, deletions, substitutions, or combinations thereof, provided the fungal strain maintains comparable nematocidal activity.

[0044] In various embodiments, the fungal component may be a naturally occurring variant, an environmentally isolated strain, a laboratory-adapted derivative, a subculture, a single-sporeAttorney Docket No. 103362-070W01 isolate, or a mutant generated through spontaneous evolution, UV mutagenesis, chemical mutagenesis, serial passaging, or other non-recombinant methods that preserve the biological characteristics of the original isolates. The ITS identity thresholds disclosed herein therefore encompass strains that are genetically similar to the identified isolates, including strains that share phylogenetic clustering with the strains corresponding to SEQ ID NOs: 1-8, as determined through phylogenetic reconstruction, neighbor-joining analysis, maximum likelihood analysis, or other tree-building approaches.

[0045] The ITS sequence identity criteria provided herein ensure that fungal strains falling within the defined homology range exhibit taxonomic relatedness to the isolated strains while allowing for natural genetic diversity. Such related strains may be identified through PCR amplification of the ITS region using universal fungal primers, sequencing of the amplicon, and comparison of the obtained sequence to SEQ ID NOs: 1-8. Fungal isolates meeting the identity thresholds described above have been found to possess comparable nematocidal, nematistatic, or nematode-suppressive activity, including but not limited to activity against soybean cyst nematodes, root-knot nematodes, and other agriculturally significant species. Thus, the ITS-based definitions provided herein support the inclusion of a broad class of related fungal strains suitable for use in the compositions and methods of the present disclosure.Surfactants and Carriers

[0046] Examples of surfactants which can be used include, but are not limited, to fatty acid esters or amides or ether analogues, or hydrophilic derivatives thereof; monoesters or diesters, or hydrophilic derivatives thereof; or mixtures thereof; monoglycerides or diglycerides, or hydrophilic derivatives thereof; or mixtures thereof; mixtures having enriched mono- or / and diglycerides, or hydrophilic derivatives thereof; surfactants with a partially derivatized with a hydrophilic moiety; monoesters or diesters or multiple-esters of other alcohols, polyols, saccharides or oligosaccharides or polysaccharides, oxyalkylene oligomers or polymers or block polymers, or hydrophilic derivatives thereof, or the amide analogues thereof; fatty acid derivatives of amines, polyamines, polyimines, aminoalcohols, aminosugars, hydroxyalkylamines, hydroxypolyimines, peptides, polypeptides, or the ether analogues thereof. Additional examples of surfactants include polyoxyethylene products of hydrogenated vegetable oils, polyethoxylated castor oils or polyethoxylated hydrogenated castor oil, polyoxyethylene-sorbitan-fatty acid esters, polyoxyethylene castor oil derivatives and the like, for example, Nikkol HCO-50, Nikkol HCO-35, Nikkol HCO-40, Nikkol HCO-60 (from Nikko Chemicals Co. Ltd.); Cremophor (from BASF) such as Cremophor RH40, Cremophor RH60, Cremophor EL, TWEENs (from ICI Chemicals) e.g., TWEEN 20, TWEENAttorney Docket No. 103362-070W01 21, TWEEN 40, TWEEN 60, TWEEN 80, TWEEN 81, Cremophor RH 410, Cremophor RH 455 and the like.

[0047] Other examples of surfactants include Lumulse GRH-40, TGPS, Polysorbate-80 (TWEEN-80), Polysorbate-20 (TWEEN-20), polyoxyethylene (20) sorbitan mono-oleate), glyceryl glycol esters, polyethylene glycol esters, polyglycolyzed glycerides, and the like, or mixtures thereof; polyethylene sorbitan fatty acid esters, polyoxyethylene glycerol esters, such as Tagat TO, Tagat L, Tagat I, tagat 12 and Tagat 0 (commercially available from Goldschmidt Chemical Co., Essen, Germany); ethylene glycol esters, such as glycol stearate and distearate; propylene glycol esters, such as propylene glycol myristate; glyceryl esters of fatty acids, such as glyceryl stearates and monostearates; sorbitan esters, such as spans and TWEENs; polyglyceryl esters, such as polyglyceryl 4-oleate; fatty alcohol ethoxylates, such as Brij type emulsifiers; ethoxylated propoxylated block copolymers, such as poloxamers; polyethylene glycol esters of fatty acids, such as PEG 300 linoleic glycerides or Labrafil 2125 CS, PEG 300 oleic glycerides or Labrafil M 1944 CS, PEG 400 caprylic / capric glycerides or Labrasol, and PEG 300 caprylic / capric glycerides or Softigen 767; cremophors, such as Cremophor E, polyoxyl 35 castor oil or Cremophor EL, Cremophor EL-P, Cremophor RH 40P, polyoxyl 40 hydrogenated castor oil, Cremophor RH40; polyoxyl 60 hydrogenated castor oil or Cremophor RH 60, glycerol monocaprylate / caprate, such as Campmul CM 10; poly oxy ethylated fatty acids (PEG-stearates, PED-laurates, Brij™), polyoxylated glycerides of fatty acid, polyoxylated glycerol fatty acid esters i.e. Solutol HS-15; PEG-ethers (Miij™), sorbitan derivatives (TWEENs), sorbitan monooleate or Span 20, aromatic compounds (Tritons™), PEG-glycerides (PECEOL™), PEG-PPG (polypropylene glycol) copolymers (PLURONICS including but not limited to PLURONICS F108, F127, and F68, Poloxamers, Jeffamines), Tetronics, Polyglycerines, PEG-tocopherols, PEG-LICOL 6-oleate; propylene glycol derivatives, sugar and polysaccharide alkyl and acyl derivatives (octyl sucrose, sucrose stearate, laurolydextran etc.) and / or a mixture thereof; surfactants based on an oleate or laureate ester of a polyalcohol copolymerized with ethylene oxide; Labrasol Gelucire 44 / 14; polyoxytheylene stearates; saturated polyglycolyzed glycerides; or poloxamers; all of which are commercially available. Polyoxyethylene sorbitan fatty acid esters can include polysorbates, for example, polysorbate 20, polysorbate 40, polysorbate 60, and polysorbate 80. Polyoxyethylene stearates can include polyoxyl 6 stearate, polyoxyl 8 stearate, polyoxyl 12 stearate and polyoxyl 20 stearate. Saturated polyglycolyzed glycerides are, for example, GELUCIRE 44 / 14 or GELUCIRE™ 50 / 13 (Gattefosse, Westwood, N.J., U.S.A.). Poloxamers used herein include poloxamer 124 and poloxamer 188.Attorney Docket No. 103362-070W01

[0048] The compositions may further include agriculturally acceptable carriers such as water, oils (e.g., mineral oil, soybean oil), emulsifiers, dispersants, stabilizers, fillers, humectants, preservatives, buffers, osmotic agents, pH adjusters, or rheology modifiers.Isolates, Extracts, and Metabolites

[0049] In other embodiments, the compositions comprise an isolate, extract, or product derived from any of the fungal strains described herein. The isolate or extract may comprise cellular material, cell lysates, culture supernatants, culture filtrates, secreted metabolites, proteins, lipids, carbohydrates, polysaccharides, chitinases, proteases, secondary metabolites, small molecules, glycoproteins, or any combination thereof. Extracts may be aqueous, organic, or mixed-solvent extracts and may be prepared using filtration, centrifugation, solvent extraction, chromatographic purification, lyophilization, precipitation, fractionation, or combinations of these techniques. Culture filtrates may be obtained by removing cells and solid biomass from fungal culture media by filtration or centrifugation, and the filtrate may contain nematocidal enzymes, toxins, or metabolites. In some embodiments, the isolated fungal metabolites are enriched or concentrated to increase nematocidal potency.Additional Active Ingredients

[0050] The compositions may optionally include one or more additional microorganisms or compounds having nematocidal, nematistatic, or biological control activity. Non-limiting examples include Bacillus species, Paecilomyces lilacinus or Purpureocillium lilacinum, other Trichoderma spp., Metarhizium spp., Clonostachys spp., or beneficial bacteria, fungi, or viruses. The additional biologicals may act synergistically with the fungal strains described herein.

[0051] Chemical nematicides may also be included in the compositions. Examples include fluopyram, abamectin, fosthiazate, oxamyl, or other commercially available nematicidal agents. The compositions may further include fungicides, insecticides, herbicides, and fertilizers, allowing co-application in integrated pest management programs or as part of seed treatment packages. Formulated Compositions

[0052] The compositions may be formulated in any agriculturally acceptable form including, but not limited to, aqueous solutions, suspensions, emulsions, wettable powders, dusts, granules, microgranules, seed coatings, seed treatment slurries, microencapsulated formulations, emulsifiable concentrates, flowable concentrates, or gel formulations. Formulation may involve drying or stabilizing the fungal component using carriers such as clays, starches, silica, diatomaceous earth, maltodextrins, gums, or polymer matrices.

[0053] In certain embodiments, the composition is provided as a sprayable liquid suitable for foliar or soil application. In other embodiments, the composition is provided as a powder forAttorney Docket No. 103362-070W01 dusting, seed treatment, soil incorporation, or dry blending with fertilizers. Granular formulations may be used for soil drench equivalents or slow-release applications. Seed-coating formulations may include binders, adhesives, colorants, or polymers.

[0054] Microencapsulated formulations may be designed to protect fungal cells or metabolites from UV degradation, environmental stress, or premature degradation, and may employ polymeric shells, lipid vesicles, starch matrices, or alginate beads.Compatibility and Stability

[0055] The compositions may be designed to maintain fungal viability or metabolite stability for extended shelflife, for example 1 month, 3 months, 6 months, 12 months, or 24 months under ambient storage conditions. Stabilizers may include antioxidants, cryoprotectants, osmoprotectants, sugars, polyols, amino acids, proteins, or salts.

