Composition and method for preserving analytes in bodily fluids
A stabilizing composition for bodily fluids at ambient temperature addresses analyte degradation by using buffering and saccharide agents, ensuring reliable biomarker detection through preserved polypeptides and nucleic acids.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- DNA GENOTEK
- Filing Date
- 2025-12-22
- Publication Date
- 2026-06-25
AI Technical Summary
Existing methods for preserving analytes in bodily fluids, such as polypeptides and nucleic acids, are inadequate at ambient temperature, leading to degradation due to enzymatic activity and instability, which complicates downstream analysis and affects the reliability of biomarker studies.
A composition comprising a buffering agent, chelating agent, and saccharide, along with a stabilizing protein, peptide, or amino acid, is used to preserve polypeptides and nucleic acids in bodily fluids at ambient temperature, maintaining their native state and functionality without the use of toxic fixatives.
The composition effectively stabilizes analytes, allowing for prolonged storage and analysis at ambient temperature, reducing pre-analytical variability and enhancing the reliability of biomarker detection in bodily fluids.
Smart Images

Figure CA2025051742_25062026_PF_FP_ABST
Abstract
Description
COMPOSITION AND METHOD FOR PRESERVING ANALYTES IN BODILY FLUIDSFIELD OF THE INVENTION
[0001] The present invention pertains to a composition and method for preserving analytes in bodily fluids. More particularly, the present invention pertains to a composition, method, and kit for preserving analytes, such as polypeptides and nucleic acids, in a bodily fluid at ambient temperature, and a device for collecting a bodily fluid comprising the composition as described herein.BACKGROUND
[0002] The “proteome” (or “protein index”) is the entire set of proteins produced or modified by an organism and varies with time, biological requirements, stress, and other environmental factors [Graves & Haystead, 2002], Proteomics is a methodological approach that refers to a large-scale and global analysis of the proteins in a system, at a specific point in time, under a determined condition [Taurines et al., 2011], Proteomics has been successful in identifying many novel disease biomarkers [Ahram & Petricoin, 2008], Biomarkers are objective indicators used to assess normal or pathological processes, evaluate responses to medical treatment, and predict outcomes [Atkinson et al., 2001], The association of biomarkers to diseases advances understanding of cellular and molecular mechanisms of diseases, since biomarkers can be direct causes of diseases, secondary players in disease initiation and progression, or mere signals of pathological conditions. By accurately measuring relative abundance of all the proteins of a biological sample, for example, rather than each one individually, protein profiling provides a more thorough reflection on the dynamic pathophysiological processes [Comes et al., 2018],
[0003] Blood plays a pivotal role in facilitating diverse biological processes.It is considered an attractive source of biomarkers because it comes in contact with all tissues in the body and factors can be released from these tissues into the circulation. Hence, collected blood samples serve as a form of “liquid biopsy” for personalized medicine applications and drug development by providing a window into all the host tissues [Comes et al., 2018], Plasma proteomics is particularly advantageous as it only requires a small volume of blood to study hundreds and sometimes thousands ofproteins and can identify changes in protein expression that may occur with age and disease [Ignjatovic et al., 2019],
[0004] Blood is a complex mixture of cells, exosomes, nucleic acids, proteins, lipids and metabolites, amongst other components. The soluble phase of whole blood, termed plasma, is obtained after centrifugation of whole blood samples in the presence of anticoagulants (e.g. EDTA, heparin, warfarin or sodium citrate). Cells and cellular material are spun to the bottom of the collection tube leaving cell- free components and biomolecules in the upper fraction available for detailed characterization. Protein integrity in plasma samples can be compromised in multiple ways, including proteolysis, oxidation, loss of posttranslational modifications, and changes in solubility [Rai et al., 2005], Biomolecules degrade at different rates under a variety of circumstances. The rate and extent of degradation depend on the type of blood collection tube used (serum, plasma, and use of additives), the blood collection process, sample handling / transport and processing, the time and / or temperature at which collected blood is held prior to processing, centrifugation speed, the time and / or temperature prior to freezing, the number of freeze-thaw cycles, and inherent analyte stability [Jewell et al., 2002], It is not always possible to process clinical samples (e.g. blood, saliva, urine) immediately after collection because the clinic and the processing facilities or laboratories are often geographically separate.
[0005] The proteomic analyses of human blood and blood-derived products(e.g. plasma) offer an attractive avenue to translate research progress from the laboratory into the clinic. The human plasma proteome, in particular, holds the promise of a revolution in disease diagnosis and therapeutic monitoring provided that major challenges in proteomics can be addressed [Anderson & Anderson, 2002], For example, due to its unique and complex protein composition, performing proteomics assays (e.g. two-dimensional gels, immunoassays, mass spectrometry) with plasma is challenging. Specifically, the discovery of blood-based protein biomarkers is challenging due to 1) the complexity in protein diversity of the plasma (and serum) proteome and 2) there is a difference of 10 orders of magnitude in concentration between albumin (55%) and the rarest plasma protein, which poses a major hurdle to the discovery and validation of low-abundance biomarkers [Anderson & Anderson, 2002], This dynamic range problem is further exacerbated by the recent expansion of plasma proteomics to cover the full range of proteoforms, which coverscharacterization of proteins and their posttranslational modifications. Plasma proteomics has regained interest due to recent more sensitive, target enriching, high- throughput technological advancements, but challenges imposed by both complications inherent to studying human biology (e.g. inter-individual variability), analysis of biospecimens (e.g. sample variability and complexity), as well as technological limitations remain [Ignjatovic et al., 2019; Dayon et al., 2017],
[0006] The chemical modifications of proteins during or after their biosynthesis via the covalent attachment of functional groups or proteolytic cleavage at specific amino acids are collectively termed protein post-translational modifications (PTMs). PTM is a key mechanism to increase proteome diversity, with over 600 different types of PTMs affecting many aspects of protein structure and function. Dysregulated or abnormal PTMs may alter protein function, leading to issues like protein misfolding, aggregation, and loss of function. These changes can disrupt crucial cellular processes and are implicated in a wide range of diseases, including cancer, diabetes, and many neurodegenerative diseases (NDDs), such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, amyotropic lateral sclerosis, spinocerebellar ataxia, transmissible spongiform encephalopathy, and multiple sclerosis. NDDs encompass heterogeneous cerebral proteinopathies, characterized by a progressive loss of vulnerable neurons, such that patients present with broad clinical sequelae that includes motor, behavioural, and cognitive deficits. At autopsy, NDDs can be characterized histopathologically via hallmark intra- or extra-cellular accumulations of degradation-resistant protein aggregates concentrated to certain brain regions [Schaffert and Carter, 2020],
[0007] The most common NDDs are amyloidoses, tauopathies, a- synucleinopathies, and transactivation response deoxyribonucleic acid (DNA) binding protein 43 (TDP-43) proteinopathies. In Alzheimer’s disease, for instance, the pathology is characterized by extracellular plaque deposits of aggregated amyloidbeta peptide (Ab), as well as intracellular neurofibrillary tangles primarily composed of hyperphosphorylated fibrils of microtubule-associated protein Tau [Dugger and Dickson, 2016], In addition to phosphorylation, Tau undergoes other PTMs, such as ubiquitination, nitration, glycation, and acetylation, all of which have been linked to abnormal Tau that accumulates in degenerative tauopathies. Notably, Tau aggregates and Ab aggregates have been the subject of targeted therapies, such asimmunotherapy, aggregation inhibitors, gene therapy, microtubule stabilizers, and glycosylation modulators. Studying these PTMs is important for understanding disease mechanisms, monitoring disease progression, and developing new therapies.
[0008] While the basic research community might focus on improving the depth of coverage to detect low abundance plasma proteins (i.e. <1 ng / mL), the clinical community emphasizes reproducibility of measurements and low coefficients of variation to support actionable and accurate clinical decisions, such as early disease detection [Ignjatovic et al., 2019], Even though there have recently been significant improvements made in analytical sensitivity in mass spectrometry-based plasma proteomics, today, sample collection methods, sample storage conditions (e.g. freezethaw cycles), and plasma processing workflows continue to contribute to pre-analytical variability and affect assay reliability and protein abundances. For instance, extensive delays of several hours prior to separating blood cells from fluids can alter plasma proteome composition due to erythrocyte lysis and platelet degradation [Hassis et al., 2015], Protein degradation may further occur due to chemical instability, the action of proteases, or depletion of active inhibitors [e.g. members of the serine protease inhibitor (SERPIN) family]. Ultimately, the quality of collected biospecimens affects the validity of the data in biomarker studies.
[0009] Once biological samples are collected, ex vivo proteolytic activity or cellular metabolism may alter protein content [Yi et al., 2007] and produce artefacts, which can also be exacerbated by cell lysis at higher centrifugation speeds during sample processing. The use of broad-spectrum protease inhibitors (Pls) during sample collection and processing is costly and is unlikely to occur routinely in the clinical setting. Interestingly, the use of plasma collection tubes containing Pls to minimize degradation, as compared to EDTA, has not been shown to have a significant impact on the levels of peptide or protein [Randall et al., 2010; Aguilar-Mahecha et al., 2012], Multiple studies have shown changes in the abundance of complement C3, at protein and peptide levels, due to pre-analytical factors [Yi et al., 2007; Zimmerman et al., 2012; Marshall et al., 2003; Insenser et al., 2010], More importantly, we lack a global understanding of factors that impact protein stability and levels in many biological samples, including blood [Hassis et al., 2015],
[0010] Proteomics is not limited to the analysis of blood samples. This methodological approach enables the use of other biological fluids, such as saliva, oral fluid, nasal fluid, sputum, cerebrospinal fluid, pancreatic fluid, synovial fluid, bile, and urine, in addition to tissue samples (e.g. tumors). As already noted above for blood samples, the success of any biomarker study will depend in large part on the quality of the biological sample analyzed, and on the control of factors that may introduce bias to the study even before the sample reaches the analytical platform.
[0011] In order to address some of the sources of pre-analytical variability(e.g. the activation of blood proteases and platelet degranulation), manufacturers have produced specialized blood collection tubes, e.g. BD™ P100 Blood Collection Tube (contains a proprietary cocktail of Pls), EDTA Tube (Becton, Dickinson and Company (BD) Vacutainer® EDTA Tube) and CTAD T ube (BD; contains buffered citrate solution, theophylline, adenosine and dipyridamole to prevent platelet degranulation or activation) [Aguilar-Mahecha et al., 2012; Randall et al., 2010], In one study, plasma was collected in EDTA and P100 tubes, aliquoted and frozen, thawed and then left up to eight hours at room temperature prior to selected reaction monitoring (SRM) mass spectrometry (MS) analysis [Randall et al., 2010], Delaying MS analysis of freeze- thawed samples for one hour showed greatly reduced recovery of some proteins, i.e. protein recovery dropped by 71 % in P100 tubes and by 55% in EDTA tubes relative to baseline levels. Aguilar-Mahecha et al. (2012) found that P100 tubes only conferred proteolytic protection for 4 of 27 cytokines tested using an immunoassay and only 1 of 55 mid- and high-abundance plasma proteins tested using multiple reaction monitoring (MRM)-MS. In blood collected in CTAD tubes, significant differences (i.e. lower levels) were observed in the concentrations of peptides measured, compared to the other collection tubes, suggesting that platelet activation may be involved in the release of these mid- to high-abundance proteins during delayed sample processing [Aguilar- Mahecha et al., 2012], Importantly, the levels of most cytokines tested were low or undetectable in samples collected in CTAD tubes. These findings suggest that many of the measured cytokines may become detectable in the plasma because of platelet activation. Hence, the use of these specialized collection tubes currently on the market may not provide adequate stability to the plasma proteome, especially when strict blood processing protocols are not implemented. Though not practical, it was concluded that samples should be processed immediately after collection andrefrigeration or centrifugation at low temperatures should be avoided to prevent platelet activation [Aguilar-Mahecha et al., 2012],
[0012] Cancer is a dynamic disease with heterogenic molecular signatures that constantly evolve during the course of the disease. Liquid biopsy of blood offers a simple, non-invasive method to risk stratify patients and guide cancer therapy, particularly for cases of cancer recurrence or metastasis when tumor sampling is challenging or not possible [Payne et al., 2019], Circulating tumor cells (CTCs), circulating tumor DNA (ctDNA), and extracellular vesicles (EVs) present in the blood of cancer patients are a potential rich source of multi-omic biomarkers. However, the optimal methods for blood collection and storage, biomarker enrichment and isolation, and subsequent downstream characterization are still unclear [Payne et al., 2023],
[0013] CTCs are early signs of metastasis and can be used to monitor disease progression well before radiological detection by imaging. CTCs detection monitors the changes in the type and number of CTCs present in the peripheral blood in order to monitor tumor dynamics in real-time, assess treatment efficacy, and enable real-time individual therapy [Wang et al., 2024], In many cancers, the quantity as well as contents of CTCs, such as protein expression and ribonucleic acid (RNA) and DNA profiles, can be correlated to progression-free survival, overall survival, and disease stage. Specifically, Purcell et al. (2024) have shown that CTCs decreased significantly during treatment, consisting of chemoradiation followed by anti-PD-L1 (programmed death ligand 1) immunotherapy, where a larger decrease in CTCs predicted a significantly longer progression-free survival time in patients with stage III non-small cell lung cancer (NSCLC). Durvalumab-treated patients who had future progression were observed to have sustained higher programmed death ligand 1 -positive CTCs, compared to stable patients. These results demonstrate that CTCs are potential biomarkers to monitor and predict patient outcomes in patients with stage III NSCLC [Purcell et al., 2024], In addition, single cell proteomic analysis could offer a suitable pathway to monitor CTC heterogeneity and deliver critical information for the diagnosis, recurrence, and drug-resistant mechanisms of cancer [Reza et al., 2021], Importantly, Reza et al. (2021 ) found that a fraction of CTCs showed high expression of certain receptor proteins during and after therapy, indicating the presence of resistant CTCs which may evolve after a certain time and progress the disease.
[0014] Proteomics analysis of biofluid-derived vesicles or exosomes holds enormous potential for discovering disease biomarkers [Welton et al., 2016], Exosomes are membrane-bound vesicles manufactured in cells within late endosomal compartments termed multi-vesicular endosomes, which are trafficked to the plasma membrane releasing the preformed nanovesicles into the extracellular space [Thery et al., 2022], These vesicles constitute a simpler version of the parent cell, encapsulating protein, nucleic acid, and other analytes depending on the cell type. Importantly, dynamic changes in exosomes are functionally important, and there is strong evidence demonstrating their roles in carcinogenesis and disease progression, through direct activities in immune evasion, stromal activation, angiogenesis and metastatic niche formation [Yu et al., 2006; Webber et al., 2015; Wang et al., 2024],
[0015] Importantly, exosomes are present within all biological fluids, and they provide a complex set of molecules of functional importance in disease, in a minimally invasive manner [Welton et al., 2016], In a study by Welton et al. (2016) of plasma versus urine vesicles, significant differences were apparent with elements like HSP90, integrin aVp5 and Contactin-1 more prevalent in urinary vesicles, while hepatocyte growth factor activator, prostate-specific antigen-anti chymotrypsin complex and many others were more abundant in plasma vesicles. However, obtaining biofluid-derived vesicles or exosomes of sufficient quality and quantity for profiling studies has been a major technical challenge. Biological fluids, particularly blood plasma, are extremely protein-rich, making the separation of vesicles from non- vesicular proteins (e.g. albumin, immunoglobulins, complement components) very difficult, confounding mass-spectrometry-based proteomics and the identification of low abundant, vesicle-associated proteins [Welton et al., 2016],
[0016] For decades, cell-free DNA (cfDNA) has been observed in multiple bodily fluids, including blood, saliva, urine, and cerebrospinal fluid, as fragmented nucleic acids, in both healthy individuals and people with diseases (e.g. cancer, diabetes, cardiovascular diseases, organ transplantation, stroke, epilepsy, autoimmune diseases, sepsis and trauma), and serves as an important tool of “liquid biopsy” ([Meddeb et al., 2019], [Stewart et al., 2018]).
[0017] Liquid biopsy typically involves extraction and analysis of cfDNA,RNA (miRNA, IncRNAs and mRNAs), proteins, peptides, exosomes and / or cellsderived from biofluids such as blood, urine, saliva and cerebrospinal fluid ([Di Meo et al., 2017]). Given their relatively small molecular weight, true levels of cfDNA in collected bodily fluids can be a) obscured by the release of genomic DNA from damaged and / or apoptotic cells and / or b) underestimated due to actions of degradative enzymes during sample collection, storage, transport, and processing.
[0018] Repeated sampling and testing of these analytes in bodily fluids from patients may enable real-time monitoring of disease progression and help ensure treatment efficacy. In particular, cfDNA in blood plasma, first observed in 1948 ([Mandel and Metais, 1948]), appears to be a suitable target for the early diagnosis, monitoring, and treatment of certain cancers. However, for the effective and efficient use cfDNA in any biochemical or molecular test, the sample collection process, transport and storage conditions, and sample processing must be optimized and standardized.
[0019] Urine provides a non-invasive alternative to blood plasma as a potential source of disease biomarkers. For instance, proteomic profiling of exosomes in human urine by Pisitkun et al (2004) revealed the presence of 21 proteins known to be associated with specific renal diseases or blood pressure regulation. These studies illustrated that exosome secretion into the urine delivers discrete packets of cytosol from renal epithelial cells to the urine, providing a potential means for non-invasive detection and analysis of protein-expression changes in renal tubule cells.
[0020] It is well-established that in many cancers several proteins are significantly mis-, up- or down-regulated, and could be taken as signatures for diagnostic confirmation. Early-stage biomarkers, often low- to very-low-abundance proteins, might be the best way to detect the beginning of most pathologies, thus permitting proper intervention and care. Several studies have already investigated urinary peptides and proteins for the detection of ovarian, breast, bladder, prostate, pancreatic, and renal cancer [Boschetti et al., 2017; Welton et al., 2016],
[0021] For example, results of a recent ovarian cancer study suggest that a panel of known urinary biomarkers (human epididymis protein 4 (HE4), creatinine, carcinoembryonic antigen (CEA), neural cell adhesion molecule (NCAM) and transthyretin (TTR)) provides diagnostic properties exceeding those reported for serum biomarkers [Lee et al., 2019], The protein profile in urine is also less complexthan that in blood, and thus the measurement of urinary proteins may also enhance overall clinical performance. Currently, tests are under development for detection of ovarian cancer protein biomarkers in urine [Matthews, 2018], Discovering biomarkers in urine can provide an inexpensive, non-invasive method for detecting ovarian cancer and enable the frequent testing of women who belong to high-risk groups.
[0022] Several urinary protein biomarkers for bladder cancer have been identified. One study comparing 46 patients with bladder cancer and 40 healthy controls reported urinary calprotectin can detect the cancer type with 80% sensitivity at 92% specificity. The median calprotectin (the heterodimer of S100A8 / S100A9) level was 10-fold higher in bladder cancer patients than healthy controls [Ebbing et al., 2013], Three other urinary proteins, Stathmin-1 (STMN1 , also known as Oncoprotein 18), growth factor beta inducible protein (BIGH3) and CD147 (or EMMPRIN) also have potential in bladder cancer detection [Bhagirath et al., 2012], Other studies, using 2D- DIGE coupled with mass spectrometry, also reported significantly higher abundance of several proteins (e.g. Reg-1 , CD5 and keratin 10) in urine samples of bladder cancer patients [Orenes-Pinero et al., 2007], Reg-1 , in particular, was associated with tumor progression and clinical outcome in bladder cancer.
[0023] Currently, prostate cancer prognosis is based on age, elevated levels of prostate-specific antigen (PSA), and a prostate digital rectal examination (DRE) often followed by prostate biopsy, none of which can distinguish between benign prostatic hyperplasia (BPH) and prostate cancer. Hence, there is an urgent need for novel biomarkers that can effectively distinguish between patients with BPH versus prostate cancer to avoid unnecessary biopsies and subsequent overtreatment. Interestingly, a number of urinary biomarkers for prostate cancer have been identified. A study using capillary electrophoresis coupled with mass spectrometry (MS) identified and validated 3 novel urinary biomarkers (p2M, PGA3, and MUC3) [Jedinak et al., 2015], Another study also reported Annexin A3 (ANXA3), a calcium- binding protein, as a novel urine-based biomarker with high specificity for early prostate cancer detection when used in conjunction with PSA testing [Schostak et al., 2009],
[0024] Despite an increase in the percentage of lower stage renal tumors, the incidence of locally advanced and metastatic disease has continued to increase,as has the overall mortality rate [Morrissey et al., 2014], As an alternative to radiology screening for masses, sensitive and specific renal tumor screening biomarkers are needed for renal cell carcinoma (RCC). Results showed that exosomal proteins aquaporin-1 (AQP1) and perlipin 2 or PLIN2 (also known as adipophilin) levels (normalized to urinary creatinine), were significantly increased 35-fold and 9-fold in the urine of patients with a pathologic diagnosis of Clear Cell Renal Cell Carcinoma (ccRCC) or papillary RCC, respectively, compared with that of healthy controls and patients with common noncancerous kidney diseases. The preoperative urinary concentrations of these markers reflected the tumor size and stage, but not tumor grade [Morrissey et al., 2014], In addition, the findings suggest that these two non- invasive markers could help in discriminating ccRCC and papillary RCC from other renal lesions [Morrissey et al., 2010; Morrissey and Kharasch, 2013; Morrissey et al., 2014], Further, authors of another study suggested that the kidney injury molecule-1 (KIM-1) may serve as a surrogate biomarker for kidney cancer and a non-invasive preoperative measure to evaluate the malignant potential of renal masses [Zhang et al., 2014],
[0025] Saliva as a diagnostic biofluid is fast, easy, inexpensive and non- invasive to collect and can reflect the physiological and pathological state of the individual [Kaczor-Urbanowicz et al., 2017; Lee & Wong, 2009], Saliva provides the first line of oral cavity defense against bacterial, fungal and viral attack. It contains a complex mixture of diverse components such as mucins, amylases, lysozyme, lipase, lactoferrins, lactoperoxidase, immunoglobulins, agglutinin, proline-rich proteins, histatins, and defensins which are produced in large part by the major and minor salivary glands, with some contributions from gingival crevicular fluid, as well as nasal and bronchial secretions. The saliva proteome contains approximately 2,300 proteins, 27% of which are identical to plasma proteins [Loo et al., 2010], Hence, salivary proteins may be useful for the diagnosis of oral diseases, systemic diseases, and brain diseases. Recently, the diagnosis of systemic diseases in saliva is focused on diabetes mellitus, cardiovascular diseases, viral infections, pancreatic cancer, lung cancer, prostate cancer, breast cancer, as well as liver and renal diseases [Zurcher & Humpel, 2023; Loo et al., 2010],
[0026] Oral cancer, oral squamous cell carcinoma (OSCC) in particular, has emerged as a global health problem due to its relatively high incidence and mortality.Direct contact between saliva and oral cancer lesions makes detection of salivary biomarkers for oral cancer especially attractive. Proteins are important molecules involved in pathological processes of oral cancer growth, apoptosis and metastasis. Proteins such as hormones, antibodies, enzymes and cytokines in saliva, secreted by oral cancer cells or by host cells, not only provide comprehensive pathological information of oral cancer, but also are considered potential targets for non-invasive screening of oral cancer [Li et al., 2020], Early screening and detection are still the most effective strategies for reducing oral cancer morbidity, with salivary biomarkers offering a great potential in achieving early-stage cancer screening.
[0027] Interestingly, Ogawa et al. (2008) discovered exosome-like vesicles in human saliva containing the serine protease dipeptidyl peptidase IV (DPP IV or CD26), galectin-3, immunoglobulin A, actin and poly-immunoglobulin receptor (plgR). These exosome-like vesicles have potential to participate in the catabolism of bioactive peptides (e.g. substance P and glucose-dependent insulinotropic polypeptide (GIP)) and influence local immune response in the oral cavity [Ogawa et al., 2008], Specifically, DPP IV in these vesicles from saliva might contribute to regulation of the concentration of peptides, such as chemokines, in the oral cavity.
[0028] Protein-coding mRNA and noncoding RNAs (such as long noncoding (Icn) RNA, circular RNA, and microRNA) in collected biological samples function as dynamic biomarkers, revealing active cellular processes and showing great potential for use in diagnostics, therapeutics, and personalized medicine [Freije and Arechavala-Gomeza, 2025], RNA isolated from patient samples can be used to detect, screen, and diagnose diseases and infections, including predicting and monitoring treatment efficacy (e.g. chemotherapy) and tracking resistance to treatment. Methods utilizing RNA from patient samples, such as quantitative Reverse Transcription PCR (qRT-PCR), RNA sequencing (RNA-seq) and microarrays, are being used to analyze gene expression, uncover pathogenic variants, and measure splice variants and gene fusions for early detection, precise diagnosis and disease monitoring. However, it is also well known in the art that RNA is inherently unstable, requiring careful collection and processing to avoid degradation, primarily driven by the enzymatic activity of ubiquitous ribonucleases, as well as additional physical and chemical factors. Fundamentally, the value of RNA as a dynamic biomarker for diagnostics and itsbroader clinical adoption relies heavily on its preservation from the point of sample collection.
[0029] High quality biological samples are vital for biomarker discovery, verification and validation. However, there is a substantial list of pre-analytical variables (above) that can alter the analysis of biological samples, such as blood [Rai et al., 2005], saliva, oral samples, and urine. Given the complexity of the plasma proteome, for example, it is not surprising that achieving complete inhibition of proteases, peptidases, phosphatases, and nucleases is a challenge, especially while maintaining low hemolysis levels in drawn blood samples. Ideally, a specialized collection tube or system would preserve in vivo analytes, including proteins and nucleic acids, in the collected biological sample and prevent ex vivo analyte generation by degradative enzymes and lysed cell membranes that can mask the diagnostic information from intrinsic analytes in lower abundance, all while preserving the biological sample in a state that is suitable with downstream analyses (e.g. mass spectrometry, qPCR, RT-qPCR, sequencing, and microarrays). Thus, there is a need to develop novel compositions and methods to stabilize analytes, in both the cellular and extracellular space, in collected biological samples for prolonged periods of time at ambient temperature, enabling research, diagnostics and therapeutic applications.
[0030] This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.SUMMARY OF THE INVENTION
[0031] Provided herein are compositions, methods of use, admixtures, devices, and kits for preserving analytes, such as polypeptides and nucleic acids, in a bodily fluid. In particular, polypeptides are preserved in a substantially native, nondenatured and / or functionally-active state / conformation at ambient temperature, without the use of toxic chemicals orfixatives, such as formaldehyde-releasing agents, namely imidazolinyl urea (IDU) or diazolidinyl urea (DU). Beneficially, the present invention eliminates the need for cold storage conditions during transport of collected samples to the laboratory and storage of said samples prior to processing and analysis. Cells in collected bodily fluids (or fractions thereof) mixed immediately withthe present composition remain substantially intact, which can subsequently be removed from the sample using centrifugation or other separation techniques known in the art.
[0032] The composition of the present application is referred to as “BMP” in the following description and accompanying figures.
[0033] In one aspect, there is provided a composition for preserving at least one polypeptide in a bodily fluid, or a cell-free or a cellular fraction thereof, at ambient temperature, the composition comprising: at least one buffering agent; at least one chelating agent; at least one saccharide; and at least one stabilizing agent selected from a stabilizing protein, a peptide, an amino acid, or a combination thereof. In another aspect, the composition stabilizes nucleic acids contained in the bodily fluid, or the cell-free or the cellular fraction thereof, at ambient temperature.
[0034] In another aspect, there is provided a method for preserving at least one polypeptide in a bodily fluid, or a cell-free or a cellular fraction thereof, at ambient temperature, the method comprising: a) obtaining a sample of the bodily fluid, or the cell-free or the cellular fraction thereof, containing the at least one polypeptide; b) contacting the sample with the composition as defined in herein to form a mixture; c) mixing the mixture of (b) to form a homogeneous mixture; and d) storing the homogeneous mixture at ambient temperature. The method can further comprise the steps of e) centrifuging the homogeneous mixture; f) collecting the supernatant or upper (cell-free) fraction of the sample; g) analyzing proteins in said upper fraction. In another aspect of the method, the composition stabilizes nucleic acids contained in the bodily fluid, or the cell-free or the cellular fraction thereof, at ambient temperature.
[0035] In yet another aspect, there is provided a kit for preserving at least one polypeptide in a bodily fluid, or a cell-free or a cellular fraction thereof, at ambient temperature, the kit comprising: a) a bodily fluid collection device; b) the composition as defined herein; c) instructions for use; and d) optionally, a collection implement, such as a swab. In another aspect of the kit, the composition stabilizes nucleic acids contained in the bodily fluid, or the cell-free or the cellular fraction thereof, at ambient temperature.
[0036] In another aspect, there is provided an admixture of a bodily fluid, or a cell-free ora cellular fraction thereof, and the composition as defined herein, whereinat least one polypeptide in the bodily fluid, orthe cell-free or the cellular fraction thereof is preserved at ambient temperature. In another aspect, nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, are stabilized.
[0037] In still yet another aspect, there is provided a device for collecting a bodily fluid, or a cell-free or a cellular fraction thereof, the device comprising: a container comprising a reservoir portion for receiving a sample of the bodily fluid, or the cell-free or the cellular fraction thereof; and the composition as defined herein, the composition being disposed in the reservoir portion of the container.BRIEF DESCRIPTION OF THE FIGURES
[0038] For a better understanding of the present invention including the progression of development to get to the end product, reference is made to the following description which is to be used in conjunction with the accompanying drawings, where:
[0039] Figures 1A-C illustrate BMP based preservation of both functional activity (Figure 1 A) and abundance (Figure 1 B) of amylase protein in saliva samples, and preservation of multiple protein targets in saliva as evaluated using Olink® Proteomics platform (Figure 1 C). Figures 1A and 1 B show data for individual donors, and Figure 1 C shows median values.
[0040] Figure 2 illustrates the impact of different chemical components inBMP towards salivary protein preservation.
[0041] Figure 3 illustrates the effect of pH on BMP based preservation of protein functionality in saliva samples.
[0042] Figure 4 illustrates the impact of select chemical components inBMP on preservation of red blood cell intactness. Median values are shown.
[0043] Figure 5 (A-D) illustrate minimization of hemolysis (Figure 5A), minimization of cellular proteins leakage into the plasma (Figure 5B) and minimization of protein degradation (Figure 5C-5D) (Figures 5C-D) in the plasma prepared from whole blood mixed with BMP and stored at room temperature for 7 days. For each of Figure 5A, B, D, the horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0044] Figure 6 illustrates the prevention of protein degradation in the plasma prepared from whole blood mixed with BMP and stored at 37°C for 3 days. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0045] Figure 7A-B illustrates preservation of protein abundance / profile in plasma prepared from whole blood mixed with BMP using CXCL8 / IL-8 ELISA assay (Figure 7A) and multiple proteins targets evaluated using Clink® Proteomics platform (Figure 7B). For Figure 7A, the horizontal line for each condition represents a median value with 95% Confidence Interval (Cl). For Figure 7B, median values are shown.
[0046] Figure 8 illustrates protein abundance / profile preservation in plasma collected from whole blood mixed with BMP containing BSA or a BSA alternative. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0047] Figure 9 illustrates protein abundance / profile preservation in plasma collected from whole blood mixed with BMP containing BSA alternatives.
[0048] Figure 10 illustrates a-amylase protein preservation in saliva samples mixed with BMP containing BSA alternatives (variations 1-6 as set forth in Table 10).
[0049] Figure 11A-B illustrates LC-MS compatibility of plasma samples prepared from whole blood mixed with BMP-1 and BMP-2 chemistry for untargeted proteomics.
[0050] Figure 12 illustrates the preservation of red blood cell integrity using the hemoglobin assay on plasma collected from whole blood mixed with BMP-3 of different pH values.
[0051] Figure 13A-E illustrates comparative performances for protein preservation in the plasma collected from whole blood mixed with BMP-2, BMP-3 and competitor chemistries. Median values are shown.
[0052] Figure 14A illustrates delta UV-VIS absorbance scans (220-900 nm) of BMP-2-modified compositions each having a different saccharide (see Table 14(H)) after 6 days of storage at 50°C (T6 - TO).
[0053] Figure 14B illustrates the concentration of hemoglobin (mg / dL) in plasma isolated from blood samples mixed with various BMP-2-modified compositions each containing a different saccharide (10% (w / v)) and stored for 3 days at 37°C.
