Ultra-low RNA sequencing library preparations

Abstract

Aspects of the present disclosure are directed to at least methods and compositions for generating sequencing libraries from an RNA sample. The RNA sample can be a low-input or ultra-low input sample.

Description

ULTRA-LOW RNA SEQUENCING LIBRARY PREPARATIONSCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority of U.S. Provisional Application No. 63 / 725,920 filed November 27, 2024, which is hereby incorporated by reference in its entirety.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on November 26, 2025, is named ARCD.P0864WO Sequence Listing. xml and is 130,459 bytes in size.BACKGROUNDI. Field

[0003] Aspects of this disclosure relate to at least the field of molecular biology, genomics, and biochemistry.II. Background

[0004] Current single-cell sequencing technologies enable high-throughput profiling of most aspects of the chromatin state and transcription, including DNA sequence, chromatin accessibility, histone modification, and DNA modification1.

[0005] However, applications on RNA are limited, largely due to the lack of an efficient adaptor ligation method for RNA species. Single-cell profiling of the transcriptome was achieved by using the template- switch property of Moloney Murine Leukemia Virus (M- MuLV) reverse transcriptase (SMART-seq2, SMART-seq23,4) or linear amplification using T7 RNA polymerase and a T7 promoter introduced to the complementary DNA (cDNA) generated from input RNA (CEL-seq5, CEL-seq26). In the SMART-seq workflow, a template- switch oligo (TSO) and designed reverse transcription (RT) primer define the 3' and 5' ends of cDNA, enabling direct amplification by polymerase chain reaction (PCR). In the CEL-seq workflow, T7 RNA polymerase-based linear amplification enables unbiased amplification of RNA. However, the current SMART-seq workflow only work on RNA species with polyA tails and CEL-seq workflow relies on cDNA synthesis after a low-efficiency random priming. They are also both biased towards the 3' of cellular RNAs. None of the existing methods enable robust sequencing from picogram-level RNA while capturing both polyadenylated and nonpolyadenylated RNA.300594318.1 - 1 -

[0006] Thus there is a need in the art for sequencing libraries that are unbiased and complete and the methods of preparing such libraries.SUMMARY OF THE INVENTION

[0007] The present disclosure relates to sequencing libraries from input RNA and methods for preparing these sequencing libraries. In certain aspects, the methods utilize polyA tailing, template- switching reverse transcription, in vitro transcription, and / or linear amplification of RNA to generate DNA for the sequencing library. Also, the methods may not require a ribosome depletion step. Such processes can allow for the generation of sequencing libraries from low or ultra-low levels of input RNA.

[0008] Disclosed herein are methods of generating a sequencing library, methods of preparing nucleic acids for sequencing, methods of preparing a sample for sequencing, methods of detecting a transcriptomic signature, methods of sequencing ribonucleic acids (RNAs), methods of identifying RNAs bound to a protein of interest, methods of sequencing RNAs in a sample, and methods of identifying RNAs in a sample, methods for preparing a sequencing library from a population of cells, as well as any resulting collections of nucleic acids or libraries from such methods. Also disclosed are methods of analyzing RNA from a biological sample, method of analyzing RNA from a biological sample obtained from a patient, methods of detecting and / or quantifying RNA expression in a cell, methods of detecting RNA modifications in a cell, methods of detecting RNA-protein-of-interest interactions in a cell, methods of detecting RNAs that interact with a protein-of-interest in a cell, methods of detecting an RNA-protein interaction in a cell, as well as any resulting collections of nucleic acids or libraries from such methods.

[0009] The methods can comprise, comprise at least, or comprise at most 1, 2, 3, 4, or 5 of the following steps: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the plurality of RNAs; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of RNAs using:(a) primer comprising a polythymidine sequence that binds to the polyA tails of the plurality of polyadenylated RNAs and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and300594318.1 - 2 -(b) a template- switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; and generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs.In some aspects, the primer used in the generating a plurality of first strand DNA oligonucleotides does or does not comprise a polythymidine sequence. In some aspects, the primer used in the generating a plurality of first strand DNA oligonucleotides does or does not comprise a random oligonucleotide sequence. The random oligonucleotide sequence may be suitable for hybridization to unpolyadenylated RNAs. In some aspects, 1, 2, 3, or 4 of these steps are specifically excluded from the method. In some aspects, the steps are performed in the order described above. The steps may also be performed in an order differently than described above.

[0010] The methods can comprise, comprise at least, or comprise at most 1, 2, 3, 4, 5, 6, or 7 of the following steps: sorting each cell in the population of cells into separate vesicles; barcoding RNAs in each cell by incubating a nucleic acid comprising a specific barcoded unique molecular identifier in each vesicle containing a cell from the population of cells to generate a plurality of barcoded RNAs; pooling the population of cells; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of barcoded RNAs using:(a) a plurality of primers, wherein each of the primers in the plurality of primers comprises a sequence that hybridizes one of the barcoded unique molecular identifiers on the barcoded RNAs; and(b) a template- switching oligonucleotide;300594318.1 - 3 -in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; and reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) for the sequencing library.In some aspects, 1, 2, 3, 4, 5, or 6 of these steps are specifically excluded from the method. In some aspects, the steps are performed in the order described above. The steps may also be performed in an order differently than described above.

[0011] The methods can comprise, comprise at least, or comprise at most 1, 2, 3, 4, 5, 6, 7, or 8 of the following steps: end repairing and polyadenylating ribonucleic acids (RNA) in the population of cells to generate a plurality of polyadenylated RNAs in the population of cells; sorting each cell in the population of cells into separate vesicles; barcoding the plurality of polyadenylated RNAs in each cell with a specific barcoded unique molecular identifier to generate barcoded RNAs; pooling the population of cells; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of barcoded RNAs using:(a) a plurality of primers, wherein each of the primers in the plurality of primers comprises (i) a polythymidine sequence that hybridizes to the polyA tails and / or a random oligonucleotide sequence suitable for hybridization to unpolyadenylated RNAs, and (ii) a sequence that hybridizes one of the barcoded unique molecular identifiers on the barcoded RNAs; and(b) a template- switching oligonucleotide; adding a T7 promoter sequence to the plurality of first strand DNA oligonucleotides; in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; and reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) using a set of primers, wherein one primer in the set of primers contains a P7 primer and index sequence and another primer in the set of primers contains a P5 primer and index sequence.300594318.1 - 4 -In some aspects, the primer used in the generating a plurality of first strand DNA oligonucleotides does or does not comprise a polythymidine sequence. In some aspects, the primer used in the generating a plurality of first strand DNA oligonucleotides does or does not comprise a random oligonucleotide sequence. The random oligonucleotide sequence may be suitable for hybridization to unpolyadenylated RNAs. In some aspects, 1, 2, 3, 4, 5, 6, or 7 of these steps are specifically excluded from the method. In some aspects, the steps are performed in the order described above. The steps may also be performed in an order differently than described above.

[0012] The methods can comprise, comprise at least, or comprise at most 1, 2, 3, 4, 5, or 6 of the following steps: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in a biological sample; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs; and analyzing the cDNA.In some aspects, the primer used in the generating a plurality of first strand DNA oligonucleotides does or does not comprise a polythymidine sequence. In some aspects, the primer used in the generating a plurality of first strand DNA oligonucleotides does or does not comprise a random oligonucleotide sequence. The random oligonucleotide sequence may be suitable for hybridization to unpolyadenylated RNAs. In some aspects, 1, 2, 3, 4, or 5 of these steps are specifically excluded from the method. In some aspects, the steps are performed in300594318.1 - 5 -the order described above. The steps may also be performed in an order differently than described above.

[0013] The methods can comprise, comprise at least, or comprise at most 1, 2, 3, 4, 5, 6, or 7 of the following steps: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in a cell; immunoprecipitating the protein-of-interest from the cell, wherein the plurality of polyadenylated RNAs are co-immunoprecipitated with the protein of interest; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs; and analyzing the cDNA to detect the RNA-protein-of-interest interaction.In some aspects, the primer used in the generating a plurality of first strand DNA oligonucleotides does or does not comprise a polythymidine sequence. In some aspects, the primer used in the generating a plurality of first strand DNA oligonucleotides does or does not comprise a random oligonucleotide sequence. The random oligonucleotide sequence may be suitable for hybridization to unpolyadenylated RNAs. In some aspects, 1, 2, 3, 4, 5, or 6 of these steps are specifically excluded from the method. In some aspects, the steps are performed in the order described above. The steps may also be performed in an order differently than described above.

[0014] Aspects herein include methods where RNA (which may be fragmented including by magnesium-mediated fragmentation) is immunoprecipitated (including through the use of a300594318.1 - 6 -carrier) using beads. In some aspects, the RNA, while on the beads, is end-repaired and polyA tailed. In some aspects, the RNA is released from the beads and then annealed to a primer comprising a polyT sequence capable of hybridizing the polyA tail added to the RNA. In some aspects, the primer also comprises an index sequence, such as an R1 sequence. In certain aspects, the RNA is then reverse transcribed using a template-switching oligonucleotide. In some aspects, the template-switching oligonucleotide comprises one or more of a GGG polynucleotide, a unique molecular identifier polynucleotide, a template switching index sequence polynucleotide, and a sequencing index polynucleotide. In certain aspects, after the reverse transcription, a sequencing index polynucleotide, such as a T7 sequence, is added to the resulting cDNA. In some aspects, the resulting cDNA is then transcribed, such as by in vitro transcription. In some aspects, the resulting RNA is again reverse transcribed to generate a sequencing library.

[0015] In some aspects, the input RNA for methods described herein is or is not generated and / or obtained after a chemical conversion of a nucleotide (including an RNA base). In some aspects, the input RNA for methods described herein is or is not generated and / or obtained by immunoprecipitating RNA, including by immunoprecipitating a protein of interest (such as an RNA-binding protein) or immunoprecipitating an RNA modification. In some aspects, the immunoprecipitating comprises contacting the RNA and / or a protein bound to the RNA with an antibody (including an antibody bound to a bead) capable of recognizing an RNA modification and / or capable of recognizing the protein bound to the RNA. Such antibodies may be known in the art and / or able to be generated by a skilled artisan. In some aspects, the protein bound to the RNA may be a ribosome or an RNA binding protein.

[0016] In some aspects, the input RNA for method described herein is or is not generated by sorting cells from a population of cells into individual vesicles, such as individual wells in a well plate. RNA in each cell may be barcoded, including by placing uniquely barcoded primers into each individual vesicle, thereby labeling the RNA in each individual vesicle with a barcode unique to the RNA in that vesicle. Such barcoded RNA can then be pooled as the input RNA for methods described herein.

[0017] In some aspects, adding polyA tails comprises adding polyA tails to one or more of, multiple of, a majority of, or at least 75%, at least 90%, at least 99%, or all of the plurality of RNAs. In some aspects, one or more of, multiple of, a majority of, or at least 75%, at least 90%, at least 99%, or all of the plurality of polyadenylated RNAs have polyA tails.

[0018] In certain aspects, the method comprises the step of adding carriers to any of the samples or compositions described herein. In some aspects, the compositions include a carrier.300594318.1 - 7 -In some aspects, the carrier can comprise glycogen. The carrier can include an agent useful to avoid sample loss during handling of the samples, compositions, buffers, etc. described herein. The carrier can be added during any of the steps described herein, including during an immunoprecipitation step.

[0019] In certain aspects, the method comprises a pre-amplification step after first-strand DNA synthesis. The pre-amplification step can be used to i) avoid sample loss and / or ii) add a T7 promoter sequence to template DNA. This design can be useful when in vitro transcription is not required by the application or user’s discretion.

[0020] In certain aspects, the plurality of RNAs are fragmented RNAs. In certain aspects, the plurality of RNAs are from a sample that has been subject to conditions sufficient to fragment the RNAs in the sample. In certain aspects, the plurality of RNAs are RNAs isolated from a sample, and then, in certain aspects, fragmented. In certain aspects, the plurality of RNAs are fragmented by magnesium ions and / or an RNA endonuclease. In certain aspects, the method comprises fragmenting the plurality of RNAs via magnesium ions. In certain aspects, the method comprises fragmenting the plurality of RNAs via an RNA endonuclease.

[0021] Certain aspects also relate to isolation of specific RNAs, which can include or exclude immunoprecipitations of RNAs or other pull-down methods. The isolation of specific RNAs can include or exclude any of the isolations described herein. Certain steps of the methods described herein can be performed during the immunoprecipitation including endrepair of RNAs and polyadenylation of RNAs. The isolation can include isolation using beads, including magnetic beads. In some aspects, the plurality of RNAs are obtained by RNA immunoprecipitation. In some aspects, the method comprises immunoprecipitating the plurality of RNAs. In some aspects, the immunoprecipitation comprises immunoprecipitating RNA bound to an RNA binding protein. In some aspects, the immunoprecipitation comprises immunoprecipitating RNA bound to a protein of interest. In some aspects, the immunoprecipitation comprises immunoprecipitating RNA bound to a ribosome, including a captured ribosome. In certain aspects, the isolation comprises fixing RNA to a protein. In some aspects, the immunoprecipitation comprises immunoprecipitating RNA having a chemical modification, including any chemical modification described herein. In some aspects, the chemical modification is a methylation.

[0022] Certain aspects also relate to adding a polyadenylation tail to RNAs during the methods described herein. In some aspects, the step of adding polyA tails is performed or is not performed during an RNA immunoprecipitation.300594318.1 - 8 -

[0023] In certain aspects, generating a plurality of first strand DNAs includes or excludes the use of a template switching reverse transcriptase. The template switching reverse transcriptase can include a MMLV-type reverse transcriptase. In some aspects, generating a plurality of first strand DNAs is performed using one or more methods described in U.S. Pat. No. 11,959,078, which is incorporated by reference herein in its entirety. In certain aspects, employing template switching oligonucleotide (TSO) comprises a unique molecular identifier, which can be a short sequence capable of being used to identify the input DNA molecule during sequencing.

[0024] In some aspects, the template DNA is or is not pooled prior to in vitro transcribing. In some aspects, the template DNA is combined for multiplexing or not.

[0025] In some aspects, the cDNA comprises or does not comprise an index sequence. The index sequence may be a sequence capable of identifying individual cDNAs. The index sequence may or may not be flanked by other known sequences. In some aspects, the index sequence is or is not a P7 sequence and / or a P5 sequence. In some aspects, the index sequence is or is not an i7 or i5 sequence.

[0026] Certain aspects relate to generating transcribed RNA from template DNA. In certain aspects, the template DNA comprises a promoter for an RNA polymerase, such as a T7 RNA polymerase. In certain aspects, the template DNA comprises a T7 promoter sequence. In some aspects, the template DNA is generated using primers capable of incorporating the promoter sequence. In certain aspects, the transcribed RNA is in vitro transcribed from the template DNA. In certain aspects, the transcribed RNA is linearly amplified from the template.

[0027] Certain aspects relate to reverse transcribing RNA to DNA. Reverse transcription can be performed by any method, including methods disclosed herein. In some aspects, reverse transcribing the transcribed RNA comprises or does not comprise reverse-transcription polymerase chain reaction (RT-PCR).

[0028] The method can include one or more of any of the steps disclosed herein. In certain aspects, the method is performed using one or more steps disclosed in a step-by-step protocol described herein.

[0029] In some aspects, the method comprises one or more steps (or all) of the following : fragmenting ribonucleic acids (RNAs) via magnesium ions and / or RNA endonucleases to generate fragmented RNAs binding the fragmented RNAs to beads comprising an RNA-targeting protein or RNA- binding protein-targeting protein;300594318.1 - 9 -end repairing the fragmented RNAs and adding a poly adenylation tail to the fragmented RNAs to generate polyadenylated RNAs; releasing the polyadenylated RNAs from the beads to generate a plurality of polyadenylated RNAs; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) a primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, (ii) and a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; adding a T7 promoter sequence to the plurality of first strand DNA oligonucleotides through a PCR pre-amplification step; in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) using primers containing a P7 primer and index sequence and a P5 primer and index sequence; and amplifying the cDNA by polymerase chain reaction.

[0030] In some aspects, the method comprises one or more steps (or all) of the following: adding a polynucleotide kinase to first sample comprising a plurality of fragmented ribonucleic acids (RNAs) and incubating the first sample in conditions sufficient to end repair the fragmented RNAs to generate end repaired RNAs; adding an E. coli poly(A) polymerase to the first sample and incubating the sample in conditions sufficient to add a polyadenylation tail to the end repaired RNAs to generate polyA RNAs; extracting the polyA RNAs to a second sample;300594318.1 - 10 -adding template-switching oligonucleotides, a plurality of reverse-transcription primers comprising a polythymidine sequence and / or random oligonucleotide sequence and each having a unique molecular identifier, and a template switching reverse transcriptase to the second sample and incubating the second sample in conditions sufficient to reverse transcribe the polyA RNAs to generate a plurality of first strand oligonucleotides; adding sequencing library preparation reagents to the second sample to generate a plurality of second strand oligonucleotides thereby making a plurality of template DNAs, wherein the first strand and second strand oligonucleotides are complementary and wherein the template DNA comprises an RNA polymerase promoter sequence; purifying the plurality of template DNAs to a third sample; adding an RNA polymerase to the third sample and incubating the third sample in conditions sufficient to generate a plurality of transcribed RNAs from the template DNA; purifying the plurality of transcribed RNAs to a fourth sample; adding a reverse transcriptase to the fourth sample and incubating the fourth sample in conditions sufficient to reverse transcribe the plurality of transcribed RNAs; and adding sequencing library preparation reagents to the fourth sample and incubating the fourth sample in conditions sufficient to generate a library of cDNA.

[0031] In some aspects, the method comprises one or more steps (or all) of the following: incubating a polynucleotide kinase in first sample comprising a plurality of fragmented ribonucleic acids (RNAs) in conditions sufficient to end repair the fragmented RNAs to generate end repaired RNAs; incubating an E. coli poly(A) polymerase in the first sample in conditions sufficient to add a poly adenylation tail to the end repaired RNAs to generate polyA RNAs; extracting the polyA RNAs to a second sample; incubating template- switching oligonucleotides, a plurality of reverse-transcription primers comprising a polythymidine sequence and each having a unique molecular300594318.1 - 11 -identifier, and a template switching reverse transcriptase in the second sample in conditions sufficient to reverse transcribe the polyA RNAs to generate a plurality of first strand oligonucleotides; incubating sequencing library preparation reagents in the second sample to generate a plurality of second strand oligonucleotides thereby making a plurality of template DNAs, wherein the first strand and second strand oligonucleotides are complementary and wherein the template DNA comprises an RNA polymerase promoter sequence; purifying the plurality of template DNAs to a third sample; incubating an RNA polymerase in the third sample in conditions sufficient to generate a plurality of transcribed RNAs from the template DNA; purifying the plurality of transcribed RNAs to a fourth sample; incubating a reverse transcriptase to the fourth sample in conditions sufficient to reverse transcribe the plurality of transcribed RNAs; and incubating sequencing library preparation reagents to the fourth sample in conditions sufficient to generate a library of cDNA.One or more of the preceding steps may be specifically excluded from the method. In some aspects, the steps are performed in the order described above. The steps may also be performed in an order differently than described above.

[0032] In some aspects, the RNA-targeting protein or RNA-binding protein-targeting protein is an antibody. In some aspects, the RNA-targeting protein is an antibody or other protein capable of binding to RNA. In some aspects, the RNA-targeting protein is an antibody or other protein capable of binding to specific RNA. In some aspects, the RNA-targeting protein is an antibody or other protein capable of binding to an RNA modification. In some aspects, the RNA-binding protein-targeting protein is an antibody or other protein capable of binding to a protein that binds to RNA.

[0033] In some aspects, a carrier, such as glycogen, is or is not added during any of the steps of the method.

[0034] The library preparation reagents can comprise a DNA polymerase (which may be a high fidelity polymerase), aptamers, buffers, and / or other reagents for amplifying template300594318.1 - 12 -DNA for a DNA sequencing library. In certain aspects, the library preparation reagents do no comprise one or more of DNA polymerase (which may be a high fidelity polymerase), aptamers, buffers, and / or other reagents for amplifying template DNA for a DNA sequencing library. In certain aspects, the library preparation reagents do or do not comprise magnesium acetate, Tris acetate buffer, and / or DNA polymerase. In certain aspects, the library preparation reagents do or do not comprise one or more reagents in an NEBNext® Ultra™ II Q5® Master Mix. In some aspects, the library preparation reagents do or do not comprise enzymes and buffers required to amplify the plurality of first strand oligonucleotides to double stranded DNA comprising a T7 promoter sequence.

[0035] In some aspects, cDNA generated from one of the methods described herein is analyzed. In some aspects, the analyzing comprises sequencing the cDNA.

[0036] Certain aspects relate to sequencing the cDNA generated from the methods disclosed herein. In some aspects, the method comprises sequencing the cDNA. In some aspects, the method does nor comprise sequencing the cDNA. The sequencing can be performed using known sequencing methods including Illumina-based sequencing methods.

