Composition and method for treating inflammatory diseases in oral cavity

Abstract

A composition for preventing, alleviating, or treating inflammatory diseases in the oral cavity according to the present invention comprises a peptide consisting of the amino acid sequence of general formula 1: K-Y-R1-R2-R3-R4-R5-R6-R7-R8 (general formula 1), wherein, in general formula 1, R1 is arginine (R), lysine (K), or glutamine (Q); R2 is arginine (R) or glutamine (Q); R3, R4, and R5 are each arginine (R) or lysine (K); R6 is asparagine (N) or serine (S); and R7 and R8 are lysine (K) or tyrosine (Y). The composition according to the present invention can prevent, alleviate, or treat inflammatory diseases in the oral cavity by reducing the expression of inflammatory factors.

Description

Composition and method for treating inflammatory diseases in the oral cavity

[0001] The present invention relates to a composition for treating oral inflammatory diseases, and more specifically, to a pharmaceutical composition for treating or preventing oral inflammatory diseases, including stomatitis, gingivitis, or periodontitis caused by stress and pathogenic microorganisms including bacteria and viruses.

[0002]

[0003] The present invention relates to the prevention or treatment of inflammatory oral diseases such as stomatitis, gingivitis, periodontitis, and periapical periodontitis. These diseases are inflammatory lesions primarily confined to external tissues that support or surround the teeth, such as the oral mucosa, gingiva, periodontal ligament, and alveolar bone, and are clearly distinguished from pulpitis occurring within the internal tissues of the teeth in terms of site of occurrence, pathophysiology, composition of causative bacteria, clinical manifestations, and treatment methods.

[0004] Pulpitis typically occurs when bacteria invade the pulp cavity through the exacerbation of dental caries, tooth trauma, or cracks. Bacteria and their metabolites trigger an acute inflammatory response within the closed root canal, leading to increased intrapulpal pressure, blockage of blood flow, and ischemic necrosis. This pathological mechanism manifests as clinical symptoms centered on acute pain, such as severe spontaneous pain, increased sensitivity to temperature stimuli, and nocturnal pain; as inflammation progresses, it can lead to pulp necrosis and apical lesions. In such cases, treatment is primarily performed through root canal treatment or tooth extraction. The bacteria primarily involved in pulpitis are mainly anaerobic, such as Streptococcus mutans, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella intermedia, and Peptostreptococcus spp., presenting as a mixed infection.

[0005] On the other hand, the oral inflammatory diseases targeted by this invention occur in the soft tissues and periodontal supporting tissues outside the oral cavity, unlike the pulp, and bacterial infection caused by the chronic accumulation of plaque or tartar is a major causative factor. These diseases are initially asymptomatic or begin with mild symptoms such as gum bleeding, swelling, and bad breath; however, as they progress, they worsen into alveolar bone resorption, periodontal pocket formation, and increased tooth mobility, which can eventually lead to tooth loss. Representative causative bacteria include chronic periodontitis-associated bacteria classified as the 'Red Complex,' such as Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola; these bacteria possess pathological characteristics that chronically stimulate the host's immune response and induce tissue destruction and bone resorption. Treatment may include scaling, root planing, anti-inflammatory therapy, administration of local or systemic antibiotics, and, in severe cases, periodontal surgery, depending on the progression of the disease.

[0006] As such, pulpitis is an acute inflammatory disease occurring in the nerve and vascular tissues within the tooth, characterized by clinical symptoms centered on pain and treatment centered on root canal therapy; in contrast, the oral inflammatory diseases targeted by the present invention originate in external tissues and constitute a group of diseases centered on chronic tissue destruction and structural damage, and thus their pathological mechanisms and treatment approaches are fundamentally different. Therefore, it is clarified that the "oral inflammatory diseases" defined in this specification do not include pulpitis, and the scope of application of the present invention is limited to diseases having pathological and clinical characteristics that are clearly distinguishable from pulpitis.

[0007] Inflammation is the body's physiological response to combat bacteria, viruses, pathogenic invaders, and external stressors. Inflammation can be classified into two types: acute and chronic. Acute inflammation is a vital physiological response to injury or infection that promotes tissue repair while protecting against microorganisms and pathogens. Chronic inflammation is a physiological response in which, if the underlying stimulus is not removed, inflammation persists and develops into a chronic state, manifesting persistent symptoms such as pain and redness in the affected area.

[0008] Numerous endogenous peptides recognized through inflammatory responses act as anti-inflammatory agents and can be used in novel therapies for autoimmune and inflammatory diseases. For example, antiinflammation peptides (AIPs) are a type of therapeutic peptide that exhibits anti-inflammatory properties. Generally, AIPs exist as short linear peptides composed of 10 to 50 amino acids. Most AIPs discovered to date are endogenous peptides or are derived from natural sources, such as endogenous neuropeptides, vasoactive intestinal peptides, melittin extracted from bee venom, and hydrostatin-SN1 isolated from sea snakes. Some synthetic peptides distinct from these have also been explored to suppress inflammatory responses, and the mechanisms of AIPs include regulating immune cell differentiation, inducing anti-inflammatory responses, and / or preventing excessive inflammation. Recently, several AIPs have been approved by the U.S. Food and Drug Administration (FDA) for preventing and controlling inflammation. These related studies show that AIP has therapeutic potential and has the potential to become a new alternative therapy for treating inflammation.

