DNA aptamer specifically binding to alpha-synuclein protein and use thereof

Abstract

The present invention relates to a DNA aptamer specifically binding to an alpha-synuclein protein and uses thereof. Specifically, the present invention relates to a DNA aptamer selected from the group consisting of nucleotide sequences of SEQ ID NOS: 1 to 12 and binding specifically to an α-synuclein protein, and a composition for detecting an α-synuclein protein, a detection kit, a detection chip or a microarray, all comprising the aptamer as an active ingredient. In addition, the present invention relates to a method for detecting an α-synuclein protein, a method for providing information for diagnosing a degenerative brain disease, a composition for diagnosing a degenerative brain disease, and a pharmaceutical composition for preventing or treating a neurodegenerative disease, all using the DNA aptamer of the present invention.

Description

DNA aptamers that specifically bind to alpha-synuclein protein and their uses

[0001] The present invention relates to a DNA aptamer that specifically binds to alpha-synuclein protein and its uses.

[0002] Parkinson's disease is a slowly progressing neurodegenerative disorder characterized by motor impairments such as slow movements, tremors at rest, muscle rigidity, and postural instability, accompanied by a decline in cognitive abilities and the progression of dementia. The disease typically begins between the ages of 50 and 79, although it rarely occurs in children and adolescents.

[0003] Meanwhile, despite the continuous increase in the number of Parkinson's disease patients, there are no absolute biomarkers in current dementia diagnosis, and there are currently no distinct inhibitors of pathological progression or treatments available. Since Parkinson's disease begins very slowly and progresses gradually, it is difficult to determine the onset time. Consequently, Parkinson's disease is often suspected based on movement-related disorders and early symptoms of dementia. Subsequently, a diagnosis is made through a medical history taken by a neurologist and physical and neurological examinations, including SPECT and PET scans using β-CIT. However, early diagnosis is difficult because these diagnostic methods are expensive and specialized, and even when diagnosed, inhibiting pathological progression is challenging due to the lack of effective treatments.

[0004] While a wide variety of factors are cited as causes of Parkinson's disease, the accumulation of toxic alpha-synuclein (α-synuclein, α-syn) protein is mentioned as a cause of onset. α-synuclein is primarily distributed in the brain, although it is also known to be present in parts of the heart, muscles, and other tissues. It is found in specialized structures at the ends of nerve cells known as presynaptic terminals and is known to play a role in releasing neurotransmitters by interacting with phospholipids and proteins. Although it is considered crucial for brain activity through signal relay between nerve cells, its precise role and mechanism have not been clearly elucidated. Numerous studies have reported evidence that α-synuclein plays a significant role in regulating dopamine release. Based on these reports, various drugs utilizing dopamine precursors to enhance dopamine delivery capabilities are commercially available to inhibit the pathological progression of Parkinson's disease. However, since most of them are used only to alleviate symptoms and cannot fundamentally inhibit the aggregation of α-synuclein protein, there is a need for greater efforts to inhibit the progression of the pathology through drugs that inhibit the aggregation of α-synuclein protein.

[0005] Numerous recent studies from molecular and structural biological perspectives have reported results regarding the structural instability of α-synuclein proteins and the weakening of aggregation inhibition through autophagy of α-synuclein aggregates due to aging. Accordingly, research is underway to develop α-synuclein protein-specific binding aptamers that inhibit α-synuclein protein aggregation or distinguish between α-synuclein protein aggregates and normal α-synuclein proteins. However, to date, no therapeutic agent capable of inhibiting α-synuclein protein aggregation has been developed and marketed.

[0006] Meanwhile, aptamers are short nucleic acid oligomers characterized by their high affinity for target substances and specific binding through the formation of a unique, stable tertiary structure. Compared to proteins, it is possible to develop aptamers that bind to a wider variety of target substances (proteins, bacteria, peptides, chemicals, metal ions, etc.). Furthermore, they offer excellent advantages in terms of productivity, as they can be mass-produced quickly and at low cost using simple synthesis techniques and exhibit almost no sequence variations. In addition, they possess high stability due to high resistance to environmental pH and temperature, and as bio-derived materials, they carry a relatively lower burden of side effects and are very easy to control their half-lives, leading to a recent high evaluation of their potential for use as therapeutic agents.

[0007] Accordingly, while researching to develop DNA aptamers capable of specifically binding to alpha-synuclein protein that can be efficiently used for the diagnosis and treatment of Parkinson's disease, the inventors succeeded in synthesizing and identifying DNA aptamers that have high affinity for alpha-synuclein protein and can specifically bind to it, and completed the present invention by confirming that such DNA aptamers can be utilized for the diagnosis and treatment of Parkinson's disease.

[0008] Therefore, the objective of the present invention is to provide a DNA aptamer that specifically binds to an alpha-synuclein (α-synuclein) protein selected from the group consisting of the nucleotide sequences of SEQ ID NOs 1 to 12.

[0009] Another objective of the present invention is to provide a composition for detecting alpha-synuclein (α-synuclein) protein comprising the DNA aptamer of the present invention as an active ingredient.

[0010] Another objective of the present invention is to provide a kit for detecting alpha-synuclein (α-synuclein) protein comprising the composition of the present invention as an active ingredient.

[0011] Another object of the present invention is to provide a chip or microarray for detecting alpha-synuclein (α-synuclein) protein, characterized in that the DNA aptamer of the present invention is immobilized on a substrate and specifically reacts with a sample containing alpha-synuclein (α-synuclein) protein.

[0012] Another objective of the present invention is to provide a method for detecting alpha-synuclein (α-synuclein) protein, comprising: (1) contacting a biological sample separated from a living organism with a DNA aptamer of the present invention; and (2) measuring the presence or content of alpha-synuclein protein in the biological sample through an alpha-synuclein (α-synuclein) protein-specific binding reaction between the biological sample and the DNA aptamer.

[0013] Another objective of the present invention is to provide a composition for diagnosing degenerative brain diseases comprising the DNA aptamer of the present invention as an active ingredient.

