Animal model incorporating fluorescent protein variant and use thereof
An animal model with an EGFP variant addresses the limitations of conventional methods by enabling real-time observation of cell damage and apoptosis, enhancing drug toxicity evaluation.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- KOREA RES INST OF BIOSCIENCE & BIOTECHNOLOGY
- Filing Date
- 2025-01-17
- Publication Date
- 2026-06-11
Smart Images

Figure KR2025001013_11062026_PF_FP_ABST
Abstract
Description
Animal models with introduced fluorescent protein variants and their uses
[0001] The present invention relates to an animal model into which a fluorescent protein variant has been introduced and to the use thereof.
[0002] Apoptosis, also known as programmed cell death, is a type of programmed cell death observed in multicellular organisms. Apoptosis plays a crucial role in the development and maintenance of homeostasis in living organisms and can be divided into extrinsic and intrinsic pathways.
[0003] Observing cell damage and apoptosis is a critical task in drug development and life science research; conventionally, methods such as TUNEL staining, enzyme activity evaluation (using substrates and colorimetric kits), and flow cytometry (PI / Annexin V staining) have been widely used. However, these methods have drawbacks, such as being non-invasive, making real-time observation difficult, and potentially leading to inconsistencies in data depending on analysis conditions.
[0004] Therefore, there is a need for research on methods that can stably express cells in vitro and in vivo and monitor the progression of cell damage and death in real time.
[0005] One aspect is to provide an animal model into which an EGFP (Enhanced Green Fluorescent Protein) variant containing the amino acid sequence represented by SEQ ID NO. 1 is introduced.
[0006] Another aspect provides a method for preparing an animal model, comprising the step of introducing into an animal a gene encoding an EGFP variant containing the amino acid sequence represented by SEQ ID NO. 1.
[0007] Another aspect provides a method for real-time observation of cell damage or apoptosis, comprising the steps of: administering a sample to the animal model; and measuring the expression of an EGFP variant in the animal model administered the sample.
[0008] Another aspect provides a method for evaluating drug toxicity, comprising the steps of: administering a sample to the animal model; and measuring the expression of an EGFP variant in the animal model administered the sample.
[0009] Another aspect is to provide a use for an EGFP variant containing the amino acid sequence represented by SEQ ID NO. 1 for the manufacture of animal models.
[0010] Another aspect is providing the use of the above animal model for real-time observation of cell damage or apoptosis.
[0011] Another aspect is providing the use of the above animal model for drug toxicity evaluation.
[0012] One aspect provides an animal model into which an EGFP (Enhanced Green Fluorescent Protein) variant containing the amino acid sequence represented by SEQ ID NO. 1 is introduced.
[0013] In one embodiment, the amino acid sequence represented by SEQ ID NO. 1 is a caspase (e.g., caspase-3 or caspase-7) recognition sequence that can be cleaved by a caspase.
[0014] The term "caspase" in the present invention refers to a type of proteolytic enzyme that causes apoptosis by cleaving a specific site of a target protein. Specifically, caspases 8, 9, 10, etc. can act at the beginning of cell damage to activate the caspase cascade, and caspases 2, 3, 6, 7, etc. can ultimately degrade DNA and proteins to cause apoptosis.
[0015] The term "EGFP (Enhanced Green Fluorescent Protein)" refers to an enhanced green fluorescent protein that exhibits green fluorescence when exposed to light in the blue to ultraviolet range. Sequences known in the art may be used for the EGFP sequence.
[0016] The term "variant" in the present invention includes fragments and polypeptides having an amino acid sequence altered due to amino acid substitution, deletion, or insertion. Variants may occur naturally or be produced artificially, and artificial variants may be produced using mutagenic techniques known in the art. Additionally, variant polypeptides may include conservative or non-conservative amino acid substitutions, deletions, or additions.
[0017] In the present invention, "conservative substitution" means substituting an amino acid residue with an amino acid residue having a similar side chain without causing a loss of the biological or biochemical function of the polypeptide or protein. A class of amino acid residues having a similar side chain is defined in the art and is well known. These classes include amino acids having basic side chains (e.g., lysine, arginine, histidine), amino acids having acidic side chains (e.g., aspartic acid, glutamic acid), amino acids having uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids having nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids having beta-branched side chains (e.g., threonine, valine, isoleucine), and amino acids having aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0018] The EGFP variant according to the present invention may include a DEVDG sequence in which the asparagine-isoleucine-glutamic acid (NIE) sequence within the amino acid sequence of the pre-mutation EGFP is replaced with an aspartic acid-glutamic acid-valine (DEV) sequence.