[0037] Certain aspects relate to methods that can avoid ribosome RNA depletion steps. Accordingly, certain aspects allow for low-input or ultra low-input of RNA to begin the method. In certain aspects, the plurality of RNA is or is at least, at most, or approximately 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or any range derivable therein, nanograms of total RNA. In certain aspects, the plurality of RNA is or is at least, at most, or approximately 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or any range derivable therein, nanograms of total RNA. In certain aspects, a sample of aspects herein comprises or comprises at least, at most, or approximately 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or any range derivable therein, nanograms of total RNA. In some aspects, the method does not comprise a ribosome RNA depletion step. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0038] In some aspects, the method comprises adding a polynucleotide kinase buffer (such as lOx T4 PNK buffer A with SUPERase ln™ RNase Inhibitor (Invitrogen®, AM2696)) and a T4 Polynucleotide Kinase (PNK, Thermo Scientific, EK0031) to input RNA in a sample. In300594318.1 - 13 -some aspects, the method comprises shaking the resulting mixture at a temperature of or of at least, at most, or approximately 35 °C, 36 °C, 37 °C, 38 °C, or 39 °C (or any range derivable therein) for or for at least, at most, or approximately 10, 20, 30 minutes (or any range derivable therein) at a speed of or of at least, at most, or approximately 400, 500, 600, 700, 800 rpm (or any range derivable therein). In certain aspects, the method comprises adding additional T4 PNK with ATP, where the ATP is at a concentration of or of at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM (or any range derivable therein). In some aspects, the method comprises shaking the resulting mixture at a temperature of or of at least, at most, or approximately 35 °C, 36 °C, 37 °C, 38 °C, or 39 °C (or any range derivable therein) for or for at least, at most, or approximately 10, 20, 30, 40, 50, or 60 minutes (or any range derivable therein). In some aspects, the PNK is heat inactivated at temperature of or of at least, at most, or approximately 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 °C (or any range derivable therein) for or for at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes (or any range derivable therein) thereby generating a heat-inactivated mixture. It is also contemplated that, in certain aspects, one or more of the above steps (including any of the adding, shaking, and / or heat inactivation steps) is specifically excluded from the method.

[0039] In certain aspects, sodium chloride (which may be at a concentration of or of at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 M (or any range derivable therein), an E. coli poly (A) polymerase, and an RNase inhibitor are added to the heat-inactivated mixture. In certain aspects, the mixture is shaken at a temperature of or at least, at most, or approximately 35 °C, 36 °C, 37 °C, 38 °C, or 39 °C (or any range derivable therein) for or for at least, at most, or approximately 10, 20, 30 minutes (or any range derivable therein) at a speed of or of at least, at most, or approximately 400, 500, 600, 700, 800 rpm (or any range derivable therein). In certain aspects, EDTA, which can be at a concentration of or of at least, at most, or approximately 200, 300, 400, 500, 600, 700, or 800 mM (or any range derivable therein) is added to quench the reaction. In certain aspects, the resulting RNA is extracted. In some aspects, the RNA is extracted pull-down beads such as Dynabeads™ MyOne™ Silane. The extracted RNA can be eluted in water. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0040] In certain aspects, the template- switching reverse transcription (RT) is performed using Template Switching RT Enzyme Mix (NEB, M0466S). In some aspects, oligo(dT) RT primers with well-specific barcodes for multiplexing purposes are used during the template switching RT. In some aspects, barcoded unique molecular identifier (UMI) containing TSv5,300594318.1 - 14 -which can comprise the following elements from the 5' to the 3', 5'-abasic site spacer- Illumina read 2 sequence-TSO barcode hexamer-random hexamer UMI-rGrGrG-3', are used as the template-switching oligo (TSO). In certain aspects, the following components are assembled in a vessel (which can be a PCR strip): RNA or a lysed cell (which may include the plurality of RNAs), RT primer (which may be at a concentration of or of at least, at most, or approximately 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 mM (or any range derivable therein)), and a dNTP mixture (which may be at a concentration, individually or combined, of or of at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM (or any range derivable therein)) to generate an RNA mixture. In some aspects, the RNA mixture is incubated for or for at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes (or any range derivable therein) at a temperature of or of at least, at most, or approximately 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 °C (or any range derivable therein). The RNA mixture can then be chilled on ice. In certain aspects, a TSO (which may be at a concentration of or of at least, at most, or approximately 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 pM (or any range derivable therein)), a buffer compatible with a reverse transcriptase, and a template switching reverse transcriptase are added to the RNA mixture and mixed to generate a reverse transcriptase reaction mixture. In some aspects, the reverse transcriptase reaction mixture is incubated at a temperature of or of at least, at most, or approximately 38, 39, 40, 41, 42, 43, 44, 45, or 46 °C (or any range derivable therein), for 90 minutes (or any range derivable therein) and then incubated at a temperature of or of at least, at most, or approximately 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, or 95 °C (or any range derivable therein) for or for at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 minutes (or any range derivable therein). The resulting template switched mixture can then be held at temperature of or at least, at most, or approximately 4 °C. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0041] In certain aspects, a pre-amplification step is performed, which may be done a hot- start polymerase mix, such as NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544). In some aspects, the pre-amplification step comprises adding one or more (or all) of water, a Q5 master mix, a forward primer (which may be V4_Amp_F) and a reverse primer (which may be V4_Amp_R) to the template switched mixture. In some aspects, the pre-amplification step comprises a cycling step using the following parameters: 98 °C for 30 seconds and 5 cycles of approximately 98 °C for 30 seconds then 58 °C for 20 seconds then 72 °C for 20 seconds with300594318.1 - 15 -the 5 cycles followed by 72 °C for 2 minutes, then hold the resulting pre-amplified mixture at 4 °C. The parameters (such as the temperature, number of cycles, or cycling time) may be adjusted based on the primers, polymerase, buffers, or other reaction conditions used. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0042] In some aspects, the resulting pre-amplified mixture is purified. The purification may include one or more purification steps using an 0.8x AMPure XP Reagent (Beckman Coulter®, A63880). The purified pre-amplification mixture can be eluted in water. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0043] In some aspects, the purified pre-amplification mixture is pool DNAs together. The pooled DNA can be used for multiplexing in some aspects. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0044] In some aspects, the method comprises performing in vitro transcription reaction using a T7 RNA polymerase. In some aspects, the method comprise assembling an in vitro transcription reaction at approximately room temperature comprising a DNA template (which may be the purified pre-amplification mixture), a reaction buffer, a NTP mix (which may be at a concentration, individually or combined, of or of at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 mM (or any range derivable therein)), an RNase inhibitor, and a T7 RNA polymerase. In some aspects, the resulting mixture is incubated at a temperature of or of at least, at most, or approximately 34, 35, 36, 37, 38, 39, 40 °C (or any range derivable therein) for or for at least, at most, or approximately 10, 11, 12, 13, 14, or 15 hours (or any range derivable therein) with lid temperature set to a temperature of or of at least, at most, or approximately 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 °C (or any range derivable therein). The resulting mixture can then be held at a temperature of or of at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 °C (or any range derivable therein). It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0045] In some aspects, after the in vitro transcription reaction is complete, a DNase is added to the reaction mixture. The reaction mixture with the DNase can be incubate at a temperature of or of at least, at most, or approximately 34, 35, 36, 37, 38, 39, or 40 °C (or any range derivable therein) for or for at least, at most, or approximately 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 minutes (or any range derivable therein).300594318.1 - 16 -The resulting transcribed RNA can then be purified, including by using silane beads. The purified transcribed RNA can be eluted in water. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0046] In some aspects, the method comprises performing an RT-PCR on the transcribed RNA to generate a DNA library, which may be used for sequencing. In some aspects, the RT- PCR step comprises performing RT-PCR with SuperScript™ III Reverse Transcriptase (Invitrogen, 18080093). In some aspects, the RT-PCR step comprises mixing a sequencing index containing PCR primer, which can be any in R501_v3-R508_v3 or R701_v3-R704_v3 (which can be at a concentration of or of at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM (or any range derivable therein)), a dNTP mixture (which may be at a concentration, individually or combined, of or of at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 mM (or any range derivable therein)), and RNA purified from the in vitro transcription reaction, which is the last step. In some aspects, the reaction mixture is incubated at a temperature of or of at least, at most, or approximately 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 °C for or for at least, at most, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 minutes (or any range derivable therein) and then immediately chilled on ice. In some aspects a buffer is added, which may be a 5x FS buffer, including DTT (which may be at a concentration of or of at least, at most, or approximately 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1,0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 M (or any range derivable therein), a ribonuclease inhibitor (including a RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen, 10777019)), and a reverse transcriptase, which can be a SSuperScript III reverse transcriptase (Invitrogen, 18080093). In some aspects, the resulting mixture is incubated at a temperature of or at least, at most, or approximately 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 °C for or for at least, at most, or approximately 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 minutes (or any range derivable therein) at a temperature of or of at least, at most, or approximately 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 °C for or for at least, at most, or approximately 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes (or any range derivable therein). The resulting cDNA mixture can be held at approximately 4 °C. A qPCR may be performed on the resulting cDNA. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.300594318.1 - 17 -

[0047] In some aspects, a final PCR is performed, which may be done a hot- start polymerase mix, such as NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544). In some aspects, the final PCR step comprises adding one or more (or all) of water, a Q5 master, and primers (which may be mix R50X_v3 / R70X_v3) to the cDNA mixture. In some aspects, the final PCR comprises a cycling step using the following parameters: 98 °C for 30 seconds and 5 cycles of approximately 98 °C for 30 seconds then 58 °C for 20 seconds then 72 °C for 20 seconds with the 5 cycles followed by 72 °C for 2 minutes. The parameters (such as the temperature, number of cycles, or cycling time) may be adjusted based on the primers, polymerase, buffers, or other reaction conditions used. In some aspects, the resulting DNA is purified, which may be done using lx AmPure XP beads. The purified DNA can be eluted in water. The DNA libraries are now ready for sequencing, which may be any sequencing including an Illumina-based sequencing. It is also contemplated that, in some aspects, one or more of the above steps is specifically excluded from the method.

[0048] Certain aspects relate to preparation and / or analysis of RNA, including methods using the RNAmp workflow described herein, where the RNA is obtained from a cell, biological sample, or a patient. In some aspects, the RNA, cell, and / or biological sample is obtained from a patient that has or has not received a therapy. In some aspects, the cell is or is not a tumor cell, a neuron, or a cell from an organ transplant. In some aspects, the cell is a cell of interest from a patient, such a cell from a tissue from a patient. In some aspects, the cell is from a cell population obtained from a tumor, organ, or lesion from a patient. In some aspects, the biological sample is or is not a biopsy. In some aspects, the biopsy is a fine-needle aspirate. In certain aspects, the biopsy comprises dissected tissue obtained from a patient. Certain aspects relate to preparation and / or analysis of RNA, including methods using the RNAmp workflow described herein, where the RNA is cell-free RNA. In some aspects, the cell-free RNA is or is not cell-free mRNA, circulating microRNA, circulating tRNA, circulating rRNA, or extracellular vesicle-associated RNA. In some aspects, the cell-free RNA is or is not from blood, plasma, serum, cerebrospinal fluid, or urine from a patient.

[0049] In some aspects, the patient has, does not have, is or is not suspected of having, or is or is not diagnosed with having a disease. The disease may be a cancer, a neurological disease, an autoimmune disease, an infection, or another disease associated with aberrant gene expression and / or RNA modifications. In some aspects, the patient has or has not received a transplant, including an organ transplant. In some aspects, the patient has or has not received a therapy. In some aspects, a method described herein is performed before, during, and / or after receiving the therapy. The RNAs analyzed during or via a method described herein are300594318.1 - 18 -analyzed before, during, and / or after a therapy to determine the effects and / or effectiveness of the therapy.

[0050] In certain aspects, one or more of the steps of the disclosure are repeated. In certain aspects, one or more of the purification steps are repeated. In certain aspects, one or more of the steps disclosed herein are specifically excluded from the method.

[0051] Also disclosed are kits comprising one or more reagents for performing any of the methods described herein. In some aspects, the kit comprises one or more (or all) of: reagents for end repairing and reagents for adding a polyadenylation tail to fragmented RNA; reagents for template-switching reverse transcribing polyadenylated RNA; sequencing library preparation reagents; in vitro transcription reagents; and reagents for reverse transcription polymerase chain reaction (RT-PCR).

[0052] In some aspects, one or more components of the kit are specifically excluded. In some aspects, the reagents for end repairing comprise a polynucleotide kinase and one or more buffers compatible with the polynucleotide kinase. In certain aspects, the buffers compatible with the polynucleotide kinase comprise or do not comprise reagents, ions, or other compounds needed for polynucleotide kinase function, including a buffering agent (such as Tris-HCl), potassium chloride (or other suitable salts), DTT, EDTA, and / or ATP. In some aspects, the reagents for adding a polyadenylation tail comprise an E. coli poly(A) polymerase and one or more buffers compatible with the polymerase. In certain aspects, the buffers compatible with the poly(A) polymerase comprise reagents, ions, or other compounds needed for polynucleotide kinase function, including a buffering agent (such as Tris-HCl), sodium chloride and / or magnesium chloride (or other suitable salts), and / or ATP.

[0053] In some aspects, the reagents for template-switching reverse transcribing polyadenylated RNA comprise: a plurality of primers having a polythymidine sequence and each having a unique molecular identifier; a template switching oligonucleotide; a template-switching reverse transcriptase; and one or more buffers compatible with the reverse transcriptase.

[0054] In certain aspects, the template switching oligonucleotide (TSO) comprises an rGrGrG sequence at the 3’ end of the oligonucleotide (where rG is riboguanosine). In certain aspects, the TSO comprises an R2 sequence, a TSO index sequence, a unique molecular300594318.1 - 19 -identifier. The R2 sequence can be GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 1). The TSO index sequence can beGTTCAGACGTGTGCTCTTCCGATCTTACGATNNNNNNrGrGrG (SEQ ID NO: 2). In certain aspects, the reagents for template-switching reverse transcribing polyadenylated RNA include those described in U.S. Pat. No. 11,959,078.

[0055] In certain aspects, the sequencing library preparation reagents comprise any of the sequencing library preparation reagents disclosed herein. In certain aspects, the library preparation reagents comprise a DNA polymerase and primers sufficient to amplify template DNA. In certain aspects, the in vitro transcription reagents comprise any of the in vitro transcription reagents disclosed herein. In certain aspects, the in vitro transcription reagents comprise an RNA polymerase and one or more buffers compatible with the RNA polymerase. In certain aspects, the RNA polymerase is or is not a T7 RNA polymerase. In certain aspects, the reagents for RT-PCR comprise any of the reagents for RT-PCR disclosed herein, including a reverse transcriptase and one or more buffers compatible with the reverse transcriptase. It is also contemplated that, in certain aspects, one or more of the sequencing preparation library reagents are specifically excluded from a mixture.

[0056] In some aspects, the conditions to produce cDNA comprises, consists, or consists essentially of (i) providing the sample with a reverse transcription (RT) reaction mixture, and (ii) halting RT. In some aspects, the RT reaction mixture comprises, consists, or consists essentially of at least one primer, dNTPs, and other components. In some aspects, the at least one primer comprises, consists, or consists essentially of an adapter-RT primer fused to random RT primers. In some aspects, the random RT primers are not hexamers. In some aspects, the random RT primers comprise, consist, or consist essentially of at least septamers, octamers, nonamers, decamers, undecamers, dodecamers, tridecamers, tetradecamers, pentadecamers, hexadecamers, heptadecamers, octadecamers, nonadecamers, or eicosamers. In some aspects, the adapter-RT primer is at a concentration of or of at least, at most, or approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 pM, including any range or value derivable therein.

[0057] In some aspects, the buffer described herein does or does not comprise a carrier, such as glycogen, which can, in some aspects, stabilizer compositions, nuclease acids, binding interactions, or other components in the buffer. In some aspects, components of a buffer described herein comprise, consist, consist essentially of, or do not comprise a non-competitive inhibitor of pancreatic-type ribonucleases, a buffer, and / or MgCh. In some aspects, the non-300594318.1 - 20 -competitive inhibitor of pancreatic-type ribonucleases comprise, consist, consist essentially of, or do not comprise at least, at most, approximately, or do or do not comprise 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 U / pl RNaseOUT, including any range or value derivable therein. In some aspects, the buffer comprise, consist, consist essentially of, or do not comprise or comprise at least, at most, or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 pl of DPBS, including any range or value derivable therein. In some aspects, the MgCh is at a concentration of or of at least, at most, or approximately 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 mM, including any range or value derivable therein.