[0054] Figure 14C illustrates the relative UV-VIS absorbance scans (220-900 nm) of compositions containing select amino acids post-gamma irradiation. The magnitude of the shift observed in these scans or profiles was impacted by the selection of amino acid present in the composition. The introduction and selection of the amino acid component within the “base” composition is important to minimize radiolysis under sterilization processes, as indicated by the peak shift in compositions containing an amino acid relative to the no-amino acid control composition (#8). The amino acids tested exhibited absorbance at higher wavelengths (e.g. above 570 nm) within acceptable levels.
[0055] Figure 14D illustrates delta UV-VIS absorbance scans (220-900 nm) of various compositions containing an amino acid post-gamma irradiation, compared to the relative absorbance of a composition without an amino acid component.
[0056] Figure 14E illustrates compositions containing amino acids at a 400 mM concentration were evaluated for the prevention of hemolysis after plasma isolation, when fingerprick blood was stored in the compositions for 3 days at 37°C at a 5:1 ratio as outlined in Table 14 (v).
[0057] Figure 14F illustrates the UV-VIS absorbance scans of various compositions containing select chelators (see Table 14 (vii)). Three compositions (ID# 7, 8, and 12) displayed visible yellowing within a few days at room temperature.
[0058] Figure 14G illustrates the concentration of hemoglobin (mg / dL) in isolated plasma after storage of fingerprick blood for 3 days at 37°C in compositions containing various buffering agents from Table 14(viii).
[0059] Figure 14H illustrates the concentration of human IL-8 protein(pg / mL) in plasma isolated from fingerprick blood samples at baseline TO and after 3 days of storage at 37°C when mixed at a 5:1 ratio with BMP-2-modified compositions from Table 14(x), compared to EDTA control (ID# 16).
[0060] Figure 141 illustrates the concentration of human EGF protein(pg / mL) in plasma isolated from fingerprick blood samples after 3 days of storage at 37°C when mixed at a 5:1 ratio with BMP-2-modified compositions from Table 14(x), compared to EDTA control (ID# 16).
[0061] Figure 15A illustrates the hemoglobin concentration (mg / dL) in isolated plasma after mixing venous blood from 3 donors with the compositions detailed in T able 15(i) at a 5: 1 ratio and storing the samples in the compositions for up to 7 days (T7) at room temperature (23°C±3°C).
[0062] Figure 15B illustrates the human EGF protein concentration (pg / mL) in isolated plasma after mixing venous blood from 3 donors with the compositions detailed in T able 15(i) at a 5: 1 ratio and storing the samples in the compositions for up to 7 days (T7) at room temperature (23°C±3°C).
[0063] Figure 15C illustrates the human LOX-1 (OLR1) protein concentration (pg / mL) in isolated plasma after mixing venous blood from 3 donors with the compositions detailed in Table 15 (i) at a 5:1 ratio and storing the samples in the compositions for up to 7 days (T7) at room temperature (23°C±3°C).
[0064] Figure 15D illustrates the fold change (TO vs T7) of a representative subset of proteins evaluated in SomaLogic’s SomaScan® Assay in plasma isolated from venous blood stored in composition 1 (see Table 15(i)) at room temperature, compared to EDTA collected samples across 3 healthy donors. Composition 1 maintained protein stability in various protein targets (C3, EGF:ECD, l-TAC, PBEF, TNF-b) after 7 days of storage at room temperature 23°C (±3°C). This boxplot is the mean fold change across 3 donors.
[0065] Figure 15E illustrates the average human LOX-1 (OLR1) protein concentration (pg / mL; n=2 technical replicates) in isolated plasma after mixing the compositions detailed in Table 15(ii) with fingerprick blood (4-5 donors) at a 5:1 ratio and storing the sample in the compositions for up to 4 days (T4) at room temperature (23°C±3°C).
[0066] Figure 15F illustrates the average human IL-8 protein concentration(pg / mL; n=2 technical replicates) in isolated plasma after mixing the compositions detailed in Table 15(ii) with fingerprick blood (4-5 donors) at a 5:1 ratio and storing the samples in the compositions for up to 4 days (T4) at room temperature (23°C±3°C).
[0067] Figure 15G illustrates the average human EGF protein concentration(pg / mL; n=2 technical replicates) in isolated plasma after mixing with the compositions detailed in Table 15(ii) with fingerprick blood (4-5 donors) at a 5:1 ratio and storing the samples in the compositions for up to 4 days (T4) at room temperature (23°C±3°C).
[0068] Figure 15H illustrates the hemoglobin concentration (mg / dL) in isolated plasma at baseline (TO) and after storage for 8 days (T8) at room temperature (23°C±3°C) for 3 donors after mixing with compositions detailed in Table 15(iii) with venous blood at a 1 :5 ratio.
[0069] Figure 15I illustrates the human LOX-1 (OLR1 ) protein concentration(pg / mL) in isolated plasma at baseline (TO) and after storage for 8 days (T8) at room temperature (23°C±3°C) for 3 donors after mixing with compositions detailed in Table 15(iii) with venous blood at a 1 :5 ratio.
[0070] Figure 15J illustrates the human EGF protein concentration (pg / mL) in isolated plasma at baseline (TO) and after storage for 8 days (T8) at room temperature (23°C±3°C) for 3 donors after mixing with compositions detailed in Table 15(iii) with venous blood at a 5:1 ratio.
[0071] Figure 16A illustrates a Boxplot showing collected venous blood volumes from 20 healthy donors into BMP-5 tubes (n=20 / 20), EDTA tubes (n=20 / 20) and a competitor’s venous blood collection tube with preservative (n=18 / 20). This boxplot is the mean collection volume across 20 donors with 95% Cl’s.
[0072] Figure 16B illustrates the hemoglobin concentration (mg / dL) in plasma isolated from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after 8 days of storage at room temperature (23°C±3°C) across 10 healthy donors (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0073] Figure 16C illustrates the concentration of human IL-8 protein(pg / mL) in plasma isolates from aliquots taken from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours) and after 8 days storage at room temperature (23°C±3°C) across 10 healthy donors (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0074] Figure 16D illustrates the concentration of human EGF protein(pg / mL) in plasma isolates from sample aliquots taken from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours) and after 8 days storage at room temperature (23°C±3°C) across 10 healthy donors (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0075] Figure 16E illustrates the concentration of human LOX-1 protein(pg / mL) in plasma isolates from aliquots taken from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours) and after 8 days storage at room temperature (23°C±3°C) across 10 healthy donors (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0076] Figure 16F illustrates the concentration of human CD62P protein(pg / mL) in plasma isolates from aliquots taken from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours) and after 8 days storage at room temperature (23°C±3°C) across 10 healthy donors (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0077] Figure 16G illustrates the average (n=10) hemoglobin concentration(mg / dL) in plasma isolated from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by a room temperature hold (23°C±3°C) for a total duration of 6 days (T6) to simulate expected transport conditions of whole blood (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0078] Figure 16H illustrates the average (n=10) human IL-8 protein concentration (pg / mL) in plasma isolated from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by a room temperature hold (23°C±3°C) for a total duration of 6 days (T6) tosimulate expected transport conditions of whole blood (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0079] Figure 161 illustrates the average (n=10) human EGF protein concentration (pg / mL) in plasma isolated from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours each temperature), followed by a room temperature hold (23°C±3°C) for a total duration of 6 days (T6) to simulate expected transport conditions of whole blood (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0080] Figure 16J illustrates the average (n=10) human LOX-1 protein concentration (pg / mL) in plasma isolated from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by a room temperature hold (23°C±3°C) for a total duration of 6 days (T6) to simulate expected transport conditions of whole blood (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0081] Figure 16K illustrates the average (n=10) human CD62P protein concentration (pg / mL) isolated from BMP-5 tubes, EDTA tubes, and a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by a room temperature hold (23°C±3°C) for a total duration of 6 days (T6) to simulate expected transport conditions of whole blood (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0082] Figure 16L illustrates the average (n=10) hemoglobin concentration(mg / dL) in plasma isolated from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from -10°C to 30°C (minimum of 24 hours at each temperature) followed by a room temperature hold for 6 days (23°C±3°C) for a total duration of 8 days (T8) tosimulate expected transport conditions of isolated plasma at baseline (TO) (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0083] Figure 16M illustrates the average (n=10) human EGF protein concentration (pg / mL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from -10°C to 30°C (minimum of 24 hours each temperature) followed by a room temperature hold for 6 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of isolated plasma at baseline (TO) (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0084] Figure 16N illustrates the average (n=10) human IL-8 protein concentration (pg / mL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from -10°C to 30°C (minimum of 24 hours each temperature) followed by a room temperature hold for 6 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of isolated plasma at baseline (TO) (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0085] Figure 160 illustrates the average (n=10) human LOX-1 protein concentration (pg / mL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from -10°C to 30°C (minimum of 24 hours each temperature) followed by a room temperature hold for 6 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of isolated plasma at baseline (TO) (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0086] Figure 16P illustrates the average (n=10) human CD62P protein concentration (pg / mL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) after temperature cycling from -10°C to 30°C (minimum of 24 hours each temperature) followed by a room temperature hold for 6 days (23°C±3°C) for a total duration of 8days (T8) to simulate expected transport conditions of isolated plasma at baseline (TO) (boxplot is mean concentration across 10 donors with 95% Cl’s).
[0087] Figure 16Q illustrates the average hemoglobin concentrations(mg / dL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by 24 hours of a simulated shaking condition (150 RPM) at room temperature (23°C±3°C), followed by a room temperature hold for 5 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of whole blood. Venous blood samples were successfully collected from 10 donors directly into BMP-5 tubes and EDTA tubes; whereas venous blood samples were successfully collected from 8 donors directly into a competitor tube (collections from 2 donors failed). The boxplot is mean concentration across the donors with 95% Cl’s.
[0088] Figure 16R illustrates the average human EGF protein concentration(pg / mL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by 24 hours of a simulated shaking condition (150 RPM) at room temperature (23°C±3°C), followed by a room temperature hold for 5 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of whole blood. Venous blood samples were successfully collected from 10 donors directly into BMP-5 tubes and EDTA tubes; whereas venous blood samples were successfully collected from 8 donors directly into a competitor tube (collections from 2 donors failed). The boxplot is mean concentration across the donors with 95% Cl’s.
[0089] Figure 16S illustrates the average human IL-8 protein concentration(pg / mL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by 24 hours of a simulated shaking condition (150 RPM) at room temperature (23°C±3°C),followed by a room temperature hold for 5 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of whole blood. Venous blood samples were successfully collected from 10 donors directly into BMP-5 tubes and EDTA tubes; whereas venous blood samples were successfully collected from 8 donors directly into a competitor tube (collections from 2 donors failed). The boxplot is mean concentration across the donors with 95% Cl’s.
[0090] Figure 16T illustrates the average human LOX-1 protein concentration (pg / mL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by 24 hours of a simulated shaking condition (150 RPM) at room temperature (23°C±3°C), followed by a room temperature hold for 5 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of whole blood. Venous blood samples were successfully collected from 10 donors directly into BMP- 5 tubes and EDTA tubes; whereas venous blood samples were successfully collected from 8 donors directly into a competitor tube (collections from 2 donors failed). The boxplot is mean concentration across the donors with 95% Cl’s.
[0091] Figure 16U illustrates the average human CD62P protein concentration (pg / mL) in plasma isolates from BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s blood collection tube with preservative at baseline (TO; plasma isolated within 2 hours of venous blood collection) and after temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by 24 hours of a simulated shaking condition (150 RPM) at room temperature (23°C±3°C), followed by a room temperature hold for 5 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of whole blood. Venous blood samples were successfully collected from 10 donors directly into BMP- 5 tubes and EDTA tubes; whereas venous blood samples were successfully collected from 8 donors directly into a competitor tube (collections from 2 donors failed). The boxplot is mean concentration across the donors with 95% Cl’s.
[0092] Figure 17 illustrates the fold change in SARS-CoV2 NucleocapsidProtein (NP) after storage of NP-spiked non-treated FVU samples and BMP-3-treatedFVU samples for 7 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0093] Figure 18A illustrates the preservation of p-globin cell-free DNA(cfDNA) in cell-free supernatants prepared from saliva samples treated with PBS or BMP composition (1 :1 ratio) and stored for 7 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0094] Figure 18B illustrates representative profiles of extracted cfDNA in cell-free supernatants prepared from saliva samples treated with PBS or BMP composition (1 :1 ratio) and stored for 7 days at room temperature.
[0095] Figure 19A illustrates the preservation of a-amylase enzymatic activity in cell-free supernatant fractions from BMP-6-treated, but not PBS-treated, oral swab samples after storage at room temperature (RT) for 7 days. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0096] Figure 19B illustrates representative profiles of extracted gDNA in cell pellet fractions prepared from oral swab samples treated with PBS or BMP-6 composition (1 :1 ratio) and stored for 7 days at room temperature.
[0097] Figure 19C illustrates ACt values following human p-globin qPCR analysis of gDNA extracted from cell pellet fractions prepared from oral swab samples treated with PBS or BMP-6 composition (1 :1 ratio) and stored for 7 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0098] Figure 19D illustrates ACt values following bacterial 16S qPCR analysis of gDNA extracted from cell pellet fractions prepared from oral swab samples treated with PBS or BMP-6 composition (1 :1 ratio) and stored for 7 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0099] Figure 20A illustrates the fold change in pTau181 protein after storage of pTaul 81 -spiked (S) plasma samples, derived from non-treated (EDTA only) or BMP-3-treated whole blood, for 7 days at room temperature.
[0100] Figure 20B illustrates the fold change in pTau217 protein after storage of pTau217-spiked (S) plasma samples, derived from non-treated (EDTA only)or BMP-5-treated whole blood, for 7 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0101] Figure 20C illustrates the fold change in endogenous or blood- derived Tau (pS396) protein in plasma samples obtained from non-treated (EDTA only) whole blood and BMP-3-treated whole blood after storage for 7 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0102] Figure 20D illustrates the fold change in endogenous or blood- derived Tau (pS396) protein in plasma samples obtained from non-treated (EDTA only) whole blood and BMP-5-treated whole blood after storage for 8 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0103] Figure 20E illustrates the fold change in pTau217 protein after storage of pTau217-spiked (S) cell-free supernatant samples, derived from nontreated (No preservative) saliva or BMP-7-treated saliva, for 2 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0104] Figure 21 illustrates the fold change in SARS-CoV2 NucleocapsidProtein (NP) after storage of NP-spiked non-treated first-void urine (FVU) samples and BMP-3 lyobead-treated FVU samples for 7 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0105] Figure 22A illustrates the preservation of p-globin cfDNA in plasma samples prepared from non-treated (EDTA only) blood samples and BMP-3-treated blood samples in 5:1 ratio (Blood: BMP-3) and stored for 7 days at room temperature. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0106] Figure 22B illustrates representative profiles of cfDNA extracted from plasma prepared from non-treated (EDTA only) blood samples or BMP-3-treated blood samples stored for 7 days at room temperature.
[0107] Figure 23A illustrates the human EGF protein concentration (pg / mL) in isolated plasma at baseline (TO) and after storage for 7 days (T7) at roomtemperature (23°C±3°C) from aliquots of non-treated (EDTA only) and BMP-8-treated pooled capillary blood samples wherein the ratio of blood: BMP-8 is 1 :0.2.
[0108] Figure 23B illustrates the fold change in pTau217 protein after storage of pTau217-spiked (S) non-treated (EDTA only) or BMP-8-treated plasma samples for 3 and 7 days at room temperature. TX represents T3 or T7 timepoints. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0109] Figure 24A illustrates the phosphatase activity in plasma isolated from non-treated (EDTA only) and BMP-9-treated whole blood samples from 2 different donors and stored at room temperature for prolonged periods.
[0110] Figure 24B illustrates the phosphatase activity in plasma isolated from non-treated (EDTA only) and BMP-10 treated whole blood samples from 3 different donors and stored at room temperature for 3 days.
[0111] Figure 24C illustrates the phosphatase activity in plasma isolated from non-treated (EDTA only) and BMP-11 treated whole blood samples from 3 different donors and stored at room temperature for 3 days.
[0112] Figure 25A illustrates a composite gel image from Genomic DNAScreenTapes illustrates the quality of DNA extracted from non-treated (EDTA only) venous blood samples and BMP-5 treated blood samples of 8 donors (D1-D8) at baseline (TO) and after storage for 7 days (T7) at room temperature.
[0113] Figure 25B illustrates representative profiles of total DNA extracted from non-treated (EDTA only) venous blood samples or BMP-5 treated blood samples of 3 donors (D1 , D5, and D8) at baseline (TO) and after storage for 7 days (T7) at room temperature.
[0114] Figure 25C illustrates the p-globin qPCR Ct values for cell-free DNA isolated from plasma prepared from non-treated (EDTA only) blood samples and BMP- 5 treated blood samples (blood: BMP-5 in a 5: 1 ratio) at baseline (TO) and after storage for 7 days (T7) at room temperature. The horizontal line for each condition represents a median with range.
[0115] Figure 25D illustrates representative profiles of cfDNA extracted from plasma prepared from non-treated (EDTA only) venous blood samples or BMP-5 treated venous blood samples from 3 donors (D6, D7 and D10) at baseline (TO) and after storage for 7 days (T7) at room temperature.
[0116] Figure 26 illustrates Ct values following human GAPDH TaqMan™Assay analysis of cDNA prepared from RNA preserved in cell pellet fractions obtained from non-treated (NA) or BMP-6-treated saliva samples (1 :1 ratio) stored for 3 days at 37°C. The horizontal line for each condition represents a median value with 95% Confidence Interval (Cl).
[0117] Figure 27 illustrates subsets of proteins (IL-16, NCF-1 , HDAC4, andSHIP1) involved in various biological pathways and analyzed from plasma isolated from whole blood samples stored for up to 7 days at room temperature in BMP-5 composition and up to 5 hours in EDTA alone. Data is presented using Violin Plots.DETAILED DESCRIPTION OF THE INVENTION
[0118] Definitions
[0119] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0120] As used in the specification and claims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
[0121] The term “comprising” as used herein will be understood to mean that the list following is non-exhaustive and may or may not include any other additional suitable items, for example one or more further feature(s), component(s) ingredient(s) and / or element(s) as appropriate.
[0122] The term “bodily fluid” as used herein will be understood to mean a naturally occurring fluid from a human or an animal, and includes, but is not limited to urine, saliva, sputum, serum, plasma, blood, pharyngeal, nasal / nasal pharyngeal and sinus secretions, mucous, gastric juices, pancreatic juices, bone marrow aspirates, cerebral spinal fluid (CSF), feces, semen, products of lactation or menstruation, cervical secretions, vaginal fluid, tears, or lymph. In one embodiment, the bodily fluid is selected from blood, urine or saliva. In another embodiment, the bodily fluid is blood.
[0123] The term “ambient temperature” as used herein refers to a range of temperatures that could be encountered by the mixture of the bodily fluid (e.g. blood, urine, or saliva sample) and the aqueous composition described herein from the point of collection, during transport (which can involve relatively extreme temperatures, albeit usually for shorter periods of time (e.g. < 5 days)), as well as during prolonged storage prior to analysis. In one embodiment, the ambient temperature is ranging from about -20°C to about 50°C. In another embodiment, the ambient temperature is room temperature (RT / rt), which as defined herein ranges from about 15°C to about 26°C.
[0124] Amino acids are used as stabilizing agents. The term “amino acids” includes a group of organic molecules that can serve as a building block of proteins and / or can participate in various biological processes. While many amino acids comprise a carboxyl group (— COOH) and an amino group (— NH2) in the molecule, having the basic formula X-R, wherein X is:
[0125] the skilled worker will be aware that there are several amino acids and derivatives thereof that can deviate from the basic formula. Unless specified otherwise, the term “amino acid” as used herein will be understood to mean an amino acid in its various forms including any essential and non-essential amino acids, aliphatic amino acids, aromatic amino acids, branched-chain amino acids, cyclic amino acids, acidic / basic amino acids, hydroxyl-containing, sulfur-containing or methylated amino acids, amide amino acids, non-proteinogenic amino acids, derivatives thereof (e.g. acetylated derivatives of amino acids), isomers thereof (e.g. D- / L- stereoisomers), and / or salts thereof (e.g. salts with inorganic acids, such as HCI). Accordingly, amino acids comprise, by way of non-limiting example, glycine, histidine, arginine, proline, glutamic acid, betaine, taurine, and N-acetyl cysteine.
[0126] In other embodiments, the stabilizing agent can be a peptide, such as glutathione or poly-histidine. Additional stabilizing agents suitable for use in the compositions described herein are discussed in the Examples below.
[0127] The term “saccharide” as used herein will be understood to include a monosaccharide, a disaccharide, an oligosaccharide, a polysaccharide, and derivatives thereof. Some examples of derivatives include, but are not limited to, reduction of the carbonyl group to form sugar alcohols, oxidation of one or more terminal groups to carboxylic acids, one or more glycosylation, one or more glycosidic bond formation or by replacement of one or more hydroxy group(s) by a hydrogen atom, an amino group, thiol group or similar groups. Saccharide derivatives can include, for example, sorbitol, xylitol, and mannitol. Additional saccharides suitable for use in the compositions described herein are discussed in the Examples below.
[0128] The term “chelator” or “chelating agent” as used herein will be understood to mean a chemical that will form a soluble, stable complex with certain metal ions (e.g., Ca2+and Mg2+), sequestering the ions so that they cannot normally react with other components, such as deoxyribonucleases (DNases) or ribonucleases (RNases) or endonucleases (e.g. type I, II and III restriction endonucleases) and exonucleases (e.g. 3’ to 5’ exonuclease), metalloproteases enzymes which are abundant in various bodily fluids. Moreover, in blood samples, chelating agent would carry out sequestration of divalent cations (Ca+2). (Ca+2) or ionized calcium is also known as Factor IV and is a key component of the blood clotting process. In some embodiments, the preserving composition comprises one or more chelating agents which are a compound of Formula I:I where: each R7is independently a straight-chain or branched alkyl with 1 to 6, preferably 1 to 4, C atoms, which terminates with a -C(=O)-OH, -OH, -C(=O)-O' or a salt thereof; andR8is a bivalent straight-chain, branched or cyclic hydrocarbon with 1 to 12, preferably 1 to 8, C atoms, in which one or more CH2 groups are optionally replaced by -CR’R”- , -O-, -S-, -C(=O)- , -C(=O)-O- -O-C(=O)-, -NR9-, -NR'-, -CR'=CR"-, - CY -CY"- or — C=C— in such a manner that O and / or S atoms are not linked directly toone another , and in which one or more H atoms are optionally replaced by OH, F , Cl , Br , I or CN, and in which one or more CH2, or CH3 groups are optionally replaced by an aryl, heteroaryl, arylalkyl, heteroarylalkyl, aryloxy or heteroaryloxy, wherein each of the aforementioned cyclic groups has 5 to 20 ring atoms, is mono- or polycyclic, does optionally contain fused rings, and is unsubstituted or substituted by one or more identical or different groups L;R9is a straight-chain or branched alkyl with 1 to 6, preferably 1 to 4, C atoms, which terminates with a -C(=O)-OH, -OH, -C(=O)-O' or a salt thereof;L is F, Cl, -CN, -NC, -NCO, -NCS, -OCN, -SCN, -R', -OR', -SR', -C(=O)R'-, - C(=O)-OR-, -NH2, -NHR', -NR'R", -SO3R', -SO2R', -OH, -NO2, -CF3, or optionally substituted silyl, carbyl or hydrocarbyl with 1 to 30 C atoms that is optionally substituted and optionally comprises one or more hetero atoms;R' and R" are each independently H or a straight-chain or branched alkyl with 1 to 6 C atoms; andY' and Y" are each independently H, F, Cl or CN.
[0129] In some embodiments, the chelating agent is a compound ofFormula IIII where R10and R11, together with the carbon atoms to which they are attached, form a cycloalkyl, such as a cyclohexyl. An example of such a chelator is cyclohexanediaminetetraacetic acid (CDTA).
[0130] In the present composition, chelating agent(s) participates in the inhibition of nucleases, metalloproteases as well as anti-coagulating agent in bodily fluids. A chelator can be, for example, ethylene glycol tetraacetic acid (EGTA), (2- hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), 1 ,2- cyclohexanediaminetetraacetic acid (CDTA), N,N-bis(carboxymethyl)glycine,triethylenetetraamine (TETA), tetraazacyclododecanetetraacetic acid (DOTA), citrate anhydrous, sodium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ferric ammonium citrate, and lithium citrate. Additional chelators suitable for use in the compositions described herein are discussed in the Examples below. These chelating agents may be used singly or in combination of two or more thereof. Preferably, monovalent salts (sodium, potassium etc.) are used as chelating agents; it is preferred that divalent salts are not used.
[0131] In one embodiment, there is provided a composition for preserving at least one polypeptide in a bodily fluid, or a cell-free or a cellular fraction thereof, at ambient temperature, the composition comprising: at least one buffering agent; at least one chelating agent; at least one saccharide; and at least one stabilizing agent selected from a stabilizing protein, a peptide, an amino acid, or a combination thereof. In another embodiment, the composition has a pH of from about 4.2 to about 8.2, or of from about 4.6 to about 7.5, or of from about 4.8 to about 7.2, or of from about 4.8 to about 5.2. More particularly, the composition has a pH of from about 4.4 to about 7.5, or of from about 4.5 to about 7.2, or of from about 4.5 to about 5.2. In another embodiment, the composition is a liquid composition, such as an aqueous composition. In another embodiment, the composition is a solid composition, such as lyobeads. In yet another embodiment, the solid composition is prepared by drying the aqueous composition, such as by spray-drying or lyophilization.
[0132] In another embodiment, the composition preserves the at least one polypeptide in a native, non-denatured conformation and / or preserves a functional activity of the at least one polypeptide.
[0133] In another embodiment, the composition minimizes lysis of cells that are present in the bodily fluid or the cellular fraction thereof - i.e. the composition minimizes lysis of cells that are present in the bodily fluid or the cellular fraction thereof relative to a sample of the bodily fluid or the cellular fraction thereof that is unpreserved (e.g. a raw sample, or a sample stored in a control composition such as PBS, EDTA, etc.).
[0134] In another embodiment, the at least one stabilizing agent is a stabilizing protein, such as bovine serum albumin (BSA). In yet another embodiment, the at least one stabilizing agent is a peptide, such as an oligopeptide (e.g. having 2-20 amino acids (such as L-carnosine) which can be synthesized or obtained from natural sources), or a synthetic polypeptide (such as poly-L-Histidine). In still yet another embodiment, the at least one stabilizing agent is an amino acid, such as glycine, histidine, arginine, proline, glutamic acid, betaine, N-acetyl cysteine, or mixtures thereof. In another embodiment, the at least one stabilizing agent is an amino acid selected from glycine, histidine, arginine, proline, glutamic acid, or mixtures thereof. In another embodiment, the at least one stabilizing agent is an amino acid, such as L-Histidine and salts and hydrates thereof, such as L-Histidine monochloride monohydrate, L-Histidine monohydrate, L-Histidine dihydrochloride, or mixtures thereof.
[0135] In another embodiment, the at least one buffering agent comprises an acetate salt, a succinate salt, a citrate salt, or a combination thereof; optionally, wherein the acetate salt is selected from sodium acetate, potassium acetate, tetramethyl ammonium acetate, tetraethyl ammonium acetate, or a combination thereof; optionally, wherein the citrate salt is selected from sodium citrate, potassium citrate, ora combination thereof; optionally, wherein the succinate salt is selected from sodium succinate, potassium succinate, or a combination thereof. Additional buffering agents suitable for use in the compositions described herein are discussed in the Examples below.
[0136] In yet another embodiment, the buffering agent comprises an acetate salt, a citrate salt, or a combination thereof.
[0137] In another embodiment, the buffering agent is an acetate salt. In yet another embodiment, the buffering agent is sodium acetate. In still yet another embodiment, the buffering agent is acetate, such as sodium acetate. In another embodiment, the composition further comprises an organic acid, in particular an organic acid selected from a hydroxycarboxylic acid, such as a C3-C6 hydroxycarboxylic acid. In another embodiment, the organic acid is citric acid.
[0138] In another embodiment, the chelating agent is selected from ethylene glycol tetraacetic acid (EGTA), (2-hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), ethylenediaminetriacetic acid (EDTA), 1 ,2-cyclohexanediaminetetraacetic acid (CDTA), N,N- bis(carboxymethyl)glycine, 1 ,3-propylenediamine tetra-acetic acid (PDTA), sodiumphytate, or a combination thereof. In another embodiment, the chelating agent is EGTA, HEDTA, or CDTA. In another embodiment, the chelating agent is EGTA or HEDTA.
[0139] In another embodiment, the at least one saccharide is selected from a monosaccharide, a disaccharide, or a combination thereof. In another embodiment, the at least one saccharide is selected from trehalose, dextrose or glucose, fructose, D-mannitol, D-sorbitol, D-xylitol, hydroxyethyl starch, inulin, maltodextrin, or a combination thereof. In another embodiment, the at least one saccharide is trehalose or hydroxyethyl starch (HES).
[0140] In yet another embodiment, the composition further comprises at least one protease inhibitor, optionally wherein the at least one protease inhibitor is selected from a serine protease inhibitor, a cysteine protease inhibitor, an aspartic protease inhibitor, an aminopeptidase inhibitor, and / or metalloprotease inhibitor, or combinations thereof. In another embodiment, the protease inhibitor is selected from 4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF), Aprotinin, Bestatin, E-64, Leupeptin, Pepstatin A, Phosphoramidon, phenylmethylsulfonyl fluoride (PMSF), Phosphatidyl dipeptide, 4-Phenyl-1 , 2, 4-triazoline-3, 5-dione, Ethyl benzimidate hydrochloride, Camostat mesylate, Antipain Dihydrochloride, Saccharin, N- methylsaccharin or combinations thereof.
[0141] In yet another embodiment, the composition further comprises at least one phosphatase inhibitor. A broad class of common phosphatase inhibitors contain phosphate-mimicking anions that are typically supplied as alkali metal salts (e.g., sodium or potassium salts). These active anions largely fall into two main groups. The first group is tetrahedral oxoanions, which mimic the phosphate group and include inorganic phosphates like pyrophosphate, transition-metal oxoanions such as vanadate and molybdate, and organic phosphates (organophosphates) like p- glycerophosphate. The second group consists of inorganic halide anions, including inhibitors like fluoride (from sodium fluoride), which function by forming metal-fluoride complexes that mimic the phosphoryl transfer transition state. In one embodiment, the at least one phosphatase inhibitor is selected from inhibitors of protein tyrosine phosphatases, serine / threonine phosphatases, acid phosphatases, or combinations thereof.
[0142] In another embodiment, the at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof, comprises one or more protein post-translational modifications (PTMs), and the composition preserves the PTMs. In still another embodiment, the PTMs comprise phosphorylation and / or glycosylation. In another embodiment, the PTMs comprise phosphorylation.
[0143] In still yet another embodiment, the bodily fluid, or the cell-free or the cellular fraction thereof, is obtained from a mammal, such as a human. In another embodiment, the bodily fluid is saliva, oral swab sample, sputum, vaginal swab samples, urine, respiratory aspirates or lavages, or blood, or a cell-free or a cellular fraction thereof. In another embodiment, the bodily fluid is saliva, urine, or blood, or a cell-free or a cellular fraction thereof. In another embodiment, the bodily fluid is blood or saliva.
[0144] In another embodiment, the at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof, is selected from a cytokine, an enzyme, a growth factor, a chemokine, a chemoattractant, or a complement factor. In another embodiment, the at least one polypeptide plays a role in one or more pathways comprising cytokine pathways, respiratory pathways, cardiovascular pathways, metabolic pathways, neurological pathways, and immunological pathways, wherein the at least one polypeptide is associated with health status, or a disease or disorder.
[0145] In another embodiment, the composition as disclosed herein preserves a plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof. In another embodiment, each of the plurality of polypeptides is independently selected from a cytokine, an enzyme, a growth factor, a chemokine, a chemoattractant, or a complement factor. In yet another embodiment, each of the plurality of polypeptides plays a role in one or more pathways comprising cytokine pathways, respiratory pathways, cardiovascular pathways, metabolic pathways, neurological pathways, and immunological pathways, wherein each of the plurality of polypeptides is associated with health status, or a disease or disorder. In still another embodiment, each of the plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof, comprises one or more protein post-translational modifications (PTMs), and the composition preserves the PTMs. In anotherembodiment, the PTMs comprise phosphorylation and / or glycosylation. In another embodiment, the PTMs comprise phosphorylation.