[0019] The above-mentioned variant EGFP includes not only the natural form but also its agonists, fragments, variants, and derivatives having fluorescent activity. That is, it is obvious that polypeptides or proteins having amino acid sequences in which some sequences are deleted, modified, substituted, or added are included within the scope of this application, provided that they have amino acid sequences that exhibit fluorescence corresponding to EGFP.
[0020] In one embodiment, the DEVDG sequence may be located in a hinge region that does not affect EGFP function. The "hinge region that does not affect EGFP function" refers to a portion that does not affect the function of the protein even if the amino acid sequence of the region is mutated.
[0021] Additionally, variants of the present invention may include deletions or additions of amino acids that have minimal effect on the characteristics and secondary structure of the polypeptide, and, for example, a signal (or leader) sequence involved in the co-translational or post-translational translocation of the protein may be conjugated to the N-terminus of the variant.
[0022] Additionally, variants of the present invention may be conjugated with other sequences or linkers so as to be identified, purified, or synthesized.
[0023] Furthermore, if a variant of the present invention has the same or corresponding activity, it does not exclude meaningless sequence additions before or after the amino acid sequence other than the variant of the present invention, naturally occurring mutations, or silent mutations thereof; it is evident that even in cases having such sequence additions or mutations, they fall within the scope of the present invention.
[0024] In one embodiment, the animal may be selected from the group consisting of rats, mice, guinea pigs, hamsters, dogs, cats, rabbits, cattle, sheep, pigs, guinea pigs, and monkeys.
[0025] Specifically, the animal may be an animal that carries a fetus in the womb through a placenta, may be a mammal, and may be one or more selected from the group consisting of rats, mice, guinea pigs, hamsters, dogs, cats, rabbits, cattle, sheep, pigs, guinea pigs, and monkeys excluding humans, and more specifically, may be a mouse.
[0026] The term "animal model" in this invention refers to an animal model having a disease that is very similar in form to a human disease. The significance of disease animal models in the study of human diseases lies in the physiological or genetic similarity between humans and animals. In disease research, biomedical animal models provide research materials regarding the various causes, pathogenesis, and diagnosis of diseases. Furthermore, through the study of disease animal models, it is possible to understand the pathogenesis related to the disease and obtain basic data to determine the feasibility of commercialization through the actual efficacy and toxicity testing of developed new drug candidates.
[0027]
[0028] Another aspect provides a method for preparing an animal model, comprising the step of introducing into an animal a gene encoding an EGFP protein variant containing an amino acid sequence represented by SEQ ID NO. 1.
[0029] The above "animal," "amino acid sequence represented by sequence number 1," "EGFP," "variant," "animal model," etc. may be within the aforementioned range.
[0030] In one embodiment, the amino acid sequence represented by SEQ ID NO. 1 may be located in the safe harbor region of the animal.
[0031] The term "safe harbor region" in the present invention refers to any region of the genome capable of accommodating the integration of new genetic material so that the new genetic element functions predictably and does not cause changes to the host genome that pose a risk to the host cell or organism. For example, the safe harbor region may be a mouse safe harbor region, and the safe harbor region includes the ROSA26 region on the chromosome within the mouse genome.
[0032] In one example, by using the Sanger sequencing method to confirm the insertion of the EGFP variant vector, it was confirmed that a transgenic vector containing a green fluorescent protein variant for observing cell damage was accurately and precisely inserted into the ROSA26 region of the transgenic mouse.
[0033] In addition, to confirm the expression of the EGFP variant in transgenic mice, a comparison was made with wild-type mice (WT) using a Fluorescence In Vivo Imaging System, and it was confirmed that the EGFP variant was expressed in the transgenic mice.
[0034] In one embodiment, the step of selecting an animal into which the gene has been introduced may be further included.
[0035] In one specific example, an animal model may be produced by selecting a transgenic animal through the expression of a gene encoding an EGFP protein variant.
[0036] In one embodiment, as a result of using an In Vivo Imaging System to compare the fluorescence expression of heterozygote Tg and homozygote Tg mice, it was confirmed that the fluorescence expression was highest in homozygote Tg (Ho Tg), and thus the transgenic mouse (Easymonitor Apop Tg) was produced.
[0037]
[0038] Another aspect provides a method for real-time observation of cell damage or apoptosis, comprising the steps of: administering a sample to the animal model; and measuring the expression of an EGFP variant in the animal model administered the sample.
[0039] The above "animal model," "EGFP variant," etc. may be within the aforementioned range.