[0014] Another objective of the present invention is to provide a method for providing information for the diagnosis of a degenerative brain disease, comprising: (1) a step of contacting a biological sample isolated from a living organism with a DNA aptamer of the present invention; and (2) a step of measuring the presence or content of alpha-synuclein (α-synuclein) protein in the biological sample through an alpha-synuclein (α-synuclein) protein-specific binding reaction between the biological sample and the DNA aptamer.

[0015] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of degenerative brain diseases, comprising the DNA aptamer of the present invention as an active ingredient.

[0016] To achieve the above objectives, the present invention provides a DNA aptamer that specifically binds to an alpha-synuclein (α-synuclein) protein selected from the group consisting of the nucleotide sequences of SEQ ID NOs 1 to 12.

[0017] In one embodiment of the present invention, the DNA aptamer may further include a labeling substance.

[0018] In one embodiment of the present invention, the labeling substance may be any one labeling substance selected from the group consisting of fluorescent substances, amine groups, biotin, thiol groups, and digoxigenin, which is labeled on the 5' end or 3' end of the DNA aptamer.

[0019] In addition, the present invention provides a composition for detecting alpha-synuclein (α-synuclein) protein comprising the DNA aptamer of the present invention as an active ingredient.

[0020] In addition, the present invention provides a kit for detecting alpha-synuclein (α-synuclein) protein comprising the composition of the present invention as an active ingredient.

[0021] In addition, the present invention provides a chip or microarray for detecting alpha-synuclein (α-synuclein) protein, characterized in that the DNA aptamer of the present invention is immobilized on a substrate and specifically reacts with a sample containing alpha-synuclein (α-synuclein) protein.

[0022] In addition, the present invention provides a method for detecting alpha-synuclein (α-synuclein) protein, comprising: (1) a step of contacting a biological sample separated from a living organism with a DNA aptamer of the present invention; and (2) a step of measuring the presence or content of alpha-synuclein protein in the biological sample through an alpha-synuclein (α-synuclein) protein-specific binding reaction between the biological sample and the DNA aptamer.

[0023] In addition, the present invention provides a composition for diagnosing degenerative brain diseases comprising the DNA aptamer of the present invention as an active ingredient.

[0024] In one embodiment of the present invention, the disease may be Parkinson's disease, dementia with Lewy bodies, or multiple system atrophy, which are diseases caused by alpha-synuclein protein aggregates.

[0025] In addition, the present invention provides a method for providing information for the diagnosis of a degenerative brain disease, comprising: (1) a step of contacting a biological sample separated from a living organism with a DNA aptamer of the present invention; and (2) a step of measuring the presence or content of an alpha-synuclein (α-synuclein) protein in the biological sample through an alpha-synuclein (α-synuclein) protein-specific binding reaction between the biological sample and the DNA aptamer.

[0026] In one embodiment of the present invention, the disease may be Parkinson's disease, dementia with Lewy bodies, or multiple system atrophy, which are diseases caused by alpha-synuclein protein aggregates.

[0027] Furthermore, the present invention provides a pharmaceutical composition for the prevention or treatment of degenerative brain diseases, comprising the DNA aptamer of the present invention as an active ingredient.

[0028] In one embodiment of the present invention, the disease may be Parkinson's disease, dementia with Lewy bodies, or multiple system atrophy, which are diseases caused by alpha-synuclein protein aggregates.

[0029] In one embodiment of the present invention, the composition may be in the form of an injectable formulation.

[0030] The DNA aptamer provided in the present invention has a high affinity for α-synuclein protein and can specifically bind to it, so it can be used not only for detecting α-synuclein protein but also for diagnosing neurodegenerative diseases caused by α-synuclein protein aggregates, and when combined with an α-synuclein protein aggregate inhibitor, it can also be used as a therapeutic agent for neurodegenerative diseases.

[0031] Figure 1 shows the results of amplifying a random DNA aptamer pool using the PCR method, purifying the amplified dsDNA using a PCR purification kit, and confirming the ssDNA amplified using the asymmetric PCR method using an agarose gel electrophoresis method, where Lane M is a 100 bp DNA marker, Lanes 1 and 2 are the results of amplifying DNA aptamers using the PCR method, Lanes 3 and 4 are the results of purifying the DNA aptamers amplified using the PCR method using a PCR purification kit, and Lanes 5 and 6 are the results of amplifying DNA aptamers using the asymmetric PCR method.

[0032] Figure 2 is a quantitative result showing the amount of DNA aptamers that specifically bind to α-synuclein protein recovered in each SELEX round performed to produce DNA aptamers that specifically bind to α-synuclein protein.

[0033] Figure 3 is a diagram showing the secondary structures of four DNA aptamer candidates (A_syn_1, A_syn_2, A_syn_3, A_syn_4) out of 12 α-synuclein protein-binding DNA aptamer candidates selected during the SELEX process for the production of DNA aptamers that specifically bind to α-synuclein protein.

[0034] Figure 4 is a diagram showing the secondary structures of four DNA aptamer candidates (A_syn_5, A_syn_6, A_syn_7, A_syn_8) out of 12 α-synuclein protein-binding DNA aptamer candidates selected during the SELEX process for the production of DNA aptamers that specifically bind to α-synuclein protein.

[0035] Figure 5 is a diagram showing the secondary structures of four DNA aptamer candidates (A_syn_9, A_syn_10, A_syn_11, A_syn_12) out of 12 α-synuclein protein-binding DNA aptamer candidates selected during the SELEX process for the production of DNA aptamers that specifically bind to α-synuclein protein.

[0036] Figure 6 is a diagram showing the predicted binding structure of α-synuclein protein and six α-synuclein protein-binding DNA aptamer candidates selected during the SELEX process and Post-SELEX process for the production of DNA aptamers that specifically bind to α-synuclein protein.

[0037] Figure 7 shows the binding affinity between A_syn_7 aptamers and other neurodegenerative disease proteins, including α-synuclein protein, Tau, Transthyretin, β-amyloid, β-secretase, and BSA proteins, by immobilizing A_syn_7 aptamers on the surface of a sensor chip, expressed as the dissociation constant (K D It is a drawing represented through ).