[0009] Periodontal disease is classified into gingivitis, which is confined to the gums, and periodontitis, where inflammation spreads to the alveolar bone surrounding the tooth roots. It is a disease in which inflammation occurs in the periodontal tissues supporting the teeth, rather than damaging the teeth themselves. Clinically, the occurrence of periodontal disease leads to tooth loss due to gingival bleeding and swelling, the formation of periodontal pockets, and the destruction of alveolar bone. The causes of periodontal disease include local and systemic factors. The primary cause of periodontal disease is the accumulation of plaque and tartar. Plaque is a thin film formed by bacteria; if brushing or flossing is insufficient, it accumulates at the boundary between the gums and teeth. Over time, this plaque hardens into tartar, which exacerbates inflammation. In addition to oral hygiene, smoking, diabetes, and genetic factors increase the risk of developing periodontal disease, while stress, nutritional deficiencies, and weakened immunity can also have adverse effects. The main symptoms of periodontal disease include gum bleeding and swelling during brushing, reddened gums, and bad breath. As the disease progresses, the gums detach from the teeth, forming periodontal pockets, which can cause teeth to loosen or fall out. In more severe cases, inflammation can spread to the jawbone, leading to alveolar bone loss; however, early diagnosis is difficult because pain is mild or imperceptible in the early stages.

[0010] Gingivitis is a disease related to oral inflammation that begins with inflammation of the gums and is reversibly treatable in relatively early stages. At this stage, inflammation can be completely resolved through proper oral care. Periodontitis is an advanced form of untreated gingivitis, accompanied by the destruction of bone and ligament tissues that support the gums and teeth. Periodontitis is a chronic disease characterized by repeated progression and deterioration, which can lead to tooth loss in severe cases.

[0011] The prevalence of periodontal disease is significantly high worldwide and is cited as one of the major causes of tooth loss. According to the World Health Organization (WHO), oral diseases, including periodontitis, affect approximately 3.5 billion people, which accounts for nearly half of the global population. Additionally, severe periodontitis is reported to affect about 1 billion people, showing a higher prevalence particularly in low- and middle-income countries. The progression of periodontitis can be divided into three stages: (i) a healthy state, (ii) an acute inflammatory state (gingivitis), and (iii) a chronic inflammatory state (periodontitis).

[0012] In a healthy state (homeostasis), the oral microbial community (multimicrobial biofilm) is maintained in harmony, and inflammatory responses are suppressed. This is because gum and bone tissues are healthy, and the immune system effectively defends against bacterial invasion. At this stage, inflammatory mediators and tissue repair factors are in balance, preventing inflammation.

[0013] In the acute gingivitis stage, neutrophils are mobilized as the first line of defense against acute inflammation due to changes in the microbial biofilm (perturbed state). Neutrophils eliminate bacteria by phagocytizing them, but this process can lead to an excessive activation of the inflammatory response. While alleviating macrophages resolve inflammation and aid in tissue repair by removing dead neutrophils, if the inflammation is not resolved at this stage, it can lead to chronic inflammation.

[0014] Finally, it can lead to the stage of chronic periodontitis. If inflammation is not resolved and becomes chronic, the microbial community transitions into a state of dysbiosis. At this point, inflammation remains continuously active, and neutrophils and macrophages cause damage to gum and bone tissues. Chronic inflammation induces tissue destruction, leading to gum recession, deepening of periodontal pockets, and bone loss. Furthermore, an overreaction of immune cells induces the growth of pathogenic bacteria, and inflammatory cytokines (e.g., IL-1β, IL-6, TNF-α) accelerate tissue destruction.

[0015] The gingival epithelium serves as the first barrier against bacterial infection. Gingival epithelial cells express Toll-like receptors (TLRs), which can assist inflammatory cells in eliminating pathogens. Toll-like receptors (TLRs) can subsequently increase the expression of certain chemokines in epithelial cells via the NF-κB signaling pathway. Involucrin is a protein that plays a crucial role in skin barrier function. Bacterial lipopolysaccharides (LPS) promote the proliferation of gingival epithelial cells, reduce cell viability, and stimulate keratinization of the gingival fold epithelium, thereby upregulating the expression of involucrin, a marker of keratinocyte differentiation. Gingival fibroblasts and periodontal ligament cells (PDLCs) also play important roles in inflammation. When gingival fibroblasts were exposed to viable P. gingivalis, gene expression of interleukin-1β (IL-1β), interleukin-6 (IL-6), interleukin-8 (IL-8), tumor necrosis factor-α (TNF-α), and monocyte chemotactic protein-1 (MCP-1) increased. Similarly, lipopolysaccharide (LPS) from P. gingivalis can also induce the expression of IL-6 and IL-8 in periodontal ligament cells and gingival fibroblasts.

[0016] Meanwhile, cyclooxygenase (COX) plays a crucial role in the synthesis of prostaglandin E2 (PGE2) from arachidonic acid. COX has three isomers: COX-1, COX-2, and COX-3. In particular, COX-2 is a potent enzyme that can induce inflammation and promote prostaglandin synthesis after being stimulated by various inflammatory factors, such as cytokines and bacteria.

[0017] Chemokine expression can be triggered by MAMPs, DAMPs, inflammatory mediators, host factors, and mechanical stress. In oral tissues, chemokines can be synthesized by various cell types, including fibroblasts, osteoblasts, endothelial cells, epithelial cells, mast cells, PMNs, lymphocytes, and monocytes / macrophages. Therefore, they play a crucial role in the migration of immune cells to sites of periodontal infection. Chemokines are known as key molecules of inflammation. They are small, structurally related proteins that can be classified into C, CC, CX3C, and CXC subfamilies based on the first two conserved cysteine ​​residues within the N-terminus. CXC chemokines mediate their effects by interacting with CXC chemokine receptors (CXCRs) on various cells. CXCL10, also known as interferon gamma-inducible protein 10 (IP-10), acts as a chemoattractant for various cells such as monocytes / macrophages, T cells, NK cells, and dendritic cells. CXCL10 plays an important role in the return of leukocytes to inflamed tissues. CXCL10 is a 10 kDa protein and is functionally classified as an "inflammatory" chemokine. It is secreted by various cell types such as monocytes, neutrophils, endothelial cells, keratinocytes, fibroblasts, mesenchymal cells, dendritic cells, and astrocytes, and binds to CXCR3.