[0040] In one embodiment, the sample may comprise one or more selected from the group consisting of a cell damage or cell death-inducing substance, an anticancer agent, and an antipyretic agent.
[0041] In addition, the above sample has side effects such as causing kidney toxicity or liver toxicity, and may be a substance that induces apoptosis.
[0042] The term "cell death-inducing substance" in the present invention refers to a substance that induces a cell to die on its own. For example, the cell death-inducing substance may include one or more of Staurosporine, Cisplatin, Busulban, Acetaminophen, 1-(5-Isoquinolinylsulfonyl)-2-methylpiperazine dihydrochloride, and Rotlerin.
[0043] The term "anticancer agent" in the present invention refers to a drug that exhibits cytotoxicity against cancer cells and may cause renal toxicity in the body. For example, the anticancer agent may include one or more of cisplatin, doxorubicin, methotrexate, and busulfan.
[0044] The term "antipyretic" in the present invention refers to a drug used to lower body temperature by reducing fever, and may cause liver toxicity in the body. For example, the antipyretic may include one or more of acetaminophen, ibuprofen, and dexibuprofen.
[0045] In one embodiment, the method for measuring the expression of the EGFP variant can be confirmed in real time using molecular biological assays known in the art, e.g., Southern and Northern blot, RT-PCR, and PCR; biochemical assays, e.g., fluorescence microscopy; and immunological methods (e.g., FACS, ELISA, and Western blot). In one embodiment of the present invention, the expression level of the EGFP variant was confirmed in real time using fluorescence microscopy and flow cytometry (FACS).
[0046] In one embodiment, to measure cell damage and confirm the fluorescence expression and the degree of cell damage-related protein expression in transgenic mice introduced with an EGFP variant vector, 100 μl of busulfan (concentration: 20 mg / ml) was administered to the testis of transgenic mice as an anticancer agent and compared with a control group treated with PBS. As a result, it was confirmed that the expression of the green fluorescent protein variant decreased in the group treated with busulfan. In addition, through an immunohistochemical staining method using GFP and cleaved caspase-3 antibodies, it was confirmed that the expression of cleaved caspase-3 increased in the region where the expression of the green fluorescent protein variant decreased in the group treated with busulfan.
[0047]
[0048] Another aspect provides a method for evaluating drug toxicity, comprising the steps of: administering a sample to the animal model; and measuring the expression of an EGFP variant in the animal model administered the sample.
[0049] The above "animal model," "sample," "EGFP variant," "expression," "measurement," etc. may be within the aforementioned range.
[0050] In one embodiment, when measuring the expression of the EGFP variant, if the expression decreases, the method may include a step of determining that the sample is toxic to the cell.
[0051] In one embodiment, the reduction in expression may be due to the activity of caspase-3 or caspase-7.
[0052] In one embodiment, the drug toxicity evaluation method of the toxicity evaluation step can determine that the sample is toxic to cells if the level of expression of the EGFP variant decreases when the sample is treated in an animal model and the level of change in expression of the EGFP variant is measured.
[0053] Another aspect provides for the use of an EGFP variant comprising the amino acid sequence represented by SEQ ID NO. 1 for the manufacture of animal models.
[0054] The above "animal model," "amino acid sequence represented by sequence number 1," "EGFP," "variant," etc. may be within the aforementioned range.
[0055]
[0056] Another aspect provides the use of the above animal model for real-time observation of cell damage or apoptosis.
[0057] The above "cell damage," "cell death," "real-time observation," "animal model," etc. may be within the aforementioned scope.
[0058]
[0059] Another aspect provides the use of the above animal model for drug toxicity evaluation.
[0060] The above "drug toxicity evaluation," "animal model," etc. may be within the scope described above.
[0061] Transgenic mice introduced with a green fluorescent protein variant vector containing a caspase-3 / 7 recognition sequence for observing cell damage according to the present invention allow for real-time verification of fluorescence expression levels, thereby enabling real-time monitoring of cell damage and apoptosis. Furthermore, the transgenic mice of the present invention can be used to evaluate the toxicity of various drugs. Therefore, the present invention can be usefully employed in cell damage / apoptosis research or drug development.
[0062] Figure 1 is a figure showing the positions and sequences of primers for the introduction and detection of a green fluorescent protein variant vector.
[0063] Figure 2 is a figure showing the genotyping PCR results for selecting transgenic mice into which a green fluorescent protein variant vector was introduced for observing cell damage using selected primers.
[0064] Figure 3 is a figure showing the results of confirming that a transgenic vector containing a green fluorescent protein variant is inserted at the ROSA26 position in transgenic mice.