[0038] Figure 8 shows the results of analyzing the α-synuclein aggregation inhibitory effect of A_syn_7 aptamer using a Thioflavin T fluorescence-based α-synuclein aggregation assay.

[0039] The present invention relates to a DNA aptamer that specifically binds to alpha-synuclein (α-synuclein) protein and its uses.

[0040] The inventors have discovered an aptamer having specific binding ability to alpha-synuclein protein as a method to solve the problems of existing antibody-based target substance detection techniques.

[0041] It was confirmed that the DNA aptamer of the present invention, which specifically binds to alpha-synuclein protein, specifically binds to alpha-synuclein protein, thereby enabling the easy detection of alpha-synuclein protein from biological samples and can be used for the diagnosis and prognosis prediction of diseases related to alpha-synuclein protein.

[0042] In this specification, the term "DNA aptamer" refers to a DNA nucleic acid molecule capable of binding to a specific molecule with high affinity and specificity. In this specification, "DNA aptamer" is used interchangeably with "DNA oligonucleotide." Aptamers are short-length oligomers that form a stable tertiary structure and possess the characteristic of having specific binding affinity to target substances. Furthermore, since aptamers are composed of nucleic acids such as DNA or RNA, they are more stable than antibodies made of proteins and have the advantage of being able to specifically bind to various target substances (proteins, peptides, metals, chemicals, etc.). In addition, because they can be produced using chemical synthesis techniques, they can be mass-produced in a short time and at low cost, and possess the excellent advantage of being able to continuously produce aptamers with the same capabilities after a single production run. Moreover, due to their high stability against ambient pH and temperature, their potential for application in various fields such as environment and medicine, including the detection of target substances and the development of disease diagnostic sensors, is highly regarded.

[0043] In one embodiment of the present invention, the DNA aptamer that specifically binds to the alpha-synuclein protein may be an oligonucleotide having a base sequence selected from the group consisting of the base sequences of SEQ ID NOs 1 to 12, or having a base sequence having 90% or more identity with such base sequence.

[0044] In addition, the DNA aptamer may be composed of additional labeling substances, wherein any one labeling substance selected from the group consisting of fluorescent substances, amine groups, biotin, thiol groups, and digoxigenin may be labeled on the 5' end or 3' end of the DNA aptamer.

[0045] In this specification, the term “oligonucleotide” generally refers to a nucleotide polymer having a length of about 200 or fewer, which may include DNA and RNA, and preferably is an RNA nucleic acid molecule. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or analogs thereof, or any substrate that can be introduced into the polymer by DNA or RNA polymerase or by a synthesis reaction. If modifications to the nucleotide structure are present, such modifications may be added before or after the synthesis of the oligonucleotide polymer. The nucleotide sequence may be interrupted by non-nucleotide components. The oligonucleotide may be further modified after synthesis, for example by binding with a label.

[0046] The DNA aptamers of the present invention can typically be obtained by in vitro selection methods for binding to target molecules. Methods for selecting aptamers that specifically bind to target molecules are known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on the cell surface, ions, metals, salts, and polysaccharides can be suitable target molecules for isolating aptamers capable of specifically binding to each ligand. Aptamer selection can be performed using in vivo or in vitro selection techniques known as the SELEX method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al., Science 249, 505-10, 1990). Specific methods for the screening and preparation of aptamers are described in U.S. Patent 5,582,981, WO 00 / 20040, U.S. Patent 5,270,163, Lorsch and Szostak, Biochemistry, 33:973 (1994), Mannironi et al., Biochemistry 36:9726 (1997), Blind, Proc. Natl. Acad. Sci. USA 96:3606-3610 (1999), Huizengan and Szostak, Biochemistry, 34:656-665 (1995), WO 99 / 54506, WO 99 / 27133, WO 97 / 42317 and U.S. Patent 5,756,291, which are incorporated herein by reference.

[0047] The DNA aptamer of the present invention is preferably an oligonucleotide having a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs 1 to 12.

[0048] The structure of this DNA aptamer having alpha-synuclein protein-specific binding ability identified in the present invention forms a secondary structure shown in FIGS. 3 to 5 of this specification.

[0049] In addition, the DNA aptamer of the present invention is interpreted to include an oligonucleotide having a base sequence that exhibits substantial identity with any one base sequence selected from the group consisting of the base sequences of SEQ ID NOs 1 to 12, while maintaining the characteristic of binding to alpha-synuclein protein.

[0050] The substantial identity described above is achieved by aligning the nucleotide sequence of the present invention described above with any other sequence as closely as possible and using algorithms commonly used in the art (Smith and Waterman, Adv. Appl. Math. 2:482 (1981); Needleman and Wunsch, J.Mol. Bio. 48:443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al., Nuc. Acids Res. 16:10881-90 (1988); Huang et al., Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al., Meth. Mol. Biol. It means a nucleotide sequence that exhibits at least 90% identity, more preferably at least 95% identity, and most preferably at least 98% identity when the aligned sequence is analyzed using 24:307-31 (1994).

[0051] In addition, the alpha-synuclein protein to which the DNA aptamer of the present invention can bind may have the amino acid sequence of SEQ ID NO. 16.

[0052] In addition, the present invention may provide a composition for detecting alpha-synuclein protein and a kit for detecting alpha-synuclein protein comprising a DNA aptamer that specifically binds to the alpha-synuclein protein synthesized and identified in the present invention as an active ingredient.

[0053] The DNA aptamer of the present invention can be used to directly detect alpha-synuclein protein or to detect alpha-synuclein protein in biological samples from patients, and can detect alpha-synuclein protein by distinguishing between aggregated and non-aggregated forms, so it can be used to diagnose degenerative brain diseases associated with alpha-synuclein protein aggregates.

[0054] The detection of alpha-synuclein protein of the present invention is based on a method for detecting a complex of alpha-synuclein protein and a DNA aptamer that specifically binds to alpha-synuclein protein. In one embodiment of the present invention, the DNA aptamer that specifically binds to alpha-synuclein protein of the present invention may include a nucleotide labeled with a fluorescent substance (e.g., fluorescein, Cy3, Cy5, or HRP), a radioactive substance, or a chemical substance such as biotin, or modified with a primary amine, to facilitate the detection of the complex.