[0018] Against this backdrop, the inventors have made diligent research efforts to develop a method to treat gingivitis and periodontitis caused by periodontal disease. As a result, they established a model of gingivitis and periodontitis in which inflammation was induced with LPS in gingival fibroblasts and periodontal ligament cells, and revealed that the inflammatory response of gingivitis and periodontitis can be controlled not only by suppressing the expression of inflammatory factors and chemokines using anti-inflammatory peptides but also by suppressing the expression of NF-κB induced by LPS. This completes the present invention.

[0019]

[0020] The present invention aims to provide a composition for treating oral inflammatory diseases to treat a new type of oral inflammation, thereby resolving concerns regarding various side effects and drug resistance (antibiotic resistance) that may be caused by conventional treatment methods for chronic periodontitis, which involve treating chronic periodontitis by removing plaque and tartar through scaling, resecting gums to reduce the depth of periodontal pockets formed between teeth and gums, prescribing antibiotics or applying antibiotic ointment to periodontal pockets between teeth and gums if periodontitis is severe, and extracting untreatable teeth.

[0021] Another objective of the present invention is to provide a composition for treating oral inflammatory diseases that provides a preventive or therapeutic effect for acute or chronic oral inflammatory diseases, including stomatitis, gingivitis, periodontitis, and periapical periodontitis, which are oral inflammatory diseases.

[0022]

[0023] The objectives of the present invention are not limited to those mentioned above, and other unmentioned objectives will be clearly understood by those skilled in the art from the description below.

[0024]

[0025] According to one aspect of the present invention for solving the above technical problem, a composition for the prevention or treatment of inflammatory oral diseases is provided, comprising a peptide of General Formula 1:

[0026] KY-R1-R2-R3-R4-R5-R6-R7-R8(General Formula 1)

[0027] In the above general formula 1,

[0028] R1 is arginine (R), lysine (K), or glutamine (Q);

[0029] R2 is arginine (R) or glutamine (Q);

[0030] R3, R4, and R5 are each arginine (R) or lysine (K);

[0031] R6 is asparagine (N) or serine (S); and

[0032] R7 and R8 are lysine (K) or tyrosine (Y).

[0033]

[0034] The composition of the present invention can be used for the prevention or treatment of various diseases caused by oral inflammation (such as stomatitis, gingivitis, periodontitis, acute or chronic oral inflammatory diseases including periapical periodontitis, etc.).

[0035] In addition, the composition of the present invention can reduce the expression of inflammatory factors such as TNF-α, IL1-α, IL1-β, or IL-6.

[0036] In addition, the composition of the present invention can reduce the expression of inflammatory CXCL10 or COX2.

[0037] In addition, the composition of the present invention can reduce TLR2 or p-NF-κB protein expression.

[0038] Meanwhile, variant peptides having a sequence in which one or more amino acid residues differ from the constituent amino acid sequence may also be included in the category of antioxidant peptides provided by the present invention, as long as they can exhibit an effect of reducing the expression of TNF-α, IL1-α, IL1-β, or IL-6, the expression of CXCL10 or COX2, or the expression of TLR2 or p-NF-κB proteins.

[0039] In general, amino acid exchanges in proteins and polypeptides that do not alter the overall activity of the molecule are known in the art. The most common exchanges are exchanges between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. Additionally, peptides may be included in which the structural stability of the peptide against heat, pH, etc. is increased by mutations or modifications in the amino acid sequence.

[0040] For example, glutamine, an acidic amino acid located at position 3 of the peptide of SEQ ID NO. 1 provided in the present invention, can exhibit the same effect of the peptide provided in the present invention even if it is substituted with lysine or arginine, which are basic amino acids; arginine, a basic amino acid located at position 4 or 5 of the peptide of SEQ ID NO. 1, can exhibit the same effect of the peptide provided in the present invention even if it is substituted with glutamine, an acidic amino acid, or lysine, which is a basic amino acid; lysine, a basic amino acid located at position 6, 7, or 9 of the peptide of SEQ ID NO. 1, can exhibit the same effect of the peptide provided in the present invention even if it is substituted with arginine, which is a basic amino acid, or tyrosine, which is an aromatic amino acid; and asparagine, an acidic amino acid located at position 8 of the peptide of SEQ ID NO. 1, can exhibit the same effect of the peptide provided in the present invention even if it is substituted with serine, which is a neutral amino acid; Even if tyrosine, an aromatic amino acid located at position 10 of the peptide of sequence number 1, is substituted with lysine, a basic amino acid, the effect of the peptide provided in the present invention can still be exhibited.

[0041] As such, since the acidic amino acid, basic amino acid, or aromatic amino acid constituting the antioxidant peptide of the present invention can be substituted with other acidic amino acid, basic amino acid, neutral amino acid, or aromatic amino acid, respectively, and still exhibit the same effect of the peptide provided by the present invention, it is obvious that variant peptides having a sequence different from the amino acid sequence constituting the peptide of the present invention and one or more amino acid residues are also included in the category of the peptide provided by the present invention.

[0042] In addition, the peptide of the present invention is included in the category of the peptide provided by the present invention, as it can exhibit the same effects as the peptide provided by the present invention even if it has a form in which any amino acid is added to its N-terminus or C-terminus. As one example, the peptide may have a form in which 1 to 300 amino acids are added to its N-terminus or C-terminus, as another example, the peptide may have a form in which 1 to 100 amino acids are added to its N-terminus or C-terminus, and as yet another example, the peptide may have a form in which 1 to 24 amino acids are added to its N-terminus or C-terminus.

[0043] In another aspect of the present invention, the present invention provides a polynucleotide encoding the peptide.