[0065] Figure 4 shows the results of comparing the expression of a green fluorescent protein variant in transgenic mice with that of wild-type mice (WT) using a Fluorescence In Vivo Imaging System.
[0066] Figure 5 shows heterozygote Tg and homozygote Tg transgenic mice (Easymonitor Apop This figure shows the results of comparing fluorescence expression using an In Vivo Imaging System to compare the fluorescence expression of Tg.
[0067] Figure 6 is a figure showing the results of confirming fluorescence expression in wild-type mice (WT) and green fluorescent protein variants using FOBI equipment to confirm the expression of green fluorescent protein variants in each organ (muscle, intestine, brain, liver, lung, heart, kidney, and spleen) of transgenic mice.
[0068] Figure 7 is a figure showing the results of confirming the expression of the green fluorescent protein variant in each organ (liver, kidney, lung, spleen, and heart) of the transgenic mouse using the Western blot method, comparing the expression of the wild-type mouse (WT) and the protein variant.
[0069] Figure 8 is a figure showing the results of confirming the expression of a green fluorescent protein variant in peripheral blood mononuclear cells (PBMCs) in the blood of a transgenic mouse using a fluorescence microscope to confirm the expression of the protein variant in wild-type mice (WT) and the protein variant.
[0070] Figure 9 is a figure showing the results of confirming the expression of the green fluorescent protein variant in each organ tissue (fat, heart, muscle, kidney, liver, lung, pancreas, stomach, intestine, spleen, brain) of the transgenic mouse using an immunohistochemistry method with a GFP antibody to confirm the expression of the protein variant compared to the wild-type mouse (WT).
[0071] Figure 10 is a figure showing the results of confirming that there were no abnormalities in both the organ structure and inflammatory response of the transgenic mouse by H&E staining to confirm the expression of green fluorescent protein variants in each organ tissue (fat, heart, muscle, kidney, liver, lung, pancreas, stomach, intestine, spleen, brain) of the transgenic mouse.
[0072] Figure 11 is a figure showing the results of confirming the expression of the green fluorescent protein variant in wild-type mice (WT) and protein variants using a fluorescence microscope to confirm the expression of the green fluorescent protein variant in somatic cell lines constructed from each organ (heart, spleen, lungs, and kidneys) of transgenic mice.
[0073] Figure 12 is a figure showing the results of confirming the expression of the green fluorescent protein variant in wild-type mice (WT) and protein variants using a flow cytometer to confirm the expression of the green fluorescent protein variant in somatic cell lines constructed from each organ (heart, spleen, lungs, and kidneys) of transgenic mice.
[0074] Figure 13 is a figure showing the results of confirming the expression of the green fluorescent protein variant in wild-type mice (WT) and protein variants using the Western blot method to confirm the expression of the green fluorescent protein variant in somatic cell lines constructed from each organ (liver, kidney, lung, spleen, and heart) of transgenic mice.
[0075] Figure 14 shows the results of treating the testis of a transgenic mouse with an anticancer agent (busulfan) to check for cell damage in the transgenic mouse, and then using FOBI equipment to check the expression level of a green fluorescent protein variant to compare with a control group treated with PBS.
[0076] Figure 15 shows the results of confirming the expression of a green fluorescent protein variant in a group treated with an anticancer agent (busulfan) through immunohistochemistry using a GFP antibody to confirm cell damage in transgenic mice.
[0077] Figure 16 shows the results of confirming the expression of a green fluorescent protein variant in a group treated with an anticancer agent (busulfan) through an immunohistochemical staining method using GFP and cleaved caspase-3 antibodies to confirm cell damage in transgenic mice.
[0078] Figure 17 shows the results of confirming the expression of a green fluorescent protein variant in a group treated with an anticancer agent (Cisplatin) through an immunohistochemical staining method using GFP and cleaved caspase-3 antibodies to confirm cell damage in transgenic mice.
[0079] Figure 18 is a figure showing the results of confirming the expression of green fluorescent protein variants using a fluorescence microscope in a group treated with a cell death-inducing substance (STA; staurosporine), an anticancer agent (Cisplatin), and an antipyretic (acetaminophen, APAP) to confirm cell damage in a somatic cell line constructed from kidney tissue of a transgenic mouse, and in a group treated with APAP as an experimental control.