[0146] In yet another embodiment, there is provided a method for preserving at least one polypeptide in a bodily fluid, or a cell-free or a cellular fraction thereof, at ambient temperature, the method comprising: a) obtaining a sample of the bodily fluid, or the cell-free or the cellular fraction thereof, containing the at least one polypeptide; b) contacting the sample with the composition as defined in herein to form a mixture; c) mixing the mixture of (b) to form a homogeneous mixture; and d) storing the homogeneous mixture at ambient temperature. The method can further comprise the steps of e) centrifuging the homogeneous mixture; f) collecting the supernatant or upper (cell-free) fraction of the sample; g) analyzing proteins in said upper fraction. In another embodiment of the above method, the at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof, is preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature. In another embodiment, a plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof, are preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
[0147] In another embodiment of the above method, nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, are stabilized for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
[0148] In another embodiment, there is provided a kit for preserving at least one polypeptide in a bodily fluid, or a cell-free or a cellular fraction thereof, at ambient temperature, the kit comprising: a) a bodily fluid collection device; b) the composition as defined herein; c) instructions for use; and d) optionally, a collection implement, such as a swab. In another embodiment, the at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof, is preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature. In another embodiment, a plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof, are preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5days, at least 6 days, or at least 7 days at ambient temperature. In yet another embodiment, nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, are stabilized for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
[0149] In another embodiment, an admixture of the bodily fluid, or the cell- free or the cellular fraction thereof, and the composition as defined herein is provided, wherein at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof is preserved at ambient temperature. In another embodiment, the at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof, is preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature. In another embodiment, a plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof, are preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature. In yet another embodiment, nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, are stabilized for at least 1 day, at least 2 days, at least s days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
[0150] In still yet another embodiment, there is provided a device for collecting a bodily fluid, or a cell-free or a cellular fraction thereof, the device comprising: a container comprising a reservoir portion for receiving a sample of the bodily fluid, or the cell-free or the cellular fraction thereof; and the composition as defined herein, the composition being disposed in the reservoir portion of the container. In another embodiment, the container is a saliva collector, a urine collector, or a capillary blood collector. In another embodiment, the container is a tube, wherein the tube is at least partially evacuated, such as a venous blood collection tube. In another embodiment, the bodily fluid collection device is configured to collect saliva, oral swab samples, vaginal swab samples, urine, sputum, respiratory aspirates or lavages, venous blood or capillary blood.
[0151] In another embodiment, the composition minimizes hemolysis of red blood cells. In another embodiment, the composition minimizes lysis of blood cells (WBCs, platelets). In another embodiment, the composition minimizes leakage ofanalytes from blood cells. In another embodiment, the composition preserves plasma space homeostasis by minimizing leakage of cellular proteins from blood cells in plasma. In another embodiment, the composition preserves protein content in the bodily fluid samples. In another embodiment, the composition preserves protein functionality in bodily fluid samples, wherein functionality refers to an enzymatic activity of said protein. In another embodiment, the composition preserves protein functionality, wherein functionality refers to the detection and quantification of said protein using a high-throughput proteomics assay.
[0152] As the skilled worker will appreciate, specific embodiments described herein with respect to the composition for preserving at least one polypeptide in a bodily fluid (or a cell-free / cellular fraction thereof) at ambient temperature are also applicable to the related methods and kits described herein.
[0153] In one embodiment, the bodily fluid is mixed immediately with the composition at the point of collection.
[0154] In one embodiment, the preserving composition can be provided in various physical forms, including solids (e.g., powders, crystals, spray-dried materials, or lyophilized products such as lyobeads), liquids (e.g., solutions or suspensions), semi-solids (e.g., gels), or aerosols. For example, the composition can be introduced as a liquid and converted into a solid using techniques such as freeze- drying / lyophilizing, spray drying, vacuum drying, drum drying, or other standard techniques. Alternatively, the composition can be applied as an aerosol to coat the interior surfaces of a sample collection device, such as a container / tube. The device, designed for single-use applications, can be made from materials like glass, plastic, or other substances that maintain the integrity of the preserving composition. The preserving composition can be added using various methods, such as a direct deposition of liquids for in situ processing or deposition of pre-formed solids, slurries, or powders.
[0155] If the composition is in a dried, e.g. spray-dried or lyophilized form, a low concentration of a coating additive or “aide” can optionally be added. The term coating additive as used herein will be understood to mean an aide that facilitates the formation of a film or coating by reducing the surface tension of the liquid composition, thereby promoting a uniform spread and adherence of the film or coating on the innersurface of the device (e.g. blood tube). A coating additive can be, for example, surfactants, preferably non-ionic, zwitterionic and / or volatile surfactants, solvents such as alcohols, e.g. geraniol, citronellol, linalool, n-propanol.
[0156] In one embodiment, the blood tube can be prepared as follows:
[0157] 1. Dispense the preserving composition into blood tube
[0158] 2. Blood tubes are brought into vacuum chamber
[0159] 3. Vacuum chamber pressuring is set to desired internal partial pressure
[0160] 4. Tubes are capped inside the chamber, allowing them to retain their partial pressure
[0161] 5. Tubes are removed from vacuum
[0162] 6. Tubes are sterilized (gases, heat, gamma, E-beam, X-ray).Sterilization is an act or process, physical or chemical, that destroys, removes, or deactivates all forms of life, especially microorganisms. Sterilization techniques include the use of autoclaves, ovens, electron irradiation (electron-beam), X-ray irradiation, gamma irradiation, and chemicals like ethylene oxide (EtO). In one embodiment, the tubes are stabilized using a Cobalt-60 gamma irradiation dose of 17.0-25.0 kiloGrays.
[0163] Addition of antioxidants to the compositions as described herein can also be beneficial.
[0164] As the skilled worker will appreciate, when the BMP (“chemistry”) is in the form of an aqueous composition, such as those described herein in the Examples below, such aqueous composition can be combined with the bodily fluid in a variety of ratios. Samples can be mixed with the chemistry at varying ratios (vol / vol depending on the sample type).
[0165] In one embodiment, there is provided a mixture / ad mixture comprising the composition as defined herein in combination with a bodily fluid, or a cell-free or a cellular fraction thereof, wherein the composition comprises at least one buffering agent, at least one chelating agent, at least one saccharide, at least one stabilizing agent, and optionally at least one protease inhibitor, at least onephosphatase inhibitor, and / or an optional hydroxycarboxylic acid, wherein such components are as defined herein, wherein:
[0166] the at least one buffering agent is present in an amount of from about 50 mM to about 1.5 M, or of from about 60 mM to about 850 mM, or of from about 50 mM to about 200 mM, or of from about 250 mM to about 850 mM, in the admixture;
[0167] the at least one chelating agent is present in an amount of from about 5 mM to about 125 mM, or of from about 15 mM to about 60 mM, or of from about 5 mM to about 12 mM in the admixture;
[0168] the at least one saccharide is present in an amount of from about1 % (w / v) to about 15% (w / v), or of from about 2% (w / v) to about 11 % (w / v), or of from about 1 .2% (w / v) to about 2.2% (w / v) in the admixture;
[0169] the at least one stabilizing agent is present in an amount of from about 0.02% (w / v) to about 6% (w / v), or of from about 0.2% (w / v) to about 5% (w / v), or of from about 0.02% (w / v) to about 2.5% (w / v), or of from about 0.25 % (w / v) to about 6% (w / v) in the admixture;
[0170] the optional at least one protease inhibitor is present in an amount of from about 0 mM to about 25 mM, or of from about 0.25 mM to about 15 mM, or of from about 0 mM to about 3 mM in the admixture;
[0171] the optional at least one phosphatase inhibitor is present in an amount of from about 1 mM to about 100 mM, or of from about 25 mM to about 65 mM, in the admixture;
[0172] the optional hydroxycarboxylic acid is present in an amount of from about 0% (w / v) to about 1 .25% (w / v), or of from about 0.05% (w / v) to about 1 % (w / v) or of from about 0% (w / v) to about 0.2% (w / v), in the admixture.
[0173] In another exemplary embodiment, the admixture comprises the composition as defined herein in combination with blood-related bodily fluids, such as blood / serum / plasma, etc., wherein: the at least one buffering agent is present in an amount of from about 50 mM to about 200 mM, or of from about 60 mM to about 190 mM, or of from about 70 mM to about 90 mM, in the admixture; the at least one chelating agent is present in an amount of from about 5 mM to about 12 mM, or offrom about 5 mM to about 10 mM, in the admixture; the at least one saccharide is present in an amount of from about 1 % (w / v) to about 3.5% (w / v), or of from about 1 % (w / v) to about 2.3% (w / v), or of from about 1.2% (w / v) to about 2.2% (w / v) in the admixture; the at least one stabilizing agent is present in an amount of from about 0.02% (w / v) to about 2.5% (w / v), or of from about 0.2% (w / v) to about 2.2% (w / v), or of from about 0.5% (w / v) to about 2% (w / v), in the admixture; the optional at least one protease inhibitor is present in an amount of from about 0 mM to about 3 mM, or of from about 0.25 mM to about 2.5 mM, in the admixture; the optional at least one phosphatase inhibitor is present in an amount of from about 0 mM to about 100 mM, or of from about 25 mM to about 65 mM, in the admixture; and the optional hydroxycarboxylic acid is present in an amount of from about 0% (w / v) to about 0.2% (w / v), or of from about 0.05% (w / v) to about 0.18% (w / v) or of from about 0.10% (w / v) to about 0.15% (w / v), in the admixture.
[0174] In another exemplary embodiment, the admixture comprises the composition as defined herein in combination with bodily fluids that may contain mucin, such as saliva / sputum / urine, etc., wherein: the at least one buffering agent is present in an amount of from about 100 mM to about 1 M, or of from about 250 mM to about 850 mM, in the admixture; the at least one chelating agent is present in an amount of from about 5 mM to about 125 mM, or of from about 15 mM to about 60 mM, in the admixture; the at least one saccharide is present in an amount of from about 1 % (w / v) to about 15% (w / v), or of from about 2% (w / v) to about 11 % (w / v), or of from about 5% (w / v) to about 11 % (w / v) in the admixture; the at least one stabilizing agent is present in an amount of from about 0.20% (w / v) to about 6% (w / v), or of from about 1 % (w / v) to about 5% (w / v), in the admixture; the optional at least one protease inhibitor is present in an amount of from about 0 mM to about 25 mM, or of from about 1 mM to about 15 mM, or of from about 25 mM to about 65 mM, in the admixture; the optional at least one phosphatase inhibitor is present in an amount of from about 0 mM to about 100 mM, or of from about 0 mM to about 80 mM, or of from about 25 mM to about 65 mM, in the admixture; and the optional hydroxycarboxylic acid is present in an amount of from about 0% (w / v) to about 1.25% (w / v), or of from about 0.25% (w / v) to about 1 % (w / v), in the admixture.
[0175] In another embodiment, the composition as defined herein is an aqueous composition wherein:
[0176] the buffering agent is present in an amount of from about 0.2 M to about 2.25 M, or of from about 450 mM to about 1 .7 M, or of from about 400 mM to about 600 mM, or of from about 650 mM to about 850 mM;
[0177] the chelating agent is present in an amount of from about 10 mM to about 250 mM, or of from about 30 mM to about 120 mM, or of from about 30 mM to about 60 mM;
[0178] the at least one saccharide is present in an amount of from about2% (w / v) to about 30% (w / v), or from about 4% (w / v) to about 22% (w / v), or of from about 6% (w / v) to about 21 % (w / v), or of from about 6% (w / v) to about 12% (w / v);
[0179] the stabilizing agent is present in an amount of from about 0.1 %(w / v) to about 15% (w / v), or of from about 0.2% (w / v) to about 12% (w / v), or of from about 1 % (w / v) to about 9% (w / v), or of from about 3% (w / v) to about 12% (w / v);
[0180] the optional protease inhibitor is present in an amount of from about 0 mM to about 50 mM, or of from about 0.1 mM to about 30 mM, or of from about 1 .5 mM to about 15 mM, or of from about 3 mM to about 30 mM;
[0181] the optional phosphatase inhibitor is present in an amount of from about 0 mM to about 400 mM, or of from about 0 mM to about 360 mM, or of from about 0 mM to about 200 mM, or of from about 150 mM to about 250 mM; or of from about 100 mM to about 200 mM; and
[0182] the optional hydroxycarboxylic acid is present in an amount of from about 0% (w / v) to about 2.5% (w / v), or of from about 0.5% (w / v) to about 2% (w / v), or of from about 0.6% (w / v) to about 1 .2% (w / v);
[0183] wherein the amounts noted above correspond to the concentrations of components in the aqueous composition prior to admixture with the bodily fluid.
[0184] In another exemplary embodiment, the composition as defined herein is used to preserve at least one polypeptide / a plurality of polypeptides and / or stabilize nucleic acids in blood-related bodily fluids, such as blood / serum / plasma, etc., wherein: the at least one buffering agent is present in an amount of from about 300 mM to about 1 ,200 mM, or of from about 450 mM to about 600 mM; the at least one chelating agent is present in an amount of from about 30 mM to about 70 mM, or of from about 30 mM to about 65 mM, or of from about 35 mM to about 65 mM; the atleast one saccharide is present in an amount of from about 5% (w / v) to about 20% (w / v), or of from about 5% (w / v) to about 15% (w / v), or of from about 6% (w / v) to about 12% (w / v); the at least one stabilizing agent is present in an amount of from about 0.10% (w / v) to about 15% (w / v), or of from about 3% (w / v) to about 12% (w / v); the optional at least one protease inhibitor is present in an amount of from about 0 mM to about 18 mM, or of from about 1.5 mM to about 15 mM; the optional at least one phosphatase inhibitor is present in an amount of from about 0 mM to about 400 mM, or of from about 0 mM to about 360 mM, or of from about 0 mM to about 200 mM; and the optional hydroxycarboxylic acid is present in an amount of from about 0% (w / v) to about 1.2% (w / v), or of from about 0.3% (w / v) to about 1.2% (w / v), or of from about 0.6% (w / v) to about 0.9% (w / v); wherein the amounts noted above correspond to the concentrations of components in the aqueous composition prior to admixture with the bodily fluid.
[0185] In another exemplary embodiment, the composition as defined herein is used to preserve at least one polypeptide / a plurality of polypeptides and / or stabilize nucleic acids in bodily fluids that may contain mucin, such as saliva / sputum / urine, etc., wherein: the at least one buffering agent is present in an amount of from about 200 mM to about 2.25 M, or of from about 450 mM to about 1 ,7M, or of from about 650 mM to about 850 mM; the at least one chelating agent is present in an amount of from about 10 mM to about 250 mM, or of from about 30 mM to about 120 mM; the at least one saccharide is present in an amount of from about 2% (w / v) to about 30% (w / v), or of from about 4% (w / v) to about 22% (w / v), or of from about 10% (w / v) to about 22% (w / v); the at least one stabilizing agent is present in an amount of from about 0.50% (w / v) to about 12% (w / v), or of from about 0.5% (w / v) to about 10% (w / v), or of from about 1 % (w / v) to about 9% (w / v); the optional at least one protease inhibitor is present in an amount of from about 0 mM to about 50 mM, or of from about 3 mM to about 30 mM; the optional at least one phosphatase inhibitor is present in an amount of from about 0 mM to about 400 mM, or of from about 0 mM to about 360 mM, or of from about 0 mM to about 200 mM; and the optional hydroxycarboxylic acid is present in an amount of from about 0% (w / v) to about 2.5% (w / v), or of from about 0.5% (w / v) to about 2% (w / v); wherein the amounts noted above correspond to the concentrations of components in the aqueous composition prior to admixture with the bodily fluid.
[0186] In one embodiment, the stabilizing agent is an amino acid, such asL-Histidine and salts and hydrates thereof, such as Histidine monochloride monohydrate, L-Histidine monohydrate, L-Histidine dihydrochloride, or mixtures thereof.
[0187] In another embodiment, the composition is an aqueous composition and is admixed with the bodily fluid in a ratio of from about 2:1 (i.e. 1 :0.5) to about 1 :10 (vol:vol), or from about 2:1 to about 1 :7, or from about 1 :1 to about 1 :5 (vol:vol). In another embodiment, the bodily fluid is saliva / urine and the aqueous composition is admixed with the saliva / urine in a ratio of composition:saliva / urine of about 1 :1 to about 1 :6 (vol:vol). In another embodiment, the bodily fluid is blood and the aqueous composition is admixed with the blood in a ratio of composition:blood of about 0.75:5 (i.e. 1 :6.7) to about 1.25:5 (i.e. 1 :4), or about 1 :5 (vol:vol), the latter of which is equivalent to a ratio of sample to chemistry / composition of about 1 :0.2. Ratios of aqueous composition / chemistry to bodily fluid as referenced herein are volume:volume (i.e. vol:vol) unless otherwise indicated.
[0188] The exemplary concentrations of the components and exemplary ratios of combining the compositions disclosed herein with blood-related bodily fluids as noted above can apply to blood and blood derivatives (plasma, serum, buffy coat), as well as bone marrow aspirates, and cerebral spinal fluid. The exemplary concentrations of the components and exemplary ratios of combining the compositions disclosed herein with bodily fluids that may contain mucin can apply to saliva, urine, and sputum, as well as pharyngeal secretions, nasal secretions, nasal / pharyngeal secretions, sinus secretions, mucous, gastric juices, pancreatic juices, feces, semen, products of lactation, products of menstruation, cervical secretions, vaginal fluid, tears, and lymph.
[0189] Methods of assessing preservation of polypeptides and other analytes / components in bodily fluids (or cell-free or cellular fractions thereof) are known to the skilled worker and / or are outlined in further detail in the Materials and Methods section and Examples described below. For example, a bodily fluid stored in BMP exhibits enhanced protein stabilization / preservation as evidenced by functional activity assay(s) and / or content of one or more proteins relative to the bodily fluid stored alone or in the presence of a control composition, such as phosphatebuffered saline (PBS) or ethylenediamine tetraacetic acid (EDTA). In another embodiment, the bodily fluid is a blood sample and storage of said sample in BMP substantially minimizes blood cell lysis (RBC, WBC etc.), minimizes leakage of proteins from the cells into plasma and minimizes degradation of plasma proteins relative to the blood sample stored alone or in the presence of a control composition, such as ethylenediamine tetraacetic acid (EDTA).
[0190] In another embodiment, a bodily fluid (or cell-free or cellular fractions thereof) stored in the compositions disclosed herein (“BMP” compositions) exhibit enhanced nucleic acid stabilization / preservation at ambient temperature relative to the bodily fluid stored alone or in the presence of a control composition, such as phosphate buffered saline (PBS) or ethylenediamine tetraacetic acid (EDTA). In one embodiment, the nucleic acid is DNA. In another embodiment, the nucleic acid is RNA. In still another embodiment, the nucleic acid is cell-free DNA (cfDNA). In another embodiment, the nucleic acid is genomic DNA. In yet another embodiment, the nucleic acid is cellular RNA. Such stabilization can be assessed by methods known to those skilled in the art, such as those described further in the Materials and Methods section, and in the Examples which follow.
[0191] In another embodiment, of the composition, method, kit, or admixture disclosed herein, the composition preserves a plurality of polypeptides and stabilizes nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, for example for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
[0192] As noted above, the present composition does not make use of harsh chemicals or fixatives, such as formaldehyde-releasing agents, such as imidazolinyl urea (IDU) or diazolidinyl urea (DU). The composition also does not contain guanidinium-containing compounds, which are strongly chaotropic. In addition, the aqueous compositions for preserving at least one polypeptide in a bodily fluid (or a cell-free fraction or a cellular fraction thereof), also do not contain shortchain (Ci to Ce) alkanols, which alleviates potential concerns with shipping / transport of such flammable liquids. In another embodiment, the composition, in particular the aqueous composition, does not contain a surfactant. In another embodiment, thecomposition does not contain strong reducing agents, such as tris(2- carboxyethyl)phosphine (TCEP) and dithiothreitol (DTT).
[0193] Materials and Methods
[0194] Materials:
[0195] Blood Collection: Venous whole blood was collected in BDVacutainer® EDTA tubes (Becton, Dickinson and Company (BD), Cat. No. 366643) by a trained Phlebotomist. Capillary whole blood was collected from fingerpricks using BD Microtainer™ Contact Activated Lancet (BD, Cat. No. 366578), followed by collection in Microvette® APT 250 EDTA K2E (Sarstedt, Inc., Cat. No. 20.1331.100).
[0196] Plasma Preparation: Collected whole blood samples were centrifuged at 1900 x g for 15 minutes at 4°C to isolate plasma in the supernatant fraction. The isolated plasma underwent an additional centrifugation step at 12000xg for 10-15 minutes at 4°C to collect platelet-free / depleted plasma for downstream analysis (e.g. ELISA assays).
[0197] Cell-free Supernatants from Saliva Samples: Collected whole saliva samples mixed with 1 x PBS (Gibco, Cat. No. 10010023) or preservatives, such as the present BMP chemistry, were centrifuged at 2500-3000 x g for 10 minutes at 4°C to obtain cell-free supernatants. These cell-free supernatants were used as input material for downstream assays.
[0198] Hemoglobin Assay: Hemoglobin content in the plasma samples obtained from whole blood samples was measured using the Hemoglobin Assay Kit (Colorimetric) (Abeam Ltd., Cat. No. ab234046). 10 pL of plasma mixed with 10 pL of 1 x PBS, or 20 pL of undiluted plasma, was used as an input material and the assay was performed as per manufacturer’s instructions.
[0199] Immunoassays and Activity Assays: ELISA assays for CXCL8 / IL-8(Human IL-8 ELISA Kit, Abeam Ltd., Cat. No. ab214030), EGF (Human EGF ELISA Kit, Abeam Ltd., Cat. No. ab217772), CD62P (Human CD62P ELISA Kit (P-Selectin), Abeam Ltd., Cat. No. ab100631) a-amylase (Human Pancreatic Amylase ELISA Kit, Abeam Ltd., Cat. No. ab137969), and LOX-1 (OLR1) (Human LOX-1 ELISA Kit, Abeam Ltd., Cat. No. ab212161) were carried out according to manufacturer’s instructions. Amylase enzymatic activity assay on precleared cell-free saliva samples was carried out using the colorimetric Amylase Assay Kit (Abeam Ltd., Cat. No. ab102523) according to manufacturer’s instructions.
[0200] SARS-CoV-2 Nucleocapsid Protein ELISA assay (Abeam Ltd., Cat.No. ab315296) was performed as follows: Prepare Nucleocapsid antigen standards (Stock = 2440 pg / mL) in 25 mM Tris pH 8.0 / 150 mM NaCI: 4, 2, 1 , 0.5, 0.25, 0.125, 0.0625, 0 pg / mL. Dilute plasma 1 :60 in 25 mM Tris pH 8.0 / 150 mM NaCI. Coat plates (Greiner Bio-One, Cat. No. 655101 ) with 100 pL of each standard and store overnight at room temperature (RT). Next day, aspirate and add 300 pL of blocking solution (5% bovine serum albumin (BSA) in PBS). Block for 2 hours at RT. Prepare enough blocking solution for blocking incubation and for primary (1 °) and secondary (2°) antibody dilutions. Aspirate blocking solution and add 100 pL of 50 ng / mL 1 ° mAb (Stock = 2 mg / mL, rabbit monoclonal anti-SARS-CoV-2 Nucleocapsid Antibody, clone 11A7 (Exon Bio, Cat. No. CV-11A7NP)). Incubate for 1 hour at RT. Wash plate 6 times with 300 pL of Wash Buffer (Abeam Ltd., Cat. No. ab206977). Aspirate Wash Buffer and add 100 pL of HRP-conjugated Goat anti-Rabbit IgG (H+L) 2° antibody at 1 :10,000 (Invitrogen, Cat. No. 31460). Incubate in the dark for 30 minutes at RT. Wash plate 6 times with 300 pL of Wash Buffer. Add 50 pL of TMB ELISA Substrate Solution (Abeam Ltd., Cat. No. ab171523) and incubate in the dark for 8-10 minutes, but no more than 20 minutes (until optimal blue colour density develops). Add 50 pL of Stop Solution (Abeam Ltd., Cat. No. ab171529) and read immediately at A450 nm.
[0201] Western Blotting: Plasma samples were mixed with 4x Laemmli buffer (Bio-Rad Laboratories, Inc., Cat. No.161-0747) in the sample: buffer ratio of 3:1 and heated at 95°C for 5 minutes, followed by snap cooling on ice. Samples were loaded on 8-16% Mini-PROTEAN TGX Stain-Free Precast gels (Bio-Rad Laboratories, Inc., Cat. No. 4568104). Gels were run for 35-40 minutes at 200 V, followed by protein transfer using Trans-Blot® Turbo™ Transfer System (Bio-Rad Laboratories, Inc., Cat. No. 1704150) and Trans-Blot Turbo Mini 0.2 pm Nitrocellulose Transfer Packs (Bio-Rad Laboratories, Inc., Cat. No.1704158) according to manufacturer’s instructions. Western blot was performed for Complement C3 protein using 1 ° rabbit recombinant monoclonal Anti-C3 antibody (Abeam Ltd., Cat. No. 200999) in 1 :2000 dilution and 2° goat anti-rabbit antibody coupled with Alexa Fluor 488 dye (Thermo Fisher Scientific Inc., Cat. No. A32731) using 1 :5000 dilution. Blot images were captured using Syngene’s G: Box F3 Gel doc by using automatic exposure settings.
[0202] Olink® Proteomics Analysis: Proteins were measured using theOlink® Target 48 Cytokine Panel and Olink® Flex Panel (Olink Proteomics AB, Uppsala, Sweden, Cat. No. 93200) according to the manufacturer's instructions. The Proximity Extension Assay (PEA) technology used for the Olink protocol has been well described (Assarsson et al, 2014), and enables multiple protein targets to be analyzed simultaneously, using 1 pL of each sample (e.g. plasma, cell-free saliva supernatants). In brief, pairs of oligonucleotide-labeled antibody probes bind to their targeted protein, and if the two probes are brought in close proximity, the oligonucleotides will hybridize in a pair-wise manner. The addition of a DNA polymerase leads to a proximitydependent DNA polymerization event, generating a unique PCR target sequence. The resulting DNA sequence is subsequently detected and quantified using a microfluidic real-time PCR instrument (Biomark HD, Fluidigm). Data is then quality controlled and normalized using an internal extension control and calibrators, to adjust for intra- and inter-run variation. The final assay read-out is presented in pg / mL using a 4-PI fit for absolute quantification. All assay validation data (detection limits, intra- and interassay precision data, etc.) are available on manufacturer's website (www.olink.com). Change in the protein concentration over time is represented as fold change (X) calculated as (TX / T0) to assess the preservation performance of tested formulations. TX stands for different time points (Day 3, Day 7) samples. TO stands for baseline samples.
[0203] LC-MS Analysis: Following steps were involved in carrying out untargeted proteomics analysis on plasma samples.
[0204] A) Protein quantification: The protein concentration and quantity were determined by the Bradford assay using a protein assay kit (#23200, Thermo Fisher Scientific) following the manufacturer’s protocol. The assay absorbance was measured with a spectrophotometer (Novaspec III, Biochrom) and semi-microvolume disposable polystyrene cuvettes (#2239955, Bio-Rad) at 595 nm. The volume of 100 pg protein was used for further processing.
[0205] B) Sample Lysis: 200 uL of lysis buffer (8 M urea, 25 mM HEPES at pH = 8, 1 mM DTT, 0.2% DDM, 5% glycerol, 1 :200 v:v protease inhibitor) was added to the aliquoted sample. Each buffer-sample mixture was homogenized by an electric homogenizer at 5 krpm for 1 minute. The samples were then incubated at 25°C for 15minutes, followed by a 3-minute centrifugation at 10,000 g. The supernatant was collected and measured for concentration by Bradford assay. The volume of 50 pg of protein was used for further processing.
[0206] C) Protein reduction, alkylation and digestion: Aliquots of 50 pg of protein was further processed with a modified filter-aided sample preparation (FASP) protocol for proteomic analysis. The samples containing 50 pg of protein were diluted to a total volume of 200 pL with a denaturation buffer (8 M urea, 25 mM HEPES, pH = 8.0). Samples were vortexed briefly and transferred to a 10 kDa MWCO filter (MRCPRT010, Millipore). Sample volume was reduced to about 20 pL by centrifugation for 20 minutes at 14,000 g, and proteins were reduced by adding 4 mM tris(2-carboxyethyl) phosphine (TCEP) in 100 pL denaturation buffer. Samples were then incubated at 25°C for 30 minutes, followed by a 15-minute centrifugation at 14,000 g. Proteins were then alkylated with 20 mM of iodoacetamide (IAA) in 100 pL denaturation buffer. The samples were incubated at 25°C for 40 minutes, followed by a 15-minute centrifugation at 14,000 g. Next, 100 pL of digestion buffer (0.6% v / v glycerol, 25 mM HEPES, pH = 8.0) was added into the filter followed by a 15-minute centrifugation at 14,000 g. After buffer exchange, the filter was transferred to a clean collection tube. Proteolytic digestion was performed by addition of MS-grade trypsin / Lys-C mix (#V5072, Promega), 1 :150 enzyme to protein ratio, and incubated in the dark under shaking at 600 rpm at 37°C for 12 hours. Peptides were eluted as filtrate by centrifugation at 14,000 g for 15 minutes, and 2% (v / v) of formic acid was added in the collected filtrates to stop digestion.
[0207] D) Desalting: The digested samples were desalted on disposablePierce C-18 tips (#87784, Thermo Fisher Scientific) with addition of C-18 resins from Pierce C-18 Spin Columns (#89870, Thermo Fisher Scientific). The desalted samples were dried by vacuum centrifugation (Savant SPD111V SpeedVac Concentrator, Thermo Scientific) and reconstituted with 25 pL of MS grade water with 0.1 % formic acid for MS analysis.
[0208] E) Nano LC-MS / MS : Nano LC-MS / MS analyses were performed on an Ultimate3000 nanoRLSC (Thermo Scientific) coupled to an Orbitrap Fusion™ Lumos™ (Thermo Scientific). 1-2 pL of protein digests were injected and separated on a column (15 cm LT x 75 pm i.d. x 365 pm o.d. fused silica capillary, PolymicroTechnologies) packed in-house with Luna C18 particles (Luna C18(2), 3 pm, 100 A, Phenomenex, Torrance, California, USA). The mobile phase consisted of a mixture of water / ACN / 0.1 % (v / v) FA, working at a flow rate of 0.30 pL / min (0-7 min, 2-2% ACN; 7-77 min, 2-38% ACN; 77-86 min, 38-98% ACN; 86-96 min, 98-98% ACN; 96-99 min, 98-2% ACN; 99-105 min, 2-2% ACN). The mass spectrometer was operated in ESI positive mode under the following parameters: ion source temperature 250°C, ion spray voltage 2.1 kV, top speed mode, and full-scan MS spectra acquired with a resolution of 60,000 over 350-2,000 m / z. Precursor ions were selectively filtered through monoisotopic precursor selection, considering a charge state range of +2 to +7, and dynamic exclusion parameters (30 s with a ± 10 ppm window). The automatic gain control settings were configured at 5*1 Ox5for the full scan and 1*1 Ox4for MS / MS scans. Fragmentation was achieved using collision induced dissociation (CID) in the linear ion trap. Isolation of precursors utilized a 2 m / z isolation window, followed by fragmentation with a normalized collision energy set at 35%.
[0209] F) MS Spectra Processing: The resulting mass spectrometry data was processed using MaxQuant software (version 2.5.1 ), implementing a stringent 1 % false discovery rate threshold for protein identification. Subsequent computational analysis was performed in R to identify proteins of biological significance. The experimental workflow incorporated multiple validation parameters for protein identification and quantification. Protein validation required detection of one or more unique peptides in a minimum of two-thirds of all samples, while sample-specific proteins were defined by the presence of at least one unique peptide exclusive to a single experimental condition. The analytical pipeline further implemented a global protein filtering threshold requiring detection in at least 50% of samples, with proteins falling below this threshold being excluded from subsequent analyses.