[0044] The above polynucleotide may be modified by substitution, deletion, insertion, or a combination thereof, of one or more bases. When preparing a nucleotide sequence by chemical synthesis, synthesis methods widely known in the art, such as the method described in the literature (Engels and Uhlmann, Angew Chem IntEd Engl., 37:73-127, 1988), may be used, and synthesis may be performed using the tryster, phosphite, phosphoramidite, and H-phosphate methods, PCR and other autoprimer methods, and methods for synthesizing oligonucleotides on solid supports. For example, the polynucleotide encoding the peptide of the present invention may include the base sequence of SEQ ID NO. 4.

[0045] In another aspect, the present invention provides an expression vector comprising the polynucleotide, a transformant comprising the expression vector, and a method for producing the peptide using the transformant.

[0046] The term "expression vector" in the present invention refers to a recombinant vector capable of expressing a target peptide in a target host cell, comprising a genetic construct that includes essential regulatory elements operably linked to enable the expression of a gene insert. The expression vector comprises expression regulatory elements such as a start codon, a stop codon, a promoter, and an operator, wherein the start codon and the stop codon are generally considered to be part of a nucleotide sequence encoding a polypeptide, must exhibit action in the individual when the genetic construct is administered, and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.

[0047] The term "operably linked" in this invention refers to a state in which a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding a target protein or RNA are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to influence the expression of the coding sequence. Operatory linkage with an expression vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage can be performed using enzymes or the like generally known in the art.

[0048] Additionally, the expression vector may include a signal sequence for the release of the peptide to facilitate the separation of the peptide from the cell culture medium. A specific initiation signal may also be required for the efficient translation of the inserted nucleic acid sequence. These signals include an ATG start codon and adjacent sequences. In some cases, an exogenous translation regulatory signal that may include an ATG start codon must be provided. These exogenous translation regulatory signals and start codons may be from various natural and synthetic sources. Expression efficiency may be increased by the introduction of appropriate transcription or translation enhancing factors.

[0049] In addition, the expression vector may additionally include a protein tag that can be removed using an endopeptidase, optionally, to facilitate the detection of the peptide.

[0050] The term "tag" in the present invention refers to a molecule exhibiting quantifiable activity or characteristics, and may be a fluorescent molecule including a chemical fluorescent substance (fluoracer) such as fluorescein, a fluorescent protein (GFP), or a polypeptide fluorescent substance such as a related protein; or may be an epitope tag such as a Myc tag, a Flag tag, a histidine tag, a leucine tag, an IgG tag, or a streptavidin tag. In particular, when using an epitope tag, a peptide tag composed of at least 6 amino acid residues, and more preferably composed of 8 to 50 amino acid residues, may be used.

[0051] In the present invention, the expression vector may include a nucleotide sequence encoding the peptide of the present invention described above. The vector used is not particularly limited thereto as long as it is capable of producing the peptide, but preferably may be plasmid DNA, phage DNA, etc., and more preferably may be a commercially developed plasmid (pUC18, pBAD, pIDTSAMRT-AMP, etc.), an E. coli-derived plasmid (pYG601BR322, pBR325, pUC118, pUC119, etc.), a Bacillus subtilis-derived plasmid (pUB110, pTP5, etc.), a yeast-derived plasmid (YEp13, YEp24, YCp50, etc.), phage DNA (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP, etc.), an animal virus vector (retrovirus, It can be an adenovirus, vaccinia virus, etc., or an insect virus vector (baculovirus, etc.). Since the protein expression levels and modifications of the above expression vectors vary depending on the host cell, it is desirable to select and use the host cell most suitable for the purpose.

[0052] The transformant provided in the present invention can be produced by introducing the expression vector provided in the present invention into a host and transforming it, and can be used to produce the peptide by expressing the polynucleotide contained in the expression vector. The transformation can be performed by various methods, and is not particularly limited thereto as long as the peptide can be produced, but methods such as the CaCl2 precipitation method, the Hanahan method which increases efficiency by using a reducing agent called DMSO (dimethyl sulfoxide) in the CaCl2 precipitation method, electroporation, calcium phosphate precipitation method, protoplasmic fusion method, stirring method using silicon carbide fibers, Agrobacterium-mediated transformation method, PEG-mediated transformation method, dextran sulfate, lipofectamine, and drying / inhibition-mediated transformation method may be used. In addition, the host used for the production of the above-mentioned transforming agent may also be bacterial cells such as Escherichia coli, Streptomyces, and Salmonella typhimurium, as long as it can produce the above-mentioned peptide, although it is not particularly limited thereto; yeast cells such as Saccharomyces cerevisiae and Schizoscaromyces pombe; fungal cells such as Pichia pastoris; insect cells such as Drosophila and Spodoptera Sf9 cells; animal cells such as CHO, COS, NSO, 293, and Bow melanoma cells; or plant cells.

[0053] The culture medium used for cultivation must satisfy the requirements of a specific strain in an appropriate manner under aerobic conditions, while controlling temperature, pH, etc., within a conventional medium containing suitable carbon sources, nitrogen sources, amino acids, vitamins, etc. Carbon sources that can be used include mixed sugars of glucose and xylose as the primary carbon source, as well as sugars and carbohydrates such as sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture. Nitrogen sources that can be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, and glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products may be used. These nitrogen sources may be used alone or in combination. The medium may contain monopotassium phosphate, dipotassium phosphate, and corresponding sodium-containing salts as phosphorus. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts may be used as phosphorus. Additionally, inorganic compounds such as sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate may be used. Finally, essential growth substances such as amino acids and vitamins may be used in addition to the above materials.