[0080] Figure 19 is a figure showing the results of confirming the expression of green fluorescent protein variants using the Western blot method in a group treated with a cell death-inducing substance (STA; staurosporine), an anticancer agent (Cisplatin, side effect: inducing kidney toxicity), and an antipyretic agent (acetaminophen, APAP, side effect: inducing liver toxicity) and an experimental control group treated with APAP to confirm cell damage in a somatic cell line constructed from kidney tissue of a transgenic mouse.
[0081] Figures 20a and 20b show the results of confirming the expression of a green fluorescent protein variant using a real-time fluorescence microscope after treating a somatic cell line derived from the kidney tissue of a transgenic mouse with a cell death-inducing substance (STA; staurosporine) and an anticancer drug (Cisplatin, side effect: induces nephrotoxicity) at 4-hour intervals for 72 hours to confirm cell damage in the somatic cell line.
[0082] Figure 21 is a figure showing the results of confirming the expression of green fluorescent protein variants in a group treated with a cell death-inducing substance (STA; staurosporine) and an anticancer drug (Cisplatin) and a control group using a flow cytometer to confirm cell damage in a somatic cell line derived from the kidney tissue of a transgenic mouse.
[0083] Figure 22 is a figure showing the results of confirming the expression of fluorescent protein variants using a fluorescence microscope in a group treated with a cell death-inducing substance (STA; staurosporine) and an antipyretic (acetaminophen, APAP) and a control group treated with APAP to confirm cell damage in a somatic cell line constructed from liver tissue of a transgenic mouse.
[0084] Figure 23 shows the results of confirming the degree of cell damage-related protein expression in a group treated with a cell death-inducing substance (STA; staurosporine) and an anticancer drug (Cisplatin) and a control group treated with APAP, and an experimental control group treated with APAP, in order to confirm cell damage in a somatic cell line constructed from kidney tissue of a transgenic mouse, using an immunohistochemical staining method with a cleaved caspase-3 antibody.
[0085] Figure 24a is a figure showing the results of surgically installing a window chamber in the abdomen of wild-type mice (WT) and Tg mice to visualize cell damage in the internal organ (liver) of transgenic mice.
[0086] Figure 24b is a figure showing the results of observing the fluorescence change of green fluorescent protein in real time using an intravital microscope before and after the treatment of the mouse with an antipyretic agent to visualize cell damage in the internal organ (liver) of the transgenic mouse.
[0087] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.
[0088]
[0089] Example 1. Preparation of a transgenic mouse model introduced with a green fluorescent protein variant containing a caspase-3 / 7 recognition sequence
[0090] 1-1. Selection of Primers for Introduction and Detection of Green Fluorescent Protein Variant Vector
[0091] TaKaRa Ex Taq using the green fluorescent protein variant (EGFP #4) gene as a template TMIn-Fusion PCR was performed using (#HRR001A, TAKARA) under the conditions shown in Table 1 below. The primers used for the In-Fusion PCR are shown in Table 2 below. By using the primers in Table 2, restriction enzyme sites (EcoRI, XhoI) were created on the EGFP #4 mutant gene.
[0092] In-Fusion PCR Temperature & Time Step 1: 98℃ 2 min Step 2: 35 cycles 98℃ 62℃ 72℃ 30 sec 30 sec 30 sec Step 3: 72℃ 5 min Step 1: Initial denaturation, Step 2: Amplification, Step 3: Final extension
[0093]
[0094] Primer bp sequence Sequence No. EGFP #4 infusion F752bpTGCCTCTCCCGAATTCATGGTGAGCAAGGGCGAGG Sequence No. 2 EGFP #4 infusion R752bpTAGATGCATGCTCGAGTTACTTGTACAGCTCGTCCATGCC Sequence No. 3
[0095]
[0096] Electrophoresis was performed on the amplified PCR product, and after recovering the band corresponding to the target size (752 bp) from the loaded sample via electrophoresis, DNA was extracted using the Geneclean® turbo kit (#111102-600, MP).
[0097] Restriction enzyme sites (EcoRI, XhoI) were created at the multiple cloning site (MSC) of the mROSA26-pCAG vector, and the vector was used as a backbone vector by cleaving it with the same restriction enzymes during insert DNA insertion. The insert DNA was ligated into the mROSA26-pCAG vector using the In-Fusion® HD Cloning Kit (#639649, TAKARA) to prepare an EGFP #4 mutant expression vector.
[0098] Primer positions (Fig. 1) and sequences (Table 3) for detecting the green fluorescent protein variant (EGFP #4) in transgenic mice created using the above vector were derived.