[0055] In addition, the DNA aptamer of the present invention can be fabricated in the form of a biosensor, kit, and chip comprising an immobilized substrate and used to detect alpha-synuclein protein.

[0056] In this specification, the term “sensor and chip” refers to a sensor and chip in which a specific material is attached at high density to a specific area of ​​a substrate. In this specification, the term “substrate” of the biosensor and sensor chip refers to a support having suitable rigidity or semi-rigidity, and includes, but is not limited to, glass, membrane, slide, filter, chip, wafer, fiber, magnetic or non-magnetic bead, gel, tubing, plate, polymer, microparticle, and capillary. The DNA aptamer of the present invention may be arranged and immobilized on the substrate. Such immobilization may be achieved by a chemical bonding method or a covalent bonding method such as UV. For example, the DNA oligonucleotide may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bonded by UV on a polylysine coated surface. Additionally, the DNA oligonucleotide may be bonded to the substrate through a linker (e.g., ethylene glycol oligomer and diamine).

[0057] The DNA aptamer of the present invention can be biotinylated, for example, and can be successfully immobilized on a streptavidin-coated substrate. The DNA aptamer of the present invention, which specifically binds to the alpha-synuclein protein immobilized on the substrate, can bind to and capture the alpha-synuclein protein, and the capture of the alpha-synuclein protein thus captured can be visualized using the DNA aptamer that specifically binds to the alpha-synuclein protein.

[0058] In addition, the composition for detecting alpha-synuclein protein in the present invention may be provided in the form of a kit. In the present invention, the kit comprises, as an active ingredient, a DNA oligonucleotide having the nucleotide sequence of SEQ ID NOs 1 to 12 or a nucleotide sequence having 90% or more identity with the sequence. The kit in the present invention may additionally include instructions or a label for using the kit to detect alpha-synuclein protein in a sample.

[0059] According to another aspect of the present invention, the present invention can provide useful information for diagnosing diseases related to alpha-synuclein protein or determining the prognosis thereof through the specific detection of alpha-synuclein protein.

[0060] Accordingly, the present invention can provide a composition for diagnosing ALK-7 related diseases comprising the DNA aptamer of the present invention as an active ingredient, and a method for providing information necessary for diagnosing alpha-synuclein aggregate-related degenerative brain diseases using the RNA aptamer of the present invention.

[0061] A method for providing information necessary for the diagnosis of an alpha-synuclein-related disease using a DNA aptamer of the present invention comprises: (1) a step of contacting a biological sample isolated from a living organism with the DNA aptamer of the present invention; and (2) a step of measuring the presence or content of an alpha-synuclein protein in the biological sample through an alpha-synuclein protein-specific binding reaction between the biological sample and the DNA aptamer.

[0062] Here, if the level or content of alpha-synuclein protein contained in the above sample is higher than that of the normal control group (sample from a normal person), it can be predicted or diagnosed that a degenerative brain disease caused by alpha-synuclein has developed.

[0063] In addition, if the alpha-synuclein protein shows an aggregated form as a result of detection using the DNA aptamer of the present invention, it can be predicted or diagnosed that a degenerative brain disease has developed.

[0064] In the present invention, the “biological sample” may include blood, saliva, tears, urine, synovial fluid, mucus, cells, tissues, and other tissues and body fluids, and may also include, but is not limited to, cell culture supernatants, ruptured eukaryotic cells, and bacterial expression systems.

[0065] Furthermore, the present invention may provide a pharmaceutical composition for the prevention or treatment of degenerative brain diseases comprising the DNA aptamer of the present invention as an active ingredient.

[0066] The DNA aptamer of the present invention has the characteristic of binding with high affinity to alpha-synuclein protein and can inhibit the aggregation of alpha-synuclein protein by specifically and strongly binding to the structurally unstable site of alpha-synuclein protein, so it can also be used as a therapeutic agent to prevent or treat degenerative brain diseases caused by alpha-synuclein protein aggregation.

[0067] In one embodiment of the present invention, it was confirmed that the DNA aptamer of the present invention can inhibit alpha-synuclein fibrillation and ultimately has activity that inhibits the formation of alpha-synuclein aggregates.

[0068] Alpha-synuclein exists as a monomer under normal conditions, but in pathological environments, aggregation among monomers occurs, leading to fibrilization. These alpha-synuclein aggregates are known to be associated with the formation of Lewy bodies. Lewy bodies are known to influence the onset of Parkinson's disease by altering neuronal membrane permeability, thereby inducing oxidative stress caused by calcium ion influx and mitochondrial damage, and disrupting normal microtubule formation, which ultimately leads to neuronal death. Thus, alpha-synuclein aggregates induce neuronal damage and act as a causative factor in the development of synucleinopathy, including Parkinson's disease.

[0069] Therefore, the present invention can provide a composition for inhibiting the aggregation of alpha-synuclein comprising the DNA aptamer of the present invention as an active ingredient.

[0070] Diseases associated with the abnormal deposition or aggregation of alpha-synuclein are collectively referred to as synucleinopathy and fall under the category of degenerative brain diseases.

[0071] The above-mentioned degenerative brain diseases may be, but are not limited to, diseases caused by alpha-synuclein protein aggregates, such as Parkinson's disease, dementia with Lewy bodies, or multiple system atrophy.

[0072] The pharmaceutical composition according to the present invention can be prepared in the form of a pharmaceutical composition obvious in the art, and preferably in the form of an injectable formulation.

[0073] The present invention will be explained in more detail below through examples. These examples are intended to explain the invention more specifically, and the scope of the invention is not limited to these examples.

[0074]

[0075] <Example 1>

[0076] Amplification of a random DNA library

[0077] To select DNA aptamers that specifically bind to α-synuclein protein, a DNA library was first prepared as described below.