[0210] Thermal Shift Assay:
[0211] The thermal shift assay (TSA) measures the melting temperature of a protein (Tm) or the thermal stability of a protein, which is the temperature at which there is 50% denaturation. Protein denaturation is monitored via an increase in fluorescence of SYPRO Orange dye as it binds to hydrophobic residues that become exposed as the target protein unfolds. Specifically, the sample is gradually heated, and the fluorescence signal is continuously monitored. As the protein unfolds, thefluorescent dye binds to newly exposed hydrophobic regions, causing a rise in fluorescence intensity. This increase in fluorescence over temperature creates a melting curve. The Tm is indicated by the inflection point of the melting curve. By comparing the Tm of the protein in the presence or absence of a ligand or other factor, one can determine if the factor stabilizes or destabilizes the protein. A higher Tm and a low delta Tm indicate good protein stability.
[0212] TSA Protocol:
[0213] 1. Weighed 0.026 g of each standard protein, Lysozyme (SigmaAldrich, Cat. No. L6876-1G) and Beta-Galactosidase (Sigma Aldrich, Cat. No. G5160- 25KU). Diluted each protein in 10 mL of nuclease-free (NF) water (2.6 mg / mL). Added 2 mL of protein (2.6 mg / mL) into 3 mL of NF water to make protein stocks (1 mg / mL).
[0214] 2. Sheep’s blood was centrifuged at 1900 g for 10 minutes at 4°C.The supernatant was isolated and subjected to a second centrifugation at 10,000 g for 10 minutes at 4°C to isolate the plasma.
[0215] 3. Lysozyme or Beta-Galactosidase standard proteins (1 mg / mL) were mixed with different compounds (e.g. buffering agents) at a 5 (protein): 1 (chemistry) ratio then stored at 37°C for 3 days. For sheep’s blood, isolated plasma samples were mixed with different compositions and stored at 37°C for 3 days.
[0216] 4. Diluted 50xSYPRO orange (Sigma Aldrich, Cat. No. S5692-50pL)(in DMSO) in NF water to 6x. Next, 25 pL of sample was mixed with 5 pL of 6x SYPRO orange and loaded into a 96 well plate (Bio-Rad, Cat. No. HSP9655). Melt Curves from 25°C to 95°C with 0.5°C increments were recorded using a Molecular Devices Spectramax M2 Microplate Reader (Catalog No. 89429-532).
[0217] 5. The final Tm values were determined by subtracting the timepoint value from the NTC (negative control) at the same time point to eliminate interference from changes in the NTC. Then, the delta (change or A) Tm between T3 and TO was calculated. Additionally, the changes in the background NTC signal were also calculated by determining the delta Tm between T3 and TO.
[0218] 6. Performance Criteria for Thermal Shift Assay: The delta (A) Tm values between T3 and TO should exhibit minimal changes (values close to zero) forlysozyme, beta-galactosidase, and plasma from sheep’s blood. Additionally, there should be a low change in the background signal over time.
[0219] Cell-free nucleic acid extraction:
[0220] Saliva samples were centrifuged at 3000 x g for 10 minutes at 4°C before the isolated supernatants were applied to a QIAamp® Circulating Nucleic Acid Kit (Qiagen, Cat. No. 55114), according to manufacturer’s protocol, to extract cell-free nucleic acid. Profiles of the extracted cell-free nucleic acid were assessed on an Agilent 4200 TapeStation System using High Sensitivity (HS) D5000 ScreenTape (Agilent Technologies, Cat. No. 5067-5592) and Reagents (Agilent Technologies, Cat. No. 5067-5593), according to manufacturer’s instructions.
[0221] Cellular DNA extraction and quantification:
[0222] At each time point, oral swab samples collected with the plastic form factor of OraCollect®»Dx devices (DNA Genotek, Inc., Cat. No. QCD-100A), prefilled with 1 mL of the present composition or 1xPBS, were spun at 3000 x g for 15 minutes at 4°C. Pellets were kept frozen at -80°C until extraction. Pellets were thawed at room temperature and resuspended in 200 pL of 1X PBS followed by total DNA extraction. T otal cellular DNA from oral swab sample pellets was extracted using a QIAamp® DNA Mini Kit (Qiagen, Cat. No. 51306), according to manufacturer’s instructions, and eluted in 50 pL of elution buffer or nuclease-free water (NFW). Total genomic DNA profile for each extracted sample was assessed using an Agilent 4200 TapeStation System and Genomic DNA ScreenTape (Agilent Technologies, Cat. No. 5067-5365), according to the manufacturer’s instructions. Targeted amplification of human genomic DNA and bacterial DNA was performed using p-globin qPCR and 16S qPCR assay, respectively, as described below.
[0223] Human p-globin qPCR assay:
[0224] Nucleic acids extracted from supernatant fractions of saliva samples were subjected to qPCR assay for the quantification of human cell-free DNA (cfDNA) content using iTaq™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, Inc., Cat. No. 1725121), a 2x concentrated, ready-to-use reaction master mix. The primers and the PCR conditions of the human p-globin qPCR assay are described in the literature (Jung et al., 2003) as follows: Forward primer: 5' ACACAACTGTGTTCACTAGC 3', reverse primer: 5' CAACTTCATCCACGTTCACC3'. The amplification mixture (20 pL) contained: 10 pL of iTaq™ Universal SYBR® Green Supermix, 1 pL each of 10 pM forward and reverse primer, 6 pL of nuclease- free water (I nvitrogen, Cat. No. 10977023) and 2 pL of extracted cell-free nucleic acid. Human gDNA standards with serial dilution (1 , 1 : 10, 1 : 100, 1 :1000) and a nontemplate control (2 pL of RNase / DNase-free water) were used in each qPCR run. qPCR reactions were performed on a C1000 Touch™ Thermal Cycler (Bio-Rad Laboratories, Inc., Cat. No. 1851 196) with the following conditions: 95°C: 5 minutes, [(95°C: 20 seconds, 56°C: 30 seconds) *45 cycles]. Melt curves were obtained by heating samples from 65°C to 95°C by increments of 0.5°C and each plate was read for 5 seconds at every increment. Human cell-free DNA (cfDNA) quantification analysis was performed using cycle threshold analysis “Ct”. “Ctco” stands for qPCR cycle threshold at day 0 or day 7. Human cellular DNA quantification analysis was performed using “ACt” which stands for [Ct(T7)-Ctcro)]. “Ct(T7)” and “Ctcro)” stands for qPCR cycle threshold at day 7 and day 0, respectively.
[0225] 16S qPCR assay:
[0226] Extracted nucleic acids from the pelleted fraction of oral swab samples were subjected to qPCR assay for the quantification of bacterial DNA content using iTaq™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, Inc., Cat. No. 1725121 ). The primers and qPCR conditions of the Bacterial 16s rRNA are as follows: BacrRNA173-Forward primer 5’ ATTACCGCGGCTGCTGG 3’, BacrRNA173-Reverse primer 5’ CCTACGGGAGGCAGCAG 3’ (Emery et al. , 2017). The amplification mixture (20 pL) contained: 10 pL of iTaq™ Universal SYBR® Green Supermix, 1 pL each of 10 pM forward and reverse primer, 6 pL of nuclease-free water (NFW from Invitrogen, Cat. No. 10977023) and 2 pL of extracted nucleic acid. E. coli gDNA standards with serial dilutions (1 , 1 :10, 1 :100 and 1 :1000) and a non-template control (2 pL of RNase / DNase-free water) were used in each qPCR run. qPCR reactions were performed on a C1000 Touch™ Thermal Cycler (Bio-Rad Laboratories, Inc., Cat. No. 1851196) with the following conditions: 95°C: 5 minutes, [(95°C: 20 seconds, 56°C: 30 seconds) *45 cycles]. Melt curves were obtained by heating the samples from 65°C to 95°C by increments of 0.5°C and each plate was read for 5 seconds at every increment. Bacterial cellular DNA quantification analysis was performed using “ACt” which stands for [Ct(T7)-Ctcro)]. “Ct(T7)” and “Ctcro)” stands for qPCR cycle threshold at day 7 and day 0, respectively.
[0227] EnzChek™ Phosphatase Assay:
[0228] The EnzChek™ Phosphatase Assay Kit (Thermo Fisher Scientific,Cat. No. E12020) can be used to continuously detect phosphatase activity at neutral, alkaline, or acidic pH. This Kit contains 6,8-difluoro-4-methylumbelliferyl phosphate (DiFMUP) substrate (D6567 or D22065). Because the reaction product of DiFMUP does not require addition of base to the reaction medium prior to measuring the fluorescence, DiFMUP can be used for the continuous assay of phosphatases with neutral, alkaline, or moderately acidic pH optima. 50 pL of neat plasma sample was used per reaction and the assay was carried out as per manufacturer's instructions. A continuous excitation / emission spectrum with an interval of 2 minutes (to, t2, t4....t60 mins) was measured for 1 hour using excitation and emission wavelength at 360 nm and 460 nm, respectively. Spectral values at different time points were normalized by subtracting baseline to values and the data was plotted for analysis.
[0229] RNA Extraction Method using TRI Reagent:
[0230] 1 . Thaw samples prepared in TRI Reagent LS.
[0231] 2. Allow samples to stand at room temperature (RT) for 5 min.
[0232] 3. Add 200 pL of chloroform to each sample and vortex to mix.
[0233] 4. Incubate at RT for 15 min.
[0234] 5. Centrifuge at 12,000 x g for 15 min at 4°C.
[0235] 6. Transfer the aqueous phase to a new tube.
[0236] 7. Add 1 pL of 20 pg / pL of glycogen to each sample.
[0237] 8. Add 500 pL of isopropanol to each sample and mix. Allow the sample to stand for 10 min at RT. Centrifuge at 12,000 x g for 10 min at 4°C. The RNA precipitate will form a pellet on the side and bottom of each tube following centrifugation.
[0238] 9. Remove supernatant and wash the RNA pellet by adding 1 mL(minimum) of 75% ethanol and flick tube to mix. Centrifuge at 12,000 x g for 5 min at 4°C.
[0239] 10. Remove the ethanol and air dry the pellet for 5-10 min.
[0240] 11. Resuspend the pellet in 20 pL of nuclease-free water (NFW).Keep on ice.
[0241] Human GAPDH RT-qPCR:
[0242] Performed reverse transcription using M-MLV ReverseTranscriptase (Thermo Fisher Scientific, Cat. No. 28025-013) and random hexamers, according to the manufacturer’s protocol, using 10 pL of RNA. cDNA quantification was performed using a human GAPDH TaqMan™ Assay (Thermo Fisher Scientific, Cat. No. 4331182; Assay ID Hs00266705_g1) with TaqMan™ Universal Master Mix II with uracil N-glycosylate (UNG) (Thermo Fisher Scientific, Cat. No. 44-400-38) using 2 pL of cDNA per reaction, according to the manufacturer’s instructions.
[0243] EXAMPLES
[0244] Note regarding “BMP” compositions: The following Examples describe the use of various “BMP” compositions (BMP, and BMP-1 through BMP-11 , along with other variants thereof). Where a particular BMP composition has been previously introduced in the Examples and is referenced in a subsequent Example, it will be understood that the pre-collection formulation of such BMP composition (i.e. the concentration of components in the composition prior to mixing with bodily fluid (or cell-free or cellular fraction thereof)) is the same as that which was previously presented, unless otherwise indicated. The post-collection formulation (i.e. the concentration of components in the composition after mixing with bodily fluid (or cell- free or cellular fraction thereof)) can be easily determined by taking into account the mixing ratio between the BMP composition and the bodily fluid (or cell-free or cellular fraction thereof) referenced in the subsequent Example.
[0245] Example 1 : Preservation of salivary proteins by BMP.
[0246] In this study, saliva samples from individual healthy donors (n=10) were collected using an alternate spitting method. The collected saliva samples were left either treated with 1 x PBS (unpreserved) or treated with BMP chemistry (preserved) in the saliva: chemistry ratio of 1 :1. Pre-collection and post-collection concentrations of BMP chemical components are provided in Table 1 (i and ii) below. An aliquot of each of the 10 unpreserved and preserved samples was processed for cell-free saliva supernatant preparation (see details in Materials and Methods section)on the day of collection. These baseline or TO supernatants were stored at -80°C until further processing and downstream analysis. The remaining aliquots of PBS and BMP- treated saliva samples were stored at room temperature for 7 days. On Day 7, like TO samples, aliquots of unpreserved and preserved saliva samples were processed for cell-free supernatant preparation. These T7 supernatants were also stored at -80°C until further processing and downstream analysis. A single target enzymatic activity assay and ELISA assay for a-amylase was conducted (see details in Materials and Methods section) to evaluate BMP-based preservation of enzyme functionality and content, respectively. An equal volume aliquot of both TO and T7 supernatant samples were shipped on dry ice to an external Olink® assay service provider for analysis on the Olink® Target 48 Cytokine Panel (see details in Materials and Methods section) to evaluate the performance of BMP chemistry in the preservation of salivary proteins.
[0247] As shown in Figure 1 , cell-free supernatants prepared from T7 PBS samples (unpreserved) showed loss of both a-amylase enzymatic activity (Figure 1 A), as well as content (Figure 1 B), unlike BMP-treated samples which showed effective preservation of both the activity and amount of this enzyme under similar storage conditions. Where no bars are shown in the charts of Fig. 1A / 1 B for PBS, the foldchange is zero which means complete loss of protein in these samples after 7 days of storage at RT. Differences in the fold change of amylase protein over time reflects sample matrix heterogeneity in different donors and thus overall biological variability in the saliva samples.
[0248] Olink® Target 48 Cytokine Panel data on a subset of proteins is presented in Figure 1C. Without being bound by theory, it is believed that, in addition to quantifying proteins at different time points, the Olink® analysis also provides an indication as to whether a given protein is in a conformational state such that it can be recognized by two distinct antibodies, to enable a functional PCR-based proximity extension assay (PEA). Saliva samples from different donors were tested using the Olink® Cytokine Panel and the median fold change (T7 / T0) is shown. Figure 1 C provides data for 17 markers which were detectable across multiple saliva samples and showed significant changes in the unpreserved PBS-treated samples over time. The Olink® T arget 48 Cytokine Panel data on this subset of proteins showed numerous changes in the protein content in T7 PBS samples relative to TO with even someprotein targets showing no detection / complete loss (the fold-change is zero) after being stored for 7 days at RT, unlike BMP-treated samples which showed minimal changes in protein content under similar room temperature storage conditions. Taken together this data clearly indicates that BMP chemistry effectively preserves both functionality and content of saliva proteins when added to the saliva samples at the time of collection and then stored at room temperature for 7 days.Table 1 (i): Pre-collection formulation of BMP chemistry.Table 1 (ii): Post-collection formulation of BMP chemistry after mixing with saliva (Saliva: BMP ratio Is 1:1).
[0249] Example 2: Impact of different chemical components in BMP on the preservation of protein functionality in saliva.
[0250] In this study, saliva was collected from 2 different healthy donors named D1 and D2. The collected saliva samples were left either treated with 1 x PBS (unpreserved) or treated with BMP and additional BMP chemistry iterations in the saliva: chemistry ratio of 1 :1 . Pre-collection and post-collection concentrations of BMP chemical components are provided in Table 2 (i, ii). Other iterations of BMP chemistry were prepared as described in Table 2 (iii). An aliquot of each of the 1X PBS, BMP and BMP-iterations treated saliva samples were processed for cell-free saliva supernatant preparation (see details in Materials and Methods section) on the day ofcollection (TO). These baseline or TO supernatants were stored at -80°C until further processing and downstream analysis. The remaining aliquots of unpreserved (PBS) saliva samples and saliva samples treated with BMP chemistry and its iterations were stored at room temperature for 7 days. On Day 7, like TO samples, aliquots of saliva treated with PBS and BMP chemistry and its iterations were processed for cell-free supernatant preparation. These T7 supernatants were also stored at -80°C until further processing and downstream analysis. A single target enzymatic activity assay was conducted (see details in Materials and Methods section) to evaluate the contribution(s) of different chemical components towards preservation of enzyme functionality.
[0251] As shown in Figure 2, cell-free supernatants prepared from T7 PBS(unpreserved) samples showed complete loss of a-amylase enzymatic activity (where no bars are shown in the chart for PBS, the fold-change is zero), unlike BMP-treated samples which showed effective preservation of a-amylase enzymatic activity under similar room temperature storage conditions. Furthermore, the data suggests that different chemical components in BMP contributed towards effective preservation of protein functionality in the saliva samples at the time of collection and after 7 days storage at room temperature.Table 2 (i): Pre-collection formulation of BMP chemistry.Table 2 (ii): Post-collection formulation of BMP chemistry after mixing with saliva (Saliva: BMP ratio Is 1:1).Table 2 (Hi): BMP chemistry iterations tested.
[0252] Example 3: Effect of pH on BMP-based preservation of protein functionality in saliva samples.
[0253] In this study, saliva was collected from 2 different healthy donors named D1 and D2. The collected saliva samples were left either treated with 1 x PBS (unpreserved) or treated with BMP at a range of different pH values [Table 3 (i)] with the saliva: chemistry ratio of 1 :1. Adjustments to pH were made using acetic acid (for 4.2) or NaOH (6.2, 7.2, 8.2). Pre-collection and post-collection concentrations of BMP chemical components are provided in Table 3 (ii, iii). An aliquot of each of the unpreserved and chemistry treated samples was processed for cell-free saliva supernatant preparation (see details in Materials and Methods section) on the day of collection (TO). These baseline or TO supernatants were stored at -80°C until further processing and downstream analysis. The remaining aliquots of PBS and BMP chemistry treated saliva samples were stored at room temperature for 7 days. On Day 7, like TO samples, aliquots of unpreserved and BMP chemistry treated saliva samples were processed for cell-free supernatant preparation. These T7 supernatants were also stored at -80°C until further processing and downstream analysis. Enzymatic activity assay for a-amylase was conducted (see details in Materials and Methods section) using TO and T7 supernatants to evaluate the effect of BMP buffered to different pH values on preservation of enzyme functionality.
[0254] As shown in Figure 3, cell-free supernatants prepared from PBS samples (T7 / T0) showed a dramatic loss of a-amylase enzymatic activity, unlike BMP- treated samples (T7 / T0) which showed effective preservation under similar roomtemperature storage conditions. Data suggests that pH range of 4.2-8.2 in BMP chemistry showed improved preservation of a-amylase enzymatic activity relative to PBS after 7 days storage at room temperature. Furthermore, the data suggests pH dependent preservation of a-amylase enzymatic activity in the saliva samples, with optimal preservation of enzymatic activity at pH 5.2-7.2 (± 0.2).Table 3 (i): Final pH of BMP chemistry.Table 3 (ii): Pre-collection formulation of BMP chemistry.Table 3 (Hi): Post-collection formulation of BMP chemistry after mixing with saliva (Saliva: BMP ratio is 1:1).
[0255] Example 4: Impact of select chemical components on red blood cell preservation in blood samples.
[0256] In this study, -250 pL of capillary blood from individual healthy donors (n=7) was collected in EDTA Microvette® tubes (Sarstedt Inc., Cat. No. 20.1331.100) from fingerpricks (see Materials and Methods section for details) and mixed to generate one pooled blood sample. The pooled blood sample was equallydivided into different aliquots and either left untreated (EDTA) or treated with different chemical components (blood: chemistry ratio is 1 :0.2) as specified in Table 4. After mixing, samples were equally divided into two aliquots for TO and T7 timepoints. TO samples were processed immediately for plasma preparation as described in the Materials and Methods section. The baseline or TO plasma samples were stored at - 80°C until further processing and downstream analysis. The second aliquot of the divided samples was left at room temperature (RT) for 7 days; also referred as T7 samples. On Day 7, aliquots of EDTA and chemistry-treated blood samples were processed for plasma preparation. These T7 plasma samples were also stored at - 80°C until further processing and downstream analysis. Both TO and T7 plasma samples were analyzed for hemoglobin content using the Hemoglobin Assay Kit (Abeam Ltd., Cat. No. ab234046) according to the manufacturer’s instructions.Table 4: Select chemical components tested.To achieve PI (6X) protease inhibitor cocktail in 1X PBS: Dissolve 1 tablet in -4.25 mL of 1X PBS.
[0257] As shown in Figure 4, plasma collected from T7 EDTA and T7 chemistry 4-treated whole blood samples showed 4-5 fold(X) increase in hemoglobin content, suggesting significant red blood cell lysis or hemolysis. T7 plasma samples collected from chemistry 2- and 3-treated samples showed ~2-fold increase in hemoglobin content. On the other hand, plasma collected from chemistry 1-, 5- and 6- treated whole blood samples showed no change in hemoglobin content when stored for 7 days at RT. This data suggests that BMP effectively minimizes red blood cell lysis or hemolysis when mixed with whole blood for storage at RT for 7 days. A small amount of EDTA is present in the blood collection tubes used in the present Example and thus is inherently present in the samples stored in chemistries 1-6 shown in Table 4 above. However, the EDTA is estimated to be present in an amount that is about 14 times less than the EGTA present in chemistries 1 -6, as such, the impact of the EDTA is believed to be negligible. Likewise, the small amount of EDTA present in certain commercial blood collection tubes / devices used in subsequent Examples (eg. Microvette® tubes and BD Vacutainer® EDTA tubes) is also deemed to be of negligible impact in view of higher amounts of other chelators present in the BMP compositions.
[0258] Example 5: BMP minimizes blood cell hemolysis, minimizes cellular protein leakage, and minimizes protein degradation in plasma samples prepared from collected whole blood.
[0259] In this study, venous blood from individual healthy donors (n=10) was collected in BD Vacutainer® EDTA tubes by a trained Phlebotomist. The collected whole blood samples were aliquoted and left either in EDTA (unpreserved) or treated with BMP chemistry (blood: chemistry ratio of 1 :0.2). Pre-collection and post-collection concentrations of chemical components in BMP are provided in Table 5 (i and ii). On the day of collection (TO), an aliquot of each of the 10 unpreserved whole blood samples was processed for plasma preparation (see details in Materials and Methods section) and then stored at -80°C until further processing and downstream analysis. Aliquots of unpreserved and preserved blood samples were stored at room temperature for 7 days.
[0260] On Day 7, like TO samples, aliquots of EDTA and BMP chemistry- treated blood samples were processed for plasma preparation. These samples were referred to as T7. Both TO and T7 plasma samples were analyzed for hemoglobinconcentration (see details in Materials and Methods section). Also, a single target ELISA assay for IL-8 / CXCL8 was conducted (see details in Materials and Methods section) on a subset of prepared TO and T7 plasma samples to evaluate the performance of BMP chemistry for the maintenance of protein profiles. Complement 3 (C3) protein western blot was also carried out on a subset of samples to assess the BMP chemistry for the maintenance of protein content (see details in Materials and Methods section).
[0261] As shown in Figure 5A, unlike TO samples, hemoglobin assay on the plasma prepared from T7 EDTA samples showed higher fold change (X) in the hemoglobin content (median value of 3.3), indicating red blood cell (RBC) lysis or hemolysis. BMP chemistry-treated samples showed minimal signs of hemolysis, as indicated by median value of 1.3 for fold change (X) after 7 days storage at room temperature. Variability between BMP-treated samples and EDTA (control)-treated samples is believed to be due to donor-dependent effects / biological variability in the blood samples. Moreover, plasma prepared from EDTA samples showed a drastic increase in IL-8 protein content [(X) median value of 199.1], indicating cellular lysis and leakage of protein after 7 days storage at room temperature, unlike BMP chemistry-treated samples which showed minimal change in IL-8 protein amount over time [fold change (X) median value of 1 .4] (Figure 5B). C3 protein western blot analysis also demonstrated that EDTA samples showed increased presence of truncated protein fragment with higher fold change (median value of 15). In contrast, BMP chemistry-treated samples showed minimal change in C3 fragment formation (fold change median value of 3.6), demonstrating effective maintenance of C3 protein stability in the plasma collected from whole blood stored at room temperature (RT) for 7 days (Figure 5C and 5D). Hence, this data clearly indicates that BMP i) minimizes blood cell lysis, 2) minimizes leakage of cellular proteins into extracellular space, and 3) effectively preserves plasma protein content when added to whole blood samples at the time of collection and stored up to 7 days at room temperature.Table 5 (i): Pre-collection formulation of BMP chemistry.Table 5 (ii): Post-collection formulation of BMP chemistry after mixing with blood (Blood: BMP ratio is 1:0.2).
[0262] Example 6: BMP minimizes protein degradation in plasma samples prepared from collected and stored whole blood.
[0263] In this study, -250 pL of capillary blood from individual healthy donors (n=5) was collected in EDTA Microvette® tubes, namely Microvette® APT 250 EDTA K2E (Sarstedt, Inc., Cat. No. 20.1331.100), from fingerpricks (see Materials and Methods section for details). Each of the collected whole blood samples was divided into 2X 100 pL aliquots with one left in EDTA (unpreserved) and another treated with 20 pL of BMP (Blood: BMP ratio of 1 :0.2). Pre-collection and post-collection BMP chemical components are provided in Table 6 (i and ii). Next, both EDTA (100 pL) and BMP (120 pL) treated whole blood samples were spiked with 1.33 pL and 1.6 pL of 1500 pg / mL NP antigen (see Materials and Methods), respectively, to obtain a final concentration of 20 pg / mL. After thorough mixing, NP-spiked samples were divided into 2 equal aliquots. One part was labeled as TO and processed immediately for plasma preparation as described in the Materials and Methods section. The baseline or TO plasma samples were stored at -80°C until further processing and downstream analysis. Another aliquot of the divided spiked samples was left at elevated temperature of 37°C for 3 days; also referred as T3 samples. On Day 3, aliquots of EDTA and BMP treated blood samples were processed for plasma preparation. These T3 plasma samples were also stored at -80°C until further processing and downstream analysis. Both TO and T3 plasma samples were analyzed for NP-spiked protein content preservation using ELISA assay (see details in Materials and Methods section).
[0264] As shown in Figure 6, plasma prepared from NP-spiked EDTA samples showed a drastic loss in NP protein content (median fold change value of zero), indicating complete degradation after 3 days storage at 37°C, whereas plasma prepared from NP-spiked BMP chemistry-treated whole blood samples showed minimal change in NP-spiked protein content over time (fold change (X) median value of 0.91) at elevated temperature (Figure 6). This data clearly indicates that BMP effectively minimizes protein degradation in the plasma prepared from whole blood mixed with chemistry and stored at 37°C for 3 days.
[0265] Table 6 (i): Pre-collection formulation of BMP chemistry.Table 6 (ii): Post-collection formulation of BMP chemistry after mixing with blood (Blood: BMP ratio is 1:0.2).
[0266] Example 7: Preservation of protein abundance / profile in plasma prepared from whole blood mixed with BMP as shown using ELISA and Olink® Proteomics platform.
[0267] In this study, venous blood from individual healthy donors (n=10) was collected in BD Vacutainer® EDTA tubes by a trained Phlebotomist. The collected whole blood samples were left either in EDTA (unpreserved) or treated with BMPchemistry with a blood: BMP ratio of 1 :0.2. Pre-collection and post-collection BMP chemical components are provided in Table 7 (i and ii).Table 7 (i): Pre-collection formulation of BMP chemistry.Table 7 (ii): Post-collection formulation of BMP chemistry after mixing with blood (Blood: BMP ratio is 1:0.2).
[0268] An aliquot of each of the 10 unpreserved and BMP-treated samples was processed for plasma preparation (see details in Materials and Methods section) on the day of collection (TO). These baseline or TO plasma samples were stored at - 80°C until further processing and downstream analysis. The remaining aliquots of unpreserved EDTA and BMP-treated whole blood samples were stored at room temperature for 7 days. On Day 7, like TO samples, aliquots of unpreserved and BMP- treated blood samples were processed for plasma preparation. These T7 plasma samples were also stored at -80°C until further processing and downstream analysis. An equal volume aliquot of both TO and T7 plasma samples were shipped on dry ice to an external Olink® assay service provider for analysis on the Custom Flex (21 plex) Panel (see details in Materials and Methods section) to evaluate the performance of BMP on the maintenance of the profile of multiple protein targets. A single target ELISA assay for IL-8 (CXCL8) was also conducted (see details in Materials and Methods section).
[0269] As shown in Figure 7A, plasma prepared from T7 EDTA samples showed a drastic increase in IL-8 / CXCL8 protein content, which indicated cellular lysis and leakage of proteins into plasma from the blood cells after 7 days storage at room temperature. On the other hand, plasma prepared from BMP-treated blood samples showed no change in IL-8 / CXCL8 protein content over time under similar storage conditions (Figure 7A). Furthermore, the Olink® Custom Flex Panel data on a subset of proteins showed significant changes in the protein content in T7 EDTA plasma samples, unlike BMP treated whole blood plasma samples which showed minimal changes in the protein content under similar storage conditions for 7 days (Figure 7B). Figure 7B provides data for 7 markers which were detectable across multiple plasma samples and also showed significant changes in unpreserved EDTA samples over time. In EDTA, cells in blood were stressed and proteins leaked out of the cells, as detected by increased median fold change in protein concentration over time (T7 / T0). In contrast, in BMP, the changes in the protein concentration over time were minimal indicating cellular stability, integrity and effective maintenance of plasma space homeostasis. Proteins like ADM, CSF3 showed decreased fold change while CCL4, CXCL11 , CXCL8, GZMB, IL-18 showed increased fold change in EDTA plasma samples, unlike BMP treated samples which showed minimal changes under storage for 7 days at RT. Hence, this data clearly indicates that BMP minimized both protein degradation and minimized protein leakage from the cells into the plasma when added to the whole blood samples at the time of collection and stored for at least 7 days at room temperature and thus maintains overall plasma homeostasis.
[0270] Example 8: Protein preservation in plasma collected from whole blood mixed with BMP containing BSA or a BSA alternative.
[0271] In this study, venous blood from individual healthy donors (n=4) was collected in BD Vacutainer® EDTA tubes by a trained Phlebotomist. The collected whole blood samples were left either in EDTA (unpreserved) or treated with different chemistries; BMP and BMP-1 (blood: chemistry ratio of 1 :0.2). Pre-collection and postcollection, the chemical components of each chemistry are provided in Table 8 (i, ii, iii, iv). An aliquot of each of the 4 unpreserved whole blood samples was stored at 4 °C for one day; also referred as T1 unpreserved samples. The remaining aliquots of unpreserved and chemistry (BMP and BMP-1) treated whole blood samples were stored at room temperature for an additional 7 days. On Day 1 , unpreserved wholeblood samples were processed for plasma preparation (see details in Materials and Methods section). The baseline or T1 plasma samples were stored at -80°C until further processing and downstream analysis. On Day 8, like T1 samples, aliquots of unpreserved and preserved blood samples were processed for plasma preparation. A single target ELISA assay for IL-8 / CXCL8 was conducted (see details in Materials and Methods section) to evaluate the performance of BMP chemistry with BSA and BMP- 1 chemistry with Poly-L-Histidine on the maintenance of protein profiles.Table 8 (i): Pre-collection formulation of BMP chemistry.Table 8 (ii): Post-collection formulation of BMP chemistry after mixing with blood (Blood: BMP ratio is 1:0.2).Table 8 (Hi): Pre-collection formulation of BMP-1 chemistry.Table 8 (iv): Post-collection formulation of BMP-1 chemistry after mixing with blood (Blood: BMP-1 ratio is 1:0.2).
[0272] As shown in Figure 8, plasma prepared from T8 EDTA samples showed a drastic increase in IL-8 / CXCL8 protein content, indicating cellular lysis and leakage of proteins after an additional 7 days storage at room temperature, unlike BMP and BMP-1 chemistry treated samples which maintained plasma protein homeostasis with minimal or no change in protein over time (Figure 8). This data reflects that polypeptide, like Poly-L-Histidine, can be effectively used as a potential alternative to BSA in the current formulation for minimizing cellular protein leakage in the plasma prepared from whole blood mixed with BMP-1 and stored for 8 days at RT.
[0273] Example 9: Protein preservation in plasma collected from whole blood mixed with BMP containing BSA alternatives.