[0056] The compositions may be compatible with commercial fertilizers, pesticides, seed coatings, or irrigation components, enabling tank-mixing or co-application.Combinations of Fungal Strains

[0057] Any two, three, four, five, six, seven, eight, nine, or all ten of the listed fungal strains may be used in combination. Combinations may be selected to expand the nematode spectrum, improve environmental robustness, enhance colonization of soil or plant roots, or provide synergistic nematocidal effects. Mixed cultures may be co-fermented or combined postfermentation.General Concentrations and Ratios

[0058] Although no specific numerical claim limitations are required, the specification supports compositions containing:• fungal biomass at concentrations from 103to IO10spores / mL or equivalents,• fungal extracts at concentrations from 0.001% to 50% (w / v),• fungal metabolites at any effective concentration,• surfactants at concentrations from 0.001% to 20% (w / v),• Additional microorganisms at densities sufficient to enhance nematocidal activity. • Ratios of fungal component to surfactant may range from 1 : 10,000 to 10,000: 1 depending on formulation type and intended use.Intended Use and Activity

[0059] The compositions are effective for killing nematodes, inhibiting nematode hatching, reducing nematode motility, damaging or degrading the nematode cuticle, penetrating nematode eggs, colonizing nematode egg masses, suppressing nematode populations in soil, and protectingAttorney Docket No. 103362-070W01 plants from nematode-associated damage. Specific target nematodes include soybean cyst nematodes, root-knot nematodes, lesion nematodes, sting nematodes, stubby-root nematodes, com needle nematodes, and other agriculturally significant species. The compositions may be used on any plant species, including but not limited to soybean and corn.METHODSProduction of Fungal Products

[0060] In certain embodiments, the present disclosure provides methods for producing a nematocidal fungal product suitable for use in the compositions and methods described herein. In some embodiments, the method comprises culturing any of the fungal strains disclosed above under conditions that promote growth, sporulation, metabolite production, or any combination thereof. Culturing may be performed in liquid (submerged) fermentation, solid-state fermentation, biphasic systems, or surface cultures. Suitable media include nutrient-rich or minimal media containing carbon sources (e.g., glucose, sucrose, starch, molasses), nitrogen sources (e.g., yeast extract, peptone, ammonium salts, urea), mineral salts, vitamins, or trace elements. Fermentation conditions may include temperatures between 10°C and 35°C, pH values between 3 and 9, aeration rates suitable to maintain dissolved oxygen concentrations supporting fungal growth, and incubation periods ranging from 24 hours to 30 days. Sporulation may be enhanced by adjusting light exposure, temperature, carbon / nitrogen ratios, or by transferring cultures to sporulation-promoting substrates such as grains, bran, compost, or other natural carriers.

[0061] Following culturing, the fungal product may comprise spores, conidia, hyphae, mycelial biomass, culture supernatant, culture filtrate, or combinations thereof. In certain embodiments, the method further comprises recovering the fungal material by filtration, centrifugation, sedimentation, spray drying, freeze-drying, or other separation or stabilization techniques. The resulting fungal material may be concentrated, dried, diluted, blended, or formulated with carriers, surfactants, stabilizers, or other agriculturally acceptable components to generate a final product. In some embodiments, the fungal culture is produced using submerged fermentation or solid-state fermentation systems optimized for large-scale industrial production. The methods described herein enable efficient and reproducible generation of fungal products with nematocidal activity suitable for incorporation into the compositions and formulations of the present invention.Methods of UseAttorney Docket No. 103362-070W01

[0062] The present disclosure further provides methods for preventing, inhibiting, treating, reducing, or ameliorating nematode infections in plants or in the soil in which such plants are grown. In certain embodiments, the methods comprise administering to a plant, a plant part, a plant seed, or soil surrounding the plant an effective amount of any of the compositions described herein. As used herein, an “effective amount” refers to an amount sufficient to reduce nematode viability, suppress nematode population growth, inhibit egg hatching, limit nematode mobility, reduce nematode colonization of plant tissues, improve plant vigor, or otherwise achieve a measurable improvement in plant health relative to an untreated control.

[0063] In certain embodiments, the compositions are administered preventatively, for example prior to the establishment of a nematode population, at planting, during early plant growth stages, or at intervals throughout the growing season. In other embodiments, the compositions are administered curatively or suppressively, for example after nematodes have been detected in soil, roots, or plant tissues. The methods may include single or repeated applications, including two, three, four, five, six, seven, eight, nine, ten, or more sequential treatments applied on a schedule appropriate for the crop, environmental conditions, and nematode pressure.

[0064] The compositions may be administered using any agriculturally acceptable application method. In some embodiments, the compositions are applied as a liquid spray to foliage, stems, or the soil surface. In other embodiments, the compositions are applied as a powder, dust, granule, wettable powder, dry flowable, or seed-applied formulation. Application may be performed using conventional sprayers, backpack sprayers, tractor-mounted booms, aerial spray equipment, drip irrigation systems, chemigation infrastructure, or automated seedtreatment systems. In certain embodiments, the compositions are applied as a soil drench, an infurrow treatment at planting, a transplant dip, a root-zone application, or via drip irrigation lines. Seed treatment embodiments may involve coating, pelleting, encapsulating, or impregnating the seed with the compositions described herein, optionally in combination with binders, polymers, colorants, or additional seed-treatment actives.

[0065] The methods described herein are effective for controlling a wide range of plant-parasitic nematodes. In certain embodiments, the methods are used to control soybean cyst nematodes (SCN), including Heterodera glycines. In additional embodiments, the methods are effective against root-knot nematodes (Meloidogyne spp.), lesion nematodes (Pratylenchus spp.), sting nematodes (Belonolaimus longicaudatus), stubby-root nematodes (Paratrichodorus spp.), com needle nematodes, or other agriculturally significant nematodes. The fungal compositions may exert their nematocidal or nematistatic activity through multiple modes ofAttorney Docket No. 103362-070W01 action, including colonization of nematode eggs, degradation or penetration of the nematode eggshell, enzymatic or biochemical damage to the nematode cuticle, suppression of egg hatching, inhibition of juvenile motility, disruption of nematode feeding, or direct killing of nematodes.

[0066] In certain embodiments, application of the compositions decreases gall formation on plant roots, reduces nematode infection levels, reduces egg density in soil, decreases the number of viable second-stage juveniles, or reduces nematode reproduction factor (Rf). In some embodiments, the methods result in suppression of nematode-induced root damage, thereby increasing root mass, enhancing nutrient uptake, improving plant vigor, increasing crop uniformity, or increasing overall yield. Treated plants may exhibit visibly improved growth characteristics compared to untreated plants under similar environmental conditions.

[0067] The compositions may be applied alone or in combination with additional biological or chemical agents. In certain embodiments, co-application with other microbial species (e.g., Bacillus spp., Paecilomyces lilacinus, Purpureocillium lilacinum) results in synergistic enhancement of nematocidal activity. In other embodiments, the compositions may be tank-mixed or co-formulated with chemical nematicides, fungicides, insecticides, herbicides, fertilizers, or seed-treatment components without loss of efficacy or stability. Co-application may broaden the spectrum of activity, improve plant performance, or enhance nematode suppression through complementary or synergistic mechanisms.

[0068] The methods described herein are applicable to any plant susceptible to nematode infection. In certain embodiments, the plant is a crop species such as soybean or com. In additional embodiments, the methods may be used for vegetables, fruits, turfgrass, ornamentals, small grains, legumes, fiber crops, bioenergy crops, or specialty crops. The compositions may be applied in field agriculture, greenhouse production, nursery operations, container systems, hydroponic systems, or soil-less media.

[0069] These methods provide growers with flexible and effective tools to manage economically damaging nematode species using naturally derived fungal agents, either as standalone treatments or as part of integrated pest management programs.

[0070] The following examples are provided to further illustrate certain embodiments of the compositions, methods, and fungal strains described herein. These examples are intended solely to demonstrate representative procedures, experimental results, and modes of practicing the invention, and should not be construed as limiting the scope of the invention in any way. Variations in materials, methods, experimental conditions, or formulation parameters may be made by those skilled in the art without departing from the spirit or scope of the invention as claimed. All references to percentages, ratios, concentrations, and volumes are by weight unlessAttorney Docket No. 103362-070W01 otherwise indicated, and all ranges expressly include any and all subranges and individual values therein. Unless otherwise specified, standard laboratory techniques, fermentation practices, and agricultural application methods known in the art may be employed.EXAMPLESExample 1: Distributions and nematophagous activity of SCN-associated fungi in a production field of Ohio

[0071] Some plant pathogens of soybean are known to follow a patchy distribution. For example, the distribution of Macrophomina phaseolina and Fusarium virguliforme in soybean fields has been described (Chong et al. 2005; Taliei et al. 2013). For F. virguliforme factors like soil pH, moisture content, and bulk density are important in their aggregation in a field, while in M. phaseolina the drivers of the aggregation are less clear (Chong et al. 2005). Some studies have also looked at the distribution and co-occurrence of fungal soybean pathogens and SCN simultaneously (Lopez-Nicora et al. 2020; Roth et al. 2019). Yet little is known about the cooccurrence and distribution of nematode antagonistic fungi and SCN in a field.

[0072] Fungi have shown promise as biological control agents (BCA) of SCN, with several species known as nematophagous having demonstrated antagonistic activity against the nematode (Haarith et al. 2020a, 2021). However, BCA discovery is often focused on known suppressive soils, which are soils that reduce pathogen damage through microbial mechanisms. The building of suppressive soils in many cases requires high pathogen pressure over a long period, where microbes antagonistic to the pathogen build up in enough abundance to cause a drop in the pathogen infection (Weller et al. 2002). Additionally, the use of a single BCA isolated from these soils often yields inconsistent success in the field where it is applied. One of the hypotheses of this inconsistency is that introduced species have a competitive disadvantage in comparison to the native soil microbiome (Kessler et al. 2003; Mazzola and Freilich 2017). Therefore, bioprospecting on the region of application is of interest, as it could better enhance its efficacy. Gaining insight into the factors that contribute to the abundance of nematophagous fungi in soybean fields is key to identifying prime locations for BCA discovery. This study also found that fields with yield-limiting levels of SCN (>600 eggs / 100 cc of soil) tend to have higher abundances of these fungi (Medina Lopez et al. 2024). The nematode parasitic fungi seem to be following their food source (i.e., SCN). This trend has been described in studies where nematophagous fungi are shown to increase in abundance at higher nematode density (Strom et al. 2020). This information could be useful in identifying suitable soybean fields for BCAAttorney Docket No. 103362-070W01 discovery. Furthermore, identifying which additional factors contribute to the abundance of different nematophagous fungi species in a field could aid in determining the likelihood of success of a BCA in specific fields or field locations.