[0078] Specifically, a single-stranded template DNA of 76 mer size containing 40 random nucleotide sequences (N40) containing dA:dG:dC:dT in a ratio of 1.5:1.15:1.25:1 (Sequence No. 13: 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'), a forward primer for this (Sequence No. 14: 5'-ATACCAGCTTATTCAATT-3'), and a reverse primer biotinylated at the 5'-terminus (Sequence No. 15: 5'-AGATAGTAAGTGCAATCT-3') were custom-made by Bionia (Korea). A PCR reaction mixture was prepared by mixing 1 µl of template DNA, 5 µl of 10x PCR buffer, 4 µl of 2.5 mM dNTP mixture, 2 µl of 25 μM forward primer, 2 µl of 25 μM biotinylated reverse primer, 0.25 µl of ExTaq polymerase (Takara, Japan) (1 unit / µl), and 35.75 µl of distilled water. PCR was performed on the prepared reaction mixture under the conditions described in Table 1 below. The obtained PCR products were verified by 2% agarose gel electrophoresis, and the results are shown in Figure 1.

[0079] PCR Conditions Initial Denaturation Step: 95°C, 5 mins (1 time) Denaturation Step: 95°C, 30 seconds (20 times) Annealing Step: 55°C, 30 seconds Elongation Step: 72°C, 30 seconds Post-Elongation Step: 72°C, 7 mins (1 time)

[0080] As shown in Figure 1, the PCR product was identified and purified using a PCR purification kit (Qiagen, USA).

[0081]

[0082] <Example 2>

[0083] Single-stranded DNA amplification process

[0084] To prepare a DNA aptamer from the 76 bp PCR product obtained in <Example 1> above, single-strand DNA (ssDNA) was amplified using an asymmetric PCR method.

[0085] First, a PCR reaction mixture was prepared by mixing 7 µl of the PCR product obtained in <Example 1>, 10 µl of 10× PCR buffer, 8 µl of dNTP mixture, 10 µl of 25 µM forward primer (SEQ No. 14), 2 µl of 25 µM biotinylated reverse primer (SEQ No. 15), 0.5 µl of ExTaq polymerase (Takara) (1 unit / µl), and 62.5 µl of distilled water. PCR was performed on the prepared reaction mixture under the conditions described in Table 2 below. The obtained PCR product was verified by 2% agarose gel electrophoresis, and the results are shown in Figure 1.

[0086] PCR Conditions Initial Denaturation Step: 95°C, 5 mins (1 time) Denaturation Step: 95°C, 30 seconds (15 times) Annealing Step: 55°C, 30 seconds Elongation Step: 72°C, 30 seconds Post-Elongation Step: 72°C, 7 mins (1 time)

[0087]

[0088] To the identified PCR product, an equal volume of PCI solution prepared by mixing phenol:chloroform:isoamyl alcohol in a volume ratio of 25:24:1 was added, and the mixture was vigorously stirred. After stirring, the mixture was centrifuged at 4°C and 13,000 rpm for 15 minutes to obtain the supernatant. To the obtained supernatant, 1 / 100th of its volume of tRNA (Sigma Aldrich, USA) and 3 volumes of 100% ethanol were added, and the mixture was reacted at -70°C for at least 1 hour. After the reaction, the mixture was centrifuged at 4°C and 13,000 rpm for 20 minutes to obtain a pellet. The obtained pellet was dried at 65°C and suspended in 50 µl of distilled water to obtain DNA. The obtained DNA was verified by 2% agarose gel electrophoresis.

[0089]

[0090] <Example 3>

[0091] Single-stranded DNA recovery process

[0092] In order to remove biotin-bound double-stranded DNA (dsDNA) and ssDNA from the ssDNA obtained above and to obtain pure forward ssDNA, a heating-cooling technique was performed as follows.

[0093] Specifically, 50 µl of distilled water was added to the ssDNA obtained in <Example 2>, and the mixture was reacted at 85°C for 5 minutes to denature the dsDNA into ssDNA, after which it was cooled to 4°C to obtain the ssDNA. The obtained ssDNA was immediately cooled to 4°C. 50 µl of streptavidin agarose resin (Thermo Scientific, USA) was added to the cooled ssDNA and reacted at room temperature for 1 hour. Subsequently, the reaction mixture was centrifuged at 4°C and 13,000 rpm for 10 minutes, and only the supernatant was collected. To obtain the ssDNA from the obtained supernatant, extraction using a PCI solution and ethanol precipitation were performed as described above.

[0094] As a result, the obtained pellet was dried at 65°C and suspended in 50 µl of distilled water to obtain ssDNA. The obtained ssDNA was confirmed by 2% agarose gel electrophoresis.

[0095]

[0096] <Example 4>

[0097] Fabrication of 3D DNA Aptamers

[0098] 60 µl of distilled water and 100 µl of SELEX buffer (20 mM Tris-HCl, 150 mM NaCl, 2 mM MgCl2, 5 mM KCl and 1 mM CaCl2, pH 7.5) were added to 40 µl of ssDNA obtained in <Example 3>. The mixture was boiled at 85°C for 5 minutes to denature it, and then left at room temperature for more than 1 hour to cool slowly, thereby producing a DNA aptamer with a three-dimensional structure from the ssDNA.

[0099]

[0100] <Example 5>

[0101] Selection of DNA aptamers that specifically bind to α-synuclein protein

[0102] DNA aptamers that specifically bind to α-synuclein protein were selected using the SELEX technique.

[0103] First, recombinant α-synuclein protein (abcam, UK) was treated with EDC (1-ethyl-3(3-dimethylamino-propyl) carbodiimide) and NHS (N-hydroxysuccinimide) and immobilized on Dynabead m-270 amine (Thermo Scientific). Subsequently, ethanolamine was added to remove the remaining unimmobilized reactive groups, thereby eliminating reactive groups other than the α-synuclein protein. Then, 10 µl of the aptamer prepared in Example 4 was mixed with 175 µl of SELEX buffer and stirred for 1 hour. The reaction mixture was then fixed to a magnet using a 6-tube magnetic stand (Thermo Scientific), the supernatant was removed, and the mixture was washed three times with SELEX buffer. An elution buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) was added to the washed reaction mixture and reacted at 85°C for 5 minutes. The mixture was then fixed to a 6-tube magnetic stand to obtain denatured DNA aptamers, and this process was repeated twice. Subsequently, the obtained DNA aptamers were subjected to PCI extraction and ethanol precipitation as in <Example 3> to finally recover DNA aptamers suspended in 50 µl of distilled water. The results of the quantification of the obtained DNA aptamers are shown in Figure 2.