[0058] Also disclosed are one or more of the following enumerated Aspects: Aspect 1. A method of generating a ribonucleic acid (RNA)-sequencing library from a sample comprising a plurality of RNAs, the method comprising: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the plurality of RNAs; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template-switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; and generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs.Aspect 2. The method of Aspect 1, wherein the plurality of RNAs are fragmented by magnesium ions.300594318.1 - 21 -Aspect 3. The method of Aspect 1 or 2, further comprising fragmenting the plurality of RNAs via magnesium ions.Aspect 4. The method of any one of Aspects 1 to 3, wherein the plurality of RNAs are obtained by RNA immunoprecipitation.Aspect 5. The method of any one of Aspects 1 to 3, further comprising immunoprecipitating the plurality of RNAs.Aspect 6. The method of Aspect 4 or 5, wherein the immunoprecipitation comprises immunoprecipitating RNA bound to an RNA binding protein.Aspect 7. The method of Aspect 4 or 5, wherein the immunoprecipitation comprises immunoprecipitating RNA bound to a protein of interest.Aspect 8. The method of Aspect 4 or 5, wherein the immunoprecipitation comprises immunoprecipitating RNA bound to a ribosome.Aspect 9. The method of Aspect 4 or 5, wherein the immunoprecipitation comprises immunoprecipitating RNA having a chemical modification.Aspect 10. The method of Aspect 9, wherein the chemical modification is a methylation and / or a pseudouridine.Aspect 11. The method of any one of Aspects 1 to 10, wherein the step of adding polyA tails is performed during an RNA immunoprecipitation.Aspect 12. The method of any one of Aspects 1 to 11, wherein the template DNA is pooled prior to in vitro transcribing.Aspect 13. The method of any one of Aspects 1 to 12, wherein the cDNA comprises an index sequence.Aspect 14. The method of Aspect 13, wherein the index sequence is a P7 sequence and / or a P5 sequence.Aspect 15. The method of any one of Aspects 1 to 14, wherein the reverse transcribing the transcribed RNAs comprises reverse-transcription polymerase chain reaction (RT-PCR).Aspect 16. A method comprising the steps of: fragmenting ribonucleic acids (RNAs) via magnesium ions to generate fragmentedRNAs300594318.1 - 22 -binding the fragmented RNAs to beads comprising an RNA-targeting protein or RNA-binding protein-targeting protein; end repairing the fragmented RNAs and adding a polyadenylation tail to the fragmented RNAs to generate polyadenylated RNAs; releasing the polyadenylated RNAs from the beads to generate a plurality of polyadenylated RNAs; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) a primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, (ii) and a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; adding a T7 promoter sequence to the plurality of first strand DNA oligonucleotides; in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) using primers containing a P7 primer and index sequence and a P5 primer and index sequence; and amplifying the cDNA by polymerase chain reaction.Aspect 17. A method comprising the steps of: adding a polynucleotide kinase to first sample comprising a plurality of fragmented ribonucleic acids (RNAs) and incubating the first sample in conditions sufficient to end repair the fragmented RNAs to generate end repaired RNAs; adding an E. coli poly(A) polymerase to the first sample and incubating the sample in conditions sufficient to add a polyadenylation tail to the end repaired RNAs to generate polyA RNAs; extracting the polyA RNAs to a second sample; adding template- switching oligonucleotides, a plurality of reverse-transcription primers comprising a polythymidine sequence and each having a unique molecular300594318.1 - 23 -identifier, and a template switching reverse transcriptase to the second sample and incubating the second sample in conditions sufficient to reverse transcribe the polyA RNAs to generate a plurality of first strand oligonucleotides; adding sequencing library preparation reagents to the second sample to generate a plurality of second strand oligonucleotides thereby making a plurality of template DNAs, wherein the first strand and second strand oligonucleotides are complementary and wherein the template DNA comprises an RNA polymerase promoter sequence; purifying the plurality of template DNAs to a third sample; adding an RNA polymerase to the third sample and incubating the third sample in conditions sufficient to generate a plurality of transcribed RNAs from the template DNA; purifying the plurality of transcribed RNAs to a fourth sample; adding a reverse transcriptase to the fourth sample and incubating the fourth sample in conditions sufficient to reverse transcribe the plurality of transcribed RNAs; and adding sequencing library preparation reagents to the fourth sample and incubating the fourth sample in conditions sufficient to generate a library of cDNA.Aspect 18. A method for preparing a sequencing library from a population of cells, the method comprising the steps of: sorting each cell in the population of cells into separate vesicles; barcoding RNAs in each cell by incubating a nucleic acid comprising a specific barcoded unique molecular identifier in each vesicle containing a cell from the population of cells to generate a plurality of barcoded RNAs; pooling the population of cells; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of barcoded RNAs using:(a) a plurality of primers, wherein each of the primers in the plurality of primers comprises a sequence that hybridizes one of the barcoded unique molecular identifiers on the barcoded RNAs; and(b) a template- switching oligonucleotide;300594318.1 - 24 -in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; and reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) for the sequencing library.Aspect 19. A method for preparing a sequencing library from a population of cells, the method comprising the steps of: end repairing and polyadenylating ribonucleic acids (RNA) in the population of cells to generate a plurality of polyadenylated RNAs in the population of cells; sorting each cell in the population of cells into separate vesicles; barcoding the plurality of polyadenylated RNAs in each cell with a specific barcoded unique molecular identifier to generate barcoded RNAs; pooling the population of cells; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of barcoded RNAs using:(a) a plurality of primers, wherein each of the primers in the plurality of primers comprises (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, (ii) and a sequence that hybridizes one of the barcoded unique molecular identifiers on the barcoded RNAs; and(b) a template- switching oligonucleotide; adding a T7 promoter sequence to the plurality of first strand DNA oligonucleotides; in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; and reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) using a set of primers, wherein one primer in the set of primers contains a P7 primer and index sequence and another primer in the set of primers contains a P5 primer and index sequence.Aspect 20. The method of Aspect 19, further comprising fixing cells in the population of cells before the end repairing step.300594318.1 - 25 -Aspect 21. The method of Aspect 19 or 20, further comprising permeabilizing the population of cells prior to the end repairing step.Aspect 22. The method of any of Aspects 18 to 21, further comprising conjugating the population of cells to beads prior to the sorting step.Aspect 23. The method of Aspect 22, wherein the beads comprise concanavalin A beads.Aspect 24. The method of any one of Aspects 18 to 23, further comprising immunoprecipitating a protein of interest from the plurality of cells.Aspect 25. The method of Aspect 24, wherein the protein of interest is an RNA-binding protein.Aspect 26. The method of any one of Aspects 18 to 25, wherein the population of cells are obtain from a patient.Aspect 27. The method of any one of Aspects 18 to 26, wherein the population of cells are obtained from a biopsy.Aspect 28. The method of any one of Aspects 1 to 27, further comprising sequencing the cDNA.Aspect 29. The method of any one of Aspects 1 to 28, wherein the method does not comprise a ribosome RNA depletion step.Aspect 30. A method of analyzing RNA from a biological sample obtained from a patient, the method comprising: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the biological sample; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA;300594318.1 - 26 -generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs; and analyzing the cDNA.Aspect 31. The method of Aspect 30, wherein the biological sample comprises cell-free RNA.Aspect 32. The method of Aspect 32, wherein the cell-free RNA comprises cell-free mRNA, circulating microRNA, circulating tRNA, circulating rRNA, or extracellular vesicle- associated RNA.Aspect 33. The method of any one of Aspects 30 to 32, wherein the biological sample comprises blood, plasma, serum, cerebrospinal fluid, or urine.Aspect 34. The method of any one of Aspects 30 to 32, wherein the biological sample comprises a biopsy.Aspect 35. The method of Aspect 34, wherein the biopsy is a fine-needle aspirate biopsy.Aspect 36. The method of Aspect 34 or 35, wherein the biopsy is a tumor biopsy, an organ biopsy, or a lesion biopsy.Aspect 37. A method of detecting and / or quantifying RNA expression in a cell and / or detecting RNA modifications in a cell, the method comprising: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the cell; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template-switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA;300594318.1 - 27 -generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs; and analyzing the cDNA to detect and / or quantify RNA expression in the cell and / or detect RNA modifications in the cell.Aspect 38. A method of detecting RNA-protein-of-interest interactions in a cell, the method comprising: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the cell; immunoprecipitating the protein-of-interest from the cell, wherein the plurality of polyadenylated RNAs are co-immunoprecipitated with the protein of interest; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template-switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs; and analyzing the cDNA to detect the RNA-protein-of-interest interaction.Aspect 39. The method of any one of Aspects 30 to 38, wherein the analyzing comprises sequencing the cDNA.Aspect 40. A kit comprising one or more reagents for performing the method of any one of Aspects 1 to 39.300594318.1 - 28 -Aspect 41. A kit comprising reagents for end repairing and reagents for adding a polyadenylation tail to fragmented RNA; reagents for template- switching reverse transcribing polyadenylated RNA; sequencing library preparation reagents; in vitro transcription reagents; and reagents for reverse transcription polymerase chain reaction (RT-PCR).Aspect 42. The kit of Aspect 41, wherein the reagents for end repairing comprise a polynucleotide kinase and one or more buffers compatible with the polynucleotide kinase.Aspect 43. The kit of Aspect 41 or 42, wherein the reagents for adding a polyadenylation tail comprise an E. coli poly(A) polymerase and one or more buffers compatible with the polymerase.Aspect 44. The kit of any one of Aspects 41 to 43, wherein the reagents for templateswitching reverse transcribing polyadenylated RNA comprise: a plurality of primers having a polythymidine sequence and each having a unique molecular identifier; a template switching oligonucleotide; a template-switching reverse transcriptase; and one or more buffers compatible with the reverse transcriptase.Aspect 45. The kit of any one of Aspects 41 to 44, wherein the sequencing library preparation reagents comprise a DNA polymerase and primers sufficient to amplify template DNA.Aspect 46. The kit of any one of Aspects 41 to 45, wherein the in vitro transcription reagents comprise an RNA polymerase and one or more buffers compatible with the RNA polymerase.Aspect 47. The kit of Aspect 46, wherein the RNA polymerase is a T7 RNA polymerase.Aspect 48. The kit of any one of Aspects 41 to 47, wherein the reagents for RT-PCR comprise a reverse transcriptase and one or more buffers compatible with the reverse transcriptase.

[0059] Other objects, features and advantages of the present inventions will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific aspects of the300594318.1 - 29 -inventions described herein, are given by way of illustration only, since various changes and modifications within the spirit and scope of the inventions will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0060] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present inventions. The inventions can be better understood by reference to one or more of these drawings in combination with the detailed description of specific aspects presented herein.

[0061] FIG. 1 : The workflow of RNAmp method, which incorporates, RNA immunoprecipitation, high-throughput library construction with RNA amplification through In vitro transcription (IVT). RNA amplification (RNAmp) for NGS library construction from ultra-low input RNA samples. Application for single-cell RNA immunoprecipitation experiments is illustrated as an example.

[0062] FIGs. 2A-2D: Adaptation of RNAmp workflow to different RNA sequencing library construction approaches. RNAmp enables efficient RNA-seq library construction for (A) chemically converted RNAs; (B) immunoprecipitated RNAs by antibodies; (C) ARTR- seq; (D) transcriptome and translatome analyses. POI: protein of interest.

[0063] FIG. 3: Table summarizing the detailed differences at each step of the workflow between the RNAmp method and other commercial low-input RNA-seq methods. Underlining indicates a shortcoming.

[0064] FIG. 4: Quality control of the RNAmp low-input library prep method. GC content distribution across sequencing reads generated using the RNAmp method and the NEBNext Ultra II Directional RNA Library Prep Kit, compared with a modeled normal distribution.

[0065] FIG. 5: Quality control of the RNAmp low-input library prep method. Comparison of read duplication rates in RNA-seq datasets generated using the RNAmp method and the NEBNext Ultra II Directional RNA Library Prep Kit. Sequence-based duplication was defined as reads with identical sequences. Mapping-based duplication was defined as reads aligned to the exact same genomic location, with splice reads considered duplicates when mapped to the same start site and exhibiting identical splicing patterns.

[0066] FIG. 6: Quality control of the RNAmp low-input library prep method. Clean read ratios recovered following adapter and low-quality sequence trimming, and mapping ratios of RNA-seq libraries prepared using the RNAmp method with different input RNA quantities.300594318.1 - 30 -

[0067] FIG. 7: Quality control of the RNAmp low-input library prep method. Correlation analysis between replicates of RNA-seq libraries generated using the RNAmp method with different input RNA quantities. The Pearson correlation coefficient (r) and corresponding p- value are indicated in the scatter plot.

[0068] FIGs. 8A-8F: (A) Mapping ratios of RNA-seq and m6A-MeRIP libraries prepared using the RNAmp method with different amounts of total RNA, as indicated. (B) Number of expressed genes in RNA-seq libraries prepared by RNAmp, defined as those with FPKM > 0.5. (C) Number of m6A peaks identified by exomePeak in m6A-MeRIP libraries prepared using RNAmp with varying total RNA inputs. (D) Overlap of expressed genes among RNA-seq libraries prepared using RNAmp with different total RNA inputs. (E) m6A density profiles along gene bodies, including 5 ' UTR, CDS, and 3 ' UTR regions. (F) Percentages of rRNA reads in RNA-seq libraries prepared using the RNAmp method with varying total RNA inputs.

[0069] FIG. 9: Unlocking RNA Epitranscriptomics: Application to Low-input m6A MeRIP. Left: UCSC Genome Browser screenshot showing m6A peaks detected by m6A-MeRIP on the TALAM1 gene using the RNAmp method with 0.1 ng and 1 ng total RNA inputs. Right: The consensus m6A motif was identified from peaks detected in the 1 ng RNA sample.

[0070] FIG. 10: Long poly(A) tails detected in read 2 of RNAmp RNA-seq data from ultralow input RNA. Presence of long poly(A) tails in read 2 of RNA-seq data prepared using the RNAmp method when working with ultra-low input RNA.

[0071] FIG. 11: Optimizing Primer Design in the RNAmp Workflow to Reduce PolyA / PolyT Sequences, also Reads Length, and Mapping Ratios. Left: PolyA / PolyT sequence lengths in RNA-seq libraries prepared using the RNAmp method with different reverse transcription (RT) primer designs. Middle: Read length distributions in RNA-seq libraries generated with different RT primer designs in the RNAmp method. Right: Mapping ratios of RNA-seq libraries prepared using different RT primer designs in the RNAmp method.

[0072] FIG. 12: Optimizing Reverse Transcriptase (RT) in the RNAmp Workflow to achieve longer reads length. Left: Read length distributions of RNA-seq libraries prepared using the RNAmp method with different reverse transcriptases (RT) without in vitro transcription (IVT). Right: Read length distributions of RNA-seq libraries prepared using the RNAmp method with different reverse transcriptases (RT) incorporating in vitro transcription (IVT).

[0073] FIG. 13: Optimizing Reverse Transcriptase (RT) in the RNAmp Workflow to achieve higher mapping ratios. Left: Read mapping ratios of RNA-seq libraries prepared using300594318.1 - 31 -the RNAmp method with different reverse transcriptases (RT) without in vitro transcription (IVT). Right: Read mapping ratios of RNA-seq libraries prepared using the RNAmp method with different reverse transcriptases (RT) incorporating in vitro transcription (IVT).

[0074] FIG. 14: RNAmp omits 12-cycle PCR and directly generates tagged RNA. Detailed structure of template- switched cDNA in RNA-seq libraries prepared using the RNAmp method. RNAmp generated approximately 80 ng of fully tagged IVT RNA from 10 ng of total RNA. In comparison, the TAKARA SMARTer-seq method, using 5 + 12 PCR cycles, produced about 100 ng of library DNA from the same input. These results demonstrate that RNAmp eliminates the additional 12-cycle PCR step and directly generates tagged RNA.

[0075] FIG. 15: RNAmp amplifies RNAs faithfully from 10 pg RNA (single cell). qPCR results demonstrating that the RNAmp method can faithfully amplify RNA from 10 pg of input RNA, corresponding to the RNA content of a single cell. The relative RNA expression levels in bulk libraries prepared using the TAKARA SMART-seq method closely matched those in single-cell libraries generated by RNAmp.

[0076] FIG. 16: RNA-seq Mapping Statistics, RNAmp vs TAKARA SMART-seq workflows. Left: Clean read ratios, following adapter and low-quality sequence trimming, in RNA libraries prepared using the RNAmp method and the TAKARA SMART kit with different total RNA input amounts, as indicated. Right: Mapping ratios of RNA libraries prepared using the RNAmp method and the TAKARA SMART kit with varying total RNA inputs.

[0077] FIG. 17: Comparable coverage over gene body. Left: Comparison of RNA-seq read coverage across gene bodies in chromatin- associated RNA-seq libraries prepared using the RNAmp method and the TAKARA SMART-seq method. Right: Comparison of RNA-seq read coverage across gene bodies in messenger RNA-seq libraries prepared using the RNAmp method and the TAKARA SMART-seq method.

[0078] FIG. 18: PCA and correlation analysis of RNA-seq data. Left: Principal component analysis (PCA) of RNA-seq data prepared using the RNAmp method and the TAKARA SMART-seq method with different RNA input amounts. Right: Pearson correlation analysis of RNA-seq data prepared using the RNAmp method and the TAKARA SMART-seq method with varying RNA inputs.

[0079] FIG. 19: RNAmp detects subtle differences in gene expression profiles compared to TAKARA SMART-seq. Left: Scatter plot showing Pearson correlation between RNA-seq replicates prepared using the RNAmp method. Middle: Scatter plot showing Pearson correlation between RNA-seq replicates prepared using the TAKARA SMART-seq method.300594318.1 - 32 -Right: Scatter plot showing Pearson correlation between RNA-seq data generated using the RNAmp method and the TAKARA SMART-seq method.

[0080] FIG. 20: RNAmp for multiplexed single-cell profiling. The detailed workflow for RNAmp based multiplexed RNA immunoprecipitation single-cell profiling.

[0081] FIG. 21: Workflow of mouse GV oocytes m6A meRIP-seq and YTHDF2 profiling using an RNAmp workflow.

[0082] FIG. 22: Mouse GV oocytes m6A meRIP-seq and YTHDF2 signals are enriched on the 3’UTR of representative maternal RNAs. Left: UCSC Genome Browser screenshot showing m6A and YTHDF2 profiling signals detected by the RNAmp method in mouse GV oocyte samples, enriched in the 3 ' UTR of the representative maternal RNA Bmpl5. Right: UCSC Genome Browser screenshot showing m6A profiling signals detected by the published ULLMeRIP method in mouse GV oocyte samples on the same maternal RNA, Bmpl5.

[0083] FIG. 23: m6A MeRIP signal is enriched around stop codons. Left: Metagene profiles showing m6A enrichment signals detected by the published ULLMeRIP method across gene bodies, including UTRs and CDS regions, in mouse GV oocyte samples. Right: Metagene profiles showing m6A enrichment signals detected by the RNAmp method across gene bodies, including UTRs and CDS regions, in libraries prepared from mouse 1 and 32 GV oocytes.

[0084] FIG. 24: Read density and motif enrichment of m6A and YTHDF2 profiling data in bulk or single mouse GV oocytes. Left: Heatmap showing m6A enrichment and input signals detected by the RNAmp method across identified m6A peaks, along with the enriched consensus motif, in libraries prepared from 1 and 32 mouse GV oocytes. Right: Heatmap showing YTHDF2 enrichment and IgG control signals detected by the RNAmp method across identified YTHDF2 peaks, along with the enriched consensus motif, in libraries prepared from 1 and 22 mouse GV oocytes.

[0085] FIG. 25: Advancing Single-Cell Epitranscriptomics: m6A, Translation, and RBP RIP co-profiling. Principal component analysis (PCA) of RNA-seq (gene expression), RNA m6A, translation (ribosome profiling), and YTHDF1 / YTHDF2 binding data generated using the RNAmp multiplexed single-cell profiling method from the same 16 single cells, demonstrating the capability of RNAmp to co-profile multiple molecular layers from a single cell. Each dot represents one cell.DETAILED DESCRIPTION

[0086] Disclosed herein are methods, compositions, and kits for ultra-low input ribo-minus RNA sequencing library preparations, which may be called, in certain aspects, RNAmp.300594318.1 - 33 -Applications include but not limited to profiling of RNA modifications using immunoprecipitation or chemical conversions, RNA immunoprecipitation (RIP), RNA crosslinking immunoprecipitation (CLIP), Assay of Reverse Transcription-based RBP binding site sequencing (ARTR-seq), and translatome / transcriptome analysis in single cells or low-input samples.

[0087] Certain aspects herein relate to methods for multiplexed library construction from ultra-low RNA inputs with minimum sequence bias. In certain aspects, RNA inputs are first fragmented, which may be by magnesium ion (Mg2+). In some aspects, the fragmented RNA is then subjected to immunoprecipitation (which may be done using antibodies against RNA- binding proteins (RBPs), RNA modifications, or actively translating ribosomes). In some aspects, immunoprecipitated RNAs are subjected to end-repair and / or poly(A) tailing before being released from the immunoprecipitation compositions (e.g. immunoprecipitation beads). In some aspects, RNA carriers are added to the reaction to minimize sample loss. In some aspects, a poly(dT) primer is annealed to the poly(A) tail of the polyadenylated RNA (which can be the immunoprecipitated RNA) for cDNA generation with a template- switching oligonucleotide (TSO). In some aspects, resulting cDNA is amplified using PCR to append a T7 promoter sequence to an end of the cDNA. In some aspects, in vitro transcription (IVT) is then performed using these T7 promoter-containing cDNAs to yield sense RNA with strand specificity. In certain aspects, RNAs are then subjected to RT-PCR reaction to yield high- throughput sequencing compatible DNA libraries. The adaptation of a poly(A) tailing step enables profiling of short RNA fragments and non-polyadenylated cellular RNAs in addition to polyA tailed mRNAs. The above method is, in some instances, referred to as RNAmp (Figure 1).

[0088] Certain methods herein avoid a ribosome RNA (rRNA) depletion step as rRNA is depleted in the final library without a ribo-minus step. Such methods can be attractive for RNA sequencing as well as sequencing RNA from immunoprecipitation or any other procedures that yield low-input RNA samples.

[0089] In some aspects, the methods can be adapted to any library construction workflows in which the analytes are RNAs in principle (see Step-by-step protocol). Potential applications include but not limited to profiling of RNA modifications using immunoprecipitation or chemical conversions7 9, RNA immunoprecipitation (RIP)10, RNA cross-linking immunoprecipitation (CLIP)11, assay of reverse transcription-based RBP binding site sequencing (ARTR-seq)12, and translatome / transcriptome analysis13 14in single cells or low-300594318.1 - 34 -input samples (Figure 2). The versatility grants of the methods allow use in almost all RNA- seq applications.

[0090] Direct comparisons between RNAmp methods and SMART-seq2, CEL-seq2, and CATS Small RNA-seq (Diagenode) are included below (Chart 1).

[0091] SMART-seq2 includes template- switching RT with poly(dT) primer to capture only poly(A)+RNAs and additional tagmentation using Tn5 transposase. In contrast, certain aspects herein add polyA tail to any RNA or RNA fragment, thereby capturing all RNA subtypes while rRNAs are depleted. In some aspects, the tagmentation step is completed during the templateswitching RT process, the 5' end of cDNA was controlled by the RT primer, and the 3' end of cDNA was determined by the TSO.

[0092] CEL-seq2 includes linear amplification using T7 promoter to capture only poly(A)+RNAs and a second random priming step to synthesize second strand cDNA. Therefore, it is biased towards the 3' of an RNA. Also, the random priming step and second strand synthesis using E. coli DNA polymerase is of very low efficiency.

[0093] CATS Small RNA-seq includes template- switching RT with poly(dT) primer annealed to an addedl poly(A) tail on small RNAs. However, it does not include T7-based linear amplification.

[0094] In addition to these designs, RNAmp workflow can, in certain aspects, include on- bead procedures and RNA carriers optimized for immunoprecipitation. RNAmp can, in certain aspects, also include a pre-amplification step before in vitro transcription to minimize sample loss due to extremely small amounts of input RNAs. The T7 promoter sequence can be added, in certain aspects, during this process so that the design for TSOs is optimized for maximized efficiency and multiplexing abilities.Chart 1: Comparisons between RNAmp and prior arts including SMART-seq2, CEL-seq2, and CATS. Bolded cells indicate a shortcoming in the method.300594318.1 - 35 -

[0095] Accordingly, specific technical advantages of certain aspects of the disclosure include, but are not limited to:1. Direct cDNA tagmentation using template switch reverse transcription.2. Enhanced reverse transcription efficiency using optimized poly(dT) and random hexamer primers, enabling uniform transcript coverage and improved sensitivity across diverse RNA biotypes.3. Elimination of long poly(A) artifacts at the 5' end of cDNA by employing the T15VN reverse transcription primer, improving read quality, mapping ratio, and data fidelity.4. Enabled workflow to seamlessly combine polyadenylation on RNA, template switching reverse transcription, and T7 polymerase based linear amplification for optimal RNA amplification and tagmentation.5. Adaptability to advanced RNA-based analyses, including single-cell RBP-RIP, CLIP / eCLIP, A-to-I RNA editing (AD AR- mediated deamination) detection, and base-resolution RNA modification mapping, significantly expanding the analytical scope of single-cell sequencing technologies.6. Broad compatibility with multi-omic single-cell assays, allowing simultaneous codetection of transcriptome, epitranscriptome (RNA modifications such as m6A, m5C, and pseudouridine), translatome (ribosome profiling), and RBP interactome within the same single cell.7. Clinical and translational applicability to biopsy-derived and cell-free RNA (cfRNA) samples, including cell-free mRNA, microRNA, tRNA, rRNA, and extracellular vesicle (EV)-associated RNA, from biofluids such as blood, plasma, serum, CSF, and urine, enabling high- sensitivity epitranscriptomic biomarker profiling.8. Utility for precision diagnostics, including liquid biopsy, minimal residual disease monitoring, early cancer detection, neurodegenerative disease biomarker discovery, and transplantation surveillance, by preserving and amplifying ultra-low RNA input with minimal bias.