[0099] Primer BP Sequence Sequence Number Easymonitor Apop F1WT 412bpTg 241bpgtttccgacttgagttgcctSequenceNumber 4Easymonitor Apop F2WT 412bpTg 241bpgctgcattaatgaatcggcc Sequence Number 5Easymonitor Apop RWT 412bpTg 241bpcacctgttcaattcccctgc Sequence No. 6
[0100]
[0101] 1-2. Transgenic mice with green fluorescent protein variant vector introduced (Easymonitor Apop Selection of Tg)
[0102] To verify whether the mROSA26-pCAG-HA-EGFP #4 vector prepared above was accurately inserted into the mouse ROSA26 site, transgenic mice (Easymonitor Apop Genomic DNA was extracted from Tg and genotyping PCR was performed to determine whether the gene was inserted. Specifically, genomic DNA was extracted from the offspring of transgenic mice using the DNeasy Blood & Tissue kit (#69506, Qiagen) according to the manufacturer's manual. Genotyping PCR was performed using the extracted genomic DNA and ExPrime Taq Premix (2X, 8-strip) (#G-6000, GeNet Bio) under the conditions shown in Table 4 below.
[0103] In-Fusion PCR Temperature Time Step 1: 95℃ 5 min Step 2: 35 cycles 95℃ 62℃ 72℃ 30 sec 30 sec 30 sec Step 3: 72℃ 5 min Step 1: Initial denaturation, Step 2: Amplification, Step 3: Final extension
[0104]
[0105] Samples for genotyping PCR were subjected to electrophoresis for 30 minutes at 120V on a 0.8% agarose gel prepared using Agarose, LE, Analytical Grade (#V3125, Promega) and 0.5X TAE (50X TAE; TR2002-100-00, Biosesang 3rd order diluted to 0.5X). Subsequently, wild-type, hetero-type, and homo-type mice were selected by comparing the band sizes of the samples. The PCR primers for genomic DNA amplification are shown in Table 3 above. As a result, a 412bp PCR product was observed when EGFP #4 was not inserted (knock-in; KI) (WT), 412bp and 241bp PCR products were observed in the hetero (He) genotype with insertion into one allele, and only a 241bp PCR product was observed in the homo (Ho) genotype (Fig. 2).
[0106]
[0107] Example 2. Confirmation of vector insertion and fluorescence expression in transgenic mice introduced with a green fluorescent protein variant vector
[0108] Transgenic mouse (Easymonitor) Apop Sanger sequencing was used to confirm the insertion of a transformation vector containing a green fluorescent protein variant into the ROSA26 region of the transgenic mouse (Figure 3). As a result, it was confirmed that a transformation vector containing a green fluorescent protein variant for observing cell damage was accurately and precisely inserted into the ROSA26 region of the transgenic mouse (Figure 3).
[0109] In addition, to confirm the expression of the green fluorescent protein variant in transgenic mice, a comparison was made with wild-type mice (WT) using the Fluorescence In Vivo Imaging System (FIOBI), and it was confirmed that the green fluorescent protein variant was expressed in transgenic mice (Fig. 4).
[0110] Furthermore, heterozygote Tg and homozygote Tg transgenic mice (Easymonitor Apop As a result of using an In Vivo Imaging System (institution name: IVIS spectrum) to compare the fluorescence expression of Tg, it was confirmed that the fluorescence expression was highest in Homozygote Tg (Ho Tg) (Fig. 5).
[0111]
[0112] Example 3. Confirmation of green fluorescent protein variant expression in organs and somatic cell lines of transgenic mice introduced with a green fluorescent protein variant vector
[0113] 4-1. Confirmation of Expression of Green Fluorescent Protein Variant in Organs of Transgenic Mice
[0114] Transgenic mouse selected from Example 2 above (Easymonitor Apop FOBI equipment and Western blot methods were used to confirm the expression of the green fluorescent protein variant in each organ of Tg. Confirmation of the expression of the green fluorescent protein variant using FOBI equipment revealed that the transgenic mice showed superior expression of the green fluorescent protein variant in muscle, intestine, brain, liver, lung, heart, kidney, and spleen compared to wild-type mice (Fig. 6). Confirmation of the expression of the green fluorescent protein variant using Western blot methods revealed that expression of the green fluorescent protein variant occurred in the liver, kidney, lung, spleen, and heart (Fig. 7).
[0115] In addition, when the expression of a green fluorescent protein variant was confirmed in peripheral blood mononuclear cells (PBMCs) in the blood of the transgenic mouse using a fluorescence microscope, the expression of the gene could not be observed in red blood cells because the nucleus is removed during the maturation process, but the expression was confirmed in PBMCs in which the nucleus is present (Fig. 8).