[0054] In addition, suitable precursors may be used in the culture medium. The aforementioned raw materials may be added to the culture in a batch, fed-batch, or continuous manner in a manner suitable for the culture process, but are not particularly limited thereto. The pH of the culture may be controlled by using basic compounds such as sodium hydroxide, potassium hydroxide, and ammonia, or acid compounds such as phosphoric acid or sulfuric acid in a suitable manner.

[0055] In addition, bubble formation can be suppressed using antifoaming agents such as fatty acid polyglycol esters. Oxygen or an oxygen-containing gas (e.g., air) is injected into the culture to maintain aerobic conditions. The temperature of the culture is typically 27°C to 37°C, preferably 30°C to 35°C. Culture is continued until the maximum amount of the peptide is obtained. For this purpose, it is usually achieved in 10 to 100 hours.

[0056] In addition, the step of recovering the peptide from the culture may be performed by methods known in the art. Specifically, the recovery method is not particularly limited to methods that can be used to recover the produced peptide, but preferably, methods such as centrifugation, filtration, extraction, spraying, drying, vaporization, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobic, and size exclusion) may be used.

[0057] The term "prevention" in the present invention refers to any act of inhibiting or delaying the occurrence of an inflammatory oral disease by administering a pharmaceutical composition for the prevention or treatment of an inflammatory oral disease comprising the peptide of the present invention.

[0058] The term "treatment" in the present invention refers to any act of administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to an individual requiring treatment for an inflammatory oral disease, thereby reducing the expression of TNF-α, IL1-α, IL1-β, or IL-6, the expression of CXCL10 or COX2, or the expression of TLR2 or p-NF-κB proteins, so as to perform treatment for an inflammatory oral disease.

[0059] The pharmaceutical composition of the present invention may be prepared in the form of a pharmaceutical composition for treating inflammatory oral diseases, which further comprises a suitable carrier (natural or non-natural carrier), excipient, or diluent commonly used in the preparation of pharmaceutical compositions to the peptide. Specifically, the pharmaceutical composition may be formulated and used in the form of a sterile injectable solution that can be administered to the site where an inflammatory oral disease is induced, according to each conventional method. In the present invention, carriers, excipients, and diluents that may be included in the pharmaceutical composition may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, collagen, etc. When formulating, the composition may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. In particular, sterile aqueous solutions, non-aqueous solvents, suspending agents, emulsions, lyophilized preparations, suppositories, ointments (e.g., pulp relining agents, etc.) may be included. As non-aqueous solvents and suspending agents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, witepsol, macrogol, tween 61, cacao oil, laurin oil, glycerogelatin, etc. may be used. However, the formulations are not limited to the above, and as formulations for topical administration, gels, ointments, creams, patches, and films may be selected.

[0060] The content of the peptide included in the pharmaceutical composition of the present invention is not particularly limited thereto, but may be included in an amount of 0.0001 to 50 weight%, more preferably 0.01 to 20 weight% based on the total weight of the final composition.

[0061] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" in the present invention refers to an amount sufficient to treat or prevent a disease with a reasonable benefit / risk ratio applicable to medical treatment or prevention. The effective dose level may be determined based on factors including the severity of the disease, drug activity, the patient's age, weight, health, gender, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and elimination rate, the duration of treatment, drugs combined or used concurrently with the composition of the present invention, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered alone or in combination with known pharmaceutical compositions for treating oral inflammatory diseases. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects, taking all of the above factors into consideration.

[0062] The dosage of the pharmaceutical composition of the present invention may be determined by a person skilled in the art by taking into consideration the purpose of use, the severity of the disease, the patient's age, weight, gender, medical history, or the type of substance used as an active ingredient. For example, the pharmaceutical composition of the present invention may be administered at a dose of about 0.1 ng to about 100 mg / kg, preferably 1 ng to about 10 mg / kg per adult. The frequency of administration of the composition of the present invention is not particularly limited thereto, but may be administered once a day or divided into several doses. The above dosage does not limit the scope of the present invention in any way.

[0063] In another aspect, the present invention provides a method for treating an oral inflammatory disease comprising the step of administering the pharmaceutical composition in a pharmaceutically effective amount to an individual with an oral inflammatory disease.

[0064] The term "mitochondrial disorder disease" in this invention refers to various inflammatory diseases occurring in the tissues of the oral cavity, and includes stomatitis, gingivitis, periodontitis, and periapical periodontitis.

[0065] “Stomatitis” is an inflammatory disease affecting the oral mucosa, characterized by pain-accompanied inflammation in various parts of the mouth. “Gingivitis” refers to inflammation localized to the gums surrounding the teeth, characterized by redness, swelling, and easy bleeding; it can be considered an early stage of periodontal disease. “Periodontitis” is a more advanced stage than gingivitis, an inflammatory disease in which gum inflammation spreads to the tissues surrounding the teeth, accompanied by alveolar bone loss and the destruction of the tooth's supporting structures. “Periapical periodontitis” is inflammation occurring in the periodontal tissues at the tip of the tooth root; it is primarily caused by pulp infection or dental trauma and involves the destruction of bone tissue around the root apex. These inflammatory oral diseases can manifest as acute or chronic conditions and can have a significant impact on both oral and systemic health.

[0066] The administration route of the pharmaceutical composition for treating oral inflammatory diseases of the present invention may be any general route as long as it can reach the target tissue. The pharmaceutical composition of the present invention may be provided in any formulation suitable for topical application as intended, although not specifically limited thereto. For example, it may be administered orally, transdermally, intravenously, intramuscularly, or subcutaneously. The pharmaceutical composition may be an injectable, a topical solution, a suspension, an emulsion, a gel, a patch, or a spray, but is not limited thereto. The formulation may be easily prepared according to conventional methods in the art, and surfactants, excipients, wettable powders, emulsification promoters, suspensions, salts or buffers for osmotic pressure regulation, coloring agents, flavorings, stabilizers, preservatives, preservatives, or other commonly used adjuvants may be appropriately used.