[0073] Given the importance of understanding the drivers of spatial distribution in a field for both SCN and potential nematophagous fungi, this research had three primary objectives. First, to characterize the edaphic factors driving the abundance of SCN and potentially nematophagous fungi in Ohio soybean production fields. Second, to compare findings at the state level to the field level. Lastly, to examine the success of targeted BCA discovery in soybean fields.Materials and Methods

[0074] Site description, soil sampling, and soil analyses: During the growing season of the year 2022 a gridded experiment was set up in three producer fields in Pandora, OH. These fields are referred to as field B, field P, and field W (FIGS. 1A-1C). Field B encompassed approximately 24 hectares where 48.6% of the area was of soil series Blount silt loam, 39.8 % was of soil series Pewamo silty clay loam, 4.0% of series Glynwood loam, 5.7% of Blount-Jenera complex, and lastly 1.9% of series Shawtown loam (Soil survey staff 2024). Field P had an area of approximately 23.3 hectares, where 67% was of soil series Pewamo silty clay loam, 28.9% of Blount silt loam, and 4.1% of series Haskins loam (Soil survey staff 2024). Field W had an area of approximately 75 hectares where soil series Pewamo silty clay loam covered 44.4% of the area, Blount silt loam 32.7%, Millgrove loam 11%, Glynwood silt loam 9.3%, and soil series Digby loam 2.7% (Soil survey staff 2024). These fields were planted following a com-soybean rotation and were split into grids depending on the crop planted in 2022 (TABLE 1).These grids were of approximately 0.4 hectares for fields planted with soybean and 0.8 hectares if planted with com. This was in order to get more sampling resolution in soybean fields since soybean cyst nematode was the focus of the study. Ultimately, field B was split into 51 grids, field P into 20 grids, and field W into 21 grids. The GPS location for the center of each grid was recorded. These grids were later used as individual sampling locations. Soybean seed of variety G3151E was planted in May according to the rotation scheme (TABLE 1).Attorney Docket No. 103362-070W01 TABLE 1. SCN reproductive factor for samples collected in the years 2022 and 2023. Current crop planted at each grid is noted.Attorney Docket No. 103362-070W01Attorney Docket No. 103362-070W01Attorney Docket No. 103362-070W01

[0075] Bulk soil samples were collected at three time points, planting, soybean maturity (R7) and harvest in 2022 in all applicable grids. In 2023 soybean rhizosphere and initial bulk soil samples were taken in all applicable grids, but bulk soil samples were only collected in all grids of fields P, W, and a subset of field B (grids B7 through B8). Bulk soil was collected using a soil probe of 2.5 cm in diameter to gather 8 soil samples at a depth of 20 cm in a zig-zag pattern, 4 cores before the midpoint of the grid, and 4 after to generate a composite sample to represent the entire grid. The soil probe was cleaned with 70% ethanol between samples. Soil samples collected at planting were used to determine the edaphic factors at each grid in 2022 only. Samples were sent to Brookside labs (New Bremen, OH, USA) where their standard soil test (Code S001) was performed. Bulk soil samples collected at planting and after harvest were used to determine the initial and final SCN abundance at each grid. SCN abundance was determined by counting the number of eggs contained within 100 cm3of soil.

[0076] Bulk and rhizosphere soil samples were collected at the initial stages of soybean maturity (R7) for fungal community analysis from 2022 samples. To collect the rhizosphere soil, three plants were collected from random locations within each grid using a shovel to keep as much of the roots as possible. These samples were refrigerated until processing, which was done within 24 hours of collection. To separate the rhizosphere soil from the roots the plants were shaken until only the soil most adhered to the root remains. The soil that had fallen from the root was discarded and the soil still attached was manually removed from the root to form the rhizosphere sample. This process was done for all three plants from each grid to create a composite sample. The rhizosphere sample and a subsample of the bulk soil were freeze-dried and stored at -80°C until further processing.

[0077] High-throughput isolation of fungi from soils: Of the grids with more than 600 eggs / 100cm3of soil 10 were selected for fungal isolation (FIGS. !A-lC)in2023. This collection site target was based on findings where at these SCN abundances potentially nematophagous fungi were enriched (Medina Lopez et al. 2024). The remaining soil from the bulk sampling at soybean maturity (R7) was used for high-throughput isolation of fungi. The approach for this process was adapted from methods developed by Collado et al. to isolate fungi in leaf litter (Collado et al. 2007). Before starting, the stainless-steel vase of a blender was disinfected using 3% bleach and 70% ethanol rinsing in between solutions with sterile distilled water (dH2O). This vessel was then left in a biosafety cabinet to dry before use. Once clean, 90g of bulk soil were placed in the blender with 200 ml of sterile dH2O. This slurry was blended at the highest setting for 60 seconds. After blending the soil slurry was passed through stacked sterile metal sieves of 2 mm, 180 pm, and 75 pm (smallest aperture at the bottom). The filtrate of the bottom sieve wasAttorney Docket No. 103362-070W01 collected in a sterile 50ml tube with 30mL of sterile dkhO. The collected filtrate was shaken manually and centrifuged at 2200g for 5 minutes. After centrifuging, the supernatant was discarded, and the pellet was mixed again with 30mL of dkhO and centrifuged at the same speed. This process was repeated three times for a total of four washes. The final pellet was resuspended in 30 mL of 0.1% sterile carboxymethyl cellulose and centrifuged at 2200g for 15 minutes. After centrifugation, the supernatant was removed a last time and the remaining pellet was resuspended in 20mL of sterile 0.1% carboxymethyl cellulose. This suspension was diluted with sterile dthO in a 1 :60 ratio before plating. The carboxymethyl cellulose allows the particles in the suspension to settle more slowly; this reduces the rapid aggregation of fungal propagules at the bottom of the tube during plating (King et al. 2006).

[0078] To isolate a higher diversity of fungi, three different media were used, V8 (Dhingra and Sinclair 1987), 2% water agar, and potato dextrose agar (Rem el, Thermo Scientific, cat. # R454322), all amended with kanamycin at 100 ppm to inhibit bacterial growth. 20pl of the diluted fungal suspension were plated in five 35mm Petri dishes per media type, for a total of 165 initial plates among all soil samples. The plates were incubated at 22°C and a relative humidity of 80%. Fungal growth was assessed daily, and isolates were separated into 100mm Petri dishes with the same media type they were initially isolated on. These fungi were re-isolated as needed through hyphal tip transfer to obtain a clean, single-isolate culture. All cultures were visually assessed and separated into morphogroups, and one randomly selected fungus from each group was chosen as its morphotype. The morphotype isolates were placed in long term storage using two methods. Glycerol stocks were made by making fungal plugs from the isolates using a sterile 5.5mm cork borer. Two fungal plugs were placed on a freezer-safe sterile 1.5mL tube and covered with sterile 10% glycerol solution before storing at -80°C. As a secondary longterm storage sand stocks were prepared. These were made by pipetting 3ml of sterile dkhO onto a fresh culture of the isolates grown in a 35mm Petri dish. The surface of the culture was scraped with a sterile toothpick to mix the fungal propagules with the water before collecting ImL of suspension. The suspension was placed in an 8mL sterile tube with a screw lid containing 10g of sand. The tubes were closed and incubated at room temperature for 14 days before storing them at 8°C (Nakasone et al. 2004). The isolates remained in long-term storage until needed for further testing.

[0079] In vitro tests for extracellular enzyme production: All fungal morphotypes were tested to determine their potential as SCN antagonists. An initial screening was performed to select fungi with a higher likelihood of success at parasitizing nematode eggs. This screening measured the in vitro production of extracellular chitinases and proteases. These targets wereAttorney Docket No. 103362-070W01 chosen since research has highlighted the importance of these two groups of enzymes in the infection of nematodes by fungi (Chen et al. 2009; Sahebani and Hadavi 2008; Wei et al. 2009). To test for extracellular protease activity skim milk media was used. To prepare 500mL of media 3.38g of pre-made potato dextrose agar powder was mixed with an additional 20g of agar. Then, 50mL of reconstituted powdered skim milk prepared per the manufacturer’s instructions was added to the mix. This mix was then topped with dJ O to complete 500mL resulting in media with approximately 10% skim milk. To test for extracellular chitinase activity a colloidal chitin media was prepared. To prepare the colloidal chitin, the study followed the methods detailed by Koteshwara (2021) (Koteshwara 2021). Briefly, the method included using HC1 (35% v / v) to acidify the chitin making it more soluble in water. The acidified chitin was then filtered and washed with distilled water multiple times to slowly bring its pH up to neutral. The resulting paste was then resuspended in dH2O to make a 1% solution. This solution was then used to amend 2% water agar, resulting in 0.4% colloidal chitin media.

[0080] Both media types were autoclaved and poured into 35mm Petri dishes for later use. To test the fungi, mycelium plugs were taken from the growing edge of a fresh culture of each morphotype in the collection using a sterile 5.5mm cork borer. The plug was placed on the center of the plate. The plates were then incubated at 22°C and a relative humidity of 80%. This process was done in triplicate for each morphotype. Fungal growth was examined daily, and the formation of a halo that indicates the breakdown of chitin or casein (in the skim milk media) in the media was visually assessed. If a halo was observed the morphotype would be classified as a producer of extracellular protease or chitinase. The nematophagous fungus Purpureocillium lilacinum (USDA-ARS NRRL #895) was used as a positive control for this experiment since it has been reported to produce both extracellular enzymes and non-inoculated media was used as a negative control.

[0081] In vitro test of SCN antagonism: Morphotypes that tested positive for both chitinase and protease production and that exhibited filamentous growth in the previous assays were then tested for their success in parasitizing SCN eggs and in reducing juvenile hatching and posthatch motility. To measure fungal parasitism of nematode eggs, SCN cysts were surface sterilized before use. To clean the cysts, these were collected in a microcentrifuge tube with diluted dish soap and gently mixed in the solution for one minute to remove as much debris as possible. The dish soap solution was then removed from the tube using a micropipette. Cysts were then washed using 70% ethanol, followed by a wash in 20% bleach solution, and lastly twice with sterile dH2O to remove as much of the disinfecting solutions as possible. The clean cysts were placed on a sterile paper towel to absorb excess moisture. Using a sterile toothpickAttorney Docket No. 103362-070W01 moistened with sterile dfUO eight of the cysts were placed in a circle of 2.5cm in diameter on the center of a Petri dish with 2% water agar (Haarith et al. 2020b). In the center of the cyst circle a 5.5mm diameter fungal plug was placed to test each morphotype. The plates were incubated at 22°C with a relative humidity of 80% and examined daily. Once the edge of the fungal growth had reached the cysts on the plate, they were incubated for an additional week before removing the cysts from the Petri dish for further analysis. This was repeated in triplicate for each fungus tested. As positive controls for this assays, two nematophagous fungi were used Purpureocillium lilacinum (USDA-ARS NR.R.L #895), and Metarhizium brunneum (USDA-ARS NRRL #1944). The time at which the fungal growth reached the cysts differed between isolates.