[0096] In addition to single-cell m6A and RBP profiling, in some aspects, methods herein (including the RNAmp platform) are broadly applicable to a diverse range of single-cell RNA- based assays, including but not limited to: single-cell RNA modification mapping, including m6A, m5C, y (pseudouridine), and other chemical modifications; single-cell RBP-RIP (RNA-300594318.1 - 36 -binding protein immunoprecipitation) to study cell-specific RNA-protein interactions; singlecell CLIP / eCLIP (crosslinking immunoprecipitation) for high-resolution mapping of RNA- binding sites of specific RBPs; single-cell A-to-I RNA editing (ADAR-mediated deamination) or ARTR assays, enabling detection of RNA base deamination and recoding events at singlecell resolution; single-cell translation profiling (ribosome footprinting or Ribo-seq) to measure translation efficiency and ribosome occupancy; single-cell base-resolution sequencing of RNA modifications, allowing precise mapping of modified nucleotides within individual cells; and single-cell simultaneously co-detection of transcriptome, epitranscriptome, translatome, and RBP interactome data from the same cell.

[0097] In additional aspects, methods herein, such as the the RNAmp workflow, can be applied to clinically derived low-input RNA samples, including biopsy samples, such as fine- needle aspirates, microdissected tissue sections, and / or rare cell populations obtained from tumors, organs, or lesions. In certain aspects, cell-free RNA (cfRNA) samples, including cell- free mRNA, circulating microRNA, circulating tRNA, circulating rRNA and extracellular vesicle (EV)-associated RNA obtained from blood, plasma, serum, cerebrospinal fluid (CSF), or urine.

[0098] Methods herein, including the RNAmp workflow, can enable high- sensitivity detection and quantification of gene expression, RNA modifications (including for example m6A and pseudouridine), and RNA-protein interactions from ultra-low amounts of clinical material, making it suitable for liquid biopsy, minimal residual disease monitoring, early cancer detection, neurodegenerative disease biomarker discovery, and transplantation surveillance. In particular, the ability of methods herein, including RNAmp, to preserve and amplify cell-free RNA, mRNA and microRNA with minimal bias provides a powerful approach for epitranscriptomic biomarker profiling, RNA editing analysis, and circulating RNA modification mapping at unprecedented sensitivity.

[0099] Collectively, these capabilities demonstrate that the methods described herein, including the RNAmp multiplexed single-cell workflow, represents a unified, low-input, and scalable platform for high-resolution, multi-omic profiling of RNA biology at the single-cell level. The approaches described herein can enable co-detection of transcriptome, epitranscriptome, translatome, and RBP interactome data from the same cell, substantially expanding the analytical power of single-cell studies and offering new avenues for the investigation of cellular heterogeneity, regulatory dynamics, and disease mechanisms. Additionally, methods herein, including the RNAmp method, also enable clinical applications,300594318.1 - 37 -including diagnostic biomarker detection, disease monitoring, and precision medicine research through analysis of cell-free RNA and tissue biopsy material.I. Definitions

[0100] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the measurement or quantitation method.

[0101] The use of the word “a” or “an” when used in conjunction with the term “comprising” can mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”

[0102] The phrase “and / or” means “and” or “or”. To illustrate, A, B, and / or C includes: A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, “and / or” operates as an inclusive or. It is specifically contemplated that A, B, or C can be specifically excluded from an aspect.

[0103] The words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0104] The compositions and methods for their use can “comprise,” “consist essentially of,” or “consist of’ any of the ingredients or steps disclosed throughout the specification. Compositions and methods “consisting essentially of’ any of the ingredients or steps disclosed limits the scope of the claim to the specified materials or steps which do not materially affect the basic and novel characteristic of the claimed invention.

[0105] As used herein, a “template-switching oligonucleotide” or “TSO” can include an oligonucleotide that can hybridize to untemplated nucleotides, including untemplated cytosine nucleotides, added by the reverse transcriptase to complementary DNA (cDNA) during reverse transcription.

[0106] Amino acid sequence variants of the disclosure can be substitutional, insertional, or deletion variants. The variant polypeptide or nucleic acid sequence has at least one modification compared to the reference polypeptide or nucleic acid sequence, e.g., from 1 to about 50 modifications. A variation in a polypeptide of the disclosure can affect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more non-contiguous or contiguous amino acids of the protein or polypeptide, as compared to wild-type. In some300594318.1 - 38 -aspects, the variant polypeptide or nucleic acid sequence has from 1 to about 50 modifications compared to the reference polypeptide or nucleic acid sequence. In some aspects, the variant polypeptide or nucleic acid sequence has from 1 to about 40 modifications compared to the reference polypeptide or nucleic acid sequence. In some aspects, the variant polypeptide or nucleic acid sequence has from 1 to about 30 modifications compared to the reference polypeptide or nucleic acid sequence. In some aspects, the variant polypeptide or nucleic acid sequence has from 1 to about 20 modifications compared to the reference polypeptide or nucleic acid sequence. In some aspects, the variant polypeptide or nucleic acid sequence has from 1 to about 10 modifications compared to the reference polypeptide or nucleic acid sequence. In some aspects, the variant polypeptide or nucleic acid sequence has from 1 to about 5 modifications compared to the reference polypeptide or nucleic acid sequence. Typically, fewer than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in a variant are substituted, inserted, or deleted, as compared to the reference. A variant can comprise an amino acid sequence that is at least 50%, 60%, 70%, 80%, or 90%, including all values and ranges there between, identical to any sequence provided or referenced herein.

[0107] It also will be understood that amino acid and nucleic acid sequences can include additional residues, such as additional N- or C-terminal amino acids, or 5' or 3' nucleic acid sequences, respectively, and yet still be essentially identical as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that can, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region.

[0108] An amino acid sequence (peptide, protein, or polypeptide) “derived from” a designated amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the first amino acid sequence. Preferably, the amino acid sequence which is derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical, or homologous to that particular sequence or a fragment thereof. Amino acid sequences derived from a particular amino acid sequence can be variants of that particular sequence or a fragment thereof. For example, it will be understood by one of ordinary skill in the art that the antigens suitable for use herein can be altered such that they vary in sequence from the naturally occurring or native sequences from which they were derived, while retaining the desirable activity of the native sequences.300594318.1 - 39 -

[0109] Changes can be introduced by mutation into a nucleic acid, thereby leading to changes in the amino acid sequence of a polypeptide (e.g., an antigen or antibody or antibody derivative) that it encodes. Mutations can be introduced using any technique known in the art. In some aspects, one or more particular amino acid residues are changed using, for example, a site-directed mutagenesis protocol. In another aspect, one or more randomly selected residues are changed using, for example, a random mutagenesis protocol. In some aspects, however it is made, a mutant polypeptide can be expressed and screened for a desired property.

[0110] Mutations can be introduced into a nucleic acid without significantly altering the biological activity of a polypeptide that it encodes. For example, one can make nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues. Alternatively, one or more mutations can be introduced into a nucleic acid that selectively changes the biological activity of a polypeptide that it encodes. For example, the mutation can quantitatively or qualitatively change the biological activity. Examples of quantitative changes include increasing, reducing or eliminating the activity. Examples of qualitative changes include altering the antigen specificity of an antibody.

[0111] “Sequence similarity” indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. “Sequence identity” between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. The terms “% identical,” “% identity,” or similar terms are intended to refer, in particular, to the percentage of nucleotides or amino acids which are identical in an optimal alignment between the sequences to be compared. Said percentage is purely statistical, and the differences between the two sequences can be but are not necessarily randomly distributed over the entire length of the sequences to be compared. Comparisons of two sequences are usually carried out by comparing the sequences, after optimal alignment, with respect to a segment or “window of comparison,” in order to identify local regions of corresponding sequences. The optimal alignment for a comparison can be carried out manually or with the aid of the local homology algorithm by Smith and Waterman, 1981, Ads. App. Math. 2, 482, with the aid of the local homology algorithm by Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, with the aid of the similarity search algorithm by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or with the aid of computer programs using said algorithms (FOGSAA, GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group). In some aspects, percent identity of two sequences is determined using the BLASTN or BLASTP algorithm, as available on the United States National Center for Biotechnology Information (NCBI) website.300594318.1 - 40 -

[0112] Percentage identity is obtained by determining the number of identical positions at which the sequences to be compared correspond, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100.

[0113] In some aspects, the degree of similarity or identity is given for a region that is, is at least, is at most, or is between (inclusive or exclusive) any two of about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the entire length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given for, for at least, for at most, or for between any two of 100, 120, 140, 160, 180, or 200 nucleotides, or any range derivable therein, in some aspects, continuous nucleotides. In some aspects, the degree of similarity or identity is given for the entire length of the reference sequence.

[0114] Homologous amino acid sequences can exhibit at least, at most, or between (inclusive or exclusive) any two of 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of the amino acid residues. In some aspects, homologous amino acid sequences exhibit at least 95% identity of the amino acid residues. In some aspects, homologous amino acid sequences exhibit at least 98% identity of the amino acid residues. In some aspects, homologous amino acid sequences exhibit at least 99% identity of the amino acid residues.

[0115] As used herein, the term “promoter” refers to a nucleic acid fragment that functions to control the transcription of one or more genes (or coding sequence), located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A “constitutive” promoter is a promoter that is active under most physiological and developmental conditions. An “inducible” promoter is a promoter that is regulated depending on physiological or developmental conditions. A “tissue specific” promoter is preferentially active in specific types of differentiated cells / tissues.

[0116] It is specifically contemplated that any limitation discussed with respect to one aspect of the disclosure can apply to any other aspect of the disclosure. Furthermore, any composition of the disclosure can be used in any method of the disclosure, and any method of the disclosure can be used to produce or to utilize any composition of the disclosure. Aspects set forth in the Examples are also aspects that can be implemented in the context of aspects300594318.1 - 41 -discussed elsewhere in a different Example or elsewhere in the application, such as in the Summary, Detailed Description, Claims, and Brief Description of the Drawings.II. Compositions

[0117] In some aspects, the current disclosure also encompasses a polynucleotide encoding the polypeptides disclosed herein. In some aspects, the polynucleotide encoding the disclosed polynucleotide construct can be an isolated DNA, a plasmid, a transposon, a viral vector, a genome integrated polynucleotide, or a chromosome. In some aspects, the polynucleotide sequence can further comprise one or more regulatory sequences. A regulatory sequence refers to any genetic element that is known to drive or otherwise regulate expression of nucleic acids. Non-limiting examples include promoters, transcription terminators, enhancers, repressors, silencers, kozak sequences, polyA sequences, ribosome skipping sequences (for example sequences encoding P2A and T2A peptides) and the like. In some aspects, a regulatory sequence can, for example, be inducible, non-inducible, constitutive, cell-cycle regulated, metabolically regulated, and the like. A regulatory sequence may comprise a promoter. In some aspects, the nucleic acid sequence encoding the fusion polypeptide can be operably linked to the promoter. In some aspects, the promoter can be an inducible promoter, a constitutive promoter, a tissue specific promoter, a weak promoter, a strong promoter, or combinations thereof. In some aspects, the promoter may also comprise an enhancer sequence.

[0118] In some aspects, the polynucleotide construct disclosed herein may further comprise a fluorophore. In some aspects, the fluorophore comprises, consists essentially of, or consists of Green Fluorescent Protein (GFP), eGFP, Red Fluorescent Protein (RFP), Teal Fluorescent Protein (TFP), Blue Fluorescent Protein (BFP), Yellow Fluorescent Protein (YFP), miRFP, cerulean fluorescent protein (CFP), eCyanFP, mCherry, mVenus, mOrange, mTurquoise, tdTomato, aminocoumarin, fluorescein, texas red, Alexa Fluor dyes (e.g. Alexa Fluor 488, Alexa Fluor 555, Alexa Fluor 594, Alexa Fluor 647, Alexa Fluor 350, Alexa Fluor 532, and Alexa Fluor 700), Cy dyes (e.g. Cy3, Cy5), DyEight dyes, FITC, or Rhodamine, or functional variants thereof. In some aspects, polynucleotide constructs described herein do not comprise a fluorophore. In some aspects, a polynucleotide construct does not comprise Green Fluorescent Protein (GFP), eGFP, Red Fluorescent Protein (RFP), Teal Fluorescent Protein (TFP), Blue Fluorescent Protein (BFP), Yellow Fluorescent Protein (YFP), miRFP, cerulean fluorescent protein (CFP), eCyanFP, mCherry, mVenus, mOrange, mTurquoise, tdTomato, aminocoumarin, fluorescein, texas red, Alexa Fluor dyes (e.g. Alexa Fluor 488, Alexa Fluor 555, Alexa Fluor 594, Alexa Fluor 647, Alexa Fluor 350, Alexa Fluor 532, and Alexa Fluor300594318.1 - 42 -700), Cy dyes (e.g. Cy3, Cy5), DyLight dyes, FITC, or Rhodamine, or functional variants thereof.A. Transcriptase composition

[0119] In some aspects, the current disclosure also encompasses transcriptase compositions comprising one or more of the polypeptide constructs disclosed herein. In some aspects, any type of suitable RT primer may be used, or may be expressly excluded from the transcriptase composition. In some aspects, the RT primers do not comprise oligo(dT) primers. In some aspects, the RT primer comprises a gene-specific primer. In some aspects, the RT primer does not comprise a gene specific primer. In some aspects, the RT primer is a random RT primer. In some aspects, the random RT primer is a hexamer. In some aspects, the random RT primer is not a hexamer, but oligonucleotide greater than six nucleotides in length. In some aspects, the random RT primer is at least 8 nucleotides in length, at least 9 nucleotides in length, or at least 10 nucleotides in length, at least 11 nucleotides in length, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, or more nucleotides in length. In some aspects, the random RT primer is between 8 and 20 nucleotides in length. In some aspects, the random RT primer is less than 20 nucleotides in length. In some aspects, the random RT primers comprise, consist, or consist essentially of at least septamers, octamers, nonamers, decamers, undecamers, dodecamers, tridecamers, tetradecamers, pentadecamers, hexadecamers, heptadecamers, octadecamers, nonadecamers, or eicosamers.

[0120] In some aspects, the random RT primer may further comprise a reactive moiety such that it can react with a barcoded oligonucleotide comprising an antibody or targeting moiety, wherein the barcode oligonucleotide comprises a corresponding reactive moiety for click chemistry. A reactive moiety of a random RT primer may be selected from the nonlimiting group consisting of azides, alkynes, nitrones (e.g., 1,3-nitrones), strained alkenes (e.g., trans-cycloalkenes such as cyclooctenes or oxanorbomadiene), tetrazines, tetrazoles, iodides, thioates (e.g., phorphoro thioate), acids, amines, and phosphates. For example, the first reactive moiety of the RT primer may comprise an azide moiety, and a second reactive moiety of the barcode oligonucleotide may comprise an alkyne moiety. The first and second reactive moieties may react to form a linking moiety. A reaction between the first and second reactive moieties may be, for example, a cycloaddition reaction such as a strain-promoted azide-alkyne cycloaddition, a copper-catalyzed azide-alkyne cycloaddition, a strain-promoted alkyne- nitrone cycloaddition, a Diels-Alder reaction, a [3+2] cycloaddition, a [4+2] cycloaddition, or300594318.1 - 43 -a [4+1] cycloaddition; a thiol-ene reaction; a nucleophilic substation reaction; or another reaction. In some cases, reaction between the first and second reactive moieties may yield a triazole moiety or an isoxazoline moiety. A reaction between the first and second reactive moieties may involve subjecting the reactive moieties to suitable conditions such as a suitable temperature, pH, or pressure and providing one or more reagents or catalysts for the reaction. For example, a reaction between the first and second reactive moieties may be catalyzed by a copper catalyst, a ruthenium catalyst, or a strained species such as a difluorooctyne, dibenzylcyclooctyne, or biarylazacyclooctynone. In some aspects, the random RT primer disclosed herein may further comprise a azide functional group (NNNN-N3).

[0121] In some aspects, the transcriptase composition comprises, consists, or consists essentially of at least one polypeptide construct, and transcriptase mix comprising the adapter- RT primers, dNTPs, and other components for reverse transcription. In some aspects, the adapter-RT primers comprise, consist, or consists essentially of an adapter primer fused to a random RT primer.

[0122] In some aspects, the adapter RT primer comprises a nucleic acid sequence reverse complementary to a cDNA adaptor. In some aspects, the transcriptase mix further comprises nucleotides, for example dNTPs. In some aspects, the dNTPs comprise, consist, or consist essentially of dCTPS, dTTPs, dATPs, and dGTPs. In some aspects, the dNTPs comprise, consist, or consist essentially of at least one labeled dNTP. In some aspects, the labeled dNTP is labeled with biotin. In some aspects, the labeled dNTP is labeled with biotin- 16. In some aspects, the labeled dNTP comprise, consist, or consist essentially of biotin- 16-dUTP, or biotin- 16-dCTP. In some aspects, the labeled dNTP is mixed with a corresponding non-labeled dNTP. In some aspects, the labeled dNTP is mixed with a non-labeled dNTP at a ratio of greater than, equal to, at least, at most, or about 0.5:1, 0.6: 1, 0:7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1 or 2:1. In some aspects, the dNTPs comprise, consist, or consist essentially of a combination of biotin- 16-dUTP, biotin- 16-dCTP, dTTP, dCTP, dATP, or dGTP, or any combination thereof. In some aspects, the biotin- 16-dUTP is at a concentration of greater than, equal to, at least, at most, or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 pM / mM, including any range or value derivable therein. In some aspects, the biotin- 16-dCTP is at a concentration of greater than, equal to, at least, at most, or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 pM / mM, including any range or value derivable therein. In some aspects, the300594318.1 - 44 -dTTP is at a concentration of greater than, equal to, at least, at most, or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 pM / mM, including any range or value derivable therein. In some aspects, the dCTP is at a concentration of greater than, equal to, at least, at most, or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 pM / mM, including any range or value derivable therein. In some aspects, the dATP is at a concentration of greater than, equal to, at least, at most, or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 pM / mM, including any range or value derivable therein. In some aspects, the dGTP is at a concentration of greater than, equal to, at least, at most, or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 pM / mM, including any range or value derivable therein.

[0123] In some aspects, one of more nucleotides comprise modified bases, modified sugar moieties, and modified phosphate backbones. Examples of modified base moieties which can be incorporated at any position on its structure include, but are not limited to: 5-fluorouracil, 5-bromouracil, 5 -chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N~6- sopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methyl cytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, methoxyarninomethyl-2-thiouracil, beta-D- mannosylqueosine, 5 '-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, 5-methyl- 2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-S-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, 2,6- diaminopurine and biotinylated analogs, amongst others. Examples of modified sugar moieties which may be used to modify nucleotides at any position on its structure include, but are not limited to arabinose, 2-fluoroarabinose, xylose, and hexose, or a modified component of the phosphate backbone, such as phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, or a formacetal or analog thereof.300594318.1 - 45 -

[0124] In some aspects, the transcriptase mix may further comprise an RNAse inhibitor (for example, a non-competitive inhibitor of pancreatic-type ribonucleases). In some aspects, the non-competitive inhibitor of pancreatic-type ribonucleases comprises, consists, or consists essentially of at greater than, equal to, at least, at most, or about 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 U / pl RNaseOUT, including any range or value derivable therein.

[0125] In some aspects, the transcriptase mix may further comprise a buffer. In some aspects, any suitable buffer may be used. Non-limiting examples include Tris-HCl, MOPS, phosphate buffered saline (PBS), or Dulbecco’s phosphate buffered saline. In some aspects, the pH of the reaction mixture ranges from 5 to 9, such as from 7 to 9, including from 8 to 9, e.g., 8 to 8.5. In some instances, the reaction mixture includes or expressly does not include a pH adjusting agent. pH adjusting agents of interest include, but are not limited to, sodium hydroxide, hydrochloric acid, phosphoric acid buffer solution, citric acid buffer solution, Tris- HCl, MOPS, phosphate buffered saline (PBS), or Dulbecco’s phosphate buffered saline (DPBS), and the like. In some aspects, the buffer comprises, consists, or consists essentially of greater than, equal to, at least, at most, or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 pl of DPBS, including any range or value derivable therein. In some aspects, the MgCh is at a concentration of, of greater than, equal to, at least, at most, or about 0.1, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3,2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.5, 5.0, 5.5, 6.0,6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 mM, including any range or value derivable therein.