[0116] Furthermore, immunohistochemical staining using GFP antibodies and H&E staining were performed on each organ tissue (fat, heart, muscle, kidney, liver, lung, pancreas, stomach, intestine, spleen, brain) of the transgenic mouse to confirm the expression of the green fluorescent protein variant, and it was confirmed that there were no abnormalities in both the organ structure and inflammatory response of the transgenic mouse (Figs. 9 and 10).
[0117]
[0118] 4-2. Confirmation of expression of green fluorescent protein variant in somatic cell lines constructed from organs of transgenic mice
[0119] We intended to confirm the expression of green fluorescent protein variants in somatic cell lines constructed from each organ of transgenic mice using fluorescence microscopy, flow cytometry, and Western blot methods. As a result of confirming the expression of green fluorescent protein variants in somatic cell lines constructed from the heart, spleen, lung, and kidney using fluorescence microscopy and flow cytometry, it was confirmed that the expression of green fluorescent protein variants was superior compared to wild-type mice (Figs. 11 and 12). As a result of confirming the expression of green fluorescent protein variants in somatic cell lines constructed from the liver, kidney, lung, spleen, and heart using Western blot methods, it was confirmed that the expression of green fluorescent protein variants was superior compared to wild-type mice (Fig. 13).
[0120]
[0121] Example 4. Measurement of cell damage in transgenic mice introduced with a green fluorescent protein variant vector and confirmation of fluorescence expression and the expression levels of cell damage-related proteins
[0122] 5-1. Confirmation of Expression of Green Fluorescent Protein Variant in Organs of Transgenic Mice
[0123] Transgenic mouse (Easymonitor) Apop 100 μl (concentration: 20 mg / ml) of busulban was administered to the testis of Tg) as an anticancer agent, and the expression level of the green fluorescent protein variant was checked using FOBI equipment to compare with a control group treated with PBS. As a result, it was confirmed that the expression of the green fluorescent protein variant decreased in the group treated with busulban (Fig. 14). In addition, immunohistochemistry using a GFP antibody confirmed that the expression of the green fluorescent protein variant decreased in the group treated with 100 μl (concentration: 20 mg / ml) of busulban (Fig. 15).
[0124] In addition, through an immunohistochemical staining method using antibodies against GFP and cleaved caspase-3, it was confirmed that the expression of cleaved caspase-3 increased in the region where the expression of the green fluorescent protein variant was decreased in the group treated with 100 μl of busulban (concentration: 20 mg / ml) (Fig. 16).
[0125] Furthermore, through an immunohistochemical staining method using GFP and cleaved caspase-3 antibodies, it was confirmed that in the group treated with cisplatin (side effect: causes nephrotoxicity) at a concentration of 10 mg / kg as an anticancer agent, the expression of cleaved caspase-3 increased in the region where the expression of the green fluorescent protein variant was decreased (Fig. 17).
[0126]
[0127] 5-1. Confirmation of expression of green fluorescent protein variant in somatic cell lines constructed from organs of transgenic mice
[0128] Somatic cell lines constructed from kidney tissue of transgenic mice were treated with a cell death-inducing substance (STA; staurosporine), an anticancer agent (Cisplatin, side effect: induces nephrotoxicity), and an antipyretic (acetaminophen, APAP, side effect: induces hepatotoxicity) at concentrations of 0.5 μM, 15 μM, and 5 mM, respectively, and
[0129] Cell damage in the above somatic cell lines was confirmed using a fluorescence microscope after treating them with APAP as an experimental control. As a result, it was confirmed that the expression of the green fluorescent protein variant decreased in the groups treated with a cell death-inducing substance, an anticancer agent, and an antipyretic, while only slight changes in the expression of the green fluorescent protein variant were observed in the kidney somatic cell lines treated with APAP (Fig. 18).
[0130] In addition, the expression of green fluorescent protein variants in control groups and somatic cell lines constructed from kidney tissue of transgenic mice, treated with a cell death-inducing substance (STA; staurosporine), an anticancer agent (Cisplatin, side effect: inducing nephrotoxicity), and an antipyretic (acetaminophen, APAP, side effect: inducing hepatotoxicity), was confirmed using the Western blot method. As a result, it was confirmed that in the groups treated with the cell death-inducing substance (STA; staurosporine) and the anticancer agent (Cisplatin, side effect: inducing nephrotoxicity), cleaved PARP and cleaved Caspase-3 increased, while the expression of green fluorescent protein variants decreased. In the experimental control group treated with APAP, only slight changes were observed in the expression of cleaved PARP, cleaved Caspase-3, and green fluorescent protein variants in the kidney somatic cell lines (Fig. 19).