[0082] The eight cysts from each antagonism plate were randomly assigned to be assessed in one of two ways; to determine the level of fungal colonization of eggs, or to test the fungi’s effect on nematode hatching and post-hatching motility. For each test, the cysts were collected in a microcentrifuge tube with 50pl of sterile dkhO and crushed using a clean micro-pestle to release the eggs. To determine the level of fungal colonization of SCN eggs, five 5 pl drops of the egg suspension were placed in a microscope slide using a micropipette. These drops were inspected for fungal parasitism using a light microscope at 40x to count the number of eggs and lOOx to evaluate the presence of fungal structures within the eggs. The fungal parasitism of eggs on each sample was calculated using the average proportion of eggs parasitized from all 5 l drops examined. Fungal effects on SCN hatching and post-hatching motility were measured by first counting the number of eggs on the suspensions prepared as detailed above. Once the total number of eggs in the sample was determined, they were then placed in hatching chambers. These hatching chambers were made using a tightly woven cloth (Jo-Ann fabric, item #400014317666) that allows for the nematode juveniles to pass through, but not the nematode eggs. This cloth was cut into circles and glued in between two 4 cm segments of a 50mL conical tube to hold the mesh in place in a beaker filled with dkhO. The mesh always was in contact with the water to ensure that the nematodes did not dry out and were able to move from the top of the mesh to the water in the beaker. The nematode eggs were left to hatch for a week, after which the number of juveniles in the water was counted to determine the proportion of hatched eggs with juveniles that moved through the mesh into the water.

[0083] DNA extraction and sequencing of fungi: Genomic DNA was extracted from the frozen subsamples of bulk and rhizosphere soil of a subset of grids in field B (B9.l-B9.12). The NucleoSpin Soil DNA extraction kit by TakaraBio (San Jose, CA, USA, Catalog #: 740780) was used per the manufacturer’s instructions. The DNA obtained from these samples was submitted to the Ohio State University’s Molecular and Cellular Imaging Center for library preparation andAttorney Docket No. 103362-070W01 sequencing of the ITS2 region of the rDNA using Illumina MiSeq. Along with a negative control which was a DNA extraction reaction run with sterile dH2O and ATCC’s My cobiome Genomic DNA Mix (MSA-1010) as a positive control. The fungal isolates selected for nematode antagonism assays were also sequenced to define their taxonomic identifications. Fresh fungal cultures grown in 35mm Petri dishes with full-strength potato dextrose agar were scraped using a sterile toothpick to collect mycelium in a microcentrifuge tube. The tubes were then filled with lOOpl of an extraction solution made in-house composed of IM Tris, KC1, EDTA, and dELO which is filter sterilized before use. The samples were macerated in the extraction solution using a sterile micropipette tip and incubated at room temperature for 10 minutes. After, the samples were incubated for another 10 minutes at 95°C. Lastly, lOOpl of 3% bovine serum albumin were added to the samples. These samples were then used to perform a PCR of the ITS region using the ITS IF and ITS4 primers (Gardes and Bruns 1993; White 1990). PCR products were cleaned using the illustra™ ExoProStar 1-Step cleanup kit (Fisher scientific, cat. no. 45-002-292) per the manufacturer’s instructions. The clean PCR product was submitted to the Ohio State University’s comprehensive cancer center for Sanger sequencing of the rDNA ITS region.

[0084] Bioinformatic pipeline: Sequencing results obtained from the Illumina MiSeq sequencing of the bulk and rhizosphere soils were processed using DADA2 (Callahan et al.2016). Extraction of the ITS region was not needed since only the ITS2 region was sequenced in this project. Only the forward read of the sequencing run was used due to poor overlap of the forward and reverse sequences. After Amplicon sequence variant (ASV) inference, the UNITE database (version 9.0) was used to assign taxonomy to the reads (Abarenkov et al. 2023). The results of the Sanger sequencing from the fungal isolates were processed using QIAGEN’s CLC sequence viewer to examine the sequencing traces, align the forward and reverse sequences, trim low-quality portions of the reads, and generate a consensus sequence. The consensus sequences were then run through NCBI’s BLAST tool, and through UNITE’s massBLASTer tool to determine the taxonomic assignment of the fungal sequences (Abarenkov et al. 2024; Altschul et al. 1990). The taxonomic assignment was determined to the highest resolution where both databases were in agreement.

[0085] Statistical methods: Statistical analyses were performed in R 4.3.1 (R Core Team 2023). SCN reproductive factor (Rf) was calculated by dividing the final SCN abundance by the initial SCN abundance for each grid. The correlation of the edaphic factors with the Rf was calculated using Spearman’s correlation due to data non-normality for 2022 only, since edaphic factor data was not collected in 2023. This analysis was performed using the correlation package (Makowski et al. 2020). Fungal communities are known to change through time and with plantAttorney Docket No. 103362-070W01 developmental stages (Han et al. 2017). Since only a subset of the soil samples at soybean maturity could be included in the fungal community analysis, the final SCN abundance was used to split them into groups. The final SCN abundance data from this subset was assessed for normality of the difference, and one outlier was found (B9.9). This outlier was removed, and the mean abundance was used as the cut-off between high and low final SCN abundance. To confirm that this cutoff was appropriate, a paired t-test was performed between the initial and final SCN abundance of the samples in the groups. This test was performed using the “t.test” function of the stats package of base R (R Core Team 2023). Principal component analysis of the soil fungal communities was performed using the “ord calc” function of the microViz package (Barnett et al. 2021). The fungal community data was centered log-ratio transformed before PCA analysis to reduce the likelihood of false positives (Armstrong et al. 2022). The statistical significance of the PCA was calculated through PERMANOVA using the “adonis2” function of the vegan package (Oksanen et al. 2013). Core community analysis was performed using the “core m embers” function of the microbiome package with a limit of detection of 0.001 relative abundance and 95% prevalence (Lahti and Shetty 2017). Indicator species analysis was done with the interspecies package (Caceres and Legendre 2009). To assess the correlation of nematophagous fungi with edaphic factors the fungal community data was filtered to retain only genera that had been reported as nematophagous in the literature (Haj Nuaima et al. 2021; Jiang et al. 2017; Lopez -Llorca et al. 2008; Pires et al. 2022; Pokhare et al. 2024). Although Fusarium is reported as having nematode parasitic species this genus was excluded due to the wide range of lifestyles the species in this group can have. Correlation analysis of edaphic factors with nematophagous fungi was done using the “variable correlation heatmap” function of the phylosmith package using the Spearman correlation method (Smith 2019). Graphs were made with ggplot2, and maps were made with ArcGIS (Wickham 2016).Results

[0086] SCN abundance in producer fields: SCN abundance was measured at the beginning and end of the growing season for a total of 92 grids in 2022 and 56 grids in 2023. Of the grids assessed in 2022, 20 were on field P where initial SCN abundance ranged from 0 to 1080 eggs per 100cm3of soil, while final abundance ranged from 0 to 2760 eggs per 100cm3of soil. In field B, 51 grids were evaluated which had initial SCN egg abundances ranging from 40 to 14360 eggs per 100cm3of soil, and a final abundance range of 120 to 10040 eggs per 100cm3of soil. In field W, 21 grids were assessed, and these had a range of initial nematode abundance of 0 to 6760 SCN eggs per 100cm3of soil, while final abundance was between 0 and 4080 eggs per 100cm3. Of the grids sampled in 2023, 15 were in field B where initial SCN abundance rangedAttorney Docket No. 103362-070W01 from 120 to 9160 eggs per 100cm3of soil, and final abundance ranged from 320 to 6120 eggs per 100cm3of soil. All 20 grids from field P were also sampled. These grids had an initial SCN abundance range of 0 to 2040 eggs per 100cm3of soil and a final SCN abundance range of 0 to 1920 eggs per 100cm3of soil. Lastly, Field W which was sampled in its entirety (21 grids) had an initial SCN abundance range of 0 to 3640 eggs per 100cm3of soil and final SCN abundances of ranging from 0 to 2440 eggs per 100cm3of soil. All SCN abundances measured are summarized in TABLE 2. Nematode abundance was unevenly distributed across the fields. The formation of “hotspots” was seen in all fields tested. For example, grids B9.8 and B9.9 had higher SCN abundance than adjacent locations. The same can be seen for grid Pl 1 in field P, and grid W14 in field W (FIGS.2A-2C).TABLE 2. SCN initial and final abundance per year of sampling on every grid (units are on eggs per 100cm3of soil).Attorney Docket No. 103362-070W01Attorney Docket No. 103362-070W01Attorney Docket No. 103362-070W01

[0087] SCN reproduction factor correlations with edaphic factors: SCN reproduction factor is a metric that represents the relative change in the nematode population over a set period, in this case, the growing season. This is calculated by dividing the final nematode population by the initial nematode population. If the Rf is higher than 1 the nematode population has increased while the opposite is true for Rf lower than 1. The study investigated whether edaphic factors influenced Rf, which could explain the aggregate nature of nematode infestation in a field. The study performed a correlation analysis to determine the effect of edaphic factors on the reproduction factor of SCN. In this analysis, the study included 15 factors that are commonly part of routine soil testing of agricultural soils (TABLE 3). No statistically significant correlations were found between the tested edaphic factors and nematode Rf.TABLE 3. Results of Spearman correlation analysis of nematode reproduction factor (Rf) with edaphic factors (n=56) for 2022 samples.Attorney Docket No. 103362-070W01

[0088] Fungal community composition at different levels of SCN abundance: The study aimed to determine if any of the findings described were consistent at smaller spatial scales, in this case at the field level. However, the grids in this study had SCN abundances that were not evenly distributed across the SCN scale, for example, only 7 samples out of 56 would fall in the Low SCN abundance category. Instead of following the same scale, the mean of the SCN egg counts at maturity was used to group samples into the categories of high abundance, and low abundance. To do so, the final SCN abundance of all samples was evaluated. Samples form plot B9 with final abundance higher than the mean in 2022 (SCN final abundance= 1833 eggs per 100cm3of soil) were classified as having high abundance while samples with final SCN abundance lower than the mean were classified as having low abundance (TABLE 2). To confirm that this selection was appropriate a paired t-test was performed comparing the initial population to the final population after separating the samples into the high and low abundance groups. Samples in the high abundance group had a significant increase in nematode population by the last sampling point (P=0.01392), while samples in the low abundance did not (FIGS.2A-2C, P= 0.4908).