[0126] In some aspects, the transcriptase composition is provided to the sample for of greater than, equal to, at least, or at most 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 minutes, including any range or value derivable therein to obtain a cDNA. In some aspects, the transcriptase mix is provided to the sample at less than, equal to, about or more than 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C, 50 °C, 51 °C, or 52 °C, 53 °C, 54 °C, 55 °C, 56 °C, 57 °C, 58 °C, or any range derivable there. In some aspects, the transcriptase mix is provided to the sample at less than, equal to, about, or more than 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, 42 °C. In some aspects, the transcriptase mix is provided to the sample at 37 °C - 42 °C.

[0127] In some aspects, the transcriptase is enzymatically active at a temperature below 42 °C. In some aspects, the transcriptase comprises one or more mutations to render transcriptase enzymatically active at a temperature below 42 °C.300594318.1 - 46 -

[0128] In some aspects, the cDNA comprises, consists, or consists essentially of the dNTPs. In some aspects, the cDNA comprises, consists, or consists essentially of unlabeled dNTPs. In some aspects, the cDNA comprises, consists, or consists essentially of labeled dNTPs. In some aspects, the cDNA comprises both labeled and unlabeled dNTPs. In some aspects, the cDNA is biotinylated. In some aspects, the cDNA comprises biotin- 16.III. Methods

[0129] In some aspects, the method is an RNAmp method. Some aspects of the method are disclosed herein.A. RNAmp

[0130] Aspects herein include RNAmp methods, which may include one or more of the following steps:1. Incubating input RNA with a polynucleotide kinase under conditions sufficient to endrepair the RNA. Conditions sufficient to end-repair the RNA may include shaking the mixture, which can include other buffers and reagents, at about 37 °C for about 20 minutes at 600 rpm. The reaction can be heat inactivated including at about 75 °C for about 10 minutes.2. Incubating the RNA with a poly(A) polymerase under conditions sufficient to polyadenylate the RNA. Conditions sufficient to polyadenylate the RNA may including shaking the mixture at about 37 °C for about 20 minutes at about 600 rpm. The reaction can be quenched with EDTA.3. Extracting the RNA, such as by using beads, which may be Dynabeads™ MyOne™ Silane and eluting in water.4. Performing template-switching reverse transcription using a template switching RT enzyme mix. The template-switching reverse transcription can include the use of oligo(dT) RT primers with well-specific barcodes for multiplexing purposes. The template- switching reverse transcription can include the use barcoded unique molecular identifier (UMI) containing a defined sequence as the template-switching oligo (TSO). In certain aspects, the template- switching reverse transcription is performed with the following components in a PCR strip: RNA / lysed cell, RT primer, and / or a dNTP mixture. The reaction may be mixed, heated for 5 minutes at 70 °C, then immediately chill on ice. A template switching oligonucleotide, buffer, reverse transcriptase can be300594318.1 - 47 -added to the mixture. The mixture can be incubated at about 42 °C for about 90 minutes and about 85 °C for about 5 minutes.5. Pre- amplifying the cDNA generated from the template- switching reverse transcription under conditions sufficient to generate amplified DNA. Conditions sufficient to generate amplified DNA may include a master mix and standard PCR conditions. In some aspects, the pre-amplification comprises adding to the reverse transcription product, water, a master mix, and a forward and reverse primer compatible with the primers and template switching oligonucleotides used in previous steps.6. Performing in vitro transcription reaction using an RNA polymerase. The in vitro transcription may be performed by assembling in a reaction the DNA template, a reaction buffer, NTP mix, an Murine RNase inhibitor, and an RNA polymerase. The reaction may be incubated at about 37 °C for about 13 hours with lid temperature set at about 70 °C, then hold at about 4 °C. After the reaction is complete, a DNase (Invitrogen, AM2238) can be added and incubated at about 37 °C for about 30 minutes.7. Reverse transcribing the in vitro transcribed product for DNA library preparation. A final PCR may then be used to amplify the resulting cDNA.

[0131] One or more of the above steps may be excluded in certain aspects. Modification of the conditions (such as the time, temperature, buffers, enzymes, reagents, etc.) may be done to achieve a similar outcome as the steps described above. One skilled in the art can modify the steps as needed to obtain the same results. In some aspects, the steps are or are not performed in the same order as listed above.

[0132] Aspects herein include RNAmp methods, which may be for single-cell analysis, that include one or more of the following steps:1. Preparing beads to immunoprecipitate a protein of interest and / or an RNA modification of interest. The preparing may include washing beads, such as Dynabeads, then incubating the beads with an antibody.2. Fixing cells in a population of cells. The cells may be fixed with a fixing agent, such as paraformaldehyde under conditions sufficient to fix biological molecules within the cell. In some aspects, the cells are incubated with beads, such as ConA beads, which may be magnetic.3. Incubating the cells with a poly (A) polymerase under conditions sufficient to polyadenylate the RNA. Conditions sufficient to polyadenylate the RNA may including shaking the mixture at about 37 °C for about 20 minutes at about 600 rpm. The reaction can be quenched with EDTA.300594318.1 - 48 -4. Sorting the cells into individual vesicles, such as wells in a well plate. In some aspects, each vesicle contains an oligonucleotide comprising a unique molecular identifier. In certain aspects, the vesicle is incubated under conditions sufficient to allow annealing of the oligonucleotide to RNAs in the cell. The conditions may include incubating at about 25 °C for about 10 minutes at about 1,400 rpm5. Aggregating the cells into one vesicle.6. Immunoprecipitating the protein of interest and / or chemical modification from the aggregated cells. The immunoprecipitating may include adding the beads from step 1 to the aggregated cells and incubating the cells under conditions sufficient to bind and immunoprecipitate the beads with the protein of interest and / or chemical modification. The step may also comprise lysing the cells.7. Performing template-switching reverse transcription using a template switching RT enzyme mix. The template-switching reverse transcription can include the use of oligo(dT) RT primers with well-specific barcodes for multiplexing purposes. The template- switching reverse transcription can include the use barcoded unique molecular identifier (UMI) containing a defined sequence as the template-switching oligo (TSO). In certain aspects, the template- switching reverse transcription is performed with the following components in a PCR strip: RNA / lysed cell, RT primer, and / or a dNTP mixture. The reaction may be mixed, heated for 5 minutes at 70 °C, then immediately chill on ice. A template switching oligonucleotide, buffer, reverse transcriptase can be added to the mixture. The mixture can be incubated at about 42 °C for about 90 minutes and about 85 °C for about 5 minutes.8. Pre-amplifying the cDNA generated from the template-switching reverse transcription under conditions sufficient to generate amplified DNA. Conditions sufficient to generate amplified DNA may include a master mix and standard PCR conditions. In some aspects, the pre-amplification comprises adding to the reverse transcription product, water, a master mix, and a forward and reverse primer compatible with the primers and template switching oligonucleotides used in previous steps.9. Performing in vitro transcription reaction using an RNA polymerase. The in vitro transcription may be performed by assembling in a reaction the DNA template, a reaction buffer, NTP mix, an Murine RNase inhibitor, and an RNA polymerase. The reaction may be incubated at about 37 °C for about 13 hours with lid temperature set at about 70 °C, then hold at about 4 °C. After the reaction is complete, a DNase (Invitrogen, AM2238) can be added and incubated at about 37 °C for about 30 minutes.300594318.1 - 49 -10. Reverse transcribing the in vitro transcribed product for DNA library preparation. A final PCR may then be used to amplify the resulting cDNA.

[0133] One or more of the above steps may be excluded in certain aspects. Modification of the conditions (such as the time, temperature, buffers, enzymes, reagents, etc.) may be done to achieve a similar outcome as the steps described above. One skilled in the art can modify the steps as needed to obtain the same results. In some aspects, the steps are or are not performed in the same order as listed above.B. Sample

[0134] The term biological sample, as used herein encompasses any sample obtained from an organism or prepared in vitro to mimic a sample of biological origin. Non-limiting examples of biological samples include isolated or assembled RNA-protein complexes, biological fluid, cells, tissue samples, or biological materials derived from cells or tissue samples. In some aspects, the biological sample may be obtained from a prokaryotic, or a eukaryotic organism. In some aspects, the eukaryotic organism may be from the kingdoms Animalia, Plantae, Fungi, Protista. In an aspect, the eukaryotic organism is a mammal. In an aspect, the eukaryotic organism is a laboratory animal, for example a primate, a rodent - a mouse, a rat, a gerbil, a nematode, or a fruit fly. In some aspects, the laboratory animal is a genetically engineered animal. In some aspects, the mammal is a human. In some aspects, the mammal has, or is at a risk of having a disease.

[0135] In certain aspects, the disclosed methods comprise obtaining a sample (also a “biological sample”) from a subject wherein the subject has, or is at a risk of having a disease or disorder. In some aspects, the methods of obtaining a biological sample can include methods of biopsy such as fine needle aspiration, core needle biopsy, vacuum assisted biopsy, incisional biopsy, excisional biopsy, punch biopsy, shave biopsy or skin biopsy. In other aspects the sample can be obtained from any of the tissues provided herein that include but are not limited to non-cancerous or cancerous tissue and non-cancerous or cancerous tissue from the serum, gall bladder, mucosal, skin, heart, lung, breast, pancreas, blood, liver, muscle, kidney, smooth muscle, bladder, colon, intestine, brain, prostate, esophagus, or thyroid tissue. Alternatively, the sample can be obtained from any other source including but not limited to blood, sweat, hair follicle, buccal tissue, tears, menses, feces, or saliva. In certain aspects of the current methods, any medical professional such as a doctor, nurse or medical technician can obtain a300594318.1 - 50 -biological sample for testing. Yet further, the biological sample can be obtained without the assistance of a medical professional.

[0136] A sample can include but is not limited to, tissue, cells, or biological material from cells or derived from cells of a subject. The biological sample can be a heterogeneous or homogeneous population of cells or tissues. The biological sample can be obtained using any method known to the art that can provide a sample suitable for the analytical methods described herein. The sample can be obtained by non-invasive methods including but not limited to: scraping of the skin or cervix, swabbing of the cheek, saliva collection, urine collection, feces collection, collection of menses, tears, or semen.

[0137] The sample can be obtained by methods known in the art. In certain aspects the samples are obtained by biopsy. In other aspects the sample is obtained by swabbing, endoscopy, scraping, phlebotomy, or any other methods known in the art. In some cases, the sample can be obtained, stored, or transported using components of a kit of the present methods. In some cases, multiple samples, such as multiple esophageal samples can be obtained for diagnosis by the methods described herein. In other cases, multiple samples, such as one or more samples from one tissue type (for example esophagus) and one or more samples from another specimen (for example serum) can be obtained for diagnosis by the methods. In some cases, multiple samples such as one or more samples from one tissue type (e.g. esophagus) and one or more samples from another specimen (e.g. serum) can be obtained at the same or different times. Samples can be obtained at different times are stored and / or analyzed by different methods. For example, a sample can be obtained and analyzed by routine staining methods or any other cytological analysis methods.

[0138] In some aspects the biological sample can be obtained by a physician, nurse, or other medical professional such as a medical technician, endocrinologist, cytologist, phlebotomist, radiologist, or a pulmonologist. The medical professional can indicate the appropriate test or assay to perform on the sample. In certain aspects a third party, such as a molecular profiling business, can consult on which assays or tests are most appropriately indicated. In further aspects of the current methods, the patient or subject can obtain a biological sample for testing without the assistance of a medical professional, such as obtaining a whole blood sample, a urine sample, a fecal sample, a buccal sample, or a saliva sample.

[0139] In other cases, the sample is obtained by an invasive procedure including but not limited to: biopsy, needle aspiration, endoscopy, or phlebotomy. The method of needle aspiration can further include fine needle aspiration, core needle biopsy, vacuum assisted300594318.1 - 51 -biopsy, or large core biopsy. In some aspects, multiple samples can be obtained by the methods herein to ensure a sufficient amount of biological material.

[0140] General methods for obtaining biological samples are also known in the art. Publications such as Ramzy, Ibrahim Clinical Cytopathology and Aspiration Biopsy 2001, which is herein incorporated by reference in its entirety, describes general methods for biopsy and cytological methods. In some aspects, the sample is a fine needle aspirate of a esophageal or a suspected esophageal tumor or neoplasm. In some cases, the fine needle aspirate sampling procedure can be guided by the use of an ultrasound, X-ray, or other imaging device.

[0141] In some aspects of the present methods, a third party, such as a molecular profiling business, can obtain the biological sample from a subject directly, from a medical professional, from a third party, or from a kit provided by a third party. In some cases, the biological sample can be obtained by the third party after the subject, a medical professional, or a third party acquires and sends the biological sample to the third party. In some cases, the third party can provide suitable containers, and excipients for storage and transport of the biological sample to the third party.

[0142] In some aspects of the methods described herein, a medical professional need not be involved in the initial diagnosis or sample acquisition. An individual can alternatively obtain a sample through the use of an over the counter (OTC) kit. An OTC kit can contain a means for obtaining said sample as described herein, a means for storing said sample for inspection, and instructions for proper use of the kit. In some cases, molecular profiling services are included in the price for purchase of the kit. In other cases, the molecular profiling services are billed separately. A sample suitable for use by the molecular profiling business can be any material containing tissues, cells, nucleic acids, genes, gene fragments, expression products, gene expression products, or gene expression product fragments of an individual to be tested. Methods for determining sample suitability and / or adequacy are provided.

[0143] In some aspects, the subject can be referred to a specialist such as an oncologist, surgeon, or endocrinologist. The specialist can likewise obtain a biological sample for testing or refer the individual to a testing center or laboratory for submission of the biological sample. In some cases the medical professional can refer the subject to a testing center or laboratory for submission of the biological sample. In other cases, the subject can provide the sample. In some cases, a third party can obtain the sample.300594318.1 - 52 -C. Sample preparation

[0144] In some aspects, the current disclosure also encompasses methods of preparing the biological sample, as disclosed herein for further processing. Methods for preparing the samples are well known in the art and can comprise use of common laboratory equipment, for example centrifuges, perfusion equipment, dissection equipment, cryostats, mounting equipment, mounting media, solid surface, for example slides, multi-well plates, capillaries etc, microscopes, staining equipment etc. In an exemplary set up, once a tissue sample is obtained, the tissue may be placed in O.C.T, and frozen in liquid nitrogen, and sliced using a cryostat (for example, Leica CM 1900). The tissue sections may then be mounted on a suitable solid surface, and further fixed and permeabilized. In another exemplary set up, a tissue obtained may be further dissected into cells, diluted and mounted on a solid surface. In yet another aspect, one or more cells from a cell line may be obtained, and processed. In yet another exemplary aspect, a ribosome, a polysome, or other RNA-protein complexes may be isolated used in the disclosed methods.

[0145] In some aspects, the processed biological sample may be fixed. A person of skill in the art is familiar with common techniques to accomplish fixation of a sample. In some aspects, the fixing step can comprise, consist, or consist essentially of rapidly freezing the sample, or can comprise, consist, or consist essentially of treating the sample with formaldehyde and / or paraformaldehyde (PFA).

[0146] A cellular sample can be fixed by treatment with a fixing agent. A fixing agent can comprise, consist, or consist essentially of a crosslinking agent, including aldehydes like formalin, glutaraldehyde, formaldehyde, PFA, or a precipitating agent, including organic solvents like methanol, acetone, or piric acid, or any combination thereof. In some aspects, the fixing step is quenched, for example with glycine. A person of skill in the art is familiar with common techniques to accomplish quenching of a fixing reaction, including addition of sodium borohydride, or addition of exogenous amine-containing reagents like ammonium chloride and / or glycine. In some aspects, the fixing step comprises, consists, or consists essentially of treating the sample with formaldehyde. In some aspects, the fixing step comprises, consists, or consists essentially of treating the sample with paraformaldehyde (PFA). In some aspects, the fixing step comprises, consists, or consists essentially of treating the sample with greater than, equal to, at least, at most 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, or 2.5% PFA. In some aspects, the fixing step occurs for greater than, equal to, at least, or at most 1, 2,300594318.1 - 53 -3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes, including any range or value derivable therein. In some aspects, the fixing step occurs at room temperature.

[0147] In some aspects, the fixing step is quenched. In some aspects, the fixing step is quenched with glycine. In some aspects, the quenching glycine is greater than, equal to, at least, at most 25, 50, 75, 100, 125, 150, 200, 225, or 250 mM, including any range or value derivable therein. In some aspects, the quenching step occurs for greater than, equal to, at least, or at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 minutes, including any range or value derivable therein. In some aspects, the quenching step occurs at room temperature.

[0148] In some aspects, the sample is permeabilized. In some aspects, a cell permeabilizing agent may comprise a detergent, an enzyme, a solvent, a small molecule, a buffer or any combination thereof. In some aspects, the cell permeabilizing agent comprises a detergent. In some aspects, the agent that permeabilizes cell membranes comprises, consists, or consists essentially of greater than or equal to 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, or 1.5%, including any range or value derivable therein, Triton X-100. In some aspects, the sample is contacted with the permeabilizing agent greater than, equal to, at least, or at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes, including any range or value derivable therein. In some aspects, the contacting (e.g., incubating together) step occurs on ice.

[0149] In some aspects, the at least one RNase is optionally provided to the sample following the permeabilizing step or further downstream. In some aspects, the providing of the at least one RNase improves resolution during the sequencing step. In some aspects, the at least one RNase comprises, consists, or consists essentially of ribonuclease I (RNase I, via Thermo Fisher Scientific), RNase A, and / or RNase Tl. In some aspects, the RNase is provided to the sample for greater than, equal to, at least, or at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes, including any range or value derivable therein. In some aspects, the at least one RNase is provided to the sample at 37 °C.

[0150] In certain aspects, the biological sample, which can be prepared using the steps disclosed herein, contains the plurality of RNAs used in the methods described herein.D. Reverse transcription and cDNA synthesis

[0151] In some aspects, the disclosed method further comprises incubating the primary or the secondary complex, or both with a transcriptase composition as disclosed herein. As provided herein, the transcriptase composition comprises at least one polypeptide construct and300594318.1 - 54 -a transcriptase mix. In some aspects, the polypeptide construct comprises a targeting moiety as disclosed herein; and a reverse transcriptase enzyme as disclosed herein. As an aspect, the transcriptase mix comprises one or more ingredients for initiation and synthesis of cDNA. In an aspect, the transcriptase mix comprises one or more adapter-RT primer, wherein the one or more adapter RT-primer each comprises an adapter primer sequence and an RT primer sequence. In some aspects, the RT primer comprises random RT primers as disclosed herein. In some aspects, the adapter primer comprises one or more of a barcode sequence, indexes etc. In some aspects, the transcriptase mix may further comprise components known in the art, for example labeled and / or unlabeled dNTPs as disclosed herein, RNase inhibitor, salts, reducing agents, buffers, solvents, osmotic agents etc.

[0152] A person of skill in the art is familiar with conditions capable of producing cDNA. As noted above, in some aspects, the conditions to produce cDNA can comprise, consist, or consist essentially of providing the sample with at least one primer (random, oligo(dT) or gene specific), dNTPs, and other components in order to conduct reverse transcription (RT) before halting the reaction. In an aspect, the primer is an adapter RT primer as disclosed herein. The other components can comprise, consist, or consist essentially of a non-competitive inhibitor of pancreatic-type ribonucleases, a buffer or buffers, MgCh, a reducing reagent, and / or water. In some aspects, the transcriptase composition is provided to the sample for greater than, equal to, at least, or at most 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 minutes, including any range or value derivable therein to obtain a cDNA. In some aspects, the transcriptase mix provided to the sample at less than, equal to, about or more than 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C, 50 °C, 51 °C, or 52 °C, 53 °C, 54 °C, 55 °C, 56 °C, 57 °C, 58 °C. In some aspects, the transcriptase mix is provided to the sample at less than, equal to, about or more than 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, 42 °C. In some aspects, the transcriptase mix is provided to the sample at 37 °C - 42 °C.

[0153] A person of skill in the art is aware of standard conditions and protocols with which to conduct reverse transcription. For example, primers with which to conduct reverse transcription can comprise, consist, or consist essentially of oligo(dT) primers, random primers, and / or gene-specific primers. A person of skill in the art can select random primers to improve cDNA synthesis for detection. These random primers can comprise, consist, or consist essentially of at least septamers, octamers, nonamers, decamers, undecamers, dodecamers, tridecamers, tetradecamers, pentadecamers, hexadecamers, heptadecamers, octadecamers, nonadecamers, or eicosamers. As a further example, the dNTPs with which to conduct reverse300594318.1 - 55 -transcription can be labelled or not labelled; as known to a person in the art a dNTP label can comprise, consist, or consist essentially of biotin, biotin- 16, a-32P, fluorescein, a fluorescent dye, and / or another label that facilitates detection and / or purification. The labeled and label- free dNTPs can be mixed at different ratios, for example 2:1, 1:1, 1:2, or any range or value derivable therein. In some aspects, the dNTPs can comprise, consist, or consist essentially of a combination of labelled dUTP, labelled dCTP, labelled dGTP, labelled dATP, dTTP, dCTP, dATP, and / or dGTP.