[0067] In another aspect, the present invention provides a quasi-drug composition for preventing or improving inflammatory oral diseases comprising the above peptide.

[0068] The term "improvement" in this invention refers to any action that at least reduces parameters related to the condition being treated, such as the degree of symptoms.

[0069] In the present invention, the improvement may be interpreted to mean any act of administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to an individual requiring treatment for an oral inflammatory disease, thereby reducing the expression of TNF-α, IL1-α, IL1-β, or IL-6, the expression of CXCL10 or COX2, or the expression of TLR2 or p-NF-κB proteins, so as to improve or benefit the symptoms of the oral inflammatory disease.

[0070] The term "quasi-drug" in the present invention refers to articles used for the purpose of diagnosing, treating, improving, alleviating, managing, or preventing diseases of humans or animals, which have a milder effect than pharmaceuticals. For example, according to the Pharmaceutical Affairs Act, quasi-drugs are defined as articles excluding those used for pharmaceutical purposes. These include fiber and rubber products used for the treatment or prevention of diseases in humans and animals, items that have a mild or no direct effect on the human body and are not instruments or machines, and similar items, as well as disinfectants and insecticides for preventing infectious diseases.

[0071] In the present invention, the type or formulation of the quasi-drug composition containing the peptide is not particularly limited, but as an example, it may be an oral rinse, toothpaste, oral spray, oral gel, oral patch, etc.

[0072] The term “oral rinse” of the present invention refers to an oral hygiene product in liquid form used for rinsing the mouth. It may contain the peptide of the present invention and be evenly distributed throughout the entire oral cavity.

[0073] The term “toothpaste” in the present invention refers to an oral hygiene product in the form of a paste used for brushing. The peptide of the present invention can be added to the toothpaste to effectively deliver it during the daily oral care process.

[0074] The term “oral spray” in the present invention refers to a product applied into the oral cavity in a spray form. By providing the peptide of the present invention in a spray form, rapid and convenient application is possible.

[0075] The term “oral gel” of the present invention refers to an oral care product in the form of a viscous gel. The peptide of the present invention is incorporated into the gel to allow for longer contact with oral tissues.

[0076] The term “oral patch” of the present invention refers to a formulation that delivers a drug by attaching it to the oral mucosa. By incorporating the peptide of the present invention into the patch, continuous and local delivery is possible.

[0077] In another aspect, the present invention provides a health functional food composition for preventing or improving inflammatory oral diseases comprising the above peptide.

[0078] The term "food" in the present invention includes meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, health functional foods, and health foods, and includes all foods in the conventional sense.

[0079] The above-mentioned health functional food is synonymous with food for special health use (FosHU) and refers to a food with high medical or therapeutic effects that is processed to efficiently exhibit bio-regulatory functions in addition to nutritional supply. Here, "functionality" means obtaining useful effects for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body. The food of the present invention can be manufactured by methods commonly used in the industry, and during such manufacturing, raw materials and ingredients commonly added in the industry may be added. Furthermore, the formulation of the food can be manufactured without restriction as long as it is a formulation recognized as a food. The food composition of the present invention can be manufactured in various forms of formulations. Unlike general pharmaceuticals, it has the advantage of being made from food ingredients and thus avoiding side effects that may occur with long-term use of pharmaceuticals. Due to its excellent portability, the food of the present invention can be consumed as an adjuvant to enhance the effects of preventing or improving inflammatory diseases in the oral cavity.

[0080] The above formulation may be a tablet, capsule, or lozenge.

[0081] The term “tablet” in the present invention refers to a solid dosage form taken orally. By providing the peptide of the present invention in tablet form, systemic effects can be expected.

[0082] The term “capsule” in the present invention refers to an oral formulation in which a drug is placed inside a shell such as gelatin. By placing the peptide of the present invention into a capsule, accurate dosage control and convenience of administration can be provided.

[0083] The term “troche” in the present invention refers to a product in the form of a tablet that dissolves slowly in the mouth. The peptide of the present invention can be incorporated into the troche to be slowly released within the oral cavity.

[0084] The aforementioned "health food" refers to a food that has active effects in maintaining or promoting health compared to general food, and "health supplement food" refers to a food intended for the purpose of supplementing health. In some cases, the terms health functional food, health food, and health supplement food may be used interchangeably.

[0085] Specifically, the above-mentioned health functional food is a food prepared by adding the peptide of the present invention to food materials such as beverages, teas, spices, gum, and confectionery, or by encapsulating, powdering, or suspension, and means that consuming it brings about specific health effects. Unlike general medicines, it has the advantage of not having side effects that may occur when taking medicine for a long period of time because it is made from food.

[0086] In particular, “gum” is an oral product that is chewed. The peptide of the present invention can be added to gum to allow the peptide to be released in the oral cavity for a long period of time.

[0087] The food composition of the present invention can be consumed on a daily basis, and since a high effect can be expected for the prevention or improvement of inflammatory diseases in the oral cavity, it can be used very effectively.

[0088] The above food composition may further include a physiologically acceptable carrier, the type of carrier is not particularly limited, and any carrier commonly used in the relevant technical field may be used.

[0089] In addition, the above food composition may include additional ingredients that are commonly used in food compositions to improve odor, taste, visual appearance, etc. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), and copper (Cu). In addition, it may include amino acids such as lysine, tryptophan, cysteine, and valine.

[0090] In addition, the above food composition may include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), disinfectants (bleaching powder and high-grade bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA), butylhydroxytoluene (BHT), etc.), coloring agents (tar dyes, etc.), colorants (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (sizing agents), coating agents, gum bases, antifoaming agents, solvents, and improvers. The above additives can be selected according to the type of food and used in appropriate amounts.