[0089] Changes in fungal community composition associated with differences in abundance were evaluated. A subset of soil and rhizosphere samples from field B, samples B9.1 to B9.12 were sequenced to determine the bulk and rhizosphere soil fungal community composition. Through a principal component analysis supported by PERMANOVA, it was found that the fungal community composition of bulk soil was significantly different between samples with different levels of SCN abundance (FIG. 3A, P= 0.0322). However, this was not the case for rhizosphere soil, where SCN abundance had no statistically significant influence on the fungal community, although clustering can be seen (FIG.3B, P= 0. 7581). Core community analysis of bulk soil also revealed a total of 35 core community members. Of these, 16 ASVs were sharedAttorney Docket No. 103362-070W01 community members among all samples, 3 were core members of the samples with high SCN abundance, and 16 were core members of samples with low abundance (FIG. 4).

[0090] Nematophagous fungi and their association with SCN abundance and edaphic conditions: To understand some of the drivers of the distribution and abundance of potentially nematophagous fungi in the study area, the study extracted the results of known nematophagous genera from the sequencing dataset for further study. The subset was generated by searching for 12 genera known to have nematophagous species, these were: Pleurotus, Trichoderma, Melarhizium. Arthrobotrys, Monacrosporium, Purpureocillium, Dactylella, Orbilia, Stagonospora, Exophiala, Chaetomium, and Clonostachys (Haj Nuaima et al. 2021; Jiang et al.2017; Lopez-Llorca et al. 2008; Pires et al. 2022; Pokhare et al. 2024). The subset was used to perform an indicator species analysis to identify ASVs that were associated with high or low SCN abundance. ASV3, a Clonostachys sp. was associated with high SCN abundance (P= 0.01) while ASV659 Monacrosporium sp. was associated with low SCN abundance (P= 0.04, FIG.5).

[0091] It was also of interest to understand what edaphic factors could influence the abundance of potentially nematophagous fungi in a field. The study performed a Spearman correlation analysis of edaphic factors with nematophagous fungi abundance using all 15 edaphic factors measured in the experiment. From the measured factors, only three were significantly associated with the abundance of at least one genus of nematophagous fungi (P<0.05). These edaphic factors were organic matter, potassium, and soluble sulfur (FIG. 6). In grids with high SCN abundance ASV3, which was classified as Clonostachys rosea was significantly negatively correlated with all three edaphic factors. ASV10 Metarhizium anisopliae was correlated positively with organic matter in grids with low SCN abundance. ASV260 Purpureocillium lilacinum was negatively correlated with potassium in grids with high SCN abundance and positively correlated with soluble sulfur in grids with low SCN abundance. In contrast AS VI 9 Stagonospora heterodereae was negatively correlated with soluble sulfur in grids with high SCN abundance.

[0092] Isolation and nematophagous activity of fungi from highly infested soil: 11 bulk soil samples were selected from locations with high SCN abundance (>600 eggs per 100cm3of soil) in the sampled plots. Five from field B and five from field P, and one from field W. From these soils, a total of 619 isolates were obtained through a high throughput fungal isolation method. These isolates were visually assessed to separate them into morphogroups based on their macroscopic morphology. A total of 264 morphogroups were formed and one isolate from each group was randomly selected as the morphotype for the group. All the morphotypes were testedAttorney Docket No. 103362-070W01 for extracellular protease production, except for 25 isolates that could not be recovered from long-term storage. Of the tested isolates 129 could produce extracellular proteases and 110 did not exhibit protease production in the assay. Of the samples that tested positive to protease, 71 could also produce extracellular chitinase while 58 could not. The 71 isolates that tested positive for the production of both extracellular enzymes were separated into groups based on their morphology, only those that exhibited filamentous growth at 22° C were tested in nematode antagonism assays. This was due to methodological challenges in plate-based assays given the differences in the patterns of yeast-like growth when compared to filamentous growth. Ultimately, 30 isolates met the requirements to be tested directly against SCN of which 15 have been evaluated (FIG. 7).

[0093] An egg colonization assay was performed to assess the isolates’ ability to penetrate SCN cysts and eggshells. This was done by observing eggs under the microscope and determining the proportion of eggs colonized by each isolated. An example of how fungal colonization of eggs can look like is shown in FIG. 8. Of the isolates tested five colonized a significant percent of eggs (FIG. 9, P<0.01). These isolates were NC.184, NC.244, NC.261, NC.359, and NC.423. Interestingly, the positive controls did not significantly colonize SCN eggs when compared to the negative control (which had zero colonization). A hatching and motility assay was also done to determine if fungal colonization or influence on the SCN eggs significantly reduced nematode hatching rate and post-hatching motility. In this assay 8 of the tested isolates significantly reduced hatching and post-hatch motility as measured by the number of nematodes that could hatch and move through the hatching mesh (FIG. 10, P<0.01). These isolates were NC.184, NC.244, NC.261, NC.297, NC.311, NC.374, NC.423, and NC.480. Furthermore, both positive controls M. brunneum and P. lilacinum also exhibited a significant reduction in SCN hatching and motility in this assay, compared to the negative control. All fungi tested against the nematode were also sequenced to determine their taxonomic identification. These isolates were classified as belonging to the genera Trichoderma, Pseudozyma, Penicillium, Gibellulopsis, and Plectosphaerella, while five of the isolates were classified as Clonostachys, two as Melarhizium. and two as Fusarium. A summary of these results can be seen in TABLE 4Attorney Docket No. 103362-070W01 TABLE 4. Taxonomic assignment of isolates tested in colonization, and hatching and motility assays.Discussion

[0094] SCN Rf was not significantly correlated with edaphic factors: The study found no significant correlations between the edaphic factors measured and SCN Rf (Table 3.2). This was surprising since several edaphic factors are associated with increased nematode abundance in a field. Soil pH has often been found to be positively correlated with higher SCN abundances. For example, a 2009 study that evaluated the effect of different soil characteristics on nematode population densities found that SCN egg density at harvest was higher as pH increased (Rogovska et al. 2009). Similarly, a different study found that SCN cysts were more abundant in infested field soil at pH of 6.5 and 7.5 than at a pH of 5.5 (Anand et al. 1995). This same trend was also found in a gridded experiment with a similar setup to ours (Pedersen et al. 2010). It is important to highlight that other studies looked at the relationship of pH with initial and final nematode populations and not Rf. Both approaches were tested in this experiment, yet only weak correlations were found for initial and final populations (Initial population R2= 0.06, P=0.03539; Final population R2= 0.15, P=0.0184), and no significant correlation was found with Rf. TheAttorney Docket No. 103362-070W01 effect of pH on Rf has not been extensively studied directly, although given the amount of evidence that shows the correlation between pH and nematode abundance Rf should follow the same trend. However, the study found this to not be the case in these fields. The pH of the soil in the grids of the study area ranged from 4.9 to 7.5 and followed a normal distribution. It is possible that this study lacked a range of pH that was wide enough to capture the correlation between SCN abundance and pH at this sampling resolution. Other edaphic factors have been studied concerning their influence on SCN abundance, but none have yielded results as consistent as the effect of pH.

[0095] Soil texture is another important edaphic factor that influences SCN reproduction, in general, sandier soils are more conducive to higher nematode reproduction (Avendano et al.2004; Koenning et al. 1988). The fields in this study had soils with a high silt content, which would lead to less SCN reproduction than in sandier soil. Another possible explanation as to why soil pH did not appear to have a significant effect on nematode Rf is that at the scale measured, soil texture is a stronger driving factor of SCN reproduction overwhelming any effect of pH. Clay content is known to influence the buffering capacity of the soil (Aitken et al. 1990). Including the clay content of the soil in future experiments at this fine scale could help determine if the effect of pH on SCN reproduction can be influenced by the influence of soil texture on soil buffering capacity.

[0096] Fungal community composition differed between levels of SCN abundance: The study saw significant differences in fungal community composition at different SCN abundance levels in bulk soil, but not in rhizosphere soil (FIGS. 3A-3B). Differences in fungal community composition were found at different levels of SCN infestation in bulk soil. Although a slightly different approach was used to group samples by nematode abundance, several findings were consistent between studies. In this study, the core community analysis of the gridded fields shared several of the core genera identified in the survey experiment. These were Mortierella, Clonostachys, Didymella, Corynespora, Gibellulopsis, Exophiala, and Plectosphaerella. Three of the core ASVs in this study also matched the same reference as other core members. These were ASV3 which matched Clonostachys rosea, ASV4 identified as Mortierella minulissima, and AS VI 1 which matched Corynespora cassiicola. Although the sequencing used in this study does not provide enough resolution to confidently establish taxonomic assignments beyond the genus level, it shows some consistency between studies.

[0097] Research on fungal communities associated with SCN in the soil is limited, but studies done on other microbe groups provide information about patterns in microbial community composition shifts. A study done on bacteria showed that SCN infection changedAttorney Docket No. 103362-070W01 bacterial community composition in both bulk and rhizosphere soil (Hussain et al. 2018). A different study also found that SCN females select for fungal communities that are different from those selected into the plant’s rhizoplane, potentially leading to changes in the rhizosphere fungal community (Strom et al. 2019). This study did not find a significant effect of SCN abundance on the rhizosphere fungal community. This may be the case due to the small sample size since, although not statistically significant, sample clustering can be seen in the PCA ordination of the rhizosphere fungal community composition (FIGS. 3A-3B). In general the spatial scales at which microbial communities are studied are known to influence the relative importance of different environmental factors on these communities (Chaudhary et al. 2022). Studies of soil fungal communities at reduced spatial scales are still limited (in contrast to global and continental patterns). In agricultural soils, crop roots exert significant selective pressure on the microbial communities of the soil, producing distinct microbial assemblies in the rhizosphere when compared to the communities of the bulk soil (Goss-Souza et al. 2020; Zhang et al. 2018). This study was performed at the within-field scale where the dissimilarity of fungal communities is already reduced when compared to differences between fields (Seaton et al. 2023). Hence the relative importance of plant-driven and environmental factors is enhanced (Chaudhary et al.2022). This paired with the small sample size in this study may contribute to the lack of statistically significant influence of the nematode on rhizosphere fungal communities.