[0274] In this example, capillary blood was collected from fingerpricks from individual healthy donors (n=7) in Microvette® APT 250 EDTA K2E (Sarstedt Inc., Cat. No. 20.1331 .100) and mixed to generate a pooled capillary blood sample. This pooled blood sample was either left in EDTA (untreated) or mixed with BMP-1 and BMP-2 chemistry (blood: chemistry ratio of 1 :0.2). Pre-collection and post-collection, chemical components of each chemistry are provided in Table 9 (i, ii, iii, iv). An aliquot of untreated (EDTA only) and chemistry treated pooled sample was processed for plasma preparation (see details in Materials and Methods section) on the day of collection (TO). These baseline or TO plasma samples were stored at-80°C until further processing and downstream analysis. The remaining aliquots of unpreserved and chemistry treated whole blood samples were stored at room temperature for 7 days. On Day 7, like TO samples, aliquots of unpreserved and chemistry treated blood samples were processed for plasma preparation. ELISA assays for Epidermal Growth Factor (EGF) and P-selectin (CD62P) were conducted (see details in Materials and Methods section) to evaluate the performance of these different chemistries.
[0275] As shown in Figure 9, plasma prepared from the T7 EDTA containing blood samples showed a drastic increase in both EGF and CD62P protein content, indicating leakage of proteins from cells, potentially platelets (Yun et al., 2016; Chen et al., 2018) after 7 days storage at room temperature, unlike BMP-1 and BMP-2 containing samples with relatively small changes in protein content over time (Figure 9). This data reflects that BMP-1 and BMP-2 chemistries can effectively minimize cellular protein leakage in the plasma prepared from whole blood mixed with these chemistries and stored for 7 days at RT.Table 9(i): Pre-collection formulation of BMP-1 chemistry.Table 9 (ii): Post-collection formulation of BMP-1 chemistry after mixing with blood (Blood: BMP-1 ratio is 1:0.2).Table 9 (Hi): Pre-collection formulation of BMP-2 chemistry.Table 9 (iv): Post-collection formulation of BMP-2 chemistry after mixing with blood (Blood: BMP-2 ratio is 1:0.2).
[0276] Example 10. Use of amino acids as BSA alternative for a-amylase protein preservation in the saliva samples.
[0277] In this study, 1 mL of saliva sample was collected from different donors (n=7) in the provided 15 mL falcon tube (Sarstedt, Cat. No. 62.554.205). The collected saliva samples were mixed to generate a pooled saliva sample. The pooled sample was either mixed with 1X PBS, BMP or different chemistries (as defined in Table 10) in 1 :1 ratio. An aliquot of each of the treated pooled sample was processed for cell-free saliva supernatant preparation (see details in Materials and Methods section) on the day of collection. These baseline or TO supernatants were stored at - 80°C until further processing and downstream analysis. The remaining aliquots of PBS and chemistries treated saliva sample were stored at room temperature for 7 days. On Day 7, like TO samples, aliquots of PBS and chemistries treated pooled saliva sample were processed for cell-free supernatant preparation. These T7 supernatants were also stored at -80°C until further processing and downstream analysis. A single target ELISA assay for a-amylase was conducted (see details in Materials and Methods section) to assess protein preservation in the saliva sample. As shown in Figure 10, 1X PBS containing T7 saliva sample showed loss in a-amylase protein detection. On the other hand, relative to PBS, BMP and different amino acids containing chemistries (outlined in Table 10) showed improved detection of a-amylase in saliva sample stored at room temperature (RT) for 7 days.
[0278] Table 10: Select amino acids components tested.
[0279] Example 11 : LC-MS workflow compatibility of plasma samples collected from whole blood mixed with BMP-1 or BMP-2 chemistry for untargeted proteomics
[0280] In this study, venous blood from individual healthy donors (n=3) was collected in BD Vacutainer® EDTA tubes by a trained Phlebotomist. The collected whole blood samples were left either in EDTA (unpreserved) or treated with different chemistries; BMP-1 and BMP-2 (blood: chemistry ratio of 1 :0.2). Pre-collection and post-collection, the chemical components of each chemistry are provided in Table 11 (i, ii, iii, iv). An aliquot of each of the 3 unpreserved and preserved samples was processed for plasma preparation (see details in Materials and Methods section) on the day of collection (TO). These baseline or TO plasma samples were stored at -80°C until further processing and downstream analysis. An aliquot of TO plasma sampleswere shipped on dry ice to an external service provider to evaluate the compatibility of plasma samples prepared from whole blood samples treated with different chemistries on LC-MS workflow for untargeted proteomics.
[0281] Table 11 (i): Pre-collection formulation of BMP-1 chemistry.Table 11 (ii): Post-collection formulation of BMP-1 chemistry after mixing with blood (Blood: BMP-1 ratio is 1:0.2).Table 11 (Hi): Pre-collection formulation of BMP-2 chemistry.Table 11 (iv): Post-collection formulation of BMP-2 chemistry after mixing with blood (Blood: BMP-2 ratio is 1:0.2).
[0282] As shown in Figure 11 A and 11 B, plasma collected from BMP-1 andBMP-2 chemistry mixed whole blood showed -94-97% proteins recovery relative to -90% proteins recovery from EDTA only untreated baseline TO samples. This data suggests that plasma samples collected from chemistries treated whole blood samples are compatible with a defined LC-MS workflow for carrying out untargeted proteomics study.
[0283] Example 12: Effect of pH on BMP-based preservation of red blood cells.
[0284] In this study, -250 pL of capillary blood from individual healthy donors (n=7) was collected in EDTA Microvette® tubes, namely Microvette® APT 250 EDTA K2E (Sarstedt, Inc., Cat. No. 20.1331.100), from fingerpricks (see Materials and Methods section for details). The collected whole blood samples were combined to generate one pooled whole blood sample. Pooled whole blood sample was divided into 100 pL aliquots with one left in EDTA (unpreserved) and others treated with 20 pL of BMP-3 (Table 12 (i)) and its iterations (Blood: chemistry ratio of 1 :0.2) as specified in Table 12 (ii). After mixing, samples were equally divided into two aliquots for TO and T7 timepoints. TO samples were processed immediately for plasma preparation as described in the Materials and Methods section. The baseline or TO plasma samples were stored at -80°C until further processing and downstream analysis. The second aliquot of the divided samples was left at room temperature (RT) for 7 days; also referred as T7 samples. On Day 7, aliquots of EDTA and chemistry-treated blood samples were processed for plasma preparation. These T7 plasma samples were also stored at -80°C until further processing and downstream analysis. Both TO and T7 plasma samples were analyzed for hemoglobin content using the Hemoglobin Assay Kit (Abeam Ltd., Cat. No. ab234046) according to the manufacturer’s instructions. As shown in Figure 12, plasma collected from BMP-3 and its iterations (of different pH values) treated whole blood sample showed no or minimal increase in hemoglobin content relative to EDTA (unpreserved) sample. Plasma prepared from T7 EDTA sample showed more than two-fold increase in hemoglobin content when stored for 7 days at RT (Figure 12). This data suggests that BMP-3 chemistry can effectively preserve red blood cell integrity by minimizing hemolysis over a broad pH range (4.6-8.1). Furthermore, the data suggests pH dependent preservation of redblood cell integrity with optimal preservation at pH 4.9- 7.5 (± 0.2) under these specific testing conditions.Table 12 (i): Pre collection formulation of BMP-3 chemistry.*To achieve, 6X Protease Inhibitor Cocktail in BMP-3: Dissolve 3 tablets of ProteaseInhibitor Cocktail (Sigma, Cat. No. S8820) in 50 mL of chemistry.Table 12 ( / / ): BMP-3 and its different pH iterations tested.
[0285] The pH was adjusted using either acetic acid to obtain pH 4.6 or sodium hydroxide for pH 5.5, 6.07, 6.46, 7.05, 7.52 and 8.12.
[0286] Example 13: Comparison of BMP-2 and BMP-3 with different competitor chemistries for the preservation of multiple proteins in the plasma collected from whole blood.
[0287] In this study, venous blood from individual healthy donors (n=7) was collected in BD Vacutainer® EDTA tubes by a trained Phlebotomist. The collected whole blood samples were aliquoted and left either in EDTA (unpreserved) or treated with different chemistries in the ratios defined in Table 13 (i). Pre-collection and postcollection concentrations of chemical components in BMP-2 and BMP-3 are provided in Table 13 (ii, iii, iv and v). On the day of collection (TO), an aliquot of each of the 7unpreserved and chemistries treated whole blood samples was processed for plasma preparation (see details in Materials and Methods section) and then stored at -80°C until further processing and downstream analysis. Aliquots of unpreserved and chemistries treated blood samples were stored at room temperature for 7 days.
[0288] On Day 7, like TO samples, aliquots of unpreserved and chemistries- treated blood samples were processed for plasma preparation. These samples were referred to as T7. Single target ELISA assays for IL-8 / CXCL8, EGF and CD62P proteins were conducted (see details in Materials and Methods section) on a subset of prepared TO and T7 plasma samples to evaluate the comparative preservation performance of BMP-2 and BMP-3 chemistries against the commercially-available competitors' chemistries (A, B and C). Moreover, Olink® Proteomics Assay using T48 Cytokine panel was also performed on EDTA, BMP-2, BMP-3, Competitor-A and Competitor-B chemistries to evaluate the comparative performance for multiple protein targets.
[0289] As shown in Figure 13A, plasma prepared from EDTA, Competitor-B and Competitor-C treated samples showed a drastic increase in IL-8 protein content, unlike BMP- 2, BMP-3 and Competitor-A chemistry-treated samples which showed no leakage of IL-8 protein from the blood cells in the collected T7 plasma samples. (Figure 13A). Leakage of IL-8 protein in the T7 plasma samples indicate compromised blood cell integrity and follows the decreasing order as: Competitor-C>EDTA>Competitor- B> BMP-2=BMP-3=Competitor-A (Figure 13A). Next, plasma prepared from T7 EDTA and T7 Competitor-C treated whole blood samples showed a drastic increase in EGF protein content, while Competitor-A, Competitor-B and BMP-2 treated samples showed relatively reduced leakage of EGF protein from blood cells in the plasma space. Moreover, BMP-3 chemistry showed overall better performance relative to the other chemistries tested with minimal leakage of EGF protein in the plasma collected from whole blood mixed with chemistries (Figure 13B). Leakage of EGF protein in the T7 plasma samples indicate platelet stimulation and follows the decreasing order as EDTA>Competitor-C->Competitor-A >Competitor-B > BMP-2> BMP-3 (Figure 13B). Furthermore, plasma prepared from T7 EDTA, T7 Competitor-A, -B and -C chemistries showed increased amounts of CD62P protein relative to BMP-2 and BMP-3. BMP-2 and BMP-3 samples showed minimal changes in CD62P protein concentration between TO and T7 plasma samples (Figure 13C). Leakage of CD62P protein into theplasma indicates platelet activation which follows the decreasing order as: EDTA>Competitor-C> Competitor-A and Competitor-B> BMP-2 > BMP-3 (Figure 13C). Data in the Figures 13A-C represent median concentration values calculated from multiple donors (n=3)
[0290] Multi-target protein analysis was also performed on plasma samples prepared from whole blood mixed with EDTA, BMP-2, BMP-3, Competitor-A and Competitor-B chemistries using Clink® Target 48 Cytokine Panel. Competitor-C showed extensive hemolysis across multiple collected whole blood samples, even higher than EDTA and hence was not included in this Clink® study.
[0291] As shown in Figure 13D and 13E, a subset of analyzed proteins showed marked changes in the protein content (increased or decreased) in the plasma samples collected from whole blood in EDTA only or mixed with Competitor-B chemistry and stored at RT for 7 days. Data in Figures 13D and 13E represents median fold change (X) values calculated from multiple donors (n=7). Our BMP-2 and BMP-3 chemistry performed either at par with Competitor-A chemistry for protein targets as shown in Figure 13D or showed improved preservation for some of the protein targets (IL27, CSF3, IL7, IL17C) as shown in Figure 13E. After 7 days storage at RT, an increased protein content in some samples indicates leakage of proteins from blood cells into the plasma, while decreases in the protein content in some samples suggest degradation of protein overtime. This increase or decrease in protein levels in plasma samples collected from whole blood stored in EDTA or Competitor-B chemistry strongly suggests that these compositions are not suitable for storing whole blood samples at RT for longer periods. On the other hand, BMP-2 and BMP-3 chemistries showed effective preservation of plasma protein homeostasis by minimizing protein leakage from blood cells and by minimizing protein degradation relative to EDTA alone and competitor chemistries A-C tested after 7 days storage at RT.Table 13 ( / ): BMP-2, BMP-3 and Competitor Chemistries tested.Table 13 ( / / ): Pre-collection formulation of BMP-2 chemistry.Table 13 ( / / / ): Pre-collection formulation of BMP-3 chemistry.*To achieve, 6X Protease Inhibitor Cocktail in BMP-3: Dissolve 3 tablets of Protease Inhibitor Cocktail (Sigma, Cat. No. S8820) in 50 mL of chemistry.Table 13 ( / ): Post-collection formulation of BMP-2 chemistry.Table 13 (v): Post-collection formulation of BMP-3 chemistry.
[0292] Example 14: Composition stability and protein stabilization under extreme conditions.
[0293] Polypeptides in biological samples and bodily fluids mixed with the present composition are preserved at the point of collection and for prolonged periods at room temperature. However, during storage and transport of collected samples to the laboratory for analysis, it is not uncommon for collected samples to be exposed to elevated temperatures, potentially impacting sample quality and the integrity of analytes therein. In addition, some biological samples, blood in particular, must be collected into a sterile tube or receptacle for donor safety and to prevent contamination of the collected sample, ensuring valid or accurate test results.
[0294] In this example, numerous compounds, from each class or category, in the present composition (saccharide, amino acid, chelating agent, buffering agent, and protease inhibitor) were screened to determine which compounds optimally withstand degradation caused by prolonged, elevated temperatures (e.g. 50°C for 6 days, 37°C for 3 days) and / or sterilization processes, such as gamma irradiation (17- 25 kiloGray), facilitating the improvement or maintenance of the physicochemical properties of these compounds, as well as their stabilization properties. For instance, it is known in the state of the art, saccharides can undergo thermal degradation, through oxidation or possibly other mechanisms, during storage at elevated temperatures or during the process of sterilization via radiolysis under exposure to gamma irradiation. In this example, quantification of hemoglobin concentration, composition solubility, UV-VIS absorbance scans, and thermal shift assays were employed to assess the impact of gamma irradiation and prolonged heat on essential compounds of the present composition.
[0295] First, in order to screen different saccharides, BMP-2 served as the “base” composition (750 mM sodium acetate trihydrate, 50 mM EGTA, 8.4% (w / v) L-Histidine monohydrochloride monohydrate, 10% (w / v) trehalose dihydrate, 0.7% (w / v) citric acid) and trehalose dihydrate (10% (w / v)) was swapped out with different saccharides at the same concentration (10% (w / v)) Table 14(i)). Table 14(i) details the solubility of each saccharide in the “base” composition, after storage at 50°C for 6 days, by visual inspection [Y, clear solution; N, cloudy solution, precipitates or solids observed]. In addition, the presence or absence of thermal oxidation, as determinedby full UV-VIS absorbance scans (220-900 nm), was assessed for each composition after storage at 50°C for 6 days (Table 14(i)).
[0296] Specifically, 170 pL of each composition, each containing a different saccharide (Table 14(i)), was dispensed into separate wells of a UV-Star half area 96- well microplate (Greiner, Catalog No. 655801). A full UV-VIS absorbance scan from 220-900 nm was performed using a Molecular Devices Spectramax M2 Microplate Reader (Catalog No. 89429-532). Averages of the absorbance wavelengths across 3 technical replicates were plotted across the full UV-VIS absorbance wavelengths for each composition containing a different saccharide at two time points, TO and following 6 days at 50°C. Surprisingly, delta UV-VIS absorbance (T6 at 50°C-T0) of the compositions tested (Table 14 (i)), demonstrated an improvement in thermal stability, or reduction in thermal oxidation, following prolonged, elevated temperature storage conditions (50°C for 6 days) when select saccharides are present in the composition. Specifically, hydroxyethyl starch (130 / 0.4), trehalose and various sugar alcohols, including sucralose (Table 14 (ii), Figure 14A), contributed to thermal stability of the present composition.
[0297] Next, various BMP-2-modified compositions, each containing a different saccharide (Table 14 (iii)), were mixed at a 1 :5 ratio with pooled human fingerprick blood (n=3) and sheep’s blood (Cedarlane Labs, Catalog No. DSB050; n=1) and stored for 3 days at 37°C. Fingerprick blood that was collected into a vial containing EDTA (Sarstedt’s Microvette® APT 250 EDTA K2E, Catalog No. 20.1331.100) and stored for 3 days at 37°C served as the “No preservative control”. Sheep’s blood (Cedarlane Labs, Catalog No. DSB050) without EDTA present was stored for 3 days at 37°C and served as the sheep's blood “No preservative control”. Evidence of hemolysis in these composition mixtures after storage at 37°C for 3 days was evaluated (Figure 14B) by measuring the concentration of hemoglobin (mg / dL) in plasma isolates with a commercially available Hemoglobin Assay Kit (Abeam, Catalog No. ab234046).
[0298] Interestingly, of the numerous saccharides tested (Table 14 (iii)), an elevated concentration of hemoglobin, indicating hemolysis, was only measured in blood samples stored in the base composition with 10% (w / v) sucralose (Figure 14B). As anticipated, hemolysis was evident in the “No preservative control” sample. Similarhemoglobin concentrations were obtained with human fingerprick blood and sheep’s blood for each composition tested. Surprisingly, the low concentration of hemoglobin in blood samples stored in the base composition without saccharide relative to the No preservative control samples (ID#11) suggests that other components in the base composition may help maintain the integrity of red blood cells under these extreme conditions (although saccharide-containing compositions generally gave superior results).Table 14 ( / ): BMP-2-modified compositions each having a different saccharide (10% (w / v) concentration) evaluated for solubility and thermal oxidation after storage at 50°C for 6 days. Solubility was evaluated by visually inspecting each composition for evidence of cloudiness, precipitation and undissolved solid materials. Thermal oxidation was evaluated using delta UV-VIS absorbance scans from 220-900 nm after storage of each composition at 50°C for 6 days.Table 14 ( / / ): Subset of BMP-2-modified compositions each having a different saccharide (see Table 14(i)) evaluated for thermal oxidation and formulation stability after elevated storage at 50°C for 6 days (see Figure 14A).Table 14 ( / / / ): Various BMP-2-modified compositions each containing a different saccharide (10% (w / v)) were evaluated for the prevention of hemolysis (see Figure 14B) when mixed with either human fingerpick blood or sheep’s blood at a 1 :5 ratio and stored for 3 days at 37°C.
[0299] In addition, protein stability in these compositions was assessed using a Thermal Shift Assay (TSA; Table 14 (iv), see Materials & Methods). Compositions with different saccharides were spiked with known amounts of protein standards (Lysozyme or Beta-Galactosidase) and then stored at 37°C for 3 days. The thermal stability or melting temperature (Tm) of these proteins, after storage under these compositions, is reported in Table 14(iv).Table 14 ( / ): Thermal shift assay (TSA) delta Tm values of standard protein-spiked compositions, each containing a different saccharide, and stored for 3 days at 37°C
[0300] Second, to screen different amino acids, BMP-2 served as the“base” composition and 8.4% (w / v) or 400 mM L-Histidine monohydrochloride monohydrate was swapped out with different amino acids at the same concentration(see Table 14 (iv)). These compositions, with and without amino acid (400 mM), were gamma irradiated (17-25 kiloGray) and then their relative UV-VIS absorbance scans (220-900 nm) were compared to the base composition containing no amino acid to look for UV-VIS changes, caused by radiolysis (Table 14 (v) and Table 14(vi), Figure 14C). Delta UV-VIS absorbance scans (220-900 nm) of various compositions containing an amino acid post-gamma irradiation, compared to the relative absorbance of a composition without an amino acid component is shown in Figure 14D. The amino acids tested exhibit absorbance at higher wavelengths (e.g. above 570 nm) within acceptable levels.Table 14 (v): Compositions containing various amino acids at 400 mM concentration were evaluated for radiolysis post-gamma irradiation via UV-VIS absorbance (Figure 14C, Figure 14D) and for the prevention of hemolysis when blood samples were stored in these compositions for 3 days at 37°C at a 1 (composition) : 5 (blood) ratio (Figure 14E). Yellowing of the tube plastics was observed in formulation #1 and #2. Composition ID #10 contained 200 mM each for a respective total concentration of 400 mM.Table 14 ( i) Select compositions containing various amino acids at 400 mM were sent for gamma irradiation and their relative UV-VIS absorbance scans were compared to a BMP-2-modified “base” composition containing no amino acid.
[0301] Compositions, each containing a different amino acid at 400 mM(Table 14 (v)), were mixed at a 1 :5 ratio with pooled human fingerprick blood (n=3) and stored for 3 days at 37°C. As described above, evidence of hemolysis in these composition mixtures after storage at 37°C for 3 days was evaluated by measuring the concentration of hemoglobin (mg / dL) in plasma isolates with a Hemoglobin Assay Kit (Abeam, Catalog No. ab234046). Of all the amino acids tested, only N-Acetyl-L- glutamic acid in this base composition had a negative impact, i.e. lysis of red blood cells, under these extreme conditions at the specific concentration tested (Figure 14E).
[0302] Third, in order to screen different chelators, BMP-2 again served as the “base” composition (750 mM sodium acetate trihydrate, 50 mM EGTA, 8.4% (w / v) L-Histidine monohydrochloride monohydrate, 10% (w / v) trehalose dihydrate, 0.7% (w / v) citric acid) and EGTA was swapped out with different chelators at the same concentration (50 mM) (see Table 14(vii)). Table 14 (vii) details the solubility of each chelator in the “base” composition, at TO baseline after the compositions were prepared, by visual inspection [Y, clear solution; N, cloudy solution, precipitates or undissolved solids observed]. In addition, the potential discoloration (yellowing) of each composition, as determined by full UV-VIS absorbance scans (220-900 nm), was assessed for each composition having a different chelator after storage at room temperature for at least 3 days (Table 14(vii) and Figure 14F).
[0303] Interestingly, while phytic acid sodium salt hydrate, methylenedisalicylic acid, and 5 -sulfosalicylic acid dihydrate were soluble in this“base” composition, distinct yellowing and shifted UV-VIS absorbance scans were observed after storage of these mixtures at room temperatures for at least 3 days (Table 14 (vii) and Figure 14F). In contrast, N-(2-carboxyethyl)iminodiacetic acid, diethylenetriaminepentaacetic acid calcium trisodium salt hydrate, diethylenetriaminepentaacetic acid, 1 ,2-diaminopropane-N,N,N',N'-tetraacetic acid, 1 ,3-diamino-2-propanol-N,N,N',N'-tetraacetic acid, glycine-N,N- bis(methylenephosphonic acid), ethylene glycol tetra acetic acid, 2- hydroxyethyl)ethylenediaminetriacetic acid, and 1 ,2-cyclohexanediaminetetraacetic acid performed well in this “base” composition in terms of good solubility, without discoloration of the composition over time.Table 14 (v / 7): BMP-2-modified compositions, each having a different chelator (50 mM), were evaluated for solubility and discoloration or yellowing after storage at room temperature for at least 3 days. Successful solubility was determined if visual inspection of each composition failed to detect evidence of cloudiness, precipitation and undissolved solid materials. Discoloration or yellowing of the compositions was evaluated using UV-VIS absorbance scans (220-900 nm) and visual observations of each composition.
[0304] Fourth, in order to screen different buffering agents, BMP-2 again served as the “base” composition (750 mM sodium acetate trihydrate, 50 mM EGTA , 8.4% (w / v) or 400 mM L-Histidine monohydrochloride monohydrate, 10% (w / v) trehalose dihydrate, 0.7% (w / v) citric acid) and sodium acetate trihydrate was swapped out with different buffering agents at the same concentration (750 mM) (see Table 14 (viii)). Visual inspection at TO was utilized to assess the solubility of these buffering agents in the “base” composition (Table 14(viii)). Subsequently, these BMP-2-modified compositions, each containing a different buffering agent, were mixed at a 1 :5 ratio with pooled human fingerprick blood (n=3) and stored for 3 days at 37°C. As described above, hemolysis in the compositions on day 3 (Table 14(viii), Figure 14G) was evaluated by measuring the concentration of hemoglobin (mg / dL) in plasma isolates with a commercially available Hemoglobin Assay Kit (Abeam Ltd., Catalog No. ab234046).
[0305] In addition, protein stability in these compositions was assessed using a Thermal Shift Assay (TSA; Table 14 (viii), Table 14 (ix), see Materials and Methods). Compositions with different buffering agents were spiked with known amounts of protein standards (Lysozyme or Beta-Galactosidase) or plasma isolatedfrom sheep’s blood and then stored at 37°C for 3 days. The thermal stability or melting temperature (Tm) of these proteins, after storage under these compositions, is reported in Table 14 (ix).
[0306] With the exception of Tris and BES, all buffering agents tested(Table 14(viii)) were soluble in the present base composition. Evidence of hemolysis, as determined by the concentration of hemoglobin in isolated plasma after storage of fingerprick blood for 3 days at 37°C in compositions containing various buffering agents, was only detected in the composition with zinc acetate dihydrate (Table 14(viii), Figure 14G). It is important to note that zinc acetate dihydrate was not compatible with the hemoglobin assay. Finally, using a TSA, the lowest delta (A) Tm values between T3 and TO were obtained with composition ID# 1 , 4, 5, and 7 (Table 14 (ix)) and preservation of at least one protein was obtained with composition ID# 3 and 8, indicating good protein stability in compositions with select acetate buffers during prolonged exposure to elevated temperature.Table 14 (v / 77): Buffering agents evaluated for solubility, prevention of hemolysis, and protein stability [L = lysozyme, B = Beta-galactosidase, S= sheep’s blood].Table 14 ( / x): Thermal shift assay (TSA) delta Tm values of standard protein- and plasma-spiked compositions, each containing a different buffering agent, and stored for 3 days at 37°C.
[0307] Finally, in order to screen different protease inhibitors, BMP-2 again served as the “base” composition (750 mM sodium acetate trihydrate, 50 mM EGTA , 8.4% (w / v) or 400 mM L-Histidine monohydrochloride monohydrate, 10% (w / v) trehalose dihydrate, 0.7% (w / v) citric acid) to which various protease inhibitors were added (see Table 14 (x)). Fingerprick blood was collected from 4-5 donors and pooled into a vial containing EDTA (Sarstedt’s Microvette® APT 250 EDTA K2E, Catalog No. 20.1331.100). An aliquot (100 pL) of pooled blood was mixed with each BMP-2- modified composition, with or without protease inhibitor(s) (Table 14 (x)), at a 5:1 ratio. Shortly thereafter, these mixed samples were split into equal volumes for processing at TO or following storage for 3 days at 37°C. At baseline TO and T3, plasma was isolated from aliquots of each sample (see details in Materials and Methods) and then stored at -80°C until further processing and downstream testing.
[0308] Finally, single target ELISA assays for human IL-8 / CXCL8 and EGF proteins (ab214030 and ab217772 from Abeam Ltd.; see Materials and Methods) were performed on the aforementioned plasma isolates prepared at TO and T3 to quantitatively measure the concentration of these proteins in the present compositions over time at elevated temperature (37°C). As shown in Figures 14H and 141, plasma prepared from EDTA samples (#16) showed a drastic increase in IL-8 protein and EGF protein at T3, respectively, unlike BMP-2, BMP-2-modified compositions, and BMP-3.At T3, this notable leakage of IL-8 protein and EGF protein from blood cells into the extracellular space or plasma space in EDTA samples indicated compromised blood cell integrity. In contrast, BMP-2-modified compositions, each having a different protease inhibitor, showed very low concentrations of IL-8 protein and EGF protein in the plasma space even after samples were stored 3 days at 37°C (Figures 14H and 141).Table 14 (x): BMP-2-modified compositions, each having a different protease inhibitor, were evaluated for plasma IL-8 protein stability and EGF protein stability when blood samples stored in these compositions at a 5:1 ratio were exposed to 37°C for 3 days.
[0309] Example 15: T esting different concentration ranges for each class of compound in the present composition for their impact on the stabilization of target proteins and prevention of hemolysis in venous blood samples.
[0310] In one aspect, the classes of components or compounds that make up the present composition comprise a buffering agent, a chelating agent, at least one saccharide, and a stabilizing agent selected from a stabilizing protein, a peptide, and amino acid or a salt thereof, or a combination thereof. In this example, the robustness of the present composition to maintain plasma homeostasis by stabilizing blood proteins under challenging conditions, as evaluated by the maintenance of select blood cell protein targets (e.g. IL-8, EGF and LOX-1 (OLR1)) and prevention of hemolysis, was examined by testing different concentration ranges for each component class within the composition. Importantly, stabilization of these protein biomarkers is critical for accurate and effective diagnosis in various subspecialties of medicine for the purpose of rapid diagnosis or predictive prognosis. In particular, human IL-8 was evaluated since this marker is routinely used for many pathophysiological conditions or various clinical conditions including urology and nephrology, hematology, oncology, pediatrics, microbiology and nuclear medicine (Shahzad et al, 2010). Inaccurate results due to suboptimal stabilization of this protein of interest within a collected blood sample can occur due to ex-vivo changes occurring post-collection under various storage and transport conditions, including exposure to suboptimal temperatures and vibration. Similarly, human EGF protein was selected and evaluated due to its importance in clinical diagnostics and prognoses in cancer pathogenesis (Kjaer et al, 2020), while LOX-1 protein was selected and evaluated as this biomarker plays a significant role in cardiovascular risk prediction (Barreto et al, 2021).
[0311] Starting with the “nominal” composition (ID #1 ) outlined in Table 15(i); a) all components were increased or decreased by 25% to create ID #2 and 3, respectively, b) HES 200 / 0.4 (w / v) alone was adjusted + / -35% to create ID #4 and 5, c) L-Histidine monohydrochloride monohydrate was increased by 35% to create ID #6 or decreased by 50% to create I D #7, d) sodium acetate was adjusted + / -35% to create ID #8 and 9, e) L-Histidine monohydrochloride monohydrate was reduced to 200 mM and combined with 200 mM L-Arginine monohydrochloride to create ID #10, f) L- Histidine monohydrochloride monohydrate was reduced to 100 mM and combined with100 mM L-Arginine monohydrochloride to create ID #11 , and g) citric acid was omitted from the “nominal” composition to create ID #12. EDTA alone for ID #13 served as a negative control. Following the preparation of these compositions outlined in Table 15(i), the pH of each solution was measured.
[0312] Venous whole blood from three healthy donors was collected in BDVacutainer® EDTA tubes (Becton, Dickinson and Company (BD), Cat. No. 366643) by a trained Phlebotomist. Next, this EDTA collected venous blood was pooled into a single sample and aliquoted into the compositions outlined in Table 15(i) at a ratio of 5:1. Shortly thereafter, these mixed samples were split into equal volumes for processing at TO or following storage for 7 days at room temperature (23°C±3°C). At baseline TO and T7, plasma was isolated from aliquots of each sample (see details in Materials and Methods) and then stored at -80°C until further processing and downstream testing.
[0313] Plasma homeostasis in these blood samples after storage at room temperature for 7 days was evaluated (Figure 15A) by measuring the concentration of hemoglobin (mg / dL) in plasma isolates at TO and T7 with a commercially available Hemoglobin Assay Kit (Abeam Ltd., Catalog No. ab234046; see Materials and Methods). Storage of venous blood samples in EDTA alone consistently resulted in the increase in hemoglobin concentration over time, suggesting the lysis of red blood cells in samples stored at room temperature for 7 days. Assay results (Figure 15A) from venous whole blood samples stored for 7 days in the present compositions (outlined in T able 15(i)) suggest that the concentration of buffering agent (e.g. sodium acetate trihydrate) and saccharide (e.g. HES) are important for red blood cell integrity.
[0314] Single target ELISA assays for human LOX-1 (OLR1) protein (a cardiovascular protein biomarker and a platelet associated protein (Barreto et al., 2021)) and EGF proteins (Abeam Ltd., Cat. No. ab212161 and ab217772, respectively; see Materials and Methods) were performed on the aforementioned plasma isolates, prepared at TO and T7, to quantitatively measure the concentration of these proteins in the present compositions over time. Not surprisingly, storage of venous blood samples in EDTA alone consistently resulted in an increase in human EGF protein (Figure 15B) and LOX-1 protein (Figure 15C) concentration over time at room temperature, suggesting leakage of these proteins from blood cells into theplasma or extracellular space. Interestingly, these ELISA assay results for the numerous compositions outlined in Table 15(i) suggest that 1) stabilizing agents (e.g. L-Histidine monochloride monohydrate) and buffering agents (e.g. citric acid) are important components for EGF protein stability. The maintenance of EGF protein concentrations after 7 days at room temperature was demonstrated when L-Histidine monochloride monohydrate concentrations varied between 80-108 mM in the sample mixture and citric acid was present, demonstrating the effective prevention of ex-vivo platelet activation in the composition mixture.