[0154] A non-competitive inhibitor of pancreatic-type ribonucleases suitable for conducting reverse transcription can comprise, consist, or consist essentially of RNase inhibitor, RNAseOUT, and / or another agent which prevents RNA degradation by RNase. Buffers with suitable for conducting reverse transcription can comprise, consist, or consist essentially of a phosphate buffer solution like PBS and / or DPBS, and / or another buffer providing a favorable pH and ionic strength for the reaction. A reducing reagent suitable for conducting reverse transcription can comprise, consist, or consist essentially of dithiothreitol (DTT), and / or another agent suitable for reducing disulfide bonds in RNases. Water suitable for conducting reverse transcription can comprise, consist, or consist essentially of nuclease- free water, water treated with diethylpyrocarbonate, and / or water treated with another agent that eliminates any RNases.

[0155] In some aspects, the disclosed method does not comprise oligo(dT) primer initiated reverse transcription. In some aspects, the method does not comprise Tn5 tagmentation.

[0156] A person of skill in the art is familiar with methods for halting RT. For example, a chelating agent can be added to the sample to halt RT. As known to a person of skill in the art, chelating agents can comprise, consist, or consist essentially of EDTA and / or EGTA. In some aspects, halting RT comprises, consists, or consists essentially of providing at least one chelating agent to the sample. In some aspects, the at least one chelating agent comprises, consists, or consists essentially of EDTA and / or EGTA. In some aspects, the EDTA is at a concentration of greater than, equal to, at least, at most, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 mM, including any range or value derivable therein. In some aspects, the EGTA is at a concentration of greater than, equal to, at least, at most, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM, including any range or value derivable therein. In some aspects, the at least one chelating agent is provided to the sample for greater than, equal to, at least, or at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 minutes, including any range or300594318.1 - 56 -value derivable therein. In some aspects, the at least one chelating agent is provided to the sample at room temperature.

[0157] As noted above, the present methods can further comprise, consist, or consist essentially steps which permit recovery of DNA and / or cDNA from a sample. For example, an optional cell digestion step can be included after the incubating step or optional in- situ imaging step. A person of skill in the art can also use alternative DNA extraction protocols, such as treatment with chemical extractants, physical disruption, treatment with proteases, and / or treatment with other cellular lysis agents. As is known in the art, chemical extractants can comprise, consist, or consist essentially of sodium dodecyl sulfate (SDS), chloroform, phenol, Chelex 100, and / or guanadinium isothiocyanate. As is known in the art, physical disruption methods can comprise, consist, or consist essentially of bead mill homogenization and / or freeze-thaw lysis. As is known in the art, proteases or other cellular lysis agents can comprise, consist, or consist essentially of a lysozyme, a proteinase K, achromopeptidase, and / or pronase E.E. DNA Sequencing

[0158] As is commonly known in the art, DNA sequencing can comprise, consist, or consist essentially of amplifying the cDNA, purifying the amplified cDNA, and sequencing the purified cDNA. A person of skill in the art is familiar with common sequencing methods, which can include high-throughput sequencing.

[0159] In some aspects, the methods of the disclosure include a sequencing method. In certain aspects, methods involve sequencing the cDNA produced by incubation step. The cDNA can be prepared for sequencing by any method known in the art, such as library preparation, hybrid capture, sample quality control, product-utilized ligation-based library preparation, or a combination thereof. The cDNA can be prepared for any sequencing technique. In some aspects, a unique genetic readout for each sample can be generated by genotyping one or more highly polymorphic SNPs. In some aspects, sequencing, such as 76 base pair, paired-end sequencing, can be performed to cover approximately 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater percentage of targets at more than 20x, 25x, 30x, 35x, 40x, 45x, 50x, or greater than 50x coverage. In certain aspects, mutations, SNPS, INDELS, copy number alterations (somatic and / or germline), or other genetic differences can be identified from the sequencing using at least one bioinformatics tool, including VarScan2, any R package300594318.1 - 57 -(including CopywriteR) and / or Annovar. Exemplary sequencing methods include those described below.

[0160] Massively parallel signature sequencing (MPSS) the first of the next- generation sequencing technologies, was developed in the 1990s at Lynx Therapeutics. MPSS was a beadbased method that used a complex approach of adapter ligation followed by adapter decoding, reading the sequence in increments of four nucleotides. This method made it susceptible to sequence- specific bias or loss of specific sequences. Because the technology was so complex, MPSS was only performed 'in-house' by Lynx Therapeutics and no DNA sequencing machines were sold to independent laboratories. Lynx Therapeutics merged with Solexa (later acquired by Illumina) in 2004, leading to the development of sequencing-by-synthesis, a simpler approach acquired from Manteia Predictive Medicine, which rendered MPSS obsolete. However, the essential properties of the MPSS output were typical of later "next-generation" data types, including hundreds of thousands of short DNA sequences. In the case of MPSS, these were typically used for sequencing cDNA for measurements of gene expression levels. Indeed, the powerful Illumina HiSeq2000, HiSeq2500 and MiSeq systems are based on MPSS.

[0161] Polony sequencing developed in the laboratory of George M. Church at Harvard, was among the first next-generation sequencing systems and was used to sequence a full genome in 2005. It combined an in vitro paired- tag library with emulsion PCR, an automated microscope, and ligation-based sequencing chemistry to sequence an E. coli genome at an accuracy of >99.9999% and a cost approximately 1 / 9 that of Sanger sequencing. The technology was licensed to Agencourt Biosciences, subsequently spun out into Agencourt Personal Genomics, and eventually incorporated into the Applied Biosystems SOLiD platform, which is now owned by Life Technologies.

[0162] 454 pyrosequencing is a parallelized version of pyrosequencing developed by 454Life Sciences, which has since been acquired by Roche Diagnostics. The method amplifies DNA inside water droplets in an oil solution (emulsion PCR), with each droplet containing a single DNA template attached to a single primer-coated bead that then forms a clonal colony. The sequencing machine contains many picoliter- volume wells each containing a single bead and sequencing enzymes. Pyrosequencing uses luciferase to generate light for detection of the individual nucleotides added to the nascent DNA, and the combined data are used to generate sequence read-outs. This technology provides intermediate read length and price per base compared to Sanger sequencing on one end and Solexa and SOLiD on the other.

[0163] Illumina (Solexa) sequencing. Solexa, now part of Illumina, developed a sequencing method based on reversible dye-terminators technology, and engineered300594318.1 - 58 -polymerases, that it developed internally. The terminated chemistry was developed internally at Solexa and the concept of the Solexa system was invented by Balasubramanian and Klennerman from Cambridge University's chemistry department. In 2004, Solexa acquired the company Manteia Predictive Medicine in order to gain a massivelly parallel sequencing technology based on "DNA Clusters", which involves the clonal amplification of DNA on a surface. The cluster technology was co-acquired with Lynx Therapeutics of California. Solexa Ltd. later merged with Lynx to form Solexa Inc.

[0164] In this method, DNA molecules and primers are first attached on a slide and amplified with polymerase so that local clonal DNA colonies, later coined "DNA clusters", are formed. To determine the sequence, four types of reversible terminator bases (RT-bases) are added and non-incorporated nucleotides are washed away. A camera takes images of the fluorescently labeled nucleotides, then the dye, along with the terminal 3' blocker, is chemically removed from the DNA, allowing for the next cycle to begin. Unlike pyro sequencing, the DNA chains are extended one nucleotide at a time and image acquisition can be performed at a delayed moment, allowing for very large arrays of DNA colonies to be captured by sequential images taken from a single camera.

[0165] Decoupling the enzymatic reaction and the image capture allows for optimal throughput and theoretically unlimited sequencing capacity. With an optimal configuration, the ultimately reachable instrument throughput is thus dictated solely by the analog-to-digital conversion rate of the camera, multiplied by the number of cameras and divided by the number of pixels per DNA colony required for visualizing them optimally (approximately 10 pixels / colony). In 2012, with cameras operating at more than 10 MHz A / D conversion rates and available optics, fluidics and enzymatics, throughput can be multiples of 1 million nucleotides / second, corresponding roughly to one human genome equivalent at lx coverage per hour per instrument, and one human genome re-sequenced (at approx. 30x) per day per instrument (equipped with a single camera).

[0166] SOLiD sequencing. Applied Biosystems' (now a Thermo Fisher Scientific brand) SOLiD technology employs sequencing by ligation. Here, a pool of all possible oligonucleotides of a fixed length are labeled according to the sequenced position. Oligonucleotides are annealed and ligated; the preferential ligation by DNA ligase for matching sequences results in a signal informative of the nucleotide at that position. Before sequencing, the DNA is amplified by emulsion PCR. The resulting beads, each containing single copies of the same DNA molecule, are deposited on a glass slide. The result is sequences of quantities300594318.1 - 59 -and lengths comparable to Illumina sequencing. This sequencing by ligation method has been reported to have some issue sequencing palindromic sequences.

[0167] Ion Torrent semiconductor sequencing. Ion Torrent Systems Inc. (now owned by Thermo Fisher Scientific) developed a system based on using standard sequencing chemistry, but with a novel, semiconductor based detection system. This method of sequencing is based on the detection of hydrogen ions that are released during the polymerization of DNA, as opposed to the optical methods used in other sequencing systems. A microwell containing a template DNA strand to be sequenced is flooded with a single type of nucleotide. If the introduced nucleotide is complementary to the leading template nucleotide it is incorporated into the growing complementary strand. This causes the release of a hydrogen ion that triggers a hypersensitive ion sensor, which indicates that a reaction has occurred. If homopolymer repeats are present in the template sequence multiple nucleotides will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal.

[0168] DNA nanoball sequencing is a type of high throughput sequencing technology used to determine the entire genomic sequence of an organism. The company Complete Genomics uses this technology to sequence samples submitted by independent researchers. The method uses rolling circle replication to amplify small fragments of genomic DNA into DNA nanoballs. Unchained sequencing by ligation is then used to determine the nucleotide sequence. This method of DNA sequencing allows large numbers of DNA nanoballs to be sequenced per run and at low reagent costs compared to other next generation sequencing platforms. However, only short sequences of DNA are determined from each DNA nanoball which makes mapping the short reads to a reference genome difficult. This technology has been used for multiple genome sequencing projects.

[0169] Heliscope single molecule sequencing is a method of single-molecule sequencing developed by Helicos Biosciences. It uses DNA fragments with added poly-A tail adapters which are attached to the flow cell surface. The next steps involve extension-based sequencing with cyclic washes of the flow cell with fluorescently labeled nucleotides (one nucleotide type at a time, as with the Sanger method). The reads are performed by the Heliscope sequencer. The reads are short, up to 55 bases per run, but recent improvements allow for more accurate reads of stretches of one type of nucleotides. This sequencing method and equipment were used to sequence the genome of the M13 bacteriophage.

[0170] Single molecule real time (SMRT) sequencing is based on the sequencing by synthesis approach. The DNA is synthesized in zero-mode wave-guides (ZMWs) - small well-300594318.1 - 60 -like containers with the capturing tools located at the bottom of the well. The sequencing is performed with use of unmodified polymerase (attached to the ZMW bottom) and fluorescently labelled nucleotides flowing freely in the solution. The wells are constructed in a way that only the fluorescence occurring by the bottom of the well is detected. The fluorescent label is detached from the nucleotide at its incorporation into the DNA strand, leaving an unmodified DNA strand. According to Pacific Biosciences, the SMRT technology developer, this methodology allows detection of nucleotide modifications (such as cytosine methylation). This happens through the observation of polymerase kinetics. This approach allows reads of 20,000 nucleotides or more, with average read lengths of 5 kilobases.IV. Kits

[0171] Certain aspects of the present disclosure also concern kits containing compositions of the disclosure and / or compositions to implement methods disclosed herein.

[0172] The kit can optionally provide additional components that are useful in the procedure. These optional components include buffers, capture reagents, developing reagents, labels, reacting surfaces, means for detection, control samples, instructions, and interpretive information. In certain aspects, a kit contains, contains at least, or contains at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 500, 1,000 or more probes, primers or primer sets, synthetic molecules or inhibitors, or any value or range and combination derivable therein. In some aspects, there are kits for evaluating RBP binding activity in cells.

[0173] Kits can comprise components, which can be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means.

[0174] Individual components can also be provided in a kit in concentrated amounts; in some aspects, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components can be provided as lx, 2x, 5x, lOx, or 20x or more. In certain aspects, negative and / or positive control nucleic acids, probes, and inhibitors are included in some kit aspects.

[0175] Kits for using probes, synthetic nucleic acids, nonsynthetic nucleic acids of the disclosure for prognostic or diagnostic applications are included as part of the disclosure. In certain aspects, negative and / or positive control nucleic acids, probes, and inhibitors are included in some kit aspects.300594318.1 - 61 -

[0176] Detection Kits and Systems: One can recognize that based on the methods described herein, detection reagents, kits, and / or systems can be utilized to detect the biomarkers, for diagnosing or prognosing an individual. The reagents can be combined into at least one of the established formats for kits and / or systems as known in the art. The kits could also contain other reagents, chemicals, buffers, enzymes, packages, containers, electronic hardware components, etc. The kits / systems could also contain packaged sets of PCR primers, oligonucleotides, arrays, beads, antibodies, or other detection reagents. Any number of probes could be implemented for a detection array. In some aspects, the detection reagents and / or the kits / systems are paired with chemiluminescent or fluorescent detection reagents. Particular aspects of kits / systems include the use of electronic hardware components, such as DNA chips or arrays, or microfluidic systems, for example. In specific aspects, the kit also comprises one or more therapeutic or prophylactic interventions in the event the individual is determined to be in need of.

[0177] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different aspects can be combined, and that these compositions may be packaged into kits and / or kits may be designed to facilitate these methods.

[0178] The claims originally filed are contemplated to cover claims that are multiply dependent on any filed claim or combination of filed claims.V. Clinical, and non-clinical applications

[0179] In some aspects, the current disclosure also encompasses methods of using the methods and / or compositions disclosed herein for use in clinical, non-clinical, and / or research use. In some aspects, the disclosed methods may also be used to develop diagnostic methods to detect a disease or a disorder, to study disease progression or to study susceptibility if a subject to a disease or disorder.A. Diseases or Disorders

[0180] In certain aspects, methods involve obtaining a sample from a subject with a disease or disorder. In some embodiments, compositions, methods, and / or kits described herein may be used in a method of preventing, treating, reducing the progression of, and / or reducing the risk of a disease or disorder, wherein the disease or disorder is a cancer and / or a neurodegenerative disease.300594318.1 - 62 -

[0181] In some embodiments, the disease or disorder is a cancer. In some embodiments, the cancer is pancreatic cancer, breast cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, urothelial cancer, endometrial cancer, ovarian cancer, cervical cancer, renal cancer, esophageal cancer, gastrointestinal stromal tumor (GIST), multiple myeloma, cancer of secretory cells, thyroid cancer, gastrointestinal carcinoma, chronic myeloid leukemia, hepatocellular carcinoma, colon cancer, melanoma, malignant glioma, glioblastoma, glioblastoma multiforme, astrocytoma, dysplastic gangliocytoma of the cerebellum, Ewing’s sarcoma, rhabdomyosarcoma, ependymoma, medulloblastoma, ductal adenocarcinoma, adenosquamous carcinoma, nephroblastoma, acinar cell carcinoma, neuroblastoma, or lung cancer. In some embodiments, the cancer of secretory cells is non-Hodgkin’s lymphoma, Burkitt’s lymphoma, chronic lymphocytic leukemia, monoclonal gammopathy of undetermined significance (MGUS), plasmacytoma, lymphoplasmacytic lymphoma or acute lymphoblastic leukemia.

[0182] In some embodiments, the disease or disorder is a neurological disorder. Neurological disorders are diseases of the body’s nervous system. Structural, biochemical or electrical abnormalities in the brain, spinal cord or other nerves can result in a range of symptoms. There are more than 600 diseases of the nervous system, such as epilepsy, dementias, Alzheimer’s disease and cerebrovascular diseases including stroke, multiple sclerosis, Parkinson’s disease, amyotrophic lateral sclerosis, migraine, neuroinfections, brain tumors and traumatic disorders of the nervous system such as brain trauma and autism.EXAMPLES

[0183] The following examples are included to demonstrate certain aspects of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the disclosure, and thus can be considered to constitute certain modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific aspects which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the inventions described herein.EXAMPLE 1 - RNAmp

[0184] In a general RNAmp workflow, RNA inputs were first fragmented by magnesium ion (Mg2+) and subjected to immunoprecipitation (using antibodies against RNA-binding300594318.1 - 63 -proteins (RBPs), RNA modifications, or actively translating ribosomes). Immunoprecipitated RNAs were subjected to end-repair, poly(A) tailing before released from beads. RNA carriers were added to the reaction to minimize sample loss. Then a poly(dT) primer was annealed to the poly(A) tail of immunoprecipitated RNA for cDNA generation with a TSO. Resulting cDNA was amplified using PCR to append T7 promoter sequence to an end. In vitro transcription (IVT) was then performed using these T7 promoter-containing cDNAs to yield sense RNA with strand specificity. RNAs were then subjected to RT-PCR reaction to yield high-throughput sequencing compatible DNA libraries. The adaptation of a poly(A) tailing step can enable profiling of short RNA fragments and non-polyadenylated cellular RNAs in addition to polyA tailed mRNAs. The inventors termed this workflow RNAmp because it incorporates high-throughput library construction with RNA amplification (Figure 1).

[0185] This procedure can also avoid ribosome RNA (rRNA) depletion step as rRNA is depleted in the final library without a ribo-minus step, making it extremely attractive for RNA sequencing as well as sequencing RNA from immunoprecipitation or any other procedures that yield low-input RNA samples.

[0186] The RNAmp method can be adapted to any library construction workflows in which the analytes are RNAs in principle (see Step-to-step protocol). Potential applications include but not limited to profiling of RNA modifications using immunoprecipitation or chemical conversions7 9(Figure 2A), RNA immunoprecipitation (RIP)10(Figure 2B), RNA crosslinking immunoprecipitation (CLIP)1^Figure 2B), assay of reverse transcription-based RBP binding site sequencing (ARTR-seq)12(Figure 2C), and translatome / transcriptome analysis13 14in single cells or low-input samples (Figure 2D). While several applications are listed, it should not be construed that these are the only applications as the RNAmp versatility grants its use in almost all RNA-seq applications (Figure 2).

[0187] Direct comparisons between the RNAmp method and SMART-seq2, CEL-seq2, and CATS Small RNA-seq (Diagenode) are included in this section (Figure 3).

[0188] To ensure that low-input libraries prepared using the RNAmp method are of high quality, the inventors performed comprehensive quality control analyses and compared them with libraries generated using the NEBNext Ultra II Directional RNA Library Prep Kit. Quality metrics included GC content and read duplication rates. The RNAmp libraries exhibited expected GC content distributions (Figure 4), and their duplication rates were comparable to those of libraries prepared using the NEBNext Ultra II kit (Figure 5).

[0189] As a proof of concept, the inventors constructed m6A MeRIP-seq libraries using 0.1 ng, 1 ng, and 10 ng of total RNA isolated from human brain tissue. The RNAmp method300594318.1 - 64 -consistently produced high-quality libraries, characterized by high clean read ratios following adapter and low-quality sequence trimming (Figure 6), and mapping ratios exceeding 85% for inputs of 1 ng and 10 ng total RNA (Figure 7). When using as little as 0.1 ng total RNA, approximately equivalent to the RNA content of a single mammalian cell, the mapping ratios for input and immunoprecipitated (IP) samples were 76% and 34%, respectively (Figure 8A).

[0190] RNAmp libraries captured 10,920, 4,918, and 2,594 expressed genes (FPKM greater than or equal to 0.5) from inputs of 10 ng, 1 ng, and 0.1 ng total RNA, respectively (Figure 8B), demonstrating high reproducibility between biological replicates. Furthermore, the inventors identified 12,141, 8,091, and 5,394 significant m6A peaks from the 10 ng, 1 ng, and 0.1 ng input samples, respectively, with substantial overlap across datasets (Figure 8C-E). The identified peaks exhibited enrichment for the GGACU consensus m6A motif, consistent with known methylation patterns (Figure 9). Importantly, the RNAmp method also demonstrated effective depletion of ribosomal RNA reads (Figure 8F), further supporting its robustness and efficiency for low-input RNA-seq and MeRIP-seq applications.