[0091] The peptide of the present invention may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient may be appropriately determined according to its purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing food or beverages, the food composition of the present invention may be added to the food or beverage in an amount of 50 parts by weight or less, specifically 20 parts by weight or less. However, when consumed over a long period for the purpose of health and hygiene, the content may be below the above range, and since there are no safety issues, the active ingredient may also be used in an amount greater than the above range.

[0092] As an example of the food composition of the present invention, it may be used as a health drink composition, in which case it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The natural carbohydrates described above may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. Sweeteners may include natural sweeteners such as thaumatin and stevia extract; and synthetic sweeteners such as saccharin and aspartame. The proportion of the natural carbohydrates may generally be about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g, per 100 mL of the health drink composition of the present invention.

[0093] In addition to the above, the health drink composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. Furthermore, it may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, or vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not critical, it is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health drink composition of the present invention.

[0094] The food composition of the present invention may be included in various weight percent as long as it can exhibit an effect of preventing or improving inflammatory diseases in the oral cavity, but specifically, the peptide of the present invention may be included in 0.00001 to 100 weight percent or 0.01 to 80 weight percent relative to the total weight of the food composition, but is not limited thereto.

[0095] In describing the present invention, the AlPpred predictor used an artificial intelligence algorithm developed by Mst. Shamima Khatun et al. The model was trained by collecting training and test data sets from the IEDB database.

[0096] In mouse and human T-cell analyses, peptides were considered anti-inflammatory (positive samples) if they induced an anti-inflammatory cytokine (one of IL-10, IL-4, IL-13, IL-22, TGFb, or IFN-a / b). To address the overfitting issue of this model, CD-HIT with a sequence identity threshold of 0.8 was used. After removing duplicate peptides, identical training and test samples were retrieved from the AIPpred predictor. The training dataset consisted of 1,258 positive samples and 1,887 negative samples, while the test dataset included 420 positive samples and 629 negative samples. All datasets are stored on a web server.

[0097] PreAIP is configured to solve binary classification problems (positive AIPs and negative AIPs) using the Random Forest (RF) algorithm. To improve classifier performance, the extraction of relevant feature sets is important, and high-quality peptide encoding methods are required. Instead of simple binary representations, five complex feature encoding methods—AAindex, KSAAP, SPIDER2, PEP2D, and pKSAAP—were adopted.

[0098] PreAIP investigated primary sequences, physicochemical properties, and structural and evolutionary features. In contrast, existing AIPpred and AntiInflam predictors used only primary sequence encoding methods. The AntiInflam method used SVM algorithms to study hybrid features based on primary sequence encoding schemes, such as amino acid composition (AAC), dipeptide composition (DPC), and tripeptide composition. AIPpred studied individual compositions (AAC, AAindex, DPC, chain transition composition) through various machine learning algorithms.

[0099] Existing prediction tools did not control the level of specificity (Sp), so users could not distinguish which AIPs were highly positive or negative. On the other hand, PreAIP increased reliability by raising the threshold of the RF score based on the results of 10-fold cross-validation (CV) tests.

[0100] Meanwhile, regarding the issue of overfitting, an excessively high Combined RF Score may imply that performance on new data may deteriorate due to overfitting. The specificity of the peptide may decrease, increasing the likelihood of binding to unwanted substances, or the structure may be too stable, making necessary modifications difficult and potentially degrading in vivo function. In other words, performance in actual biological environments may be lower than expected, and reduced synthesis efficiency may lead to increased production costs. Therefore, it is important to find an appropriate balance in terms of the Combined RF Score. Accordingly, in the above KY-R1-R2-R3-R4-R5-R6-R7-R8 (General Formula 1), in terms of the balance of anti-inflammatory activity and various properties, it is more preferable that R1 is lysine (K) or glutamine (Q); R2 is glutamine (Q); R3 is lysine (K) or arginine (R); R4 is arginine (R); and R5 is arginine (R) or lysine (K); R6 is serine (S) or asparagine (N); and R7 and R8 may be tyrosine (Y) or lysine (K), respectively.

[0101]

[0102] The present invention provides a new type of composition for treating oral inflammation that resolves concerns regarding various side effects and drug resistance (antibiotic resistance) that may be caused by conventional treatment methods for chronic periodontitis, which involve treating chronic periodontitis by removing plaque and tartar through scaling, resecting gums to reduce the depth of periodontal pockets formed between teeth and gums, prescribing antibiotics or applying antibiotic ointment to periodontal pockets between teeth and gums if periodontitis is severe, and extracting untreatable teeth.

[0103] The present invention may provide a composition for treating oral inflammation to prevent or treat acute or chronic oral inflammatory diseases, including stomatitis, gingivitis, periodontitis, and periapical periodontitis, which are oral inflammatory diseases caused by various causes, by inhibiting inflammatory cytokines, chemokines that induce immune cell activity, and the expression of enzyme genes that cause inflammation.

[0104]

[0105] The effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by those skilled in the art from the description below.

[0106]

[0107] Figure 1 shows the results of analyzing the gene expression of inflammatory factors (A) TNF-α, (B) IL-1a, (C) IL-1b, and (D) IL-6 after inducing inflammation with LPS in human-derived gingival fibroblasts and then treating them with the peptide to confirm the anti-inflammatory effect of the peptide of the example in gingivitis.

[0108] Figure 2 is the result of analyzing the gene expression of CXCL10, a chemokine that induces inflammation in immune cells, by inducing inflammation with LPS in human-derived gingival fibroblasts and then treating them with the peptide to confirm the anti-inflammatory effect of the peptide of the example in gingivitis.

[0109] Figure 3 is the result of analyzing the expression of the COX2 gene, an inflammation-inducing enzyme, after inducing inflammation with LPS in human-derived gingival fibroblasts and then treating them with the peptide to confirm the anti-inflammatory effect of the peptide of the example in gingivitis.