[0315] Importantly, plasma isolated from composition #1 in Table 15(i) demonstrated direct compatibility with a next-generation proteomic technology, the SomaLogic SomaScan® Assay on a panel of 100 protein targets (unlike other known compositions that require pre-processing for use with SomaScan - see user manual). Also importantly, a subset of proteins across the three donors evaluated were identified in EDTA collected blood tubes that significantly changed overtime and were unstable, namely C3 (Complement C3), EGF:ECD (Epidermal Growth Factor: cytoplasmic domain), l-TAC (C-X-C motif chemokine 11), PBEF (Nicotinamide phosphoribosyltransferase), and TNF-b (Lymphotoxin-alpha)). The stabilization performance in the present composition demonstrated a significant improvement in the collected blood samples held at room temperature for up to 7 days for all three donors (Figure 15D).Table 15 ( / ): Formulation of each composition tested, including pH values.
[0316] Next, gamma irradiated compositions containing no Pls or protease inhibitors (ID #4, 5; Table 15(H)), along with other compositions detailed in Table 15(ii), demonstrated effective prevention of hemolysis and maintenance of plasma homeostasis (data not shown). The addition of a PI or protease inhibitor, namely AEBSF hydrochloride (12 mM) and Bestatin (40-120 pM), to the present composition demonstrated improved performance in maintaining LOX-1 protein concentrations (ID #6, #7, and #9; Figure 15E) in fingerprick blood samples mixed at a 1 :5 ratio (1 part composition : 5 parts blood), compared to compositions containing no PI (ID #8) or EDTA (ID #11) collected samples after storage for 4 days at room temperature. Surprisingly, a composition containing a Protease Inhibitor Cocktail (ID #9; Table 15(H)) that was gamma irradiated, prior to mixing with fingerprick blood (1 :5 ratio), demonstrated effective LOX-1 protein stabilization, compared to a gamma irradiated composition containing no Pls (ID #8; Figure 15E). Importantly, this surprising finding demonstrates the effective functionality of an active protease inhibitor post-gamma irradiation for protein stabilization and is significant improvement considering protease inhibitors are commonly stored at -20°C before use and added fresh to common reagents or buffers used for effective protein stabilization in the current state of the art. Compositions containing Pls (ID #6, 7, and #9) effectively maintained the prevention of blood cell associated IL-8 protein release or leakage (Figure 15F) and maintained platelet associated EGF protein concentration after storage for 4 days at room temperature (Figure 15G.) These data support that the use of protease inhibitors (i.e. Pl’s) may be beneficial depending on the protein targeted for preservation.Table 15 ( / / : Compositions tested for hemolysis and / or protein stabilization for up to 4 days at room temperature (23°C±3°C).
[0317] Finally, in Table 15(iii)), BMP-4 compositions, with (ID #1 , #4-#7) and without (ID #2) Pls or protease inhibitors (12 mM of AEBSF hydrochloride and 40-120 pM of Bestatin), as well as a BMP-4 composition containing 12 mM of AEBSF- OH or hydrolyzed AEBSF and 120 pM of Bestatin (ID #3) were evaluated to 1) test abroader functional range when the composition volume was adjusted by ±15% and ±25%, before mixing with a constant volume of venous blood collected into EDTA tubes; and 2) to evaluate if the hydrolyzed form of AEBSF impacts EGF protein and LOX-1 protein stability after storage of these samples for up to 8 days at room temperature. Surprisingly, EGF protein stability (Figure 15J) and LOX-1 protein stability (Figure 151) were reduced in the presence of BMP-4 with hydrolyzed AEBSF, even in the presence of 120 pM of Bestatin (ID #3), indicating that functional unhydrolyzed AEBSF appears to be beneficial for EGF and LOX-1 protein stability under these conditions. Importantly, the BMP-4 composition with Pls successfully stabilized EGF and LOX-1 target proteins when the composition volume was varied by ±15% (ID #4 and #5). An increase in EGF protein concentration after 8 days at room temperature; however, was observed in venous blood samples when the composition volume was decreased by 25% (ID #7) with similar performance observed in the competitor composition ID #9 and relatively better performance than EDTA alone (ID#10). Unlike the EDTA control (ID #10), the various BMP compositions outlined in Table 15(iii) (ID #1-8) prevented hemolysis when mixed with venous blood in a 1 :5 ratio and stored at room temperature for 8 days (Figure 15H).Table 15 (Hi) Summary of chemistry compositions evaluated for the prevention of hemolysis, as well as their impact on EGF protein and LOX-1 protein stability, after storage for up to 8 days at room temperature (23°C±3°C).00318] Example 16: Impact of sterilization, extreme temperature fluctuations, and vibration or shaking on the stabilization of target proteins and maintenance of plasma homeostasis in venous blood collected into the present composition and stored for up to 8 days under temperature cycling and simulated vibration conditions.
[0319] Impact of Sterilization (Condition #1 )
[0320] In this example, venous blood was collected from 10 healthy donors(n=2 per donor) directly into partially evacuated, sterile tubes containing: EDTA (BD Vacutainer® EDTA tubes; see Materials and Methods), a competitor’s preservative, and the present composition (BMP-5). Specifically, 1.5 mL of BMP-5 composition, comprising 487.5 mM sodium acetate trihydrate, 50 mM HEDTA, 500 mM L-Histidine monohydrochloride monohydrate, 11.5% (w / v) HES 130 / 0.4, 0.7% (w / v) citric acid),12 mM AEBSF hydrochloride, and 120 pM Bestatin, was dispensed into collection tubes, the tubes were partially evacuated during capping, and then gamma irradiated (17.0-25.0 kiloGray) prior to venous blood collection.
[0321] Table 16 ( / ): Pre-collection formulation of BMPS chemistry.
[0322] Figure 16A illustrates the average volume of venous blood collected into each tube. Notably, two of the twenty (10%) blood collection tubes tested from the competitor failed upon venous blood collection due to loss of their internal vacuum during storage. Similarly, 10% (2 / 20) of EDTA tubes failed to maintain a draw volume within the expected + / -10% range (Figure 16A). In contrast, BMP-5 tubes collected an average of 7.36 mL of venous blood (MIN=6.84 mL, MAX= 7.72 mL) with all 20 tubes, collecting within + / -10% of the expected blood draw volume of 7.5 mL.
[0323] Within two hours of venous blood sample collection (into three types of tubes as described above), plasma was isolated (see Materials and Methods) from a small aliquot (TO) taken from each tube and then all blood tubes were stored at room temperature (23°C±3°C) up to 8 days. Figure 16B demonstrates hemoglobin concentration (mg / dL) in isolated plasma from venous blood samples collected into BMP-5 tubes, EDTA tubes and a competitor’s blood collection tube with liquid preservative at baseline (TO) and after 8 days of room temperature storage across 10 healthy donors. The increase in hemoglobin concentration in EDTA tube samples at T8 suggests that red blood cell lysis occurred during room temperature storage, whereas hemolysis was minimal in BMP-5 tube samples and samples stored in the competitor’s tubes (Figure 16B).
[0324] Single target ELISA assays for human EGF protein, IL-8 protein,LOX-1 (OLR1) protein, and CD62P protein (see Materials and Methods) wereperformed on the aforementioned plasma isolates, prepared at TO and T8, to quantitatively measure the concentration of these target proteins in the present compositions over time at room temperature. Not surprisingly, storage of venous blood samples in EDTA tubes consistently resulted in an increase in IL-8 protein (Figure 16C), EGF protein (Figure 16D), LOX-1 protein (Figure 16E), and CD62P protein (Figure 16F) concentrations during room temperature storage, suggesting leakage of these target proteins from blood cells into the plasma or extracellular space.
[0325] Minimal changes in the concentration of IL-8 protein (Figure 16C) were observed in BMP-5 tube samples and samples stored in the competitor’s tube during room temperature for 8 days. Importantly, in BMP-5 tube samples, the average EGF protein concentration after 8 days storage (Average = 87.42 pg / mL, MIN = 27.33 pg / mL, MAX = 166.3 pg / mL, STDV = 41.27 pg / mL) was significantly less (P=0.0073 , Table 16(H)) than changes in protein concentration that occurred in samples stored in the competitor’s blood collection tube (Figure 16D). This significant difference or improvement in BMP-5 tube samples was also observed for LOX-1 protein (P=0.0014; Table 16(ii), Figure 16E) and CD62P protein (P=0.0009; Table 16(ii), Figure 16F).T able 16(ii): Summary statistics of protein targets evaluated using a one-way repeated measure ANOVA, Tukey’s multiple comparisons analysis (a = 0.05); Graphpad Prism Version 10.0.1.
[0326] It is well known that during the transport of whole blood from the point of collection (e.g. patient’s home, doctor’s office, clinic) to the laboratory for analysis, the stability of biomolecules (e.g. nucleic acid and protein) and integrity of blood cells therein can become compromised to varying degrees. In addition to changes known to occur with time, exposure to elevated and / or fluctuating temperatures, as well as physical forces, such as vibration and shaking, can negatively impact sample quality.
[0327] To simulate elevated and fluctuating temperature changes possible during transport, venous blood (10 donors) was collected into BMP-5 tubes, EDTA tubes, and a competitor’s blood collection tube with preservative. At baseline (TO) plasma was isolated within 2 hours of venous blood collection from an aliquot taken from each tube and then frozen at -80°C, followed by exposure of all tubes to temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by a room temperature hold (23°C±3°C) for a total duration of 6 days (T6). Figure 16G demonstrates hemoglobin concentration (mg / dL) in isolated plasma from venous blood samples collected into BMP-5 tubes, EDTA tubes and a competitor’s blood collection tube with liquid preservative at baseline (TO) and following temperature cycling plus room temperature storage up to 6 days. As expected, the increase in hemoglobin concentration in EDTA tube samples at T6 suggests that red blood cell lysis occurred during this temperature cycling, whereas hemolysis was minimal in BMP-5 tube samples and samples stored in a competitor’s tube (Figure 16G).
[0328] Single target ELISA assays for human EGF protein, IL-8 protein,LOX-1 (OLR1) protein, and CD62P protein (see Materials and Methods) were performed on plasma isolates, prepared at TO and T6, to quantitatively measure the concentration of these target proteins in the present compositions over time when the temperature is elevated and fluctuated. Not surprisingly, storage of venous blood samples in EDTA tubes consistently resulted in an increase in IL-8 protein (Figure 16H), EGF protein (Figure 161), LOX-1 protein (Figure 16J), and CD62P protein (Figure 16K) concentrations by T6, suggesting leakage of these target proteins from blood cells into the plasma or extracellular space.
[0329] Minimal changes in the concentration of IL-8 protein (Figure 16H) were observed in BMP-5 tube samples and samples stored in the competitor’s tube at T6. Importantly, in BMP-5 tube samples, the average EGF, CD62P and LOX-1 protein concentration at T6 was significantly less (P= 0.0067, P=0.0078, P=0.003 respectively; Table 16(iii)) than changes in protein concentrations that occurred in samples stored in the competitor’s blood collection tubes.Table 16(iii): Summary statistics of protein targets evaluated (TO vs. Temperature cycling from 4°C to 30°C, followed by room temperature hold for a total duration of 6days; using a one-way repeated measure ANOVA, Tukey’s multiple comparisons analysis (a = 0.05); GraphPad Prism Version 10.0.1.
[0330] Temperature Cycling Plasma (Condition #2):
[0331] To further simulate elevated and fluctuating temperature changes and prolonged storage possible during transport when plasma isolates are shipped at ambient temperature negating requirements for cold chain shipping of plasma isolates at -80°C, venous blood (10 donors) was collected into BMP-5 tubes, EDTA tubes, and a competitor’s blood collection tube with preservative, at baseline (TO) plasma was isolated within 2 hours of venous blood collection from an aliquot taken from each tube and then frozen at -80°C. Next, a second aliquot of plasma isolate was exposed to temperature cycling from -10°C to 30°C (minimum of 24 hours at each temperature), followed by a room temperature hold (23°C±3°C) for a total duration of 8 days (T8). Figure 16L demonstrates hemoglobin concentration (mg / dL) in isolated plasma from venous blood samples collected into BMP-5 tubes, EDTA tubes and a competitor’s blood collection tube with liquid preservative at baseline (TO) and following temperature cycling plus room temperature storage up to 8 days (T8). Not surprisingly, minimal increases in hemoglobin concentration were observed across all plasma isolates exposed to temperature cycling followed by storage at room temperature for up to 8 days in EDTA, BMP-5 and the competitor preservative.
[0332] Single target ELISA assays for human EGF protein, IL-8 protein,LOX-1 (OLR1) protein, and CD62P protein (see Materials and Methods) were performed on plasma isolates, prepared at TO and T8, to quantitatively measure the concentration of these target proteins in the present compositions over time when the temperature is elevated and fluctuated. Not surprisingly, storage of venous bloodsamples in EDTA tubes consistently resulted in an increase in EGF protein (Figure 16M), IL-8 protein (Figure 16N), LOX-1 protein (Figure 160), and CD62P protein (Figure 16P) concentrations by T8.
[0333] Importantly, in BMP-5 tube samples, the average concentration ofEGF protein, IL-8 protein, LOX-1 protein, and CD62P protein remained stable between TO and T8, even after exposure of samples to extreme temperature cycling and prolonged storage. In general, these target protein concentrations remained lower in BMP-5 tube samples, compared to samples stored in the competitor’s tube for 8 days.
[0334] Temperature Cycling + Vibration (Condition #3):
[0335] To simulate elevated and fluctuating temperature changes along with vibration or shaking possible during transport, venous blood was collected into BMP-5 tubes (10 donors), EDTA tubes (10 donors), and a competitor’s blood collection tube with preservative (8 donors), at baseline (TO) plasma was isolated within 2 hours of venous blood collection from an aliquot taken from each tube and then frozen at - 80°C, followed by exposure of all tubes to temperature cycling from 4°C to 30°C (minimum of 24 hours at each temperature), followed by 24 hours of a simulated shaking condition (150 RPM) at room temperature (23°C±3°C), followed by a room temperature hold for 5 days (23°C±3°C) for a total duration of 8 days (T8) to simulate expected transport conditions of whole blood.
[0336] Figure 16Q demonstrates hemoglobin concentration (mg / dL) in isolated plasma from venous blood samples collected into BMP-5 tubes, EDTA tubes and a competitor’s blood collection tube with liquid preservative at baseline (TO) and following temperature cycling, shaking, and then a room temperature hold for 5 days for a total duration of 8 days. An increase in hemoglobin concentration in BMP-5 tube samples, EDTA tube samples, and samples stored in a competitor’s tube at T8 suggests that limited red blood cell lysis occurred during this simulated transport which included shaking of the tubes at room temperature (Figure 16Q).
[0337] Single target ELISA assays for human EGF protein, IL-8 protein,LOX-1 (OLR1) protein, and CD62P protein (see Materials and Methods) were performed on plasma isolates, prepared at TO and T8, to quantitatively measure the concentration of these target proteins in the present compositions over time and following extreme simulated transport conditions. Not surprisingly, storage of venousblood samples in EDTA tubes consistently resulted in a dramatic increase in EGF protein (Figure 16R), IL-8 protein (Figure 16S), LOX-1 protein (Figure 16J), and CD62P protein (Figure 16U) concentrations by T8, suggesting leakage of these target proteins from blood cells into the plasma or extracellular space and possibly lysis of blood cells.
[0338] Importantly, in BMP-5 tube samples, the average concentration ofEGF protein, IL-8 protein, LOX-1 protein, and CD62P protein remained stable between TO and T8, even after exposure of samples to extreme temperature cycling, shaking, and prolonged storage. The concentrations of EGF protein and LOX-1 protein remained lower in BMP-5 tube samples, compared to samples stored in the competitor’s tube for 8 days.BMP-5 (1.5 mL) was dispensed into a COP-BCT which means Cyclic Olefin Polymer - Blood Collection Tube. Tubes were partially evacuated so that 7.5 mL of venous blood was collected during the blood draw.
[0339] Cyclic olefin polymers (COPs) and cyclic olefin copolymers (COCs) are amorphous, transparent thermoplastics used in various applications due to their unique properties, including low water absorption, high electrical insulation, and resistance to solvents. COPs and COCs are made by copolymerizing cyclic olefin monomers (like norbornene) with linear olefins (like ethene). They are known for their high optical clarity, making them suitable for optics and film applications. Their biocompatibility and ability to withstand sterilization processes make them suitable for medical implants and other devices. However, for collection of venous blood, any commercially available evacuated blood tube would be acceptable.
[0340] Example 17: Preservation of proteins in first-void urine samples.
[0341] In this study, random first-void urine (FVU) samples were collected from 7 healthy female donors using Colli-Pee™ 10 mL devices (DNA Genotek, Inc., Cat. No. N00309_RUG). Each collected FVU sample was aliquoted and split between two conditions: 1) non-treated (No Chemistry) and 2) BMP-3-treated, wherein FVU was mixed with BMP-3 composition in a 1 :1 ratio. Both non-treated and BMP-3-treated urine samples were spiked with SARS-CoV2 Nucleocapsid Protein (NP) at an approximate final concentration of 20 pg / mL. Next, these spiked urine samples were divided into two aliquots. The first aliquot was processed immediately by centrifugationat 3000 x g for 10 minutes at 4°C and the pre-cleared supernatant was isolated, labeled TO, and stored at -80°C. The second aliquot of the NP-spiked non-treated and BMP-3-treated urine samples was stored at RT for 7 days. At T7, these samples were also processed by centrifugation (see above) to obtain pre-cleared supernatant which was isolated and stored at -80°C until analysis. Both TO and T7 pre-cleared supernatant isolates were thawed before carrying out the SARS-CoV2 Nucleocapsid Protein ELISA Kit assay, as described in the Materials and Methods section.
[0342] As shown in Figure 17, a loss of spiked NP (median fold change=0.3) was observed in pre-cleared supernatants obtained from non-treated FVU samples stored at RT for 7 days. In contrast, BMP-3-treated FVU samples showed improved protection of spiked NP (median fold change =0.8) after RT storage for 7 days, compared to non-treated FVU samples (Figure 1). Both the extent of loss and preservation of this protein in non-treated and BMP-3-treated FVU samples, respectively, were also found to be donor dependent.
[0343] Example 18: Preservation of salivary cell-free DNA (cfDNA).
[0344] In this study, two saliva samples were collected from each healthy donor (n=10) into empty tubes using an alternate spitting method. For paired samples from each donor, one saliva sample was mixed with an equal volume of 1xPBS, and the other saliva sample was treated with an equal volume of BMP composition (1 :1 ratio). Notably, pre- and post-collection concentrations of BMP chemical components are provided in Table 17 (i and ii) below. Next, an aliquot from each of the 10 PBS- treated and 10 BMP-treated saliva samples was processed as described in the Materials and Methods to produce cell-free saliva sample supernatant fractions at baseline or TO. These baseline or TO supernatant fractions were stored at -80°C until further processing and downstream analysis. Another aliquot from each of the 10 PBS- treated and 10 BMP-treated saliva samples was stored at room temperature for 7 days.
[0345] At T7, like TO, aliquots of PBS-treated and BMP-treated saliva samples were processed to produce cell-free saliva sample supernatant fractions which were also stored at -80°C until further processing and downstream analysis. On the day of processing, both TO and T7 cell-free supernatant fractions were thawed,and nucleic acid was purified using the QIAamp® Circulating Nucleic Acid Kit (Qiagen, Cat. No. 55114). In particular, cfDNA content and quality analysis was performed using a p-globin qPCR assay and TapeStation analysis using HSD5000 tapes, respectively, as described in the Materials and Methods section.
[0346] As shown in Figure 18A, cell-free supernatants prepared from T7PBS-treated samples showed dramatic losses of cfDNA content, as indicated by dramatic increases in Ct values (median: 35.58) relative to Ct values for TO PBS- treated samples (median: 31 .40) for p-globin cfDNA. In contrast, BMP-treated samples showed effective cfDNA preservation with median TO and T7 Ct values of 29.2 and 27.8, respectively, under similar storage conditions (Figure 18A).
[0347] Moreover, the profiles of extracted nucleic acid from the supernatants of T7 PBS-treated saliva samples were found to be markedly changed, relative to the corresponding TO PBS-treated saliva samples. Representative profiles for samples from 3 donors (D1-D3) are depicted in Figure 18B. Importantly, the profiles of extracted nucleic acid from the supernatants of BMP-treated saliva samples remained similar between TO and T7 timepoints (Figure 18B) for all three donors.Table 17(i): Pre-collection formulation of BMP composition.Table 17(ii): Post-collection formulation of BMP composition after mixing with saliva (saliva: BMP ratio is 1 :1).
[0348] Example 19: Preservation of protein and genomic DNA in oral swab samples.
[0349] In this study, seven healthy donors were recruited to collect paired oral swab samples using the plastic form factor of OraCollect®»Dx devices (DNA Genotek, Inc., Cat. No. OCD-100A), prefilled with either 1 mL of 1X PBS or BMP-6 composition (see Table 18), as per manufacturer’s Instructions for Use. Donors were asked to wait at least an hour in between collections and to not eat or drink for 30 minutes prior to sample collection. Sample collection in each device was randomized per donor to minimize variability from time of collection. Oral swab samples collected with modified OraCollect®»Dx devices were processed as follows:
[0350] 1 . Wring out each swab in the tube of each device and transfer the entire sample into a 1 .5 mL centrifuge tube.
[0351] 2. Pulse spin devices in a centrifuge to collect any remaining sample in the bottom of the tube of each device and transfer remaining sample into the centrifuge tube.
[0352] 3. Based on the volume of recovered sample, the appropriate aliquot volumes for each time point (TO and T7) were determined (i.e. , an equal volume of sample per time point). Baseline or TO samples were centrifuged at 3,000 x g for 15 minutes at 4°C to generate cell-free supernatant fractions and cellular pellet fractions. Both fractions were isolated and stored at -80°C until further processing and downstream analysis. The remaining aliquots of PBS-treated and BMP-6-treated oral swab samples were stored at room temperature for 7 days. At T7, like TO, aliquots of PBS-treated and BMP-6-treated oral swab samples were centrifuged to generate cell- free supernatant fractions and cellular pellet fractions. These T7 supernatant and cellular pellet fractions were also stored at -80°C until further processing and downstream analysis.
[0353] 4. A single target ELISA assay for a-amylase was conducted (see details in the Materials and Methods section) on cell-free supernatant fractions to evaluate the preservation of protein content by BMP-6 (Figure 19A).
[0354] 5. In addition, cellular pellet fractions from both TO and T7 samples were subjected to gDNA extraction using a QIAamp® DNA Mini Kit (Qiagen, Cat. No. 51306), according to manufacturer’s instructions, and eluted in 50 pL of elution buffer or nuclease-free water (NFW). The extracted gDNA was subsequently subjected to qualitative and quantitative analysis (for both human and bacterial DNA) using Genomic DNA ScreenTape (Figure 19B) (Agilent Technologies, Cat. No. 5067-5365) and qPCR analysis (human p-globin qPCR (Figure 19C) and 16S bacterial qPCR (Figure 19D)), respectively (see the Materials and Methods).Table 18: Pre-collection formulation of BMP-6 composition.
[0355] As shown in Figure 19A, the cell-free supernatant fractions from1xPBS-treated oral swab samples (T7 / T0) showed a dramatic loss in a-amylase protein detection, unlike the cell-free supernatant fractions from BMP-6-treated oral swab samples which showed effective preservation of this target protein under similar room temperature (RT) storage conditions.
[0356] Moreover, the profiles of extracted gDNA from cell pellet fractions ofT7 PBS-treated oral swab samples were found to be markedly changed, relative to the corresponding TO PBS-treated samples. Representative profiles for samples from 3 healthy donors (D1-D3) are depicted in Figure19B. Importantly, the profiles of extracted gDNA from cell pellet fractions of BMP-6-treated oral swab samples remained similar between TO and T7 timepoints (Figure 19B) for all donors.
[0357] Finally, qPCR analysis (human p-globin qPCR (Figure 19C) and bacterial 16S qPCR (Figure 19D) was conducted on gDNA extracted from cell pelletfractions prepared from oral swab samples treated with PBS or BMP-6 and stored at RT for 7 days. Human p-globin qPCR analysis and 16S qPCR analysis of BMP-6- treated samples showed relatively unchanged values for “ACt” = [Ct(T7)-Ctcro)], compared to PBS-treated samples which showed more variable changes with either an increase or a decrease in gDNA content across different donors. Taken together, the present composition showed that multiple analytes are preserved in this biological sample, emphasizing its utility in multi-omics applications.
[0358] Example 20: Preservation of protein post-translational modifications(PTMs) in blood and saliva samples stored in the present composition at room temperature for prolonged periods.
[0359] In this example, a series of experiments were conducted to evaluate the ability of the present compositions, namely BMP-3, BMP-5, and BMP-7, to preserve PTMs of key proteins or biomarkers in biological samples. Specifically, the preservation of human phosphorylated microtubule-associated protein Tau (pMAPT / pTAU) was assessed in blood and saliva samples.
[0360] In neurons, Tau protein functions to promote tubulin polymerization and stabilize microtubules of the cytoskeleton. Hyperphosphorylation of Tau, forming pTau, causes pTau to dissociate from microtubules, aggregate intracellularly, and destabilize microtubules, which, in turn, leads to a breakdown of axonal transport, decreases in neurotransmission, and even neuronal apoptosis (Beharry et al., 2014). Neurofibrillary tangles, containing pTau, are found in a range of central nervous system disorders and are thought to result from the breakdown of neuron microtubules.
[0361] Recently, phosphorylated Tau (pTau) has emerged as the leading blood biomarker specific for Alzheimer’s disease (AD) pathology throughout all stages of the disease, including the early asymptomatic phase (Barthelemy et al., 2020). PTau has shown great promise in reflecting amyloid pathology as typically evidenced by cerebrospinal fluid (CSF) analysis or positron emission tomography (PET) scans. Various isoforms of pTau, including pTau181 , pTau217, and pTau235, have been recognized for their ability to identify amyloid-positive individuals. Notably, phosphorylated Tau at threonine 217 (pTau217) has emerged as a superior andreliable biomarker of amyloid positivity, differentiating AD from other neurodegenerative disorders and in detecting AD pathology in patients with mild cognitive impairment (Ashton et al., 2024; Lai et al., 2024). Given that AD can begin 20 years or more before symptom onset, there is a substantial window in which medical interventions may alter disease progression (Barthelemy et al., 2020). Hence, reliable, easily accessible, robust biomarkers are critical for early detection of preclinical AD, to delay or prevent the development of clinical AD, and, ultimately, providing timely access to disease-modifying therapies (Ashton et al., 2024; Lai et al., 2024). In this example, the present composition is shown to preserve both spiked and endogenous pTau proteins in saliva, blood, as well as isolated plasma samples stored at room temperature for prolonged periods.
[0362] In the first experiment, capillary blood was collected from six healthy donors using a fingerprick method. Specifically, fingerprick blood was collected into vials containing EDTA (Sarstedt’s Microvette APT 250 EDTA K2E, Cat. No. 20.1331 .100). Collected blood was pooled and then aliquoted into two different tubes: 1 ) non-treated (EDTA only) or 2) treated with BMP-3 composition in 5:1 ratio (blood: composition). As detailed in the Materials and Methods, plasma was isolated from each tube. 100 pL aliquots of non-treated (EDTA only) plasma and BMP-3-treated plasma samples were spiked with 10 pL of phosphorylated human Tau protein [pT181] Standard (provided at 1 ,000 pg / mL in Invitrogen’s Human Tau [pT181] phosphoELISA™ ELISA Kit, Cat. No. KHO0631). Next, 50 pL aliquots of both nonspiked (NS) and pTaul 81 -spiked (S) plasma samples were stored at -80°C and labeled as TO, while 50 pL aliquots of non-spiked and pTau181-spiked plasma samples were stored at room temperature (RT) for 7 days to obtain T7 samples, followed by storage at -80°C until downstream analysis. Both TO and T7 plasma samples were thawed before carrying out the ELISA assay for pTau181 , as per the manufacturer’s instructions.
[0363] As expected, non-spiked (NS), non-treated (EDTA only) plasma TO and T7 samples showed no detection of pTau181 protein (data not shown), suggesting the specificity of the ELISA assay. However, as shown in Figure 20A, pTaul 81 -spiked (S), non-treated (EDTA only) plasma sample showed an approximate 35% loss in pTau181 protein detection when samples were stored at RT for 7 days, unlikepTau 181 -spiked (S) plasma sample, prepared from whole blood treated with BMP-3 composition, which showed no loss in spiked pTau181 protein under similar storage conditions.
[0364] In the second experiment, venous blood was collected from 3 healthy donors in BD Vacutainer® EDTA tubes (Becton, Dickinson and Company (BD), Cat. No. 366643) by a trained Phlebotomist. The collected whole blood samples were aliquoted and marked as non-treated (EDTA only) samples or treated with BMP- 5 composition in 5:1 ratio (blood: composition). As described in the Materials and Methods, an equal volume aliquot from each of the non-treated (EDTA only) and BMP- 5 treated whole blood samples was processed to obtain plasma samples. Next, these plasma samples were spiked with pTau217 standard protein, provided in Abcam’s Human Tau (phospho T217) ELISA kit (Cat. No. ab318936), at a final concentration of 10 ng / mL. Each of the spiked plasma samples was divided into 2 aliquots. One aliquot from each condition was labeled TO and immediately stored at -80°C, while the second aliquot from each condition was stored at RT for 7 days, followed by storage at -80°C until downstream analysis. Both TO and T7 plasma samples were thawed before carrying out the ELISA assay for pTau217, as per the manufacturer’s instructions.
[0365] As shown in Figure 20B, pTau217-spiked (S), non-treated (EDTA only) plasma samples showed an approximate 62% loss in pTau217 protein detection (median fold change (T7 / T0)=0.38) when stored at RT for 7 days, unlike pTau217- spiked (S) plasma samples, prepared from whole blood treated with BMP-5 composition, which showed effective preservation of spiked pTau217 protein (median fold change (T7 / T0)=0.80) under similar storage conditions.
[0366] In the third experiment, paired venous blood samples from 3 healthy donors were collected by a trained Phlebotomist into BD Vacutainer® EDTA tubes (Cat. No. 366643) and partially evacuated tubes containing BMP-3 composition. In the treated condition, approximately 3.5-3.6 mL of blood was collected into tubes containing about 0.7 mL of BMP-3 composition. At TO or baseline, an aliquot was removed from each tube and processed to obtain plasma as described in the Materials and Methods section. Collected TO plasma samples were stored at -80°C. Tubes containing the remainder of these non-treated and BMP-3-treated blood samples werestored at RT for 7 days. On day 7, another aliquot was removed from each tube, processed to obtain plasma, and these T7 plasma samples were stored at -80°C until analysis.
[0367] Both TO and T7 plasma samples were thawed, and the Human Tau(Phospho) [pS396] ELISA Kit assay was carried out as per manufacturer’s instructions (Thermo Fisher Scientific or Invitrogen, Cat. No. EEL 188). As shown in Figure 20C, endogenous or blood-derived levels of Tau (pS396) protein did not dramatically change (median fold change (T7 / T0)=1 .6) in plasma obtained from whole blood mixed with BMP-3 composition and stored at RT for 7 days, compared to plasma obtained from whole blood that was non-treated (EDTA only) which showed a marked increase in Tau (pS396) protein content (median fold change (T7 / T0)=4.47). This dramatic increase in Tau (pS396) protein in the plasma obtained from non-treated (EDTA only) whole blood samples suggested that protein leaked from compromised blood cells during storage at RT for 7 days.
[0368] In the fourth experiment, paired venous blood from 4 healthy donors was collected by a trained Phlebotomist into BD Vacutainer® EDTA tubes and partially evacuated tubes containing BMP-5 composition. In the treated condition, approximately 7.5 mL of blood was collected into tubes containing about 1.5 mL of BMP-5 composition. At TO, an aliquot of these collected blood samples was processed to obtain plasma samples, as described in the Materials and Methods section, and then stored at -80°C. Tubes containing the remainder of these non-treated (EDTA only) and BMP-5-treated blood samples were stored at RT for 8 days. On day 8, another aliquot was removed from each tube, processed to obtain plasma, and then stored at -80°C until analysis.