[0191] During application of the RNAmp method to ultra-low RNA input samples, the inventors observed the appearance of long poly(A) tails in read 2 of the resulting RNA-seq data (Figure 10). The presence of these extended poly(A) sequences caused the RNAmp libraries to be biased toward short RNA fragments, resulting in lower mapping ratios and waste of a substantial fraction of sequencing reads. To address this issue, the inventors optimized the design of the reverse transcription (RT) primer (see Step-to-step protocol) and evaluated several reverse transcriptases (see Step-to-step protocol). The inventors found that using poly(T) primers with one or two random bases at the 3 ' end (TisVN (SEQ ID NO: 3) and TisVNN (SEQ ID NO: 4), respectively) effectively shortened the poly(A) tails and mitigated the problem (Figure 11). In contrast, libraries prepared using random hexamer (Ne) RT primers did not exhibit this artifact. Among the tested primers, TisVN (SEQ ID NO: 3 produced longer read lengths and higher mapping ratios than TisVNN (SEQ ID NO: 4) and RTTn_v4, while the Ne RT primer achieved the shortest poly(A) tails, the longest read lengths, and the highest mapping ratios overall (Figure 11). Based on these results, the Ne RT primer was selected for subsequent experiments to demonstrate the downstream applications of the RNAmp method. Furthermore, the inventors screened multiple reverse transcriptases and determined that Maxima H Minus Reverse Transcriptase provided the highest read lengths and mapping ratios compared with the other enzymes tested whether combined with or without In vitro300594318.1 - 65 -transcription (IVT) (Figure 12-13). Therefore, Maxima H Minus Reverse Transcriptase was adopted for all downstream RNAmp assays.

[0192] Currently, the SMART-Seq® Total RNA Kit from TAKARA Bio represents one of the most widely used and best-performing commercial solutions for low-input RNA library preparation. To benchmark the performance of an RNAmp method, the inventors conducted a head-to-head comparison against the TAKARA SMART-Seq workflow. The preliminary results show that RNAmp generates approximately 80 ng of fully tagged IVT RNA from 10 ng of total RNA. In contrast, the TAKARA SMARTer-Seq method, which requires 5 + 12 PCR amplification cycles, produced about 100 ng of library DNA from the same input (Figure 14). These results demonstrate that RNAmp eliminates the need for an additional 12-cycle PCR amplification step and directly produces tagged RNA, simplifying the workflow and reducing amplification bias. qPCR analysis further demonstrated that the RNAmp method faithfully amplifies RNA from inputs as low as 10 pg, equivalent to the RNA content of a single mammalian cell. The relative RNA expression levels obtained from bulk libraries prepared using TAKARA SMART-Seq closely matched those from single-cell RNAmp libraries, confirming the accuracy and reproducibility of RNAmp across input scales (Figure 15). When libraries prepared by RNAmp and TAKARA SMART-Seq using 10 ng, 1 ng, and 0.1 ng total RNA were subjected to sequencing, RNAmp libraries exhibited comparable or slightly higher clean read and mapping ratios than those prepared using the TAKARA kit with equivalent input amounts (Figure 16). When applied to both chromatin- associated RNA and messenger RNA (mRNA) samples, the RNAmp and TAKARA SMART-Seq methods showed comparable coverage across gene bodies, indicating similar transcript representation fidelity (Figure 17).

[0193] Principal component analysis (PCA) and correlation analyses of RNA-seq data generated using both methods further demonstrated that libraries prepared by the same method (either RNAmp or TAKARA SMART-Seq) were highly correlated within replicates, whereas inter- method correlations were slightly lower (Figure 18). Pearson correlation analyses confirmed that biological replicates prepared using the same method showed near-perfect correlation, while modest differences were observed between RNAmp and TAKARA SMART-Seq datasets (Figure 19). These findings suggest that RNAmp captures subtle differences in gene expression profiles compared to the TAKARA SMART-Seq method, potentially reflecting differences in amplification or molecular capture efficiency.

[0194] Current single-cell RNA sequencing (scRNA-seq) technologies aim to characterize transcriptomic heterogeneity at the resolution of individual cells. Widely used methods include300594318.1 - 66 -SMART-seq2, which employs template- switch reverse transcription (RT) followed by Tn5 tagmentation for cDNA library construction; and CEL-seq and CEL-seq2, which utilize T7 in vitro transcription (IVT) and second-strand synthesis for RNA amplification (Figure 20). These approaches have enabled the study of cell-to-cell variability, developmental lineage tracing, and regulatory network analysis across diverse biological systems. However, existing scRNA- seq platforms often require multiple enzymatic steps, high amplification cycles, or complex workflows that limit throughput, introduce bias, and make it difficult to integrate with multi- omic analyses.

[0195] To overcome these limitations, the inventors extended the RNAmp low-input RNA library preparation workflow to a multiplexed single-cell profiling format, developing the RNAmp multiplexed single-cell workflow (Figure 21) (see Step-to-step protocol). Besides the single-cell transcriptome, this method enables simultaneous detection and analysis of multiple RNA-derived molecular signals, including transcriptome, RNA modification, and RNA-protein interaction profiles at the single-cell level. The inventors then applied the RNAmp multiplexed single-cell workflow to mouse germinal vesicle (GV) oocytes, both individually and in small pools, to perform m6A MeRIP-seq and YTHDF2 binding profiling (Figure 22). Similar to observations from bulk-cell m6A and YTHDF2 analyses, m6A and YTHDF2 enrichment detected by RNAmp in GV oocytes were localized primarily to the 3 ' UTRs of representative maternal RNAs (Figure 23). Metagene analyses revealed that m6A modification peaks were enriched around stop codons, consistent with known biological patterns (Figure 24). Heatmaps of m6A MeRIP read density showed consistent m6A enrichment and input signals across identified peaks in libraries generated from 1 and 32 GV oocytes, indicating high reproducibility (Figure 25). Similarly, YTHDF2 profiling using libraries from 1 and 22 GV oocytes exhibited strong reproducibility between replicates (Figure 25). The consensus motif (GGACU) identified from both m6A and YTHDF2-enriched peaks matched the canonical m6A recognition motif observed in bulk m6A-MeRIP libraries prepared using RNAmp (Figure 9).

[0196] The inventors further demonstrated the versatility of the RNAmp multiplexed single-cell workflow by applying it to 16 individual mouse T regulatory (T-reg) cells. From the same single cells, the inventors simultaneously co-profiled RNA expression (RNA-seq), m6A modification, translation activity (ribosome profiling), and YTHDF1 / YTHDF2 binding (Figure 26). Principal component analysis (PCA) of these datasets demonstrated distinct clustering by molecular layer while maintaining strong internal consistency across single cells.300594318.1 - 67 -Step-to-step protocol of a general RNAmp workflow:

[0197] To 15 pl input RNA, add 2 pl 1 Ox T4 PNK buffer A + 0.5 pl SUPERase- In™ RNase Inhibitor (Invitrogen, AM2696) + 2 pl T4 Polynucleotide Kinase (PNK, Thermo Scientific, EK0031). Shake the mixture at 37 °C for 20 minutes at 600 rpm. Then add another 1 pl T4 PNK + 2 pl 10 mM ATP (NEB, P0756S). Shake the mixture at 37 °C for 20 minutes. Heat inactivate T4 PNK at 75 °C for 10 minutes.

[0198] To the mixture, add 1.5 pl 5 M NaCl (Invitrogen, AM9760G) + 1 pl E. coli poly(A) polymerase (NEB, M0276S) + 0.5 pl SUPERase- In™ RNase Inhibitor. Shake the mixture at 37 °C for 20 minutes at 600 rpm. Add 1 pl 500 mM EDTA (Invitrogen, 15575020) to quench the reaction. Extract RNA using Dynabeads™ MyOne™ Silane (Invitrogen, 37002D) and elute in 5 pl water.

[0199] Perform template- switching reverse transcription using Template Switching RT Enzyme Mix (NEB, M0466S). Use oligo(dT) RT primers with well-specific barcodes for multiplexing purposes. Use barcoded unique molecular identifier (UMI) containing TSv5 as the template- switching oligo (TSO). Assemble the following components in a PCR strip: 4 pl RNA / lysed cell, 1 pl 500 nM RT primer, 1 pl 10 mM dNTP mixture.

[0200] Mix well, incubate for 5 minutes at 70 °C, then immediately chill on ice.

[0201] Mix and add 4 ul of the mixture (0.5 pl 20 pM TSO, 2.5 pl TS RT buffer, 1 plTemplate Switching RT Enzyme Mix) to the annealed reaction, mix well.

[0202] Incubate the entire reaction at 42 °C, for 90 minutes and 85 °C for 5 minutes. Hold at 4 °C.

[0203] Perform pre-amplification using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544). To 10 pl TS RT product, add 10 pl water, 25 pl 2x Q5 master mix, 2.5 pl 10 pM V4_Amp_F, 2.5 pl 10 pM V4_Amp_R. Perform cycling using the following parameters: 98 °C 30 s and 5 cycles of (98 °C 30 s + 58 °C 20 s + 72 °C 20 s) and 72 °C 2 minutes, hold at 4 °C.

[0204] Purify reaction twice with 0.8x AMPure XP Reagent (Beckman Coulter, A63880). Elute in 15 pl water, (optional, for multiplexing) pool DNAs together after step 6, 7 or 8 at the artisan’s discretion.

[0205] Perform in vitro transcription reaction using T7 RNA polymerase (NEB, M0251S). Assemble the reaction at room temperature in the following order and incubate at 37 °C for 13 hours with lid temperature set at 70 °C, then hold at 4 °C. 15 pl DNA template, 2 pl lOx reaction buffer, 1 pl NTP mix (25 mM, NEB N0466S), 0.5 pl Murine RNase inhibitor (NEB, M0314S), 2 pl T7 RNA polymerase.300594318.1 - 68 -

[0206] After the reaction is complete, add 1 pl TURBO™ DNase (Invitrogen, AM2238). Incubate at 37 °C for 30 minutes. Purify RNA using silane beads, elute in 15 pl water.

[0207] RT-PCR for DNA library: Perform RT-PCR with Superscript™ III Reverse Transcriptase (Invitrogen, 18080093). Mix 1 pl 10 pM R50X_v3, 1 pl 10 mM dNTP and 11 pl IVT RNA. Incubate the mixture at 65 °C for 5 minutes and then immediately chill on ice. Add 4 pl 5x FS buffer, 1 pl 0.1 M DTT, 1 pl RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen, 10777019), 1 pl SSIII. Incubate the mixture at 50 °C for 30 minutes, 70 °C for 15 minutes and hold at 4 °C. Then qPCR using 1 pl out of 20 pl cDNA.

[0208] Final PCR using NEBNext® Ultra™ II Q5® Master Mix and R50X_v3 / R70X_v3 as primers: 98 °C, 30 s and 5 cycles of (98 °C 30 s + 58 °C 20 s + 72 °C 20 s) and 72 °C for 2 minutes. Purify reaction once with lx AmPure XP beads. Elute in 15 pl water.

[0209] DNA libraries are now ready for Illumina-based sequencing.Step-to-step protocol of Oligo dT or N6 RT primer testing:

[0210] 1. Sample for testing different oligo dT primers:

[0211] Steps: 1) dA tailing; 2) RT by Maximum H minus, by different RT oligo dT primer; 3) 1stPCR of 5 cycles by V4_Amp_R and P5-8bp-index*; 4) xp 0.8x twice; 5) IVT; 6) RT by SSIII; 7) qPCR; 8) Final 2ndPCR by QP1 and 8bp-P7-index*300594318.1 - 69 -

[0212] 2. Sample for testing different N6 primers

[0213] Steps: 1) RT by Maximum H minus, by two N6 primer (with or without Phosphorothioate); 2) 1stPCR of 5 cycles by V4_Amp_R and P5-8bp-index*; 3) xp 0.8x twice;4) IVT; 5) RT by SSIII; 6) qPCR; 7) Final 2ndPCR by QP1 and 8bp-P7-index*300594318.1 - 70 -

[0215] 4 Protocol

[0216] 1. dA tailing

[0217] To 15 pl RNA, add 2 pl commercial lOx T4 PNK buffer-i- 0.5 pl SUPERaselN + 0.5 pl T4 PNK + 1 pl 10 mM ATP + 0.5 pl polyA polymerase (NEB M0276S). Shake suspension at 37 °C, 900 rpm for 30 minutes. Recover RNA using RCC-5, elute in 6 pl water.

[0218] 2. Reverse transcription

[0219] For sample 1-24 using 500 nM oligo dT primer, the final RT primer is 50 nM300594318.1 - 71 -

[0220] For sample 25-32 using random primer, the final RT primer is 600 nM. Mix well and 72°C 3 min, 4°C pause.

[0221] Maxima H mix

[0222] Add following RT mixture, 25°C 10 min; 50°C 30 min, 42°C 60 min; 70°C 5 min;85°C 10 min, 4°C hold

[0223] Based on Maxima H Minus Reverse Transcriptase manual:

[0224] If an oligo(dT)18 primer or gene-specific primer is used, incubate for 15-30 min at50 °C. If a random hexamer primer is used, incubate for 10 min at 25 °C followed by 30 min at 50 °C. For transcription of GC-rich RNA, the reaction temperature can be increased to 65 °C. Terminate the reaction by heating at 85 °C for 5 minutes.

[0225] 3. PCR300594318.1 - 72 -

[0226] 95°C 3 min, then 5 cycles of : 98°C 20s, 65°C for 30s, 72°C for 30s; 72°C 2 min

[0227] 4. XP Purify with 0.8 X xp, twice. Elute in 20 uL

[0228] 5. Take ALL for IVT

[0229] 6. With IVT protocol

[0230] Perform in vitro transcription reaction T7 RNA polymerase (M0251S)

[0231] 37°C 13 hr, qubit

[0232] 7. After the reaction is complete, add 1 pl TURBO™ DNase (Invitrogen, AM2238).Incubate at 37 °C for 30 minutes.

[0233] 8. Purify RNA using RCC-5 (Zymo), elute in 7 pl water.

[0234] 9. SSIII reverse transcription by QP1

[0235] Add the RT mixl, then 65°C 5min, 4C pause;

[0236] Then add the RT mix2, 50°C 30 min, 70°C 15 min, 4°C pause.300594318.1 - 73 -

[0237] 10. RT-PCR for DNA library: take 0.5 uL out of 20 uL cDNA from Step 8

[0238] qPCR program: 95°C 10 min; 35 cycles of 95°C 15s, 63°C 20s, 72°C 30s;

[0239] 11. Final library PCR by QP1 and P7-8bp-index

[0240] 12. Purify with XP from Vazyme, 0.8x, twice. Elute in 15 uL

[0241] Step-to-step protocol of RT enzymes test:

[0242] Start material: Sample Nos. 1-32 is HepG2 rRNA-deleted twice 200bp for. SampleNos. 33-64 is half of the samples 1-32 but performed the IVT step.300594318.1 - 74 -

[0243] RT primer: P5-N6-oligol300594318.1 -75-

[0244] 1 Mix well and 72 °C 3 min

[0245] 2 Reverse transcription. Add the RT mix, 25° C 5 min; 42 ° C 5 min; 50° C 10 min; 42° C 55 min; 50° C 20 min; 70° C 5 min; 85° C 10 min, 4° C hold

[0246] The reason of first “42 ° C 5 min; 50° C 10 min”: SSIV has very high efficiency and could finish the RT by 10 min at 50° C. Since the SSIV has worse performance compared to SSIII and Maxiam H minus, next time, the RT program could be “72° C 3 min, pause; 25 ° C 5 min; 42° C 60 min; 50° C 30 min; 70° C 5 min; 85° C 10 min, 4° C hold”

[0247] Heat deactivation of RT enzyme:

[0248] SS2 mix300594318.1 - 76 -

[0249] SS3 mix

[0250] SS4 mix

[0251] Maxima H mix300594318.1 -77-

[0252] 3 PCR

[0253] 95°C 3 min, then 5 cycles of : 98°C 20s, 65°C for 30s, 72°C for 30s; 72°C 2 min

[0254] 4. XP Purify with 0.8 X xp, twice. Elute in 20 uL

[0255] 5. Take Vi for IVT, the rest Vi index PCR

[0256] With IVT protocol

[0257] 10. Perform in vitro transcription reaction T7 RNA polymerase (M0251S)0258] 37°C 13 hr, qubit300594318.1 - 78 -

[0259] 11. After the reaction is complete, add 1 pl TURBO™ DNase (Invitrogen,AM2238). Incubate at 37 °C for 30 minutes. Purify RNA using RCC-5 (Zymo), elute in 7 pl water.

[0260] 12. RT-PCR for DNA library: Perform RT-PCR with SuperScript™ III ReverseTranscriptase (Invitrogen, 18080093). Mix 0.5 pl 10 pM R50X_v3 QP1, 0.5 pl 10 mM dNTP and 5.5 pl IVT RNA. Incubate the mixture at 65 °C for 5 minutes and then immediately chill on ice. Add 2 pl 5x FS buffer, 0.5 pl 0.1 M DTT, 0.5 pl RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen, 10777019), 0.5 pl SSIII. Incubate the mixture at 50 °C for 30 minutes, 70 °C for 15 minutes and hold at 4 °C. Then qPCR using 1 pl out of 20 pl cDNA.

[0261] 6. Final 2ndPCR and purify with XP 0,8x twice.

[0262] Without IVT protocolStep-to-step protocol of RNAmp multiplexed single-cell workflow:

[0263] Antibody-beads conjugation:

[0264] For each IP. Number of IP reactions equals to number of 96 well plates for each antibody

[0265] Abl (m6A): wash 5 pl Dynabeads protein A beads with lx m6A IP buffer for three times. Rotate with 1 pl anti-m6A antibody (CST 56593) and 1000 pl lx m6A IP buffer at 4°C for 1 hour. Wash for three times with lx m6A IP buffer and keep on ice.

[0266] Ab2 (riboLace): A volume of 5 pl of Dynabeads MyOne Streptavidin Cl (Invitrogen, 65001) were washed for 5 min with a 0.05 M NaCl, 0.1 M NaOH, in DEPC-treated water. Then, beads were washed with 500 mL of nuclease free water and with Binding Buffer (2 M NaCl, 10 mM Tris-HCl, pH 7.5 in DEPC water). For functionalization with biotin-3P (MedChemExpress, HY- 148865), 0.5 pl of a 1 mM solution of 3P in Binding Buffer was added to the beads followed by an incubation of 1 h, mixing at 1400 rpm at 20°C. Wash for three times with lx m6A IP buffer and keep on ice.

[0267] Ab3 (YTHDF1): wash 5 pl Dynabeads protein A beads with lx m6A IP buffer for three times. Rotate with 1 pl anti-YTHDFl antibody (Abeam, ab220162) and 1000 pl lx m6A IP buffer at 4°C for 1 hour. Wash for three times with lx m6A IP buffer and keep on ice.

[0268] Ab4 (YTHDF2): wash 5 pl Dynabeads protein A beads with lx m6A IP buffer for three times. Rotate with 1 pl anti-YTHDF2 antibody (Abeam, ab220163) and 1000 pl lx m6A IP buffer at 4°C for 1 hour. Wash for three times with lx m6A IP buffer and keep on ice.

[0269] Beads preparation, can be done during cell fixation:

[0270] Resuspend the ConA beads and transfer 11 pL per reaction (< 0.5M cells) to a 1.5 mL tube. Remove supernatant via magnetic rack.300594318.1 - 79 -

[0271] Wash beads twice with 100 pl / reaction ice-cold Bead Activation Buffer (20 mM HEPES pH7.9, 10 mM KC1, 1 mM CaCl2, 1 mM MnCl2)

[0272] Resuspend beads in 11 pl / reaction cold Bead Activation Buffer and keep on ice before use.

[0273] Cell fixation:

[0274] Harvest cells. For suspension cell cultures, spin for 3 minutes at 600 x g at room temperature (RT) in a 1.5 mL tube. For adherent cells, detach using 0.25% Trypsin-EDTA at 37°C. Measure cell numbers. Use 0.5 M cells for this run.

[0275] Thaw digitonin from -20°C

[0276] Cell fixation.

[0277] I) For PFA fixation, resuspend cells in 100 pl / reaction DPBS and add 7 pl 16% formaldehyde solution (methanol free), resuspend well and incubate at 25°C for 10 minutes. Add 10 pl IM glycine to quench reaction.

[0278] Centrifuge suspension at 4°C, 1,000 g for 3 minutes.

[0279] Wash cells once by resuspending in 100 pE / reaction (0.5M cells) Wash Buffer (20 mM HEPES pH7.5, 150 mM NaCl, lx Halt proteinase & phosphatase inhibitor + 0.1% SUPERaselN), spin for 3 minutes at 1000 x g at 4°C, remove supernatant.

[0280] Resuspend cells in 100 pL / reaction Wash Buffer. Pipette to mix.

[0281] Add 10 pL of activated ConA beads per 100 pL washed cells. Gently vortex to mix.

[0282] Incubate cell - bead slurry for 10 min on an end-to-end rotor at room temperature.

[0283] Remove supernatant with a magnet, resuspend beads in 100 pl per reaction Wash Buffer + 0.01% Digitonin, and rotate at room temperature for 10 minutes to permeabilize cells.

[0284] End repair / polyA tailing and nucleus staining:

[0285] Remove supernatant with a magnet, resuspend beads in 100 pl per reaction Wash Buffer and remove supernatant

[0286] Wash once briefly with ultrapure water.