[0098] Nematophagous fungi correlated with some edaphic factors: Two potentially nematophagous fungi were identified as indicator species for high and low SCN abundance (FIG. 5). Clonostachys was an indicator species for grids with high SCN abundance, which is consistent with results where Clonostachys was significantly enriched at high SCN abundance. When compared, the ASV from this analysis matched with the Clonostachys ASV identified as significantly different in the previous differential network analysis (ASV3 in the current data set, with ASV148 in the previous data set, 100% identity match, 35% Query cover). On the other hand, Monacrosporium SN S identified as an indicator of low SCN abundance, although this genus did not stand out as significantly influenced by SCN abundance, it matched ASV9082 from this previous data set (99.11% identity match, 97% query cover). Clonostachys" nematophagous strategy has not been extensively described, but it has been demonstrated that this fungus can produce conidia that stick to the nematode to kill it and colonize it, in a process that can take around two days (Zhang et al. 2008). The exact mechanism by which this fungus kills nematodes is still unclear, however, the members of the Closnotachys genus are known for their production of chitinases, proteases, and fungal cell wall degrading compounds (Sun et al.2020). Moreover, a serine protease produced by this fungus has been characterized and canAttorney Docket No. 103362-070W01 degrade nematode cuticles (Li et al. 2006). On the other hand, several members of the Monacrosporium genus create adhesive traps that immobilize the nematode (Heintz and Pramer 1972; Khan et al. 2006; Liu and Zhang 1994). These differences in antagonism strategy could potentially account for their identification as indicator species at different levels of SCN abundance. Clonostachys infection strategy allows the nematode to continue moving through the soil and potentially reproduce before being killed. The same cannot be said about Monacrosporium which immobilizes the fungus upon contact. This indicator species analysis could also be just showing preferences in environmental factors that may influence both nematode and nematophagous fungi abundance.

[0099] Edaphic factors are important in determining the distribution of nematophagous fungi in the soil (Gray 1985). Through correlation analysis of nematophagous fungi with the measured edaphic factors, it was found that fungal ASV differed in their correlation with edaphic factors (FIG. 6). Two fungi were significantly correlated with soil organic matter in opposing directions at different levels of SCN abundance. Soil organic matter is known to be positively correlated with nematode abundance (van den Hoogen et al. 2019). Although SCN abundance specifically was not correlated with organic matter in this study at the scale measured, nematophagous fungi can feed on many other nematodes within agricultural soils. Some nematophagous fungi have predatory strategies that can be density-dependent, and slightly selective to different nematodes (Gray 1983, 1985; Jaffee et al. 1993). It appears that the differences in correlation with organic matter at different levels of SCN abundance is related to the density of the soil nematode community at large and the fungal parasitic strategy. Nematophagous fungi with higher prey selectivity may have a competitive disadvantage at high levels of soil organic matter against nematophagous fungi with more generalist predation. This is because higher levels of organic matter favor nematodes with fast-growing life strategies (r-strategists) (Quist et al. 2019). Potassium was also negatively correlated with two nematophagous fungi at high SCN abundance. Potassium has been identified as being positively correlated with the abundance of nematophagous fungi in soil (Gray 1988). At low SCN abundance this same trend is observed, although not statistically significant. This correlation is inverted and statistically significant for some fungi at high SCN abundance. These results suggest that the correlation of potassium with nematophagous fungi may change with shifts in the nematode community. There have been no correlations found in the literature between soluble sulfur and nematophagous fungi abundance in soils. However, studies done on soil fungal and nematode communities have shown that sulfur additions can influence the community assembly of these groups. Thus the correlations observed between soil soluble sulfur and potentially nematophagous ASV may be related to direct effectsAttorney Docket No. 103362-070W01 on the fungal community or to indirect effects through changes in the soil nematode community (Wu et al. 2021; Zhang et al. 2021). It would be interesting to examine the relevance of the correlation found in this study in the ecology and distribution of nematophagous fungi in field soil. In general, these findings can help guide the selection of potential biocontrol agent applications to fields where these are more likely to succeed. However, more studies are needed on the ecology of nematophagous fungi as it relates to their correlation with edaphic factors before accurate recommendations can be made.

[0100] A targeted isolation approach may facilitate the discovery of indigenous nematophagous fungi from SCN conducive soils: Soil from grids with high nematode abundance (>600 eggs / 100cm3of soil) was used in a high throughput isolation approach resulting in over 600 fungal isolates recovered (FIG. 7). Of the isolates tested for extracellular production of proteinase and chitinase, 27% were found to produce both enzyme types (FIG. 7).67% of the isolates from this group tested to date have shown colonization of eggs and / or reduction of hatching and post-hatch motility in SCN (FIG.9 and FIG. 10). This high proportion of isolates showing antagonism against the nematode after selection using protease and chitinase assays is congruent with research that has shown a significant correlation between the extracellular production of these enzymes and nematode parasitic activity (Szabo et al. 2013; Van Nguyen et al. 2007; Wei et al. 2009). During these assays, the study also included two positive controls that are known nematode antagonists Purpureocillium linacinum and Metarhizium brunneum (Khoja et al. 2021; Parajuli et al. 2014). Interestingly P. linacinum which is known to colonize nematode eggs did not exhibit significant egg parasitism. Both fungi, however, were effective in reducing nematode hatching and post-hatch motility. These findings support the use of classic bioassays of extracellular enzyme production for the initial selection of isolates with biocontrol potential against nematodes. Yet, these experiments also highlight the importance of measuring fungal antagonism towards nematodes using methods that account for different antagonism strategies.

[0101] Assays that examine egg parasitism will only identify fungi with egg-parasitic activity. Another drawback of this approach is the visibility of hyphae within eggs. Although a fungus may be parasitizing the eggs at high rates it may not be apparent through visualization only using light microscopy. In this case, a hatching and motility assay can help identify fungi that colonize eggs and are hard to visualize, or that do not colonize nematode eggs but can produce nematotoxic metabolites that reduce nematode hatching and motility. If this experiment had not included the latter, the study would have failed to identify five isolates that did not appear to colonize eggs but that were effective in reducing hatching and post-hatch nematode motility.Attorney Docket No. 103362-070W01

[0102] The isolates that showed significant antagonism against SCN in egg colonization, and hatching and post-hatch motility assays were identified as belonging to the genera Trichoderma, Melarhizium. Clonostachys, and Pseudozyma (TABLE 4). All of these genera except for Pseudozyma are known nematode antagonists (Khoja et al. 2021; Szabo et al. 2013; Zhang et al.2008). However, members of the Metarhizium genus (NC.244) have not been reported to colonize nematode eggs in literature. Instead, the mechanism of antagonism is thought to be primarily related to the production of nematotoxic volatile compounds, so finding an isolate from this genus that can colonize eggs was surprising (Khoja et al. 2021). Pseudozyma is a genus of yeast that has been studied for the biocontrol potential of some of its members against plant pathogenic fungi (Marchand et al. 2009). Though, this fungus has never been reported as a nematode antagonist its activity against the nematode is not necessarily surprising. Fungi with activity against nematodes can also exhibit antagonism against other fungi, this is the case for some of the genera described here like Clonostachys and Trichoderma (Sun et al. 2020). This is likely due to overlapping antagonistic mechanisms that are useful in the parasitism of both nematodes and fungi, like the production of extracellular chitinases and proteases (Sun et al.2020). Further exploring the potential mechanism of the Pseudozyma isolate found to have potential for SCN antagonism is of interest.