[0104]

[0105] <Example 6>

[0106] Removal of non-specifically binding DNA aptamers

[0107] To remove non-specific DNA aptamers that bind to Dynabead m-270 amine rather than α-synuclein protein, and at the same time improve the specificity of DNA aptamers that bind to α-synuclein protein, the following experiments were performed.

[0108] First, using the DNA aptamers obtained in <Example 5>, DNA aptamers with enhanced specificity were selected by repeating the process of <Example 5> seven times. Using the selected DNA aptamers, a negative SELEX was performed to select DNA aptamers that bind to Dynabead m-270 amine without α-synuclein protein binding. The experiment was conducted under the same conditions and methods as in <Example 5>, except that Dynabead m-270 amine without α-synuclein protein was used. At this time, only aptamers that did not bind to Dynabead m-270 amine were obtained. Using the obtained aptamers, the process of <Example 5> was repeated two more times to perform a total of nine SELEXs, thereby finally obtaining DNA aptamers that specifically bind to α-synuclein protein. The quantification results of the obtained DNA aptamers are shown in Figure 2.

[0109]

[0110] <Example 7>

[0111] Confirmation of DNA aptamer sequence

[0112] The sequence of the DNA aptamer obtained from the SELEX 9 round performed above was confirmed by the following method.

[0113] First, PCR was performed using the 9 rounds of DNA aptamers obtained above as a template to obtain double-stranded DNA. The obtained dsDNA was cloned into a T-vector according to the manufacturer's protocol using a T-blunt cloning kit (Solgent, Korea).

[0114] Specifically, 1 µl of T-vector (10 ng / µl), 4 µl of PCR product (20 ng / µl), and 1 µl of 6X T-blunt buffer were reacted at 25°C for 5 minutes. The reaction mixture was mixed with 100 µl of DH5α water-soluble strain and transformed by applying heat shock at 42°C for 30 seconds. The mixture was left on ice for 2 minutes, and 900 µl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose) was added and incubated in a shaking incubator at 37°C for 40 minutes. 200 µl of culture medium was plated onto an LB culture plate containing 50 µg / ml ampicillin (SigmaAldrich), 50 µg / ml X-gal (SigmaAldrich), and 5 µg / ml IPTG (Thermo Scientific). After incubating in a 37°C incubator for 15 hours, only white colonies were selected from the resulting colonies, DNA was extracted using conventional methods, and the base sequences were sent to Solgent to confirm a total of 12 DNA aptamer sequences as shown in Table 3.

[0115] Aptamer Sequence Clone Sequence (5'→3') Size (mer) Sequence Number A_syn_1ATTGGAGGGATGCTCCCAGCCCAGATCGTTACCGGTTGTA40 Sequence Number 1A_syn_2CGGATAGGCCCAGTCAAGACGGGCAGTCGACCGTCCTAGC40 Sequence Number 2A_syn_3CGGAAATGACAAGGGGAGTGTACGCGCAGTAATCTGACAG40 Sequence Number 3A_syn_4CTATGCAGAGTTGATTCGGGTACATTGGATGCAACGAGGG40 Sequence Number 4A_syn_5GGAGAAGTAGCAGGACGAAGCTAGAGGTCTGAACTCTAGG40 Sequence Number 5A_syn_6CCGAGCGGATGGGGAAGGGCGGCAAGTGACAATGGGGGCG40 Sequence Number 6A_syn_7GGCGGAGAATTGCCAGAACGAAGGGCCAGGGGCACACCGG40 Sequence No. 7A_syn_8GGGGCTCACGTGGATTGCTTCAGGAGCTCATGATCCGGCG40 Sequence No. 8A_syn_9CGACGGGTTGCTTCGGTCGTAACTGTTCACATTGGCTGTG40 Sequence No. 9A_syn_10GAGGTGGAGACAGGGCACGAAGGGGAAGGCGGCGGACCAG40 Sequence No. 10A_syn_11CAGGACACCAATATAGGAAGGAGACGACAGCTCAGCGCAT40 Sequence No. 11A_syn_12GGCCGAGGATATCTGCATGCTGGTTGTATGGACGGGGGTG40 Sequence No. 12

[0116]

[0117] <Example 8>

[0118] Confirmation of the structure of DNA aptamers

[0119] Figures 3, 4, and 5 show the results of imaging the structures of 12 DNA aptamers that bind with high affinity to the above α-synuclein protein using the DNA mfold website (http: / www.unafold.org).

[0120]

[0121] <Example 9>

[0122] Prediction of the binding structure of α-synuclein protein and DNA aptamer

[0123] First, based on the two-dimensional structures of the 12 DNA aptamers identified in the above example, the three-dimensional structures were predicted using the RNAcomposer website (https: / rnacomposer.cs.put.poznan.pl). Meanwhile, the three-dimensional structure of the α-synuclein protein was obtained using PDB code 1XQ8 provided on the RCSB PDB website (https: / www.rcsb.org). Using the obtained structures of the DNA aptamers and α-synuclein protein, the structure of the combined complex was analyzed using MOE (molecular operation environment) software. Before structure prediction, all energy was minimized for the structures of the DNA aptamers and α-synuclein protein, and the triangle matcher method was used for interactions. All structures were repeated 10 times, and the result with the highest prediction was plotted using the ChimeraX structure program.