[0287] Remove supernatant with a magnet, resuspend beads in 20 pl ERPA mix (2 pl commercial lOx T4 PNK buffer A + 0.5 pl SUPERaselN + 0.5 pl T4 PNK + 1 pl 100 mM ATP + 1 pl polyA polymerase + 15 pl water). Shake suspension at 37°C, 900 rpm for 30 minutes.

[0288] After the reaction, remove supernatant using a magnet.

[0289] Resuspend cells using 100 pl per reaction Wash Buffer with lx Hoechst 33342, incubate at room temperature for 10 minutes. Remove supernatant.

[0290] Resuspend 0.5 million cells in 1 ml DPBS + 0.1% SUPERaselN and keep on ice before sorting300594318.1 - 80 -

[0291] Cell sorting:

[0292] Prepare 4 pl Wash Buffer (20 mM HEPES pH7.5, 150 mM NaCl, should add 0.01% digitonin next time 0.1% Halt proteinase & phosphatase inhibitor+ 0.1% SUPERaseIN)+ 1 pl 500 nM RTv5.5_XX in each well of a 96 well plate. Seal and number the plates.

[0293] Bring plates, more sealing films, sealing tool and cell suspension to cell sorting facility

[0294] Collect sorted single cells to plates containing barcoded primers. Bring back to the lab.

[0295] Primer annealing:

[0296] Briefly centrifuge to collect liquid to the bottom. Shake at 25 °C for 10 minutes with 1,400 rpm. Now each well was one cell in 4 pl Wash Buffer with 1 pl 500 nM RTv5.5_XX RT primer.

[0297] Immunoprecipitation :

[0298] Combine wells from the same plate into a single eppendorf tube, try not to replace pipette tips. Each tube are for one TSO.

[0299] Add 500 pl 2x denaturing lysis buffer (20 mM EDTA, 1% NP-40, 0.2% Triton X- 100, 0.2% SDS, 0.2% sodium deoxycholate, lx Halt proteinase & phosphatase inhibitor, lx SUPERaselN RNase inhibitor) to each well. (Next time add less and use more concentrated ones) Tubes were incubated at 4°C for 10 minutes on an end-to-end rotator.

[0300] Wash antibody-conjugated beads and separate cell lysates: For four IP reactions, use 200 pl for each IP. Apply to washed beads with supernatant just removed.

[0301] Rotate at 4°C for 1 hour on an end-to-end rotor.

[0302] Wash beads for 3 times using lx m6A reaction buffer, each wash was 100 pl

[0303] Briefly wash twice with pure water to get rid of detergents

[0304] Wash once using lx FS buffer (50 mM Tris pH8.0, 75 mM KC1, 3 mM MgCh)

[0305] Perform on-beads template- switching RT.

[0306] Mix and add 20 pl of the mixture to pooled beads with liquid removed just before adding the mixture, mix well. Shake at 25°C for 30 minutes to allow initial elongation, then shake at 42°C, 60 minutes. Hold at 4°C.300594318.1 - 81 -| Oligo (20 pM) | | |

[0307] Incubate beads at 80°C for 10 minutes and immediately separate beads and supernatant, keep supernatant for PCR pre-amplification.

[0308] Pool samples with different TSO to the same library ID (see in the experimental design chart).

[0309] Pre-amplification:

[0310] Pre-mix 50 pl 2x NEBNext® Mitra™ II Q5® Master Mix (NEB, M0544), 5 pl 10 pM V4_Amp_F + 5 pl 10 pM V4_Amp_R, 20 pl water and add to 20 pl RT reaction. PCR for 5 cycles. 98°C 30s and 5 cycles of (98°C 30s + 58°C 20s + 72°C 20s) and 72°C 2 minutes.

[0311] Isolate residual protein A / G beads using a magnet first. Purify reaction twice with 0.8x AMPure XP beads. Elute in 15 pl water.

[0312] In vitro transcription (IVT):

[0313] Perform IVT using NEB M0251S. Add 2 pl lOx T7 RNA polymerase reaction buffer, 1 pl NTP mix (25 mM each), 0.5 pl Murine RNase inhibitor, 2 pl T7 RNA polymerase the reaction at room temperature in the following order and incubate at 37 °C for 13 hours with lid at 70°C, then hold at 4°C.

[0314] Add 1 pl TURBO Dnase, incubate at 37°C 30 minutes. Add 80 pl RLT buffer with 5 pl washed silane beads (now 100 pl in total) and add 100 pl 100% EtOH. Purify RNA with silane beads standard protocol. Elute in 15 pl water.300594318.1 - 82 -

[0315] RT-PCR for DNA library:

[0316] Perform RT-PCR with SuperScript III. Use 1 pl 10 pM R50X_v3, 1 pl 10 mM dNTP and 11 pl IVT RNA. 65°C 5 minutes then chill on ice. Add 4 pl 5x FS buffer, 1 pl 0. IM DTT, 1 pl RNaseOUT, 1 pl SSIII. Incubate at 50°C for 30 minutes and 70°C for 15 minutes.

[0317] Then qPCR to analyze cDNA content using 1 pl out of 20 pl cDNA

[0318] Perform final PCR using NEBNext® Mitra™ II Q5® Master Mix (NEB, M0544). 25 pl 2x Q5 master mix, 2.5 pl 10 pM R50X_v3. 2.5 pl 10 pM R70X_v3 and add desired amount of cDNA. PCR at 98°C 30s and 6 cycles of (98°C 30s + 58°C 20s + 72°C 20s) and 72 °C for 2 minutes. Purify reaction once with lx AmPure XP beads. Elute in 15 pl water. Measure Qubit concentration.EXAMPLE 2 - Sequences

[0319] Sequences of nucleic acids used in aspects and examples described herein include:300594318.1 - 83 -300594318.1 - 84-300594318.1 -85-300594318.1 - 86-300594318.1 -87-* * *

[0320] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of certain aspects, it will be apparent to those of skill in the art that variations can be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related can be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications300594318.1 - 88 -apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.REFERENCES

[0321] All references cited herein, including patent applications, patent publications, and Accession numbers, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically herein incorporated by reference in their entirety, as if each individual reference were specifically and individually indicated to be incorporated by reference.1. Lotfoilahi, M., Yuhan Hao, Theis, F.J., and Satija, R. (2024). The future of rapid and automated single-cell data analysis using reference mapping. Cell 187, 2343-2358. https: / / doi.Org / 10.1016 / j.cell.2024.03.009.2. Ramskold, D., Luo, S., Wang, Y. C., Li, R., Deng, Q., Faridani, O.R., Daniels, G.A., Khrebtukova, I., Loring, J.F., Laurent, L.C., et al. (2012). Full-length mRNA-Seq from singlecell levels of RNA and individual circulating tumor cells. Nat Biotechnol 30, 777-782. https: / / doi.org / 10.1038 / nbt.2282.3. Picelli, S., Faridani, O.R., Bjorklund, A.K., Winberg, G., Sagasser, S., and Sandberg, R. (2014). Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc 9, 171-181. https: / / doi.org / 10.1038 / nprot.2014.006.4. Picelli, S., Bjorklund, A.K., Faridani, O.R., Sagasser, S., Winberg, G., and Sandberg, R. (2013). Smart-seq2 for sensitive full-length transcriptome profiling in single cells. Nat Methods 10, 1096-1098. https: / / doi.org / 10.1038 / nmeth.2639.5. Hashimshony, T., Wagner, F., Sher, N., and Yanai, I. (2012). CEL-Seq: Single-Cell RNA-Seq by Multiplexed Linear Amplification. Cell Reports 2, 666-673. https: / / doi.Org / 10.1016 / j.celrep.2012.08.003.6. Hashimshony, T., Senderovich, N., Avital, G., Klochendler, A., De Leeuw, Y., Anavy,L., Gennert, D., Li, S., Livak, K.J., Rozenblatt-Rosen, O., et al. (2016). CEL-Seq2: sensitive highly-multiplexed single-cell RNA-Seq. Genome Biol 17, 77. https: / / doi.org / 10.1186 / sl3059-016-0938-8.7. Dominissini, D., Moshitch-Moshkovitz, S., Schwartz, S., Salmon-Divon, M., Ungar, L., Osenberg, S., Cesarkas, K., Jacob-Hirsch, J., Amariglio, N., Kupiec, M., et al. (2012). Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485, 201-206. https: / / doi.org / 10.1038 / naturel 1112.300594318.1 - 89 -8. Hu, L., Liu, S., Peng, Y., Ge, R., Su, R., Senevirathne, C., Harada, B.T., Dai, Q., Wei,J., Zhang, L., et al. (2022). m6A RNA modifications are measured at single-base resolution across the mammalian transcriptome. Nat Biotechnol 40, 1210-1219. https: / / doi.org / 10.1038 / s41587-022-01243-z.9. Xiao, Y.-L., Liu, S„ Ge, R„ Wu, Y„ He, C„ Chen, M„ and Tang, W. (2023). Transcriptome-wide profiling and quantification of N6-methyladenosine by enzyme-assisted adenosine deamination. Nat Biotechnol 41, 993-1003. https: / / doi.org / 10.1038 / s41587-022- 01587-6.10. McHugh, C.A., Russell, P., and Guttman, M. (2014). Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biol 15, 203. https: / / doi.org / 10.1186 / gb4152.11. Ule, J., Jensen, K.B., Ruggiu, M„ Mele, A., Ule, A., and Darnell, R.B. (2003). CLIP Identifies Nova-Regulated RNA Networks in the Brain. Science 302, 1212-1215. https: / / doi.org / 10.1126 / science.1090095.12. Xiao, Y„ Chen, Y.-M., Zou, Z„ Ye, C„ Dou, X., Wu, J., Liu, C„ Liu, S„ Yan, H„ Wang, P., et al. (2024). Profiling of RNA-binding protein binding sites by in situ reverse transcriptionbased sequencing. Nat Methods 21, 247-258. https: / / doi.org / 10.1038 / s41592-023-02146-w.13. Clamer, M., Tebaldi, T., Lauria, F., Bemabd, P., Gomez-Biagi, R.F., Marchioretto, M., Kandala, D.T., Minati, L., Perenthaler, E., Gubert, D., et al. (2018). Active Ribosome Profiling with RiboLace. Cell Reports 25, 1097-1108. e5. https: / / doi.Org / 10.1016 / j.celrep.2018.09.084.14. Battich, N., Beumer, J., De Barbanson, B., Krenning, L., Baron, C.S., Tanenbaum, M.E., Clevers, H., and Van Oudenaarden, A. (2020). Sequencing metabolically labeled transcripts in single cells reveals mRNA turnover strategies. Science 367, 1151-1156. https: / / doi.org / 10.1126 / science.aax3072.300594318.1 - 90 -

Claims

1. CLAIMSWhat is claimed is:

1. A method of generating a ribonucleic acid (RN A)- sequencing library from a sample comprising a plurality of RNAs, the method comprising: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the plurality of RNAs; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; and generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs.

2. The method of claim 1, wherein the plurality of RNAs are fragmented by magnesium ions.

3. The method of claim 1 or 2, further comprising fragmenting the plurality of RNAs via magnesium ions.

4. The method of any one of claims 1 to 3, wherein the plurality of RNAs are obtained by RNA immunoprecipitation.

5. The method of any one of claims 1 to 3, further comprising immunoprecipitating the plurality of RNAs.

6. The method of claim 4 or 5, wherein the immunoprecipitation comprises immunoprecipitating RNA bound to an RNA binding protein.

7. The method of claim 4 or 5, wherein the immunoprecipitation comprises immunoprecipitating RNA bound to a protein of interest.300594318.1 - 91 -8. The method of claim 4 or 5, wherein the immunoprecipitation comprises immunoprecipitating RNA bound to a ribosome.

9. The method of claim 4 or 5, wherein the immunoprecipitation comprises immunoprecipitating RNA having a chemical modification.

10. The method of claim 9, wherein the chemical modification is a methylation and / or a pseudouridine.

11. The method of any one of claims 1 to 10, wherein the step of adding polyA tails is performed during an RNA immunoprecipitation.

12. The method of any one of claims 1 to 11, wherein the template DNA is pooled prior to in vitro transcribing.

13. The method of any one of claims 1 to 12, wherein the cDNA comprises an index sequence.

14. The method of claim 13, wherein the index sequence is a P7 sequence and / or a P5 sequence.

15. The method of any one of claims 1 to 14, wherein the reverse transcribing the transcribed RNAs comprises reverse-transcription polymerase chain reaction (RT-PCR).

16. A method comprising the steps of: fragmenting ribonucleic acids (RNAs) via magnesium ions to generate fragmented RNAs binding the fragmented RNAs to beads comprising an RNA-targeting protein or RNA-binding protein-targeting protein; end repairing the fragmented RNAs and adding a polyadenylation tail to the fragmented RNAs to generate polyadenylated RNAs; releasing the polyadenylated RNAs from the beads to generate a plurality of polyadenylated RNAs; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:300594318.1 - 92 -(a) a primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; adding a T7 promoter sequence to the plurality of first strand DNA oligonucleotides; in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) using primers containing a P7 primer and index sequence and a P5 primer and index sequence; and amplifying the cDNA by polymerase chain reaction.

17. A method comprising the steps of: adding a polynucleotide kinase to first sample comprising a plurality of fragmented ribonucleic acids (RNAs) and incubating the first sample in conditions sufficient to end repair the fragmented RNAs to generate end repaired RNAs; adding an E. coli poly(A) polymerase to the first sample and incubating the sample in conditions sufficient to add a polyadenylation tail to the end repaired RNAs to generate polyA RNAs; extracting the polyA RNAs to a second sample; adding template- switching oligonucleotides, a plurality of reverse-transcription primers comprising a polythymidine sequence and / or a random oligonucleotide sequence and each having a unique molecular identifier, and a template switching reverse transcriptase to the second sample and incubating the second sample in conditions sufficient to reverse transcribe the polyA RNAs to generate a plurality of first strand oligonucleotides; adding sequencing library preparation reagents to the second sample to generate a plurality of second strand oligonucleotides thereby making a plurality of template DNAs, wherein the first strand and second strand oligonucleotides are complementary and wherein the template DNA comprises an RNA polymerase promoter sequence; purifying the plurality of template DNAs to a third sample;300594318.1 - 93 -adding an RNA polymerase to the third sample and incubating the third sample in conditions sufficient to generate a plurality of transcribed RNAs from the template DNA; purifying the plurality of transcribed RNAs to a fourth sample; adding a reverse transcriptase to the fourth sample and incubating the fourth sample in conditions sufficient to reverse transcribe the plurality of transcribed RNAs; and adding sequencing library preparation reagents to the fourth sample and incubating the fourth sample in conditions sufficient to generate a library of cDNA.

18. A method for preparing a sequencing library from a population of cells, the method comprising the steps of: sorting each cell in the population of cells into separate vesicles; barcoding RNAs in each cell by incubating a nucleic acid comprising a specific barcoded unique molecular identifier in each vesicle containing a cell from the population of cells to generate a plurality of barcoded RNAs; pooling the population of cells; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of barcoded RNAs using:(a) a plurality of primers, wherein each of the primers in the plurality of primers comprises a sequence that hybridizes one of the barcoded unique molecular identifiers on the barcoded RNAs; and(b) a template- switching oligonucleotide; in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; and reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) for the sequencing library.

19. A method for preparing a sequencing library from a population of cells, the method comprising the steps of: end repairing and polyadenylating ribonucleic acids (RNA) in the population of cells to generate a plurality of polyadenylated RNAs in the population of cells;300594318.1 - 94 -sorting each cell in the population of cells into separate vesicles; barcoding the plurality of polyadenylated RNAs in each cell with a specific barcoded unique molecular identifier to generate barcoded RNAs; pooling the population of cells; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of barcoded RNAs using:(a) a plurality of primers, wherein each of the primers in the plurality of primers comprises (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a sequence that hybridizes one of the barcoded unique molecular identifiers on the barcoded RNAs; and(b) a template- switching oligonucleotide; adding a T7 promoter sequence to the plurality of first strand DNA oligonucleotides; in vitro transcribing the plurality of first strand DNA oligonucleotides to generate a plurality of transcribed RNAs; and reverse transcribing the transcribed RNAs to generate complementary DNA (cDNA) using a set of primers, wherein one primer in the set of primers contains a P7 primer and index sequence and another primer in the set of primers contains a P5 primer and index sequence.

20. The method of claim 19, further comprising fixing cells in the population of cells before the end repairing step.

21. The method of claim 19 or 20, further comprising permeabilizing the population of cells prior to the end repairing step.

22. The method of any of claims 18 to 21, further comprising conjugating the population of cells to beads prior to the sorting step.

23. The method of claim 22, wherein the beads comprise concanavalin A beads.

24. The method of any one of claims 18 to 23, further comprising immunoprecipitating a protein of interest from the plurality of cells.

25. The method of claim 24, wherein the protein of interest is an RNA-binding protein.300594318.1 - 95 -26. The method of any one of claims 18 to 25, wherein the population of cells are obtain from a patient.

27. The method of any one of claims 18 to 26, wherein the population of cells are obtained from a biopsy.

28. The method of any one of claims 1 to 27, further comprising sequencing the cDNA.

29. The method of any one of claims 1 to 28, wherein the method does not comprise a ribosome RNA depletion step.

30. A method of analyzing RNA from a biological sample obtained from a patient, the method comprising: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the biological sample; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs; and analyzing the cDNA.

31. The method of claim 30, wherein the biological sample comprises cell-free RNA.

32. The method of claim 32, wherein the cell-free RNA comprises cell-free mRNA, circulating microRNA, circulating tRNA, circulating rRNA, or extracellular vesicle- associated RNA.300594318.1 - 96 -33. The method of any one of claims 30 to 32, wherein the biological sample comprises blood, plasma, serum, cerebrospinal fluid, or urine.

34. The method of any one of claims 30 to 32, wherein the biological sample comprises a biopsy.

35. The method of claim 34, wherein the biopsy is a fine-needle aspirate biopsy.

36. The method of claim 34 or 35, wherein the biopsy is a tumor biopsy, an organ biopsy, or a lesion biopsy.

37. A method of detecting and / or quantifying RNA expression in a cell and / or detecting RNA modifications in a cell, the method comprising: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the cell; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs; and analyzing the cDNA to detect and / or quantify RNA expression in the cell and / or detect RNA modifications in the cell.

38. A method of detecting RNA-protein-of-interest interactions in a cell, the method comprising: generating a plurality of polyadenylated RNAs by adding polyA tails to RNAs in the cell;300594318.1 - 97 -immunoprecipitating the protein-of-interest from the cell, wherein the plurality of polyadenylated RNAs are co-immunoprecipitated with the protein of interest; generating a plurality of first strand deoxyribonucleic acid (DNA) oligonucleotides by reverse transcribing the plurality of polyadenylated RNAs using:(a) primer comprising (i) a polythymidine sequence that binds to the polyA tails and / or a random oligonucleotide sequence, and (ii) a barcoded unique molecular identifier, and(b) a template- switching oligonucleotide; generating plurality of second strand DNA oligonucleotides complementary to the first strand DNA oligonucleotides thereby generating a plurality of template DNA; generating a plurality of transcribed RNAs by in vitro transcribing the plurality of template DNA; generating complementary DNA (cDNA) by reverse transcribing the transcribed RNAs; and analyzing the cDNA to detect the RNA-protein-of-interest interaction.

39. The method of any one of claims 30 to 38, wherein the analyzing comprises sequencing the cDNA.

40. A kit comprising one or more reagents for performing the method of any one of claims 1 to 39.

41. A kit comprising reagents for end repairing and reagents for adding a polyadenylation tail to fragmented RNA; reagents for template-switching reverse transcribing polyadenylated RNA; sequencing library preparation reagents; in vitro transcription reagents; and reagents for reverse transcription polymerase chain reaction (RT-PCR).

42. The kit of claim 41, wherein the reagents for end repairing comprise a polynucleotide kinase and one or more buffers compatible with the polynucleotide kinase.

43. The kit of claim 41 or 42, wherein the reagents for adding a polyadenylation tail comprise an E. coli poly(A) polymerase and one or more buffers compatible with the polymerase.300594318.1 - 98 -44. The kit of any one of claims 41 to 43, wherein the reagents for template-switching reverse transcribing polyadenylated RNA comprise: a plurality of primers having a polythymidine sequence and each having a unique molecular identifier; a template switching oligonucleotide; a template- switching reverse transcriptase; and one or more buffers compatible with the reverse transcriptase.

45. The kit of any one of claims 41 to 44, wherein the sequencing library preparation reagents comprise a DNA polymerase and primers sufficient to amplify template DNA.

46. The kit of any one of claims 41 to 45, wherein the in vitro transcription reagents comprise an RNA polymerase and one or more buffers compatible with the RNA polymerase.

47. The kit of claim 46, wherein the RNA polymerase is a T7 RNA polymerase.

48. The kit of any one of claims 41 to 47, wherein the reagents for RT-PCR comprise a reverse transcriptase and one or more buffers compatible with the reverse transcriptase.300594318.1 - 99 -

Images