[0103] The following patents, applications and publications as listed below and throughout this document are hereby incorporated by reference in their entirety herein.Attorney Docket No. 103362-070W01 Reference ListAbarenkov, K., et al. 2024. The UNITE database for molecular identification and taxonomic communication of fungi and other eukaryotes: sequences, taxa and classifications reconsidered. Nucleic Acids Research 52:D791-D797.Abarenkov, K., et al. 2023. UNITE general FASTA release for Fungi.Aitken, R., et al. 1990. Lime requirement of acidic Queensland soils. I. Relationships between soil properties and pH buffer capacity. Soil Res. 28:695.Altschul, S. F., et al. 1990. Basic local alignment search tool. Journal of Molecular Biology 215:403-410.Anand, S. C., et al. 1995. Effect of Soil Temperature and pH on Resistance of Soybean to Heterodera glycines. JNematol 27:478-482.Aijoune, Y., et al. 2022. Soybean cyst nematode detection and management: a review. Plant Methods 18:110.Armstrong, G., et al. 2022. Applications and Comparison of Dimensionality Reduction Methods for Microbiome Data. Frontiers in Bioinformatics 2.Avendano, F., et al. 2004. The Spatial Distribution of Soybean Cyst Nematode in Relation to Soil Texture and Soil Map Uni. Agronomy Journal 96:181-194.Avendano, F., et al. 2003. Geostatistical Analysis of Field Spatial Distribution Patterns of Soybean Cyst Nematode. Agronomy Journal 95:936-948.Bandara, A. Y., et al. 2020. Dissecting the economic impact of soybean diseases in the United States over two decades. PLoS ONE 15:e0231141.Barnett, D., et al. 2021. micro Viz: an R package for microbiome data visualization and statistics. JOSS 6:3201.Caceres, M. D., and Legendre, P. 2009. Associations between species and groups of sites: indices and statistical inference. Ecology 90:3566-3574.Callahan, B. J., et al. 2016. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13:581-583.Chaudhary, V. B., et al. 2022. Fungal Dispersal Across Spatial Scales. Annual Review of Ecology, Evolution, and Systematics 53:69-85.Attorney Docket No. 103362-070W01 Chen, L.-L., et al. 2009. Characterization and gene cloning of a novel serine protease with nematicidal activity from Trichoderma pseudokoningii SMF2. FEMS Microbiology Letters 299:135-142.Chong, S.-K., et al. 2005. Mapping soybean sudden death syndrome as related to yield and soil / site properties. Soil and Tillage Research 84:101-107.Collado, J., et al. 2007. High-throughput culturing of fungi from plant litter by a dilution-to-extinction technique: High-throughput culturing of fungi from plant litter. FEMS Microbiology Ecology 60:521-533.Dhingra, O. D., and Sinclair, J. B. 1987. Basic plant pathology methods. 4. pr. Boca Raton; Flor: CRC Press, Inc.Gardes, M., and Bruns, T. D. 1993. ITS primers with enhanced specificity for basidiomycetes -application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.Goss-Souza, D., et al. 2020. Ecological Processes Shaping Bulk Soil and Rhizosphere Microbiome Assembly in a Long-Term Amazon Forest-to- Agri culture Conversion. Microb Ecol 79:110-122.Gray, N. F. 1985. Ecology of nematophagous fungi: Effect of soil moisture, organic matter, pH and nematode density on distribution. Soil Biology and Biochemistry 17:499-507.Gray, N. F. 1988. Ecology of nematophagous fungi: Effect of the soil nutrients N, P and K, and seven major metals on distribution. Plant Soil 108:286-290.Gray, N. F. 1983. Ecology of nematophagous fungi .Panagrellus redivivus as the target organism. Plant Soil 73:293-297.Haarith, D., et al. 2020a. Fungal communities associated with Heterodera glycines and their potential in biological control: a current update. Journal of Nematology 52:1-17.Haarith, D., et al. 2021. Growth chamber and greenhouse screening of promising in vitro fungal biological control candidates for the soybean cyst nematode (Heterodera glycines'). Biological Control 160:104635.Haarith, D., et al. 2020b. In vitro Screening of a Culturable Soybean Cyst Nematode Cyst Mycobiome for Potential Biological Control Agents and Biopesticides. Phytopathology™ 110:1388-1397.Attorney Docket No. 103362-070W01 Haj Nuaima, R., et al. 2021. Fungi isolated from cysts of the beet cyst nematode parasitized its eggs and counterbalanced root damages. J Pest Sci 94:563-572.Han, L.-L., et al. 2017. Temporal dynamics of fungal communities in soybean rhizosphere. J Soils Sediments 17:491 498.Heintz, C. E., and Pramer, D. 1972. Ultrastructure of Nematode-Trapping Fungi. Journal of Bacteriology 110:1163-1170.van den Hoogen, J., et al. 2019. Soil nematode abundance and functional group composition at a global scale. Nature 572:194-198.Hussain, M., et al. 2018. Bacterial community assemblages in the rhizosphere soil, root endosphere and cyst of soybean cyst nematode-suppressive soil challenged with nematodes. FEMS Microbiology Ecology 94:fiyl42.Jaffee, B. A., et al. 1993. Tests for Density-Dependent Parasitism of Nematodes by Nematode-Trapping and Endoparasitic Fungi. Biological Control 3:329-336.Jiang, X., et al. 2017. Nematode-Trapping Fungi. Microbiology Spectrum 5:10.1128 / microbiolspec. funk-0022-2016.Kessler, P., et al. 2003. The effect of application time and soil factors on the occurrence of Beauveria brongniartii applied as a biological control agent in soil. Journal of Invertebrate Pathology 84:15-23.Khan, A., et al. 2006. Infection of plant-parasitic nematodes by Paecilomyces lilacinus and Monacrosporium lysipagum. Biocontrol 51:659-678.Khoja, S., et al. 2021. Volatiles of the entomopathogenic fungus, Metarhizium brunneum. attract and kill plant parasitic nematodes. Biological Control 152:104472.King, G. W., et al. 2006. Automated Agar Plate Streaker: A Linear Plater on Society for Biomolecular Sciences Standard Plates. J Biomol Screen 11:704-711.Koenning, S. R., et al. 1988. Effect of Within-field Variation in Soil Texture on Heterodera glycines and Soybean Yield. J Nematol 20:373-380.Koteshwara, A. 2021. Simple Methods for the Preparation of Colloidal Chitin, Cell Free Supernatant and Estimation of Laminarinase. Bio-protocol 11.Lahti, L., and Shetty, S. 2017. microbiome.Attorney Docket No. 103362-070W01 Li, J., et al. 2006. Purification and characterization of an extracellular serine protease from Clonostachys rosea and its potential as a pathogenic factor. Process Biochemistry 41:925-929. Liu, X.-Z., and Zhang, K.-Q. 1994. Nematode-trapping species oiMonacrosporium with special reference to two new species. Mycological Research 98:862-868.Lopez-Llorca, L. V., et al. 2008. Mode of Action and Interactions of Nematophagous Fungi. In Integrated Management and Biocontrol of Vegetable and Grain Crops Nematodes, eds. A. Ciancio and K. G. Mukerji. Dordrecht: Springer Netherlands, pp. 51-76.Lopez -Nicora, H. D., et al. 2020. Evaluation of the Combined Effect of Heterodera glycines and Macrophomina phaseolina on Soybean Yield in Naturally Infested Fields with Spatial Regression Analysis and in Greenhouse Studies. Phytopathology™ 110:406-417.Makowski, D., et al. 2020. Methods and Algorithms for Correlation Analysis in R. JOSS 5:2306. Marchand, G., et al. 2009. Identification of Genes Potentially Involved in the Biocontrol Activity of Pseudozyma flocculosa. Phytopathology™ 99: 1142-1149.Mazzola, M., and Freilich, S. 2017. Prospects for Biological Soilbome Disease Control: Application of Indigenous Versus Synthetic Microbiomes. Phytopathology™ 107:256-263. McCarville, M. T., et al. 2017. Increase in Soybean Cyst Nematode Virulence and Reproduction on Resistant Soybean Varieties in Iowa From 2001 to 2015 and the Effects on Soybean Yields. Plant Health Progress 18:146-155.Medina Lopez, M., et al. 2024. Fungal communities shift with soybean cyst nematode abundance in soils. Phytobiomes Journal.Nakasone, K. K., et al. 2004. Preservation and distribution of fungal cultures. Biodiversity of fungi 37-47.Niblack, T. 2005. Soybean cyst nematode management reconsidered. Plant disease 89:1020- 1026.Niblack, T. L., et al. 2008. Shift in Virulence of Soybean Cyst Nematode is Associated with Use of Resistance from PI 88788. Plant Health Progress 9:29.Oksanen, J., et al. 2013. Package ‘vegan.’ Community ecology package, version 2:1-295. Parajuli, G., et al. 2014. Improving suppression of Meloidogyne spp. by Purpureocillium lilacinum strain 251.Attorney Docket No. 103362-070W01 Pedersen, P., et al. 2010. Correlation between Soil pH, Heterodera glycines Population Densities, and Soybean Yield. Crop Science 50:1458-1464.Pires, D., et al. 2022. The Fight against Plant-Parasitic Nematodes: Current Status of Bacterial and Fungal Biocontrol Agents. Pathogens 11 : 1178.Pokhare, S. S., et al. 2024. Fungal Biocontrol Agents for Nematode Management in Organic Agriculture. In Sustainable Management of Nematodes in Agriculture, Vol.2: Role of Microbes- Assisted Strategies, eds. Kamal Kishore Chaudhary, Mukesh Kumar Meghvansi, and Sazada Siddiqui. Cham: Springer International Publishing, pp. 183-206.Quist, C. W., et al. 2019. Spatial distribution of soil nematodes relates to soil organic matter and life strategy. Soil Biology and Biochemistry 136:107542.R Core Team. 2023. R: A Language and Environment for Statistical Computing.Rogovska, N. P., et al. 2009. Soybean Yield and Soybean Cyst Nematode Densities Related to Soil pH, Soil Carbonate Concentrations, and Alkalinity Stress Index. Agronomy Journal 101:1019-1026.Roth, M. G., et al. 2019. Predicting Soybean Yield and Sudden Death Syndrome Development Using At-Planting Risk Factors. Phytopathology™ 109:1710-1719.Sahebani, N., and Hadavi, N. 2008. Biological control of the root-knot nematode Meloidogyne javanica by Trichoderma harzianum. Soil Biology and Biochemistry 40:2016-2020.Seaton, F. M., et al. 2023. Soil bacterial and fungal communities show within field heterogeneity that varies by land management and distance metric. Soil Biology and Biochemistry 177: 108920. Smith, S. 2019. phylosmith.Soil survey staff. 2024. Web Soil Survey.Strom, N., et al. 2019. Continuous Monoculture Shapes Root and Rhizosphere Fungal Communities of Com and Soybean in Soybean Cyst Nematode-Infested Soil. Phytobiomes Journal 3:300-314.Strom, N., et al. 2020. Com and Soybean Host Root Endophytic Fungi with Toxicity Toward the Soybean Cyst Nematode. Phytopathology™ 110:603-614.Sun, Z.-B., et al. 2020. Biology and applications of Clonostachys rosea. Journal of Applied Microbiology 129:486-495.Attorney Docket No. 103362-070W01 Szabo, M., et al. 2013. Comparative gene expression profiles of Trichoderma harzianum proteases during in vitro nematode egg-parasitism. Biological Control 67:337-343.Taliei, F., et al. 2013. Spatial Distribution of Macrophomina phaseolina and Soybean Charcoal Rot Incidence Using Geographic Information System (A Case Study in Northern Iran). Journal of Agricultural Science and Technology 15:1523-1536.Van Nguyen, N., et al. 2007. The role of chitinase from Lecanicillium antillanum B-3 in parasitism to root-knot nematode Meloidogyne incognita eggs. Biocontrol Science and Technology 17:1047-1058.Wang, J., et al. 2003. Soybean Cyst Nematode Reduces Soybean Yield Without Causing Obvious Aboveground Symptoms. Plant Disease 87:623-628.Wei, B.-Q., et al. 2009. A novel screening strategy to identify biocontrol fungi using protease production or chitinase activity against Meloidogyne root-knot nematodes. Biocontrol Science and Technology 19:859-870.Weller, D. M., et al. 2002. Microbial populations responsible for specific soil suppressiveness to plant pathogens. Annu. Rev. Phytopathol. 40:309-348.White, T. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A guide to methods and applications / Academic Press, Inc. Wickham, H. 2016. ggplot2: elegant graphics for data analysis. Second edition. Switzerland: Springer.Wu, Y., et al. 2021. Long-term nitrogen and sulfur deposition increased root-associated pathogen diversity and changed mutualistic fungal diversity in a boreal forest. Soil Biology and Biochemistry 155:108163.Zhang, A., et al. 2021. Sulfur deposition changed the community structure of soil nematodes by affecting omnivores-predators. Science of The Total Environment 771:144912.Zhang, B., et al. 2018. Co-occurrence patterns of soybean rhizosphere microbiome at a continental scale. Soil Biology and Biochemistry 118:178-186.Zhang, L., et al. 2008. Investigation on the infection mechanism of the fungus Clonostachys rosea against nematodes using the green fluorescent protein. Appl Microbiol Biotechnol 78:983-990.Attorney Docket No. 103362-070W01 SEQUENCESSEQ ID NO: 1 (ITS region of NC.184) TCTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGC GGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAAC TGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTNGCAGCCCCGGAACCAGGCGCC CGCCGGAGGGNCCAACCAAACTCTTTNNGTAGTCCCCTCGCGGACGTTATTTCTTA CAGCTCTGANCAAAAATTCAAAATGNATCAAAACTTTCAACAACGGATCTCTTGGT TCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAAT TCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTNTGGCGGGC ATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGG GATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCC GCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCNCCGNGNNCNCGGCGCGTCC ACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATAC CCGCTGAACTTAAGCATATCAT SEQ ID NO: 2 (ITS region of NC.244) TCTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGC GGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAAT TGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTTA ATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTC TTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGC AGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGG CGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGT TGGGGATCGGCGAGGCTGGTTTTCCAGCACAGCCGTCCCTTAAATTAATTGGCGGT CTCGCCGTGGCCCTCCTCTGCGCAGTAGTAAAACACTCGCAACANGNGCCCNNCG CGGTCCACTGCCGTAAAACCCCCCAACATTTTTATAGTTGACCTCGNATCAGGTAG GACTACCCGCTGAACTTAAGCATATCAAT SEQ ID NO: 3 (ITS region of NC.374) TCTTGGTCAATTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAG CGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAA TTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTTAttorney Docket No. 103362-070W01 AATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCT CTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTG CAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTG GCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTG TTGGGGATCGGCGAGGCTGGTTTTCCAGCACAGCCGTCCCTTAAATTAATTGGCGG TCTCGCCGTGGCCCTCCTCTGCGCAGTAGTAAAACACTCGCAACANGAGNNCNGC GCGGTCCACTGCCGTAAAACCCCCCAACTTTTTATAGTNNNCCTCGAATCAGGTAG GACTACCCGCTGAACTTAAGCATATCAATA SEQ ID NO: 4 (ITS region of NC.423) CTTGGTCAATTAGAGGAAGTAAAAGTCGTAACAAGGTATCTGTAGGTGAACCTGC AGATGGATCATTTCGATGAAAACCTTTTTTCTGAGGTGTGGCTCGCACCTGTCCAA CTAAACTGGGCTACCATTTTCAACACGGTTGCATCGGTTGGGCCTGTCAAGGAGTG CCATTTTGGCGCTTCGAGACGGACTCGACACTTTACACAAAACACTTTTGATGATC TAGGATTTGAATGAAAGTTCATTTTTTATGATGGAACCGACTGGTAATGCGGTCGT CTAAATCTAAGAAACAACTTTTGGCAACGGATCTCTTGGTTCTCCCATCGATGAAG AACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAAGTGAATCATCGAATCTT TGAACGCACCTTGCGCTCCCGGCAGATCTAATCTGGGGAGCATGCCTGTTTGAGGG CCGCGAATTGTTTCGAACGTCGACTTTTTTCACGAAGAGTCAACGGATCGGTATTG AGGGTCTTTGCCATTCACCGTGGCTCCCTCGAAATGCATTAGCGCATCCATTTGAT AGGCAAGACGGACGAAAGCTCGACTTTTGTTTCCTCTTTCCTGCCGGGTTTTGATA ATATCAGGACTTCGGAGGCAGAGAGGAAACNTGAGCTGGACGTAACGTTTTNCTG GTTGGANNGCNNCTNNACCCCNCCTTTTTTCGTTANGAAAGAGGATNTATTTNNAA TTCATCGGCCTCAGATTGGTAGGACTACCCGCTGAACTTAAGCATATCAATA SEQ ID NO: 5 (ITS region of NC.480) ATAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATC ATTACCGAGTTTACAACTCCCAAACCCATGTGAACATANNNNNNGTTGCTTCGGCG GGATTGCCCCGGGCGCCTCGTGTGCCCCGGATCAGGCGCCCGCCTAGGAAACTCA ACTCTTGTTTTATTTTGGAATCTTCTGAGTAGTTTTTACAAATAAATAAAAACTTTC AACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC GCCAGTATTCTGGCGGGCATGCCTGTCTGAGCGTCATTTCAACCCTCATGCCCCTA GGGCGTGGTGTTGGGGATCGGCCAAAGCCCGCGAGGGACGGCCGGCCCCTAAATCAttorney Docket No. 103362-070W01 TAGTGGCGGACCCGTCGTGGCCTCCTCTGCGAAGTAGTGATATTCCGCATCGGAGA GCGACGAGCCCCTGCCGTTAAACCCCCAACTTNCNANGGTTGACCTCAGATCAGG TAGNAATACCCGCTGAACTTAAGCATATCAA SEQ ID NO: 6 (ITS region of NC.261) TCTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGC GGAGGGATCATTACCGAGTTTACAACTCCCAAACCCATGTGAACATACCTACTGTT GCTTCGGCGGGATTGCCCCGGGCGCCTCGTGTGCCCCGGATCAGGCGCCCGCCTAG GAAACTCAACTCTTGTTTTATTTTGGAATCTTCTGAGTAGTTTTTACAAATAAATAA AAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAC ATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGAGCGTCATTTCAACCCTC ATGCCCCTAGGGCGTGGTGTTGGGGATCGGCCAAAGCCCCGCGAGGGACGGCCGG CCCCTAAATCTAGTGGCGGACCCGTCGTGGCCTCCTCTGCGAAGTAGTGATATTCC GCATCGGAGAGCGACGAGCCCCTGCCGTTAAACCCCCAACTTTCCAAGGTTGACCT CAGATCAGGTAGGAATACCCGCTGAA SEQ ID NO: 7 (ITS region of NC.297) GTATGCTTAAGTTCAGCGGGTATTCATTTCTTGGTCAATTAGAGGAAGTAAAAGTC GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACT CCCAAACCCATGTGAACATACCTACTGTTGCTTCGGCGGGATTGCCCCGGGCGCCT CGTGTGCCCCGGATCAGGCGCCCGCCTAGGAAACTCAACTCTTGTTTTATTTTGGA ATCTTCTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGT TCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAAT TCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGC ATGCCTGTCTGAGCGTCATTTCAACCCTCATGCCCCTAGGGCGTGGTGTTGGGGAT CGGCCAAAGCCCCNCGAGGGACGGCCGGCCCCTAAATCTAGTGGCGGACCCGTCG TGGCCTCCTCTGCNAAGTAGTGATATTCCGCATCGGAGAGCGACGAGCCCCTGCCG TTNAACCCCCAACTTNCNANGGTTGACCTCATATCAAGTAGGAATACCCGCTGAAC TTAAGCATATCAATAGTCGGAGGAATTGACCTCGGATCAGGTAGGAATACCCGCT GAACTTAAGCATATAAAttorney Docket No. 103362-070W01 SEQ ID NO: 8 (ITS region of NC.438) TCTTGGTCAATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTG CGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTT GTCTTGGTCAATAAGAGGAAGTAAAAGTCGTAACAAGGTATGGGTTGGTGAACCN NCGGAGGGATCATTACTGAGTACTNCACTCTNNACCCTNTGTGAANTATNATNCCT GTTGCTTCGGNNGCGCCCGCGAGGGTGCCCNCCGGNCTCATCNGAATCTCTGTTTT NNAACCNNACNATACTTNNGAGTGTTNTTAGNNAACNGTCAAAACTTTTAACAAC GGATCTCTTGNCTCCAGCATCNATGAAGANNNCNNCGAANCGCGATATGTAATGT GAATTGCANAATTCANTGAATCATNGAATCTTTGAACGCACATGGCNCCTTCCANT ATCNTGGGAGGCATGCCTGTCCNAGCGTNGTTTCAACCCTNGAGCCCCCGTGGCCC GGNGTTGGGGATNTGCCNCGGNAGGCCCCTAAAACCNNNGGCGGNCCCNAAGGC CCTCTCCTTTGNNCANNANCATCANCCTCGCATTGGGATCCCTNGGCNTCCTGCCT CNTAANACCCCCCACAAGTCCGCTCTCGNCNGCNNCCANGNTGACCTCNGATCAT GTAGGAATACCCTCTGAACTTAGGCATATCAATCATTTGTAGGAAACTGATGCAGG ATTTCACAGAGAAAAGGCCGGCAACGGTTTTGTCTCTGTCAAACTCGATCTCAAAT CAAGTAAGACTACCCGCTGAACTTAAGCATATCAATAA