[0369] Both TO and T8 plasma samples were thawed, and the Human Tau(Phospho) [pS396] ELISA Kit assay was carried out, as per manufacturer’s instructions. As shown in Figure 20D, endogenous Tau (pS396) protein level did not change (median fold change (T8 / T0)=1.18) in plasma obtained from whole blood mixed with BMP-5 composition and stored at RT for 8 days, compared to plasma obtained from whole blood that was non-treated (EDTA only) which showed a marked increase in endogenous Tau (pS396) protein content (median fold change (T8 / T0)=12.2) under similar test conditions. Again, this dramatic increase in Tau(pS396) protein measured in the plasma obtained from non-treated (EDTA only) whole blood samples suggests that protein leaked from compromised blood cells during storage at RT for 8 days.
[0370] Overall, this series of experiments consistently showed that the present composition, namely BMP-3 and BMP-5, minimized changes in pTau protein levels in chemistry-treated, spiked, isolated plasma or chemistry-treated whole blood samples stored at RT for at least one week, unlike non-treated (EDTA only), spiked plasma or non-treated (EDTA only) whole blood samples which showed either degradation of the exogenous spiked pTau proteins or leakage of endogenous pTau proteins from blood cells under similar storage conditions.
[0371] In a fifth study, saliva samples were collected from different healthy donors (n=4). Each of the collected saliva samples were aliquoted into two different tubes: 1) non-treated (no preservative) or 2) treated with BMP-7 composition in 1 :1 ratio (saliva: composition). Pre-collection and post-collection formulation of BMP-7 is specified in Table 19(i) and 19(H). Next, these saliva samples were spiked with pTau217 standard protein, provided in Abcam’s Human Tau (phospho T217) ELISA kit (Cat. No. ab318936), at a final concentration of 10 ng / mL. Each spiked saliva sample was divided into 2 aliquots. One aliquot from each condition was labeled TO and processed immediately by centrifugation at 3000 x g for 10 minutes at 4°C and the cell-free supernatant was isolated and stored at -80°C, while the second aliquot from each condition was stored at RT for 2 days, followed by processing to generate cell-free supernatant which was isolated and stored at -80°C until downstream analysis. Both TO and T2 cell-free supernatant samples were thawed before carrying out the ELISA assay for pTau217, as per the manufacturer’s instructions.
[0372] As shown in Figure 20E, pTau217-spiked (S), no preservative saliva cell-free supernatant samples showed an approximate 80% loss in pTau217 protein detection (median fold change (T7 / T0)=0.20) when stored at RT for 2 days, unlike pTau217-spiked (S) cell-free supernatant samples, prepared from saliva treated with BMP-7 composition, which showed effective preservation of spiked pTau217 protein (median fold change (T7 / T0)=0.70) under similar storage conditions.Table 19(i): Pre-collection formulation of BMP-7 composition.Table 19(ii): Post-collection formulation of BMP-7.
[0373] Example 21 : Preservation of protein in urine samples treated with lyobeads comprising the present composition and stored at room temperature for 7 days.
[0374] The present composition can be prepared and utilized in a liquid state, such as an aqueous composition, or in a solid / dry state. Depending on the circumstances, drying, spray-drying, or lyophilizing the present composition may prove beneficial. Dried compositions are particularly useful if one is trying to minimize the dilution of a collected biological sample and importantly its analytes upon mixture with the preservative. Blood, and particularly urine, are prime examples of biological samples typically collected in large volumes for a variety of reasons, includingdiagnostic tests, that would benefit from the use of a dried or lyophilized preserving composition.
[0375] For this study, BMP-3 liquid composition was provided to a third party to produce lyophilized reagent beads or lyobeads (Lyo_BMP-3) which involved the use of liquid nitrogen to freeze droplets of BMP-3 which were then freeze-dried to remove the water. Next, random first-void urine (FVU) samples were collected from 4 healthy female donors using empty Colli-Pee™ 10 mL devices (DNA Genotek, Inc., Cat. No. N00309_RUO). Each FVU sample was aliquoted and split between two conditions: 1) non-treated and 2) BMP-3 lyobead-treated, wherein FVU samples were mixed with BMP-3 lyobeads as described above (1 lyobead per -100 pL of urine sample). The estimated concentrations of compounds, after BMP-3 lyobeads were dissolved in first void urine samples, were:
[0376] Sodium acetate trihydrate: 375 mM
[0377] EGTA: 25 mM
[0378] Trehalose dihydrate: 5.0% (w / v)
[0379] Citric acid: 0.35% (w / v)
[0380] L-Histidine monohydrochloride monohydrate: 4.2 % (w / v)
[0381] Protease Inhibitor Cocktail: 0.5X
[0382] Both non-treated and BMP-3lyobead-treated urine samples were spiked with SARS-CoV2 Nucleocapsid Protein (NP) at an approximate final concentration of 20 pg / mL. Next, these spiked urine samples were further divided into two aliquots. The first aliquot was processed immediately by centrifugation at 3000 x g for 10 minutes at 4°C and the pre-cleared supernatant was isolated, labeled TO, and stored at -80°C. The second aliquot of the NP-spiked non-treated and BMP-3 lyobead- treated urine samples was stored at RT for 7 days. At T7, these aliquots were also processed by centrifugation (see above) to obtain pre-cleared supernatant which was isolated and stored at -80°C until analysis. Both TO and T7 pre-cleared supernatant isolates were thawed before carrying out the SARS-CoV2 Nucleocapsid Protein ELISA Kit assay, as described in the Materials and Methods.
[0383] As shown in Figure 21 , a dramatic loss of spiked NP (median fold change =0.37) was observed in pre-cleared supernatants obtained from non-treatedFVU samples stored at RT for 7 days. In contrast, little to no loss of spiked NP (median fold change=1.1) was observed in pre-cleared supernatants obtained from BMP-3 lyobead-treated FVU samples after RT storage for 7 days, compared to non-treated FVU samples (as shown in Figure 21). It is to be noted that the extent of loss of spiked NP in non-treated FVU samples was found to be donor dependent.
[0384] Example 22: Preservation of cfDNA in the plasma samples prepared from whole blood treated with the present composition and stored at room temperature for 7 days.
[0385] In this study, venous blood samples from 5 healthy donors were collected by a trained Phlebotomist into BD Vacutainer® EDTA tubes (Cat. No. 366643). Each collected blood sample was split between two conditions: 1) nontreated (EDTA only) or2) BMP-3-treated in 5:1 ratio (Blood: BMP-3). At TO or baseline, an aliquot was removed from each tube and processed to obtain plasma samples as described in the Materials and Methods. Collected TO plasma samples were stored at -80°C. Tubes containing the remainder of these non-treated and BMP-3-treated blood samples were stored at RT for 7 days. On day 7, another aliquot was removed from each tube, processed to obtain plasma, and these T7 plasma samples were stored at -80°C until analysis. On the day of processing, both TO and T7 cell-free plasma samples were thawed, and cell-free nucleic acid was purified using the QIAamp® Circulating Nucleic Acid Kit (Qiagen, Cat. No. 55114). CfDNA content and quality analysis was performed using a p-globin qPCR assay and TapeStation analysis using HSD5000 tapes, respectively, as described in the Materials and Methods.
[0386] As shown in Figure 22A, cell-free plasma prepared from T7 nontreated (EDTA only) blood samples showed marked increases in cfDNA content, as indicated by dramatic decreases in Ct values (median: 24.17) relative to Ct values for cell-free plasma samples prepared from TO non-treated (EDTA only) blood samples (median: 33.20) for p-globin cfDNA. In stark contrast, plasma prepared from BMP-3- treated whole blood samples showed effective cfDNA preservation with median TO and T7 Ct values of 34.13 and 32.84, respectively, under similar storage conditions (Figure 22A). The dramatic increase in cfDNA content in the plasma obtained from non-treated (EDTA only) whole blood samples suggests that apoptotic genomic DNA leaked from compromised blood cells during storage at RT for 7 days.
[0387] Moreover, the profiles of extracted nucleic acid from plasma prepared from T7 non-treated (EDTA only) blood samples were found to be markedly changed, relative to the corresponding TO samples (Figure 22B). Non-treated (EDTA only) T7 plasma samples showed the presence of leaked apoptotic genomic DNA from blood cells undergoing programmed cell death under these tested RT storage conditions. Representative profiles for samples from 3 donors (D1-D3) are depicted in Figure 22B. Importantly, the profiles of extracted nucleic acid from plasma prepared from BMP-3-treated whole blood samples remained similar between TO and T7 timepoints (Figure 22B) across different donors.
[0388] Example 23: Dipeptides can be utilized as stabilizing agents in the present composition.
[0389] In addition to utilizing the above-described stabilizing proteins, peptides, and amino acids in the present composition, dipeptides have also proven beneficial for the preservation of analytes in biological samples, including blood. For demonstration purposes, L-carnosine was utilized as the stabilizing agent in the present composition (i.e. BMP-8). L-carnosine is a naturally occurring dipeptide molecule composed of the amino acids p-alanine and L-histidine.
[0390] In this example, capillary blood was collected using the fingerprick method from individual healthy donors (n=9) in Microvette® APT 250 EDTA K2E (Sarstedt Inc., Cat. No. 20.1331.100) and then pooled to generate a single capillary blood sample. This pooled blood sample (EDTA only) was split between two tubes. One tube was left non-treated (EDTA only) and the sample in the second tube was treated with BMP-8 composition (blood: composition ratio of 1 :0.2). Pre-collection and post-collection formulation of BMP-8 is provided in Table 20 (i and ii). An aliquot of non-treated (EDTA only) and BMP-8-treated blood was processed for plasma preparation (see Materials and Methods) on the day of blood collection (TO). These baseline or TO plasma samples were stored at -80°C until further processing and downstream analysis. The remaining samples of non-treated (EDTA only) and BMP- 8-treated whole blood samples were stored at room temperature for 7 days. On Day 7, like TO samples, T7 aliquots of non-treated (EDTA only) and BMP-8-treated blood samples were processed for plasma preparation. An ELISA assay for Epidermal Growth Factor (EGF) was conducted (see Materials and Methods) to assess thestability of protein in the plasma fraction of blood samples treated with BMP-8 and stored at RT for prolonged periods.
[0391] As shown in Figure 23A, plasma prepared from the T7 aliquot of non-treated (EDTA only) blood showed a drastic increase in EGF protein content, indicating leakage of proteins from blood cells during this 7-day storage at room temperature. In contrast, plasma prepared from BMP-8-treated blood samples showed relatively small changes in protein content over time (Figure 23A). This data demonstrates that dipeptides, such as L-carnosine, can be utilized as stabilizing agents in the present composition which effectively minimizes protein leakage from cells in whole blood samples treated with the present composition and stored for 7 days at RT.Table 20(i): Pre-collection formulation of BMP-8 composition.Table 20(H): Post-collection formulation of BMP-8 composition after mixture with whole blood (Blood: BMP-8 ratio is 1 :0.2).
[0392] In another study, venous blood was collected from 3 healthy donors in BD Vacutainer® EDTA tubes (Becton, Dickinson and Company (BD), Cat. No. 366643) by a trained Phlebotomist. The collected blood samples were processed toprepare plasma within 1 hour of collection via two-step centrifugation as described in the Materials and Methods. Plasma samples were either left non-treated (EDTA only) or treated with BMP-8 composition in 5:1 ratio (blood: composition). Pre-collection and post-collection formulation of BMP-8 is shown above in Table 20 (i and ii). Next, these plasma samples were spiked with pTau217 standard protein, provided in Abcam’s Human Tau (phospho T217) ELISA kit (Cat. No. ab318936), at a final concentration of 10 ng / mL. Each of the spiked plasma samples was divided into 3 aliquots. One aliquot from each condition was labeled TO and immediately stored at -80°C, while the second and third aliquots were labeled as T3 and T7 and stored at RT for 3 days and 7 days, respectively, followed by storage at -80°C until downstream analysis. All TO, T3 and T7 plasma samples were thawed before carrying out the ELISA assay for pTau217, as per the manufacturer’s instructions.
[0393] As shown in Figure23B, pTau217-spiked (S), non-treated (EDTA only) plasma samples showed an approximate 45% and 53% loss in pTau217 protein detection [median fold change (T3 / T0)=0.55; (T7 / T0)= 0.47] when stored at RT for 3 and 7 days, respectively, unlike pTau217-spiked (S) plasma samples treated with BMP-8 composition, which showed effective preservation of spiked pTau217 protein [median fold change (T3 / T0)=0.89; (T7 / T0)= 0.96] under similar storage conditions.
[0394] Example 24: Inhibition of phosphatase activity in plasma isolated from whole blood samples treated with the present composition and stored at room temperature for prolonged periods.
[0395] Protein phosphorylation is the addition of a phosphate group to a protein, a reversible process that acts like a molecular switch to regulate a protein's function, activity, location, or interactions which can, in turn, impact cell signaling and numerous cellular processes like cell division, growth, and metabolism. Because phosphate groups are highly negatively charged, phosphorylation of a protein alters its charge, which can then alter the conformation of the protein and ultimately its functional activity. Phosphorylation is carried out by enzymes called protein kinases and is reversed by protein phosphatases. In blood, for example, protein phosphatases, like alkaline phosphatase (ALP), acid phosphatase, protein phosphatase 1 (PP1), protein phosphatase 2A (PP2A), calcineurin (PP2B), and protein tyrosine phosphatases (PTPs) are responsible for dephosphorylating phosphoproteinsinvolved in critical signaling pathways. Common phosphatase inhibitors, including sodium fluoride, sodium orthovanadate, sodium pyrophosphate, and p- glycerophosphate can be used to control the activity of phosphatases and maintain the phosphorylation state of proteins needed for important biological functions.
[0396] In the first experiment, venous blood was collected from2 healthy donors in BD Vacutainer® EDTA tubes (Becton, Dickinson and Company (BD), Cat. No. 366643) by a trained Phlebotomist. The collected blood samples were aliquoted and marked as non-treated (EDTA only) samples or treated with BMP- 9 composition in 5:1 ratio (blood: composition). Pre-collection and post-collection formulation of BMP-9 is shown in Table 21 (i and ii). One aliquot from each condition was labeled TO, while the second and third aliquots were labeled as T3 and T7 from each condition and stored at RT for 3 days and 7 days, respectively. As described in the Materials and Methods, an equal volume aliquot from each of the non-treated (EDTA only) and BMP-9-treated whole blood samples was processed to obtain plasma samples. These baseline or TO plasma samples were stored at -80°C. On day 3 and 7, T3 and T7 whole blood sample aliquots were processed to obtain plasma samples, followed by storage at -80°C until downstream analysis. Both TO and T7 plasma samples were thawed before carrying out the EnzChek™ Phosphatase Assay (Thermo Fisher Scientific, Cat. No. E12020) as per the manufacturer’s instructions (see Materials and Methods for details).Table 21 (i): Pre-collection composition of BMP-9.Table 21 (ii): Post-collection composition of BMP-9 after mixing with whole blood.
[0397] As shown in Figure 24A, an increase in phosphatase activity is observed in plasma collected from non-treated (EDTA only) whole blood samples at both T3 and T7, while no increase in phosphatase activity was observed in plasma samples prepared from whole blood treated with BMP-9 composition, indicating that BMP-9 effectively prevented the activity of phosphatase enzymes like acid phosphatase, protein phosphatase 1 , and protein phosphatase 2A. One possible explanation for this could be that BMP-9 prevents both cellular leakage of phosphatases as well as controls enzyme activity in the plasma collected from whole blood samples stored at RT for 3 and 7 days. Baseline data for EDTA_T0 is included in the graph and falls in the same range as BMP-9 data.
[0398] In the second experiment, venous blood was collected from3 healthy donors in BD Vacutainer® EDTA tubes (Becton, Dickinson and Company (BD), Cat. No. 366643) by a trained Phlebotomist. The collected blood samples were aliquoted and marked as non-treated (EDTA only) samples, treated with BMP-10 composition, or treated with BMP-11 composition in 5:1 ratio (blood: composition).Pre-collection and post-collection formulation of BMP-10 and BMP-11 is shown in Tables 21 (iii), (iv), (v) and (vi), respectively. One aliquot from each condition was labeled TO, while the second aliquot was labeled T3 from each condition and stored at RT for 3 days. As described in the Materials and Methods, an equal volume aliquot from each of the non-treated (EDTA only), BMP-10-treated, or BMP-11 -treated whole blood samples was processed to obtain plasma samples (see Materials and Methods). These baseline or TO plasma samples were stored at -80°C. On day 3, T3 whole blood sample aliquots were processed to obtain plasma samples, followed by storage at -80°C until downstream analysis. Both TO and T3 plasma samples were thawed before carrying out the EnzChek™ Phosphatase Assay (Thermo Fisher Scientific, Cat. No. E12020) as per the manufacturer’s instructions (see Materials and Methods for details).Table 21 (iii): Pre-collection composition of BMP-10.Table 21 (iv): Post-collection composition of BMP-10 after mixing with whole blood.Table 21 (v): Pre-collection composition of BMP-11.Table 21 (vi): Post-collection composition of BMP-11 after mixing with whole blood.
[0399] As shown in Figures 24B and 24C, an increase in phosphatase activity is observed in plasma collected from non-treated (EDTA only) whole blood samples after storage at RT for 3 days (T3), while no increase in phosphatase activity was observed in plasma samples prepared from whole blood treated with BMP-10 or BMP-11 composition, indicating that BMP-10 and BMP-11 effectively prevented the activity of phosphatase enzymes like acid phosphatase, protein phosphatase 1 , and protein phosphatase 2A.
[0400] Example 25: Preservation of cellular DNA and cell-free DNA in venous blood samples treated with the present composition and stored at room temperature for 7 days.
[0401] Total (cellular) DNA
[0402] To assess the quality of total DNA in whole blood samples after storage at room temperature (RT) for 7 days, venous blood samples were collected from each healthy donor (n=8) into 1) a BD Vacutainer® EDTA tube (Becton, Dickinson and Company (BD), Cat. No. 366643) and 2) a partially-evacuated blood tube containing BMP-5 (ratio of blood: BMP-5 was 1 :0.2), by a trained Phlebotomist. Each blood tube was mixed by gentle inversion and then two 500 pL samples were immediately taken from each tube. Total DNA was immediately extracted at TO from one sample, while the second sample was stored at RT for 7 days prior to DNA extraction. Essentially, at TO and T7, the samples were mixed by gentle inversion and then duplicate 200 pL aliquots were extracted using a QIAamp® DNA Mini Kit (Qiagen, Cat. No. 51306), according to manufacturer’s “DNA Purification from Blood or Body Fluids (Spin Protocol),” and total DNA was eluted in 200 pL of buffer (Buffer AL). Thequality of the extracted DNA was assessed using an Agilent 4200 TapeStation System and Genomic DNA ScreenTape (Agilent Technologies, Cat. No. 5067-5365) with Genomic DNA Reagents (Agilent Technologies, Cat. No. 5067-5366), according to the manufacturer’s instructions.
[0403] As shown in Figure 25A, the integrity of the DNA, analyzed by theTapeStation System, was maintained in venous blood samples treated with BMP-5 and stored at RT for 7 days. In contrast, there were visible signs of DNA degradation in non-treated (EDTA only) blood samples stored for 7 days at RT. Specifically, there was a decrease in the size and intensity of the large DNA peak, as well as evidence of apoptotic laddering of DNA extracted from non-treated (EDTA only) blood samples after 7 days (see Figure 25A). During apoptosis, chromosomal DNA in cells is fragmented by endonucleases at nucleosome sites resulting in nucleosomal oligomers in multiples of 180-200 base pairs in length. This fragmented DNA was observed in all non-treated (EDTA only) blood samples at T7.
[0404] The profiles of extracted nucleic acid, predominantly genomic DNA, from non-treated (EDTA only) blood samples stored at RT for 7 days were found to be markedly changed, relative to the corresponding TO samples (Figure 25B). Nontreated (EDTA only) T7 blood samples showed the presence of apoptotic DNA undergoing programmed cell death under these tested RT storage conditions. This characteristic laddering is visible in the profiles as smaller, regular DNA fragments in T7 samples. Representative profiles for DNA extracted from venous blood samples obtained from 3 donors (D1 , D5 and D8) are depicted in Figure 25B. Importantly, the profiles of extracted DNA from BMP-5 treated blood samples remained similar between TO and T7 timepoints (Figure 2) across different donors and there was no evidence of apoptotic ladders.
[0405] Cell-free DNA
[0406] In a separate study, venous blood samples were collected from each healthy donor (n=5) into 1) a BD Vacutainer® EDTA tube (Becton, Dickinson and Company (BD), Cat. No. 366643) and 2) a partially-evacuated blood tube containing BMP-5 (ratio of blood: BMP-5 was 1 :0.2), by a trained Phlebotomist. Each tube was mixed by gentle inversion and immediately transferred to the laboratory for processing. At TO or baseline, an aliquot was removed from each tube and processed to obtainplasma samples as described in the Materials and Methods. Collected TO plasma samples were stored at -80°C. Tubes containing the remainder of these non-treated (EDTA only) and BMP-5 treated blood samples were stored at RT for 7 days. On day 7 (T7), another aliquot was removed from each tube, processed to obtain plasma, and these T7 plasma samples were stored at -80°C until analysis. On the day of processing, both TO and T7 cell-free plasma samples (1 mL each) were thawed, and cell-free nucleic acid was purified in duplicate using the QIAamp® Circulating Nucleic Acid Kit (Qiagen, Cat. No. 55114). A human p-globin qPCR assay was performed with this extracted nucleic acid to determine cfDNA quantity, while cfDNA quality was assessed using TapeStation analysis and Cell-free DNA ScreenTape (Agilent Technologies, Cat. No. 5067-5630), as described in the Materials and Methods.
[0407] As shown in Figure 25C, plasma prepared from T7 non-treated(EDTA only) blood samples showed marked increases in cfDNA content, as indicated by a dramatic decrease in p-globin DNA Ct values (median: 25.3), relative to p-globin DNA Ct values for plasma samples prepared from non-treated (EDTA only) blood samples at TO (median: 31.4). In contrast, plasma prepared from BMP-5 treated venous blood samples showed effective cfDNA preservation with median TO and T7 Ct values of 34.1 and 32.8, respectively, under similar storage conditions (Figure 25C). The dramatic increase in cell-free DNA content in the plasma obtained from nontreated (EDTA only) venous blood samples suggested that apoptotic genomic DNA leaked into the cell-free space from compromised blood cells undergoing programmed cell death during storage at RT for 7 days.
[0408] Moreover, the profiles of extracted nucleic acid from plasma prepared from T7 non-treated (EDTA only) blood samples were found to be markedly changed, relative to the corresponding TO samples (Figure 25D). Plasma from nontreated (EDTA only) samples at T7 showed the clear presence of leaked apoptotic genomic DNA (i.e. , the DNA ladder effect) from blood cells undergoing programmed cell death under prolonged RT storage conditions. Representative profiles for samples from 3 donors (D6, D7, and D10) are depicted in Figure 25D. Importantly, the profiles of extracted cfDNA from plasma prepared from BMP-5 treated venous blood samples remained similar between TO and T7 timepoints (Figure 25D) across different donors with no evidence of DNA ladders. The present composition controlled the significantgenomic DNA release from cells observed in venous blood samples stored in EDTA tubes.
[0409] Note, the scale of sample intensity (FU) depicted on the y-axes of these profiles differs between non-treated (EDTA only) blood samples and BMP-5 treated blood samples to facilitate visualization of large amounts of fragmented genomic DNA recovered from the plasma of non-treated (EDTA only) blood samples after 7 days storage. In addition, due to the larger scale of the y-axis required to illustrate results for non-treated (EDTA only) samples after 7 days, the profiles of DNA extracted from the plasma of non-treated (EDTA only) samples at TO were largely masked by the x-axis.
[0410] Example 26: Preservation of cellular RNA in saliva samples treated with the present composition and stored at 37°C for 3 days.
[0411] In this study, each healthy donor (n=3) was recruited to collect a saliva sample by spitting into an empty tube with a fill-to line. Donors were asked to not eat or drink for 30 minutes prior to sample collection. Each collected saliva sample was divided into two tubes. One tube was marked non-treated (NA) and no preservative or reagent was added to the saliva, while BMP-6 composition was added to the second tube containing saliva in a 1 :1 ratio (saliva: composition) and mixed. Pre-collection and post-collection formulation of BMP-6 is shown in Table 22 (i and ii). One aliquot from each condition was labeled TO, while the second aliquot from each condition was labeled T3 and stored at 37°C for 3 days.
[0412] At TO and T3, an aliquot from each of the non-treated (NA) andBMP-6-treated saliva samples was processed to obtain cellular pellets (see Materials and Methods). Each cellular pellet was resuspended in 250 pL 1 xPBS, mixed with 750 pL TRI Reagent® LS (Sigma-Aldrich, Cat. No. T3934) and then stored at -80°C until RNA extraction and quantification using RT-qPCR analysis (see Materials and Methods).Table 22(i): Pre-collection formulation of BMP-6 composition.Table 22(H): Post-collection formulation of BMP-6 composition mixed with saliva samples in 1 :1 ratio.
[0413] As shown in Figure 26, the cells obtained from non-treated (NA) saliva samples showed an approximate 62% loss in cellular RNA as indicated by an increase in Ct values (median value: 30.5) in T3 samples relative to TO samples Ct values (median: 29.1 ) for human GAPDH RNA detection when non-treated (NA) saliva samples were stored at 37°C for 3 days. In contrast, BMP-6-treated saliva samples showed effective cellular RNA preservation with median TO and T7 Ct values of 29.8 and 29.7, respectively, under similar storage conditions (Figure 26).
[0414] Example 27: Stabilization of different classes of proteins by the present composition.
[0415] In this study, paired venous blood was collected from healthy participants (n=5) by a trained Phlebotomist into a BD Vacutainer® EDTA tube (Cat. No. 366643) and a partially evacuated tube filled with BMP-5 composition (ratio of blood: BMP-5 was 1 :0.2) following standard blood collection procedures. Samples were mixed gently by inversion and transferred immediately to the laboratory for processing. Within 30 minutes of collection, whole blood from each BMP-5 tube was divided into equal volume aliquots, one for each timepoint (T=0, T=5 hours, T=3 days, T=5 days, T= 7 days). Plasma was immediately isolated from the T=0 aliquots by centrifugation at 1900 x g for 15 minutes at 4°C and frozen at -80°C until analysis. The remaining aliquots were stored at room temperature (RT), and plasma was isolated and frozen as above at the respective timepoints. For EDTA-collected tubes, the plasma was isolated from T=0 and T=5 hours timepoints (to mimic the standard processing time within a few hours of collection). The isolated plasma samples from EDTA tubes were also kept frozen.
[0416] Once plasma was isolated from T7 day aliquots, all frozen plasma aliquots were sent to an external service provider for the Illumina Protein Prep Assay. The assay was conducted in an automated fashion according to the manufacturer’s instructions for use. Primary sequence analysis was performed on the NovaSeq X System. Secondary sequencing analysis was performed using the DRAGEN Protein Quantification pipeline. Illumina Connected Multi-omics was used to calculate the sequencing read count fold change for each protein target (tertiary analysis) across timepoints against matched chemistry (EDTA or BMP-5) T=0. A Holm-Sidak error correction was used to get adjusted p-values for each protein above LOD reported in the Illumina Connected Multi-omics pipeline. Figure 27 shows data for a subset of proteins potentially involved in various biological relevant pathways.
[0417] As shown in Figure 27, plasma isolated from whole blood treated with BMP-5 composition showed no significant changes (adjusted p-value > 0.05) in the content of representative proteins over a course of storage up to 7 days at RT. Data from the Illumina Protein Prep Assay (not shown) reflected that approximately 99% of target proteins did not significantly change in the plasma isolated from whole blood mixed with BMP-5 composition and stored for 7 days. Further data analysissuggested that more than 95% of the proteins involved in multiple disease pathways (e.g., cytokine, respiratory, cardiovascular, metabolic, neurological, inflammation & immune, and oncology) were found to be stable in the plasma obtained from whole blood mixed with BMP-5 composition and stored at RT for up to 7 days (data not shown).
[0418] This data, along with data presented in the earlier examples on targeted proteins like IL-8, OLR1 , EGF, Complement C3 protein, a-amylase, Clink T48 Cytokine Panel data and 100-plex Somalogic SomaScan Assay data, indicate that the present composition stabilizes different classes of proteins, including cytokines, enzymes, complement factors and many proteins known to be involved in different biological pathways.
[0419] References
[0420] Aguilar-Mahecha A, Kuzyk MA, Domanski D, Borchers CH, Basik M.(2012) The effect of pre-analytical variability on the measurement of MRM-MS-based mid- to high-abundance plasma protein biomarkers and a panel of cytokines. PLoS One 7: e38290.
[0421] Ahram M & Petricoin EF. (2008) Proteomics discovery of disease biomarkers. Biomarker Insights 6(3): 325-333.
[0422] Anderson NL & Anderson NG. (2002) The human plasma proteome: history, character, and diagnostic prospects. Mol Cell Proteomics 1 : 845-867.
[0423] Assarsson E, Lundberg M, Holmquist G, Bjdrkesten J, BuchtThorsen SB, Ekman D, Eriksson A, Rennel Dickens E, Ohlsson S, Edfeldt G, Andersson A-C, Lindstedt P, Stenvang J, Gullberg M, Fredriksson S. (2014) Homogenous 96-plex PEA immunoassay exhibiting high sensitivity, specificity, and excellent scalability. PLOS ONE 9(4): e95192.
[0424] Atkinson J, Colburn WA, DeGruttola VG, DeMets DL, Downing GJ,Hoth DF, Oates JA, Peck CC, Schooley RT, Spilker BA, Woodcock J, ZegerSL. (2001) Biomarkers and surrogate endpoints: preferred definitions and conceptual framework. Clin Pharmacol Ther 69(3): 89-95.
[0425] Bhagirath D, Abrol N, Khan R, Sharma M, Seth A, Sharma A, (2012)Expression of CD147, BIGH3 and Stathmin and their potential role as diagnostic marker in patients with urothelial carcinoma of the bladder. Clin Chim Acta 413: 1641- 1646.
[0426] Boschetti E, D’ Amato A, Candiano G, Righetti PG. (2017) Protein biomarkers for early detection of diseases: The decisive contribution of combinatorial peptide ligand libraries (Accepted manuscript). J Proteomics, 188: p. 1-14. Doi: 10.1016 / j.jprot.2017.08.009.
[0427] Chen R, Jin G, Li W, McIntyre TM. (2018) Epidermal growth factor(EGF) autocrine activation of human platelets promotes EGF receptor-dependent oral squamous cell carcinoma invasion, migration, and epithelial mesenchymal transition. J Immunol 201 (7): 2154-2164.
[0428] Comes AL, Papiol S, Mueller T, Geyer PE, Mann M, Schulze TG.(2018) Proteomics for blood biomarker exploration of severe mental illness: Pitfalls of the past and potential for the future. Translational Psychiatry 8: 160. [DOI 10.1038 / s41 398-018-0219-2],
[0429] Dayon L, Nunez Galindo A, Cominetti O, Corthesy J, Kussmann M.(2017) A highly automated shotgun proteomic workflow: clinical scale and robustness for biomarker discovery in blood. Methods Mol Biol 1619: 433-449.
[0430] Ebbing J, Mathia S, Seibert FS, Pagonas N, Bauer F, Erber B,Gunzel K, Kilic E, Kemp ken steffen C, Miller K, Bachmann A, Rosenberger C, Zidek W, Westhoff TH. (2014) Urinary calprotectin: a new diagnostic marker in urothelial carcinoma of the bladder. World J Urol 32(6): 1485-1492.
[0431] Graves PR & Haystead TAJ. (2011) Molecular biologist’s guide to proteomics. Microbiol Mol Biol Rev 66(1): 39-63.
[0432] Hassis ME, Niles RK, Braten MN, Albertolle ME, Witkowska E,Hubei CA, Fisher SJ, Williams KE. (2015) Evaluating the effects of preanalytical variables on the stability of the human plasma proteome. Anal Biochem 478: 14-22.