[0131] Furthermore, somatic cell lines derived from the kidney tissue of transgenic mice were treated with a cell death-inducing substance (STA; staurosporine) and an anticancer drug (Cisplatin, side effect: induces nephrotoxicity) at 4-hour intervals for 72 hours, and confirmed using real-time fluorescence microscopy. As a result, it was confirmed that the expression of the green fluorescent protein variant decreased in the group treated with the cell death-inducing substance (STA; staurosporine) and the anticancer drug (Cisplatin, side effect: induces nephrotoxicity) (Figs. 20a and 20b).
[0132] The expression of green fluorescent protein variants in somatic cell lines derived from the kidney tissue of transgenic mice, treated with a cell death-inducing substance (STA; staurosporine) and an anticancer drug (Cisplatin, side effect: induces nephrotoxicity), and in the control group were confirmed using a flow cytometer. As a result, it was confirmed that the expression of green fluorescent protein variants in the group treated with the cell death-inducing substance (STA; staurosporine) and the anticancer drug (Cisplatin, side effect: induces nephrotoxicity) was reduced compared to the control group (Fig. 21).
[0133] The expression of fluorescent protein variants in somatic cell lines constructed from the liver tissue of transgenic mice was confirmed using a fluorescence microscope in a group treated with a cell death-inducing substance (STA; staurosporine) and an antipyretic (acetaminophen, APAP, side effect: induces hepatotoxicity), a control group, and an experimental control group treated with APAP. As a result, it was confirmed that the expression of the green fluorescent protein variant decreased in the group treated with the cell death-inducing substance (STA; staurosporine) and an antipyretic (acetaminophen, APAP, side effect: induces hepatotoxicity), while only slight changes in the expression of the green fluorescent protein variant were observed in the liver somatic cell lines of the experimental control group (Fig. 22).
[0134] The expression levels of cell damage-related proteins in somatic cell lines constructed from kidney tissue of transgenic mice were confirmed using an immunostaining method with a cleavage-related caspase-3 antibody in groups treated with a cell death-inducing substance (STA; staurosporine) and an anticancer drug (Cisplatin, side effect: induces nephrotoxicity), a control group, and an experimental control group treated with APAP. As a result, it was confirmed that the expression of cleavage-3 increased in the region where the expression of the green fluorescent protein variant was decreased in the group treated with the cell death-inducing substance (STA; staurosporine) and the anticancer drug (Cisplatin, side effect: induces nephrotoxicity). In the experimental control group, only slight changes were observed in the expression of the green fluorescent protein variant and the increase in the expression of cleavage-related PARP and cleavage-3 in the kidney somatic cell lines (Fig. 23).
[0135] A window chamber was surgically inserted into the abdominal cavity of transgenic mice to observe changes in the expression of the green fluorescent protein variant in internal organs using an intravital microscope before and after administration of an antipyretic (Acetaminophen, APAP, side effect: induces hepatotoxicity). Starting from day 1 after APAP treatment, the expression of the green fluorescent protein variant began to decrease, and on day 3, the partial recovery of the reduced green fluorescence was observed in real time (Figs. 24a and 24b).
Claims
1. An animal model into which an EGFP (Enhanced Green Fluorescent Protein) variant containing the amino acid sequence represented by sequence number 1 has been introduced.
2. An animal model according to claim 1, wherein the amino acid sequence represented by SEQ ID NO. 1 is a caspase-3 or caspase-7 recognition sequence.
3. The animal model of claim 1, wherein the animal is selected from the group consisting of rats, mice, guinea pigs, hamsters, dogs, cats, rabbits, cattle, sheep, pigs, guinea pigs, and monkeys.
4. A method for preparing an animal model comprising the step of introducing into an animal a gene encoding an EGFP protein variant containing an amino acid sequence represented by SEQ ID NO.
1.
5. A method for real-time observation of cell damage or apoptosis comprising the steps of: administering a sample to an animal model according to any one of claims 1 to 3; and measuring EGFP variant expression in the animal model administered the sample.
6. A method for real-time observation of cell damage or cell death according to claim 5, wherein the sample comprises one or more selected from the group consisting of a cell death-inducing substance, an anticancer agent, and an antipyretic agent.
7. A method for evaluating drug toxicity, comprising the steps of: administering a sample to an animal model of any one of claims 1 to 3; and measuring the expression of an EGFP variant in the animal model administered the sample.