Claims

Attorney Docket No. 103362-070W01 What is claimed is:

1. A composition comprising:a fungus selected from the group consisting of Trichoderma koningiopsis NC.184, Metarhizium NC.244, Clonostachys NC.261, Clonostachys NC.359, Clonostachys NC.297, unidentified Hypocreales fungus NC.311, Pseudozyma pruni NC.423, Clonostachys rosea NC.480, Metarhizium anisopliae NC.374, Plectosphaerella cucumerina NC.438, or any combination thereof; andat least one surfactant.

2. A composition comprising:an isolate, extract, or product derived from a fungus selected from the group consisting of Trichoderma koningiopsis NC.184, Metarhizium NC.244, Clonostachys NC.261, Clonostachys NC.359, Clonostachys NC.297, unidentified Hypocreales fungus NC.311, Pseudozyma pruni NC.423, Clonostachys rosea NC.480, Metarhizium anisopliae NC.374, Plectosphaerella cucumerina NC.438, or any combination thereof; andat least one surfactant.

3. The composition of claim 2, wherein the isolate, extract, or product comprises a protein, lipid, carbohydrate, small molecule, or any combination thereof.

4. The composition of any one of claims 1-3, wherein the fungus has an internal transcribed spacer (ITS) region comprising 80% similarity or more to any one of SEQ ID NOs: 1-8.

5. The composition of any one of claims 1-4, further comprising one or more additional microorganisms or compounds with nematocidal activity.

6. The composition of claim 5, further comprising a chemical nematicide.

7. A spray comprising the composition of any one of claims 1-6.

8. A powder comprising the composition of any one of claims 1-6.Attorney Docket No. 103362-070W01 9. A method of preventing, inhibiting, treating, reducing, and / or ameliorating a nematode infection in a plant, the method comprising administering the composition of any one of claims 1-6 to the plant.

10. The method of claim 9, wherein the composition is administered preventatively.

11. The method of any one of claims 9-10, wherein the composition is administered one, two, three, four, five, six, seven, eight, nine, ten, or more times.

12. A method of preventing, inhibiting, treating, reducing, and / or ameliorating a nematode infection in a plant, the method comprising administering the spray of claim 7 to the plant.

13. The method of claim 12, wherein the spray is administered preventatively.

14. The method of any one of claims 12-13, wherein the spray is administered one, two, three, four, five, six, seven, eight, nine, ten, or more times.

15. A method of preventing, inhibiting, treating, reducing, and / or ameliorating a nematode infection in a plant, the method comprising administering the powder of claim 8 to the plant.

16. The method of claim 15, wherein the powder is administered preventatively.

17. The method of any one of claims 15-16, wherein the powder is administered one, two, three, four, five, six, seven, eight, nine, ten, or more times.

18. The method of any one of claims 9-17, wherein the nematode infection is caused by soybean cyst nematodes (SCN).

19. The method of any one of claims 9-18, wherein the method causes fungal colonization of nematode eggs.

20. The method of any one of claims 9-19, wherein the method decreases nematode egg hatching and / or nematode motility.Attorney Docket No. 103362-070W01 21. The method of any one of claims 9-20, wherein the plant is soybean or corn.