[0433] Ignjatovic V, Geyer PE, Palaniappan KK, Chaaban JE, Omenn GS,Baker MS, Deutsch EW, Schwenk JM. (2019) Mass spectrometry-based plasma proteomics: Considerations for sample collection to achieving translational data. J Proteome Res 18(12): 4085-4097.
[0434] Insenser M, Martinez-Garcia M, Nieto RM, San-Millan JL, Escobar-Morreale HF. (2010) Impact of the storage temperature on human plasma proteomic analysis: implications for the use of human plasma collections in research. Proteomics Clin Appl 4: 739-744.
[0435] Jedinak A, Curatolo A, Zurakowski D, Dillon S, Bhasin MK,Libermann TA, Roy R, Sachdev M, Loughlin KR, Moses MA. (2015) Novel non- invasive biomarkers that distinguish between benign prostate hyperplasia and prostate cancer. BMC Cancer 15: 259.
[0436] Jewell SD, Srinivasan M, McCart LM, Williams N, Grizzle WH,LiVolsi V, MacLennan G, Sedmak DD. (2002) Analysis of the molecular quality of human tissues: an experience from the Cooperative Human Tissue Network. Am J Clin Pathol 118: 733-741.
[0437] Kaczor-Urbanowicz KE, Carreras-Presas CM, Aro K, Tu M, Garcia-Godoy F, Wong DTW. (2017) Saliva diagnostics - Current views and directions. Exp Biol Med 242: 459-472.
[0438] Lee SW, Lee H-Y, Bang HJ, Song H-J, Kong SW, Kim Y-M. (2019)An improved prediction model for ovarian cancer using urinary biomarkers and a novel validation strategy. Int J Mol Sci 20: 4938.
[0439] Lee Y-H & Wong DT. (2009) Saliva: an emerging biofluid for early disease detection. Am J Dent 22(4): 241-248.
[0440] Li Q, Ouyang X, Chen J, Zhang P, Feng Y. (2020) A review on salivary proteomics for oral cancer screening. Curr Issues Mol Biol 37: 47-56.
[0441] Loo JA, Yan W, Ramachandran P, Wong DT. (2010) Comparative human salivary and plasma proteomes. J Dent Res 89: 1016-1023.
[0442] Marshall J, Kupchak P, Zhu W, Yantha J, Vrees T, Furesz S, JacksK, Smith C, Kireeva I, Zhang R, Takahashi M, Stanton E, Jackowski G. (2003) Processing of serum proteins underlies the mass spectral fingerprinting of myocardial infarction. J Proteome Res 2: 361-372.
[0443] Matthews S. (2018) Life-saving 'urine-stick' test for early ovarian cancer could boost survival rates to 90 per cent. MailOnline https: / / www.dailymail.co.uk / health / article-6155745 / A-urine-test-detect-ovarian- cancer.html.
[0444] Morrissey JJ, London AN, Luo J, Kharasch ED (2010) Urinary biomarkers for the early diagnosis of kidney cancer. Mayo Clin Proc 85(5): 413-4 21.
[0445] Morrissey JJ and Kharasch ED. (2013) The specificity of urinary aquaporin-1 and adipophilin to screen for renal cell carcinoma. J Urol 189(5): 1913- 1920.
[0446] Morrissey JJ, Mobley J, Song J, Vetter J, Luo J, Bhayani S,Figenshau RS, Kharasch ED (2014) Urinary concentrations of aquaporin-1 and perilipin-2 in patients with renal cell carcinoma correlate with tumor size and stage but not grade. Urology 83(1): 256.e9-e14.
[0447] Ogawa Y, Kanai-Azuma M, Akimoto Y, Kawakami H, Yanoshita R.(2008) Exosome-like vesicles with dipeptidyl peptidase IV in human saliva. Biol Pharm Bull 31 (6): 1059-1062.
[0448] Orenes-Pinero E, Corton M, Gonzalez-Peramato P, Algaba F, CasalI, Serrano A, Sanchez-Carbayo M, (2007) Searching urinary tumor markers for bladder cancer using a two-dimensional differential gel electrophoresis (2D-DIGE) approach. J Proteome Res 6(11): 4440-4448.
[0449] Payne K, Brooks J, Spruce R, Batis N, Taylor G, Nankivell P,Mehanna H. (2019) Circulating tumour cell biomarkers in head and neck cancer: current progress and future prospects. Cancers 11 : 1115.
[0450] Payne K, Brooks J, Batis N, Khan N, El-Asrag M, Nankivell P,Mehanna H, Taylor G. (2023) Feasibility of mass cytometry proteomic characterizationof circulating tumour cells in head and neck squamous cell carcinoma for deep phenotyping. British J Cancer 129: 1590-1598.
[0451] Pisitkun T, Shen R-F, Knepper MA. (2004) Identification and proteomic profiling of exosomes in human urine. PNAS 101 (36): 13368-13373.
[0452] Rai AJ, Gelfand CA, Haywood BC, Warunek DJ, Yi J, SchuchardMD, Mehigh RJ, Cockrill SL, Scott GB, Tammen H, Schulz-Knappe P, Speicher DW, Vitzthum F, Haab BB, Siest G, Chan DW. (2005) HUPO Plasma Proteome Project specimen collection and handling: towards the standardization of parameters for plasm proteome samples. Proteomics 5: 3262-3277.
[0453] Randall SA, McKay MJ, Baker MS, Molloy MP. (2010) Evaluation of blood collection tubes using selected reaction monitoring MS: implications for proteomic biomarker studies. Proteomics 10: 2050-2056.
[0454] Reza KK, Dey S, Wuethrich A, Wang J, Behren A, Antaw F, WangY, Sina AAI, Trau M. (2021) In situ single cell proteomics reveals circulating tumor cell heterogeneity during treatment, ACS Nano 15: 11231-11243.
[0455] Schostak M, Schwall GP, Poznanovic S, Groebe K, Muller M,Messinger D, Miller K, Krause H, Pelzer A, Horninger W, Klocker H, Hennenlotter J, Feyerabend S, Stenzi A, Schrattenholz A. (2009) Annexin A3 in urine: a highly specific noninvasive marker for prostate cancer early detection. J Urol 181 : 343-353.
[0456] Taurines R, Dudley E, Grassl J, Warnke A, Gerlach M, Coogan AN,Thome J. (2011) Proteomic research in psychiatry. J Psychopharm 25(2): 151-196.
[0457] Thery C, Zitvogel L, Amigorena S. (2002) Exosomes: composition, biogenesis and function. Nat Rev Immunol 2: 569-579.
[0458] Wang X, Wang L, Lin H, Zhu Y, Huang D, Lai M, Xi X, Huang J,Zhang W, Zhong T. (2024) Research progress of CTC, ctDNA, and EVs in cancer liquid biopsy. Front Oncol 14: 1303335.
[0459] Webber J, Yeung V, Clayton A. (2015) Extracellular vesicles as modulators of the cancer microenvironment. Semin Cell Dev Biol 40: 27-34.
[0460] Welton JL, Brennan P, Gurney M, Webber JP, Spary LK, Carton DG,Falcon-Perez JM, Walton SP, Mason MD, Tabi Z, Clayton A. (2016) Proteomics analysis of vesicles isolated from plasma and urine of prostate cancer patients using a multiplex, aptamer-based protein array. J Extracell Vesicles 5: 31209.
[0461] Yi J, Kim C, Gelfand CA. (2007) Inhibition of intrinsic proteolytic activities moderates preanalytical variability and instability of human plasma. J Proteome Res 6: 1768-1781.
[0462] Yu X, Harris SL, Levine AJ. (2006) The regulation of exosome secretion: a novel function of the p53 protein. Cancer Res 66: 4795-4801.
[0463] Yun S-H, Sim E-H, Goh R-Y, Park J-l, Han J-Y. (2016) Platelet activation: The mechanisms and potential biomarkers. BioMed Res Int, vol. 2016, Article ID 9060143, 5 pages.
[0464] Zhang PL, Mashni JW, Sabbisetti VS, Schworer CM, Wilson GD,Wolforth SC, Kernen KM, Seifman BD, Amin MB, Geddes TJ, Lin F, Bonventre JV, Hafron JM, (2014) Urine kidney injury molecule-1 : a potential non-invasive biomarker for patients with renal cell carcinoma. Int Urol Nephrol 46(2): 379-388.
[0465] Zimmerman LJ, Li M, Yarbrough WG, Slebos RJ, Liebier DC. (2012)Global stability of plasma proteomes for mass spectrometry-based analyses. Mol Cell Proteomics 11.6: M111 014340.
[0466] Assarsson E, Lundberg M, Holmquist G, Bjorkesten J, Thorsen SB,Ekman D, Eriksson A, Dickens ER, Ohlsson S, Edfeldt G, Andersson A-C, Lindstedt P, Stenvang J, Gullberg M, Fredriksson S. (2014) Homogeneous 96-plex PEA immunoassay exhibiting high sensitivity, specificity, and excellent scalability. PLoS ONE 9(4): e95192.
[0467] Yun S-H, Sim E-H, Goh R-Y, Park J-l, Han J-Y. (2016) Platelet activation: the mechanisms and potential biomarkers. BioMed Res Int doi: 10.1155 / 2016 / 9060143.
[0468] Chen R, Jin G, Li W, McIntyre TM. (2018) Epidermal Growth Factor(EGF) autocrine activation of human platelets promotes EGF receptor-dependent oralsquamous cell carcinoma invasion, migration, and epithelial mesenchymal transition.J Immunol. 201 (7): 2154-2164.
[0469] Barreto J, Karathanasis SK, Remaley A, Sposito AC. (2021) Role ofLOX-1 (Lectin-like Oxidized Low-Density Lipoprotein Receptor 1) as a cardiovascular risk predictor. Arterioscler Thromb Vase Biol 41 : 153-166.
[0470] Shahzad, A, Knapp, M. Lang, I. Kohler G (2010) Interleukin 8 (IL-8)- a universal biomarker? I nt Arch Med. 3:11.
[0471] Kjaer, I. Olsen, D. Brandslund, I. Bechmann, T. Jakobsen, E. Bogh,S. Madsen, J. (2020) Prognostic impact of serum levels of EGFR and EGFR ligands in early-stage breast cancer. Scientific Reports 10: 16558.
[0472] Barreto J, Karathanasis SK, Remaley A, Sposito AC. (2021) Role ofLOX-1 (Lectin-like Oxidized Low-Density Lipoprotein Receptor 1) as a cardiovascular risk predictor. Arterioscler Thromb Vase Biol 41 : 153-166.
[0473] Dugger BN, Dickson DW. (2016) Pathology of neurodegenerative diseases. Cold Spring Harb Perspect Biol. 9: a028035.
[0474] Schaffert L-N, Carter WG. (2020) Do post-translational modifications influence protein aggregation in neurodegenerative diseases: a systematic review. Brain Sciences 10, 232. doi:10.3390 / brainsci10040232.
[0475] Jung M, Klotzek S, Lewandowski M, Fleischhacker M, Jung K (2003)Changes in concentration of DNA in serum and plasma during storage of blood samples. Clinical Chem 49(6): 1028-1029.
[0476] Emery DC, Shoemark DK, Blatstone TE, Waterfall CM, Coghill JA,Cerajewska TA, Davies M, West NX, Allen SJ (2017) 16S rRNA next generation sequencing analysis shows bacteria in Alzheimer’s post-mortem brain. Frontiers in Aging Neuroscience 9: 195. Doi: 10.3389 / friagi.2017.00195
[0477] Ashton NJ, Brum WS, Di Molfetta G, Benedet AL, Arslan B, JonaitisE, Langhough RE, Cody K, Wilson R, Carisson CM, Vanmechelen E, Montoliu-Gaya L, Lantero-Rodriguez J, Rahmouni N, Tissot C, Stevenson J, Servaes S, Therriault J, Pascoal T, Lleo A, Alcolea D, Fortea J, Rosa-Neto P, Johnson S, Jeromin A, BlennowK, Zetterberg H. (2024) Diagnostic accuracy of a plasma phosphorylated Tau 217 immunoassay for Alzheimer Disease Pathology. JAMA Neurol 81 (3): 255-263.
[0478] Beharry C, Cohen LS, Di J, Ibrahim K, Briffa-Mirabella S, del CAlonso, A. (2014). Tau-induced neurodegeneration: Mechanisms and targets. Neurosci Bull 30(2): 346-358.
[0479] Barthelemy NR, Li Y, Joseph-Mathurin N, Gordon BA, HassenstabJ, Benzinger TLS, Buckles V, Fagan AM, Perrin RJ, Goate AM, Morris JC, Karch CM, Xiong C, Allegri R, Mendez PC, Berman SB, Ikeuchi T, Mori H, Shimada H, Shoji M, Suzuki K, Noble J, Farlow M, Chhatwal J, Graff-Radford NR, Salloway S, Schofield PR, Masters CL, Martins RN, O’Connor A, Fox NC, Levin J, Jucker M, Gabelle A, Lehmann S, Sato C, Bateman RJ, McDade E. (2020) A soluble phosphorylated tau signature links tau, amyloid and the evolution of stages of dominantly inherited Alzheimer’s disease. Nat Med 26(3): 398-407.
[0480] Lai R, Li B, Bishnoi R. (2024) P-tau217 as a reliable blood-based marker of Alzheimer’s Disease. Biomedicines 12, 1836[https: / / doi.Org / 10.3390 / Biomedicines12081836],
[0481] Freije CA, Arechavala-Gomeza V. (2025) The current and future landscape of RNA-based therapies and diagnostics. Commun Med 5, 463. https: / / doi.Org / 10.1038 / S43856-025-01166-1
[0482] Meddeb R, Pisareva E, Thierry AR (2019) Guidelines for the preanalytical conditions for analyzing circulating cell-free DNA. Clin Chem 65(5): 623- 633. Doi: 10.1373 / clinchem.2018.298323
[0483] Stewart CM, Kothari PD, Mouliere F, Mair R, Somnay S, BenayedR, Zehir A, Weigelt B, Dawson S-J, Arcila ME, Berger MF, Tsui DWY (2018) The value of cell-free DNA for molecular pathology. J Pathol 244(5): 616-627. Doi: 10.1002 / path.5048
[0484] Meo AD, Bartlett J, Cheng Y, Pasic MD, Yousef GM (2017) Liquid biopsy: A step forward towards precision medicine in urologic malignancies. Mol Cancer 16: 80. Doi: 10.1186 / s12943-017-0644-5
[0485] P Mandel, P Metais (1948) Les acides nucleiques du plasma sanguine chez I’homme. C R Acad Sci Paris: 241-243
[0486] All publications, patents and patent applications mentioned in thisSpecification are indicative of the level of skill of those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0487] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims. The scope of the claims should not be limited to the preferred embodiments set for the description but should be given the broadest interpretation consistent with the description as a whole.
Claims
1. CLAIMS1 . A composition for preserving at least one polypeptide in a bodily fluid, or a cell- free or a cellular fraction thereof, at ambient temperature, the composition comprising: at least one buffering agent; at least one chelating agent; at least one saccharide; and at least one stabilizing agent selected from a stabilizing protein, a peptide, an amino acid or a salt thereof, or a combination thereof.
2. The composition of claim 1 , wherein the composition has a pH of from about 4.2 to about 8.2, or of from about 4.4 to about 7.5, or of from about 4.5 to about 7.2, or of from about 4.5 to about 5.2.
3. The composition of claim 2, wherein the composition is a liquid composition, such as an aqueous composition.
4. The composition of claim 1 , wherein the composition is a solid composition.
5. The composition of claim 4, wherein the solid composition is prepared by drying the composition of claim 3, such as by spray-drying or lyophilization.
6. The composition of any one of claims 1-5, wherein the composition preserves the at least one polypeptide in a native, non-denatured conformation and / or preserves a functional activity of the at least one polypeptide.
7. The composition of any one of claims 1-5, wherein the composition minimizes lysis of cells that are present in the bodily fluid or the cellular fraction thereof.
8. The composition of any one of claims 1-7, wherein the composition stabilizes nucleic acids contained in the bodily fluid, or the cell-free or the cellular fraction thereof, at ambient temperature.
9. The composition of any one of claims 1-8, wherein the at least one stabilizing agent is a stabilizing protein, such as bovine serum albumin (BSA).
10. The composition of any one of claims 1-8, wherein the at least one stabilizing agent is a peptide, such as an oligopeptide or a synthetic polypeptide (e.g. poly-L- histidine).11 . The composition of any one of claims 1-8, wherein the at least one stabilizing agent is an amino acid, such as glycine, histidine, arginine, proline, glutamic acid, betaine, N-acetyl cysteine, or mixtures thereof.
12. The composition of claim 11 , wherein the at least one stabilizing agent is an amino acid selected from glycine, histidine, arginine, proline, glutamic acid, or mixtures thereof.
13. The composition of claim 11 , wherein the at least one stabilizing agent is selected from L-Histidine and salts and hydrates thereof, such as L-Histidine monochloride monohydrate, L-Histidine monohydrate, L-Histidine dihydrochloride, or mixtures thereof.
14. The composition of any one of claims 1-13, wherein the at least one buffering agent comprises an acetate salt, a succinate salt, a citrate salt, or a combination thereof; optionally, wherein the acetate salt is selected from sodium acetate, potassium acetate, tetramethyl ammonium acetate, tetraethyl ammonium acetate, or a combination thereof; optionally, wherein the citrate salt is selected from sodium citrate, potassium citrate, or a combination thereof; optionally, wherein the succinate salt is selected from sodium succinate, potassium succinate, or a combination thereof.
15. The composition of claim 14, wherein the at least one buffering agent comprises an acetate salt, a citrate salt, or a combination thereof.
16. The composition of any one of claims 1-15, wherein the at least one buffering agent is an acetate salt.
17. The composition of claim 16, wherein the at least one buffering agent is sodium acetate.
18. The composition of claim 16 or 17, wherein the composition further comprises an organic acid selected from a hydroxycarboxylic acid, such as a C3-C6 hydroxycarboxylic acid.
19. The composition of claim 18, wherein the organic acid is citric acid.
20. The composition of any one of claims 1-19, wherein the at least one chelating agent is selected from ethylene glycol tetraacetic acid (EGTA), (2- hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), ethylenediaminetriacetic acid (EDTA), 1 ,2- cyclohexanediaminetetraacetic acid (CDTA), N,N-bis(carboxymethyl)glycine, 1 ,3- propylenediamine tetra-acetic acid (PDTA), or a combination thereof.21 . The composition of claim 20, wherein the at least one chelating agent is EGTA, HEDTA, or CDTA.
22. The composition of any one of claims 1-21 , wherein the at least one saccharide is selected from a monosaccharide, a disaccharide, or a combination thereof.
23. The composition of any one of claims 1-21 , wherein the at least one saccharide is selected from trehalose, dextrose or glucose, fructose, D-mannitol, D-sorbitol, D- xylitol, hydroxyethyl starch (HES), inulin, maltodextrin, or a combination thereof.
24. The composition of any one of claims 1-21 , wherein the at least one saccharide is trehalose or hydroxyethyl starch (HES).
25. The composition of any one of claims 1-24, further comprising at least one protease inhibitor, optionally wherein the at least one protease inhibitor is selected from a serine protease inhibitor, a cysteine protease inhibitor, an aspartic protease inhibitor, an aminopeptidase inhibitor, and / or metalloprotease inhibitor, or combinations thereof.
26. The composition of claim 25, wherein the at least one protease inhibitor is selected from4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF), Aprotinin, Bestatin, E-64, Leupeptin, Pepstatin A, Phosphoramidon, phenylmethylsulfonyl fluoride (PMSF), 4-Phenyl-1 , 2, 4-triazoline-3, 5-dione, Ethyl benzimidate hydrochloride, Camostat mesylate, Antipain Dihydrochloride, Saccharin, N-methylsaccharin, or combinations thereof.
27. The composition of any one of claims 1-26, further comprising at least one phosphatase inhibitor, optionally, wherein the at least one phosphatase inhibitor is selected from inhibitors of protein tyrosine phosphatases, inhibitors of serine / threonine phosphatases, inhibitors of acid phosphatases, or combinations thereof; optionally, wherein the at least one phosphatase inhibitor is selected from sodium fluoride, sodium orthovanadate, sodium pyrophosphate, p-glycerophosphate, or combinations thereof.
28. The composition of any one of claims 1 -27, wherein the at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof, comprises one or more protein post-translational modifications (PTMs), and the composition preserves the PTMs.
29. The composition of claim 28, wherein the PTMs comprise phosphorylation and / or glycosylation.
30. The composition of any one of claims 1 -29, wherein the bodily fluid, or the cell- free or the cellular fraction thereof, is obtained from a mammal, such as a human.
31. The composition of claim 30, wherein the bodily fluid is saliva, oral swab sample, sputum, vaginal swab samples, urine, respiratory aspirates or lavages, or blood, or a cell-free or a cellular fraction thereof.
32. The composition of claim 31 , wherein the bodily fluid is blood or saliva.
33. The composition of any one of claims 1 -32, wherein the at least one polypeptide is selected from a cytokine, an enzyme, a growth factor, a chemokine, a chemoattractant, or a complement factor.
34. The composition of claim 33, wherein the at least one polypeptide plays a role in one or more pathways comprising cytokine pathways, respiratory pathways, cardiovascular pathways, metabolic pathways, neurological pathways, and immunological pathways, wherein the at least one polypeptide is associated with health status, or a disease or disorder.
35. The composition of any one of claims 1 -34, wherein the composition preserves a plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof.
36. The composition of claim 35, wherein each of the plurality of polypeptides is independently selected from a cytokine, an enzyme, a growth factor, a chemokine, a chemoattractant, or a complement factor.
37. The composition of claim 36, wherein each of the plurality of polypeptides plays a role in one or more pathways comprising cytokine pathways, respiratory pathways, cardiovascular pathways, metabolic pathways, neurological pathways, and immunological pathways, wherein each of the plurality of polypeptides is associated with health status, or a disease or disorder.
38. The composition of any one of claims 35-37, wherein each of the plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof,comprises one or more protein post-translational modifications (PTMs), and the composition preserves the PTMs.
39. The composition of claim 38, wherein the PTMs comprise phosphorylation and / or glycosylation.
40. A method for preserving at least one polypeptide in a bodily fluid, or a cell-free or a cellular fraction thereof, at ambient temperature, the method comprising: a) obtaining a sample of the bodily fluid, or the cell-free or the cellular fraction thereof, containing the at least one polypeptide; b) contacting the sample with a composition comprising: at least one buffering agent; at least one chelating agent; at least one saccharide; and at least one stabilizing agent selected from a stabilizing protein, a peptide, an amino acid or a salt thereof, or a combination thereof; to form a mixture; c) mixing the mixture of (b) to form a homogeneous mixture; and d) storing the homogeneous mixture at ambient temperature.
41. The method of claim 40, wherein the composition has a pH of from about 4.2 to about 8.2, or of from about 4.4 to about 7.5, or of from about 4.5 to about 7.2, or of from about 4.5 to about 5.2.
42. The method of claim 41 , wherein the composition is a liquid composition, such as an aqueous composition.
43. The method of claim 40, wherein the composition is a solid composition.
44. The method of claim 43, wherein the solid composition is prepared by drying the composition of claim 3, such as by spray-drying or lyophilization.
45. The method of any one of claims 40-44, wherein the composition preserves the at least one polypeptide in a native, non-denatured conformation and / or preserves a functional activity of the at least one polypeptide.
46. The method of any one of claims 40-44, wherein the composition minimizes lysis of cells that are present in the bodily fluid or the cellular fraction thereof.
47. The method of any one of claims 40-46, wherein the composition stabilizes nucleic acids contained in the bodily fluid, or the cell-free or the cellular fraction thereof, at ambient temperature.
48. The method of any one of claims 40-47, wherein the at least one stabilizing agent is a stabilizing protein, such as bovine serum albumin (BSA).
49. The method of any one of claims 40-47, wherein the at least one stabilizing agent is a peptide, such as an oligopeptide or a synthetic polypeptide (e.g. poly-L- histidine).
50. The method of any one of claims 40-47, wherein the at least one stabilizing agent is an amino acid, such as glycine, histidine, arginine, proline, glutamic acid, betaine, N-acetyl cysteine, or mixtures thereof.51 . The method of claim 50, wherein the at least one stabilizing agent is an amino acid selected from glycine, histidine, arginine, proline, glutamic acid, or mixtures thereof.
52. The method of claim 50, wherein the at least one stabilizing agent is selected from L-Histidine and salts and hydrates thereof, such as L-Histidine monochloride monohydrate, L-Histidine monohydrate, L-Histidine dihydrochloride, or mixtures thereof.
53. The method of any one of claims 40-52, wherein the at least one buffering agent comprises an acetate salt, a succinate salt, a citrate salt, or a combination thereof;optionally, wherein the acetate salt is selected from sodium acetate, potassium acetate, tetramethyl ammonium acetate, tetraethyl ammonium acetate, or a combination thereof; optionally, wherein the citrate salt is selected from sodium citrate, potassium citrate, or a combination thereof; optionally, wherein the succinate salt is selected from sodium succinate, potassium succinate, or a combination thereof.
54. The method of claim 53, wherein the at least one buffering agent comprises an acetate salt, a citrate salt, or a combination thereof.
55. The method of any one of claims 40-54, wherein the at least one buffering agent is an acetate salt.
56. The method of claim 55, wherein the at least one buffering agent is sodium acetate.
57. The method of claim 55 or 56, wherein the composition further comprises an organic acid selected from a hydroxycarboxylic acid, such as a C3-C6 hydroxycarboxylic acid.
58. The method of claim 57, wherein the organic acid is citric acid.
59. The method of any one of claims 40-58, wherein the at least one chelating agent is selected from ethylene glycol tetraacetic acid (EGTA), (2- hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), ethylenediaminetriacetic acid (EDTA), 1 ,2- cyclohexanediaminetetraacetic acid (CDTA), N,N-bis(carboxymethyl)glycine, 1 ,3- propylenediamine tetra-acetic acid (PDTA), or a combination thereof.
60. The method of claim 59, wherein the at least one chelating agent is EGTA, HEDTA, or CDTA.61 . The method of any one of claims 40-60, wherein the at least one saccharide is selected from a monosaccharide, a disaccharide, or a combination thereof.
62. The method of any one of claims 40-60, wherein the at least one saccharide is selected from trehalose, dextrose or glucose, fructose, D-mannitol, D-sorbitol, D- xylitol, hydroxyethyl starch (HES), inulin, maltodextrin, or a combination thereof.
63. The method of any one of claims 40-60, wherein the at least one saccharide is trehalose or hydroxyethyl starch (HES).
64. The method of any one of claims 40-63, further comprising at least one protease inhibitor, optionally wherein the at least one protease inhibitor is selected from a serine protease inhibitor, a cysteine protease inhibitor, an aspartic protease inhibitor, an aminopeptidase inhibitor, and / or metalloprotease inhibitor, or combinations thereof.
65. The method of claim 64, wherein the at least one protease inhibitor is selected from4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF), Aprotinin, Bestatin, E-64, Leupeptin, Pepstatin A, Phosphoramidon, phenylmethylsulfonyl fluoride (PMSF), 4-Phenyl-1 , 2, 4-triazoline-3, 5-dione, Ethyl benzimidate hydrochloride, Camostat mesylate, Antipain Dihydrochloride, Saccharin, N-methylsaccharin, or combinations thereof.
66. The method of any one of claims 40-65, further comprising at least one phosphatase inhibitor, optionally, wherein the at least one phosphatase inhibitor is selected from inhibitors of protein tyrosine phosphatases, inhibitors of serine / threonine phosphatases, inhibitors of acid phosphatases, or combinations thereof; optionally, wherein the at least one phosphatase inhibitor is selected from sodium fluoride, sodium orthovanadate, sodium pyrophosphate, p-glycerophosphate, or combinations thereof.
67. The method of any one of claims 40-66, wherein the at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof, comprises one or more protein post-translational modifications (PTMs), and the composition preserves the PTMs.
68. The method of claim 67, wherein the PTMs comprise phosphorylation and / or glycosylation.
69. The method of any one of claims 40-68, wherein the bodily fluid, or the cell-free or the cellular fraction thereof, is obtained from a mammal, such as a human.
70. The method of claim 69, wherein the bodily fluid is saliva, oral swab sample, vaginal swab samples, urine, sputum, respiratory aspirates or lavages, or blood, or a cell-free or a cellular fraction thereof.71 . The method of claim 70, wherein the bodily fluid is blood or saliva.
72. The method of any one of claims 40-71 , wherein the at least one polypeptide is selected from a cytokine, an enzyme, a growth factor, a chemokine, a chemoattractant, or a complement factor.
73. The method of claim 72, wherein the at least one polypeptide plays a role in one or more pathways comprising cytokine pathways, respiratory pathways, cardiovascular pathways, metabolic pathways, neurological pathways, and immunological pathways, wherein the at least one polypeptide is associated with health status, or a disease or disorder.
74. The method of any one of claims 40-73, wherein the at least one polypeptide is preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
75. The method of any one of claims 40-74, wherein a plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof, are preserved for at least1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
76. The method of claim 75, wherein each of the plurality of polypeptides is independently selected from a cytokine, an enzyme, a growth factor, a chemokine, a chemoattractant, or a complement factor.
77. The method of claim 76, wherein each of the plurality of polypeptides plays a role in one or more pathways comprising cytokine pathways, respiratory pathways, cardiovascular pathways, metabolic pathways, neurological pathways, and immunological pathways, each of the plurality of polypeptides is associated with health status, or a disease or disorder.
78. The method of any one of claims 75-77, wherein each of the plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof, comprises one or more protein post-translational modifications (PTMs), and the composition preserves the PTMs.
79. The method of claim 78, wherein the PTMs comprise phosphorylation and / or glycosylation.
80. The method of any one of claims 40-79, wherein nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, are stabilized for at least 1 day, at least2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.81 . A kit for preserving at least one polypeptide in a bodily fluid, or a cell-free or a cellular fraction thereof, at ambient temperature, the kit comprising: a) a bodily fluid collection device; b) the composition as defined in any one of claims 1-39; c) instructions for use; andd) optionally, a collection implement, such as a swab.
82. The kit of claim 81 , wherein the at least one polypeptide is preserved for at least1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
83. The kit of claim 81 or 82, wherein a plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof, are preserved for at least 1 day, at least2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
84. The kit of any one of claims 81-83, wherein nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, are stabilized for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
85. An admixture of the bodily fluid, or the cell-free or the cellular fraction thereof, and the composition as defined in any one of claims 1-39, wherein at least one polypeptide in the bodily fluid, or the cell-free or the cellular fraction thereof is preserved at ambient temperature.
86. The admixture of claim 85, wherein the at least one polypeptide is preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
87. The admixture of claim 85 or 86, wherein a plurality of polypeptides in the bodily fluid, or the cell-free or the cellular fraction thereof, are preserved for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
88. The admixture of any one of claims 85-87, wherein nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, are stabilized for at least 1 day, atleast 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.
89. A device for collecting a bodily fluid, or a cell-free or a cellular fraction thereof, the device comprising: a container comprising a reservoir portion for receiving a sample of the bodily fluid, or the cell-free or the cellular fraction thereof; and the composition of any one of claims 1-39, the composition being disposed in the reservoir portion of the container.
90. The device of claim 89, wherein the container is a tube, wherein the tube is at least partially evacuated.91 . The device of claim 90, wherein the tube is a venous blood collection tube.
92. The kit of any one of claims 81-84, wherein the bodily fluid collection device is configured to collect saliva, oral swab samples, vaginal swab samples, urine, sputum, respiratory aspirates or lavages, venous blood or capillary blood.
93. The composition of any one of claims 1 -39, wherein the composition preserves a plurality of polypeptides and stabilizes nucleic acids in the bodily fluid, or the cell- free or the cellular fraction thereof.
94. The method of any one of claims 40-80, wherein the composition preserves a plurality of polypeptides and stabilizes nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof.
95. The kit of any one of claims 81-84 and 92, wherein the composition preserves a plurality of polypeptides and stabilizes nucleic acids in the bodily fluid, or the cell- free or the cellular fraction thereof.
96. The admixture of any one of claims 85-88, wherein the composition preserves a plurality of polypeptides and stabilizes nucleic acids in the bodily fluid, or the cell- free or the cellular fraction thereof.
97. The composition, method, kit, or admixture of any one of claims 93-96, wherein the composition preserves the plurality of polypeptides and stabilizes nucleic acids in the bodily fluid, or the cell-free or the cellular fraction thereof, for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days at ambient temperature.