[0124] The numerical results of the structural analysis of the 12 DNA aptamers and α-synuclein protein complexes obtained are shown in Table 4. The ΔG value, representing the structural stability of the DNA aptamers, was obtained in Example 8 above. The S score, representing the binding strength of the α-synuclein protein and DNA aptamer complex, and the RMSD value, representing the homology of the binding structure, were obtained from the complex structure analysis using MOE. Based on the obtained values, six candidate aptamers (A_syn_1, A_syn_2, A_syn_5, A_syn_7, A_syn_9, A_syn_10) were selected based on the structural analysis as having the highest binding strength and efficacy. The predicted binding structures of the six selected candidates with α-synuclein protein are shown in Figure 6.

[0125] Numerical results of structural analysis of 12 DNA aptamers and α-synuclein protein complexes Aptamer Number Clone Number △GS score RMSD Sequence Number 1A_syn_1-3.52-71.83510.6666 Sequence Number 2A_syn_2-5.08-60.72560.8342 Sequence Number 3A_syn_3-2.01-68.90450.9216 Sequence Number 4A_syn_4-2.77-65.42840.6832 Sequence Number 5A_syn_5-5.21-64.40191.3794 Sequence Number 6A_syn_6-0.81-62.74751.4048 Sequence Number 7A_syn_7-4.54-59.90690.6158 Sequence No. 8A_syn_8-2.37-63.54950.6315 Sequence No. 9A_syn_9-4.53-64.08810.6034 Sequence No. 10A_syn_10-4.18-68.26980.7683 Sequence No. 11A_syn_11-1.38-73.23060.5947 Sequence No. 12A_syn_12-3.45-58.46730.2264

[0126]

[0127] <Example 10>

[0128] Evaluation of the affinity of α-synuclein protein and DNA aptamer complex using SPR

[0129] To evaluate the affinity of the six aptamers obtained in the above example with the α-synuclein protein, a Surface Plasmon Resonance (SPR) experiment was performed using the BIAcore X-100 (BIACORE), an SPR detection system instrument. To quantify the affinity between the α-synuclein protein and the DNA aptamer, a sensor chip CM5 (Cytiva, UK) with a surface coated with carboxyl groups was used. A mixture of 0.1 M NHS and 0.4 M EDC was flowed through the sensor chip CM5 at a rate of 5 µl / min for 10 minutes to activate the carboxyl groups on the surface of the sensor chip into the more reactive NHS-ester. To immobilize α-synuclein protein on the surface of an NHS-ester-activated sensor chip CM5, the chip surface was coated with α-synuclein protein by treating it with a solution of α-synuclein protein dissolved at a concentration of 60 µg / ml in 10 mM sodium acetate (pH 4.5) buffer at a rate of 5 µl / min for 10 minutes. Subsequently, carboxyl reactive groups remaining on the sensor chip surface were inactivated by flowing 1 M ethanolamine over the immobilized α-synuclein protein sensor chip at a rate of 5 µl / min for 10 minutes. This prevented other reagents and DNA aptamers from directly binding to the chip surface, and the sensor chip was regenerated with 1 M NaCl and 50 mM NaOH after each experiment. Rate parameters were obtained and quantified using the BIA evaluation program (BIACORE).

[0130] To quantify the affinity between α-synuclein protein and aptamers, six types of aptamers were prepared by dissolving them in HBS-EP buffer (Cytiva) at concentrations of 300 nM, 500 nM, 700 nM, and 1,000 nM, respectively. The affinity between α-synuclein and DNA aptamers that specifically bind to it was quantified by flowing various concentrations of the six aptamers through a sensor chip without any binding (Channel 1) and a sensor chip with α-synuclein protein immobilized (Channel 2). The results of obtaining the dissociation constant (KD) for each aptamer are shown in Table 5.

[0131] Dissociation constant of each aptamer Sequence number Clone K D (M) Sequence No. 1A_syn_13.262×10 -9 Sequence No. 2A_syn_21.811×10 -8 Sequence No. 5A_syn_56.184×10 -9 Sequence number 7A_syn_72.215×10 -9 Sequence number 9A_syn_93.517×10 -9 Sequence No. 10A_syn_102.934×10 -9

[0132]

[0133] <Example 11>

[0134] Evaluation of the specificity of α-synuclein protein-binding aptamers using SPR

[0135] Among the six aptamers obtained in the above example, A_syn_7, which has the highest affinity, was selected to perform a specificity evaluation, and control proteins associated with Alzheimer's disease, a disease similar to Parkinson's disease, were prepared at the same concentration. The control proteins prepared were BSA, Tau, Transthyretin, β-amyloid, and β-secretase. The prepared α-synuclein proteins and control proteins were treated at a rate of 5 µl / min for 10 minutes on a sensor chip with nothing bound (Channel 1) and a sensor chip with A_syn_7 aptamer immobilized (Channel 2) to quantify the affinity.

[0136] As a result of the analysis, as shown in Figure 7, the aptamer (A_syn_7) synthesized and selected in the present invention was found to have a significantly superior binding affinity for α-synuclein protein compared to other proteins.

[0137]

[0138] <Example 12>

[0139] Confirmation of α-synuclein protein aggregation inhibitory activity using the aptamer of the present invention

[0140] Furthermore, the inventors analyzed whether the DNA aptamer having binding specificity to α-synuclein discovered and synthesized in the present invention has activity capable of inhibiting the aggregation of α-synuclein protein.

[0141] To this end, a Thioflavin T (ThT) fluorescence-based α-synuclein aggregation assay was performed on the A_syn_7 aptamer obtained in the above example. This experiment was conducted by monitoring the formation of β-sheet structures that appear during the fibrillation process of α-synuclein protein through an increase in ThT fluorescence intensity, and the Thioflavin T reagent is a reagent that specifically binds to alpha synuclein fibrils.

[0142] Specifically, α-synuclein protein was prepared at a concentration of 70 μM in 50 mM Tris-HCl (pH 7.4) and 100 mM NaCl buffer, and the A_syn_7 DNA aptamer of the present invention was dissolved in the same buffer and added at a molar ratio of 1:5 relative to α-synuclein protein (α-synuclein protein: aptamer = 1:5 molar ratio). As a control, a group containing only α-synuclein protein without the addition of aptamer was used. ThT was added to the reaction mixture to achieve a final concentration of 20 μM. Subsequently, the prepared reaction mixture was dispensed into 96-well black plates (Corning, USA) and reacted for 48 hours at 37 °C with stirring at 600 rpm. Fluorescence intensity was measured at 20-minute intervals during the reaction, and ThT fluorescence was measured using a Cytation 5 microplate reader (BioTek, USA) at excitation wavelengths of 440 nm and emission wavelengths of 485 nm.

[0143]

[0144] As shown in Figure 8, the analysis results showed that in the group treated with α-synuclein protein alone without the addition of aptamers, the ThT fluorescence intensity increased over time and exhibited a typical fibrillation pattern. On the other hand, in the group treated with the A_syn_7 aptamer of the present invention, the aggregation of α-synuclein protein was inhibited and almost no increase in fluorescence intensity was observed.

[0145] Through these results, the inventors found that the A_syn_7 DNA aptamer of the present invention can effectively inhibit the β-sheet-based fibrillation process of α-synuclein and suppress the aggregation of α-synuclein, and these results mean that the aptamer of the present invention can also be used as a therapeutic agent to prevent, improve, and treat degenerative brain diseases caused by the aggregation of α-synuclein.

[0146]

[0147] Based on the above results, the inventors can use the DNA aptamer provided in the present invention, which can specifically bind to α-synuclein protein, to efficiently detect α-synuclein, which is the cause of synuclein-related diseases including Parkinson's disease, with high specificity. Furthermore, it can be used to distinguish between aggregated and non-aggregated proteins of α-synuclein protein, making it useful for diagnosing degenerative brain diseases caused by α-synuclein aggregates. In addition, the DNA aptamer of the present invention can specifically and strongly bind to structurally unstable sites of α-synuclein protein and inhibit the aggregation of α-synuclein protein, thereby making it useful as a therapeutic agent for degenerative brain diseases such as Parkinson's disease.

[0148]

[0149] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0150] This patent application is the result of research conducted under the following national research support program.

[0151] Project ID: 1345366488

[0152] Assignment No.: 2020R1A6A1A06046235

[0153] Ministry Name: Ministry of Education

[0154] Project Management (Specialized) Agency Name: National Research Foundation of Korea

[0155] Research Project Name: University Key Research Institute Support Project

[0156] Research Project Title: Elucidation of Molecular Mechanisms of Ecological Hazardous Factors and Development of Response Technologies

[0157] Project Performing Organization Name: Chungbuk National University

[0158] Research Period: 2020.06.01 ~ 2029.05.31

[0159]

[0160] Project ID: 2400424307

[0161] Project Number: RS-2024-00424307

[0162] Ministry Name: Ministry of Science and ICT

[0163] Project Management (Specialized) Agency Name: Korea Institute for Science and Technology Commercialization

[0164] Research Project Name: Promotion of University Technology Management (IP Star Scientist Support Type)

[0165] Research Project Title: IP Advancement and Commercialization for the Promotion of Virus Diagnosis and Treatment Commercialization of Aptamer Technology

[0166] Project Performing Organization Name: Chungbuk National University

[0167] Research Period: April 1, 2024 – December 31, 2025

Claims

1. A DNA aptamer that specifically binds to an alpha-synuclein (α-synuclein) protein selected from the group consisting of the nucleotide sequences of SEQ ID NOs 1 to 12.

2. In Paragraph 1, A DNA aptamer characterized by further including a labeling substance.

3. In Paragraph 2, A DNA aptamer characterized by having a label selected from the group consisting of fluorescent substances, amine groups, biotin, thiol groups, and digoxigenin labeled on the 5' end or 3' end of the DNA aptamer.

4. A composition for detecting alpha-synuclein (α-synuclein) protein comprising the DNA aptamer of claim 1 as an active ingredient.

5. A kit for detecting alpha-synuclein (α-synuclein) protein comprising the composition of claim 4 as an active ingredient.

6. A chip or microarray for detecting alpha-synuclein (α-synuclein) protein, characterized in that the DNA aptamer of claim 1 is immobilized on a substrate and specifically reacts with a sample containing alpha-synuclein (α-synuclein) protein.

7. (1) A step of contacting a biological sample separated from a living organism with the DNA aptamer of claim 1; and (2) a step of measuring the presence or content of alpha-synuclein protein in the biological sample through an alpha-synuclein protein-specific binding reaction between the biological sample and the DNA aptamer; comprising Method for detecting alpha-synuclein (α-synuclein) protein.

8. A composition for diagnosing degenerative brain diseases comprising the DNA aptamer of claim 1 as an active ingredient.

9. In Paragraph 8, A composition for diagnosing a degenerative brain disease, characterized in that the above disease is Parkinson's disease, dementia with Lewy bodies, or multiple system atrophy, which are diseases caused by alpha-synuclein protein aggregates.

10. (1) A step of contacting a biological sample separated from a living organism with the DNA aptamer of claim 1; and (2) a step of measuring the presence or content of alpha-synuclein (α-synuclein) protein in the biological sample through an alpha-synuclein (α-synuclein) protein-specific binding reaction between the biological sample and the DNA aptamer; comprising, Method for providing information for the diagnosis of degenerative brain diseases.

11. In Paragraph 10, A method for providing information for the diagnosis of a degenerative brain disease, characterized in that the above disease is Parkinson's disease, dementia with Lewy bodies, or multiple system atrophy, which are diseases caused by alpha-synuclein protein aggregates.

12. A pharmaceutical composition for the prevention or treatment of degenerative brain diseases, comprising the DNA aptamer of claim 1 as an active ingredient.

13. In Paragraph 12, A pharmaceutical composition for the prevention or treatment of degenerative brain diseases, characterized in that the above disease is Parkinson's disease, dementia with Lewy bodies, or multiple system atrophy, which are diseases caused by alpha-synuclein protein aggregates.

14. In Paragraph 12, A pharmaceutical composition for the prevention or treatment of degenerative brain diseases, characterized in that the above composition is in the form of an injectable formulation.

Images