[0110] Figure 4 shows the results of analyzing the gene expression of inflammatory factors (A) TNF-α, (B) IL-1a, (C) IL-1b, and (D) IL-6 after inducing inflammation with LPS in human-derived periodontal ligament cells and then treating them with the peptide to confirm the anti-inflammatory effect of the peptide of the example in periodontitis.

[0111] Figure 5 is the result of analyzing the gene expression of CXCL10, a chemokine that induces inflammation in immune cells, by inducing inflammation with LPS in human-derived periodontal ligament cells and then treating them with the peptide to confirm the anti-inflammatory effect of the peptide of the example in periodontitis.

[0112] Figure 6 shows the results of analyzing the expression of the COX2 gene, an inflammation-inducing enzyme, after inducing inflammation with LPS in human-derived periodontal ligament cells and then treating them with the peptide to confirm the anti-inflammatory effect of the peptide of the example in periodontitis.

[0113] Figure 7 shows the results of analyzing the effect of the peptide of the example on the phosphorylation of the LPS receptor (A) TLR2 and the TLR2 downstream factor (B) Nfkb protein using the Westblot method.

[0114] Figure 8 shows the results of immunohistochemical analysis of iNOS, an inflammatory factor, in a one-wall periodontal tissue defect animal model.

[0115]

[0116] The objectives and effects of the present invention, and the technical configurations for achieving them, will become clear by referring to the embodiments described in detail below in conjunction with the accompanying drawings. In describing the present invention, if it is determined that a detailed description of known functions or configurations may unnecessarily obscure the essence of the invention, such detailed description will be omitted. Furthermore, the terms described below are defined with consideration of their function in the present invention, and these may vary depending on the intentions or practices of the user or operator.

[0117] However, the present invention is not limited to the embodiments disclosed below but may be implemented in various different forms. These embodiments are provided merely to ensure that the disclosure of the present invention is complete and to fully inform those skilled in the art of the scope of the invention, and the present invention is defined only by the scope of the claims. Therefore, such definition should be based on the content throughout this specification.

[0118] The details of the invention will be specifically explained below through embodiments of the invention.

[0119]

[0120] Despite the existence of numerous anti-inflammatory peptides (AIPs) experimentally investigated in vivo, the molecular mechanisms regarding AIP specificity remain largely unknown. On the other hand, large-scale experiments and analyses of AIPs are time-consuming, subject to many experimental constraints, and require significant costs. To complement these experimental efforts and to rapidly identify potential AIPs prior to synthesis, an alternative logical approach that provides accurate and reliable predictions of AIPs can be considered. Several silico methods have been proposed for predicting AIPs; in 2017, Gupta et al. developed an AntiInflam predictor using a Support Vector Machine (SVM) classifier and hybrid features, while Manavalan et al. developed the AlPpred predictor using a Random Forest (RF) classifier along with basic sequence encoding features. These predictors allow for the rapid prediction of anti-inflammatory peptides for efficacy evaluation. The peptide of the present invention was predicted using the AlPpred predictor, and after confirming the potential anti-inflammatory efficacy of the synthesized peptide, further experiments and analyses were conducted.

[0121]

[0122] Example:

[0123] 1. Synthesis of peptides

[0124]

[0125] The inventors synthesized a peptide (Sequence No. 1) exhibiting a tyrosinase activity-promoting effect by the 9-fluorenylmethyloxycarbonyl (Fmoc) method, and synthesized peptides of each group by substituting amino acids of the synthesized peptide (Tables 1 to 12).

[0126]

[0127] N-KYQRRKKNKY-C(Sequence No. 1)

[0128] First, the peptide of Group 1 was synthesized by substituting the peptide of SEQ ID NO. 1 or amino acids 5 through 7 of the peptide of SEQ ID NO. 1 with lysine or arginine (Table 1).

[0129]

[0130] Sequence Number Amino Acid Sequence (NC) 12345678KYQRRKKNKYKYQRRKRNKYKYQRRRKNKYKYQRRRRNKYKYQRKKKNKYKYQRKRKNKYKYQRKKRNKYKYQRKRRNKY

[0131] Next, the peptide of group 2 was synthesized by substituting amino acids 5 through 7 of the peptide of SEQ ID NO. 1 with lysine or arginine, and substituting amino acid 8 with serine (Table 2).

[0132] Sequence Number Amino Acid Sequence (NC) 910111213141516KYQRRKKSKYKYQRRKRSKYKYQRRRKSKYKYQRRRRSKYKYQRKKKSKYKYQRKRKSKYKYQRKKRSKYKYQRKRRSKY

[0133] Next, the peptide of group 3 was synthesized by substituting amino acids 5 through 7 of the peptide of SEQ ID NO. 1 with lysine or arginine, and substituting amino acid 9 with tyrosine (Table 3).

[0134] Sequence Number Amino Acid Sequence (NC) 1718192021222324KYQRRKKNYKKYQRRKRNYKKYQRRRKNYKKYQRRRRNYKKYQRKKKNYKKYQRKRKNYKKYQRKKRNYKKYQRKRRNYK

[0135] Next, the peptide of group 4 was synthesized by substituting amino acids 5 through 7 of the peptide of SEQ ID NO. 1 with lysine or arginine, substituting amino acid 8 with serine, substituting amino acid 9 with tyrosine, and substituting amino acid 10 with lysine (Table 4).

[0136] Sequence Number Amino Acid Sequence (NC) 2526272829303132KYQRRKKSYKKYQRRKRSYKKYQRRRKSYKKYQRRRRSYKKYQRKKKSYKKYQRKRKSYKKYQRKKRSYKKYQRKRRSYK

[0137] Next, the peptide of group 5 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with arginine, substituting the 4th amino acid with glutamine, and substituting the 5th to 7th amino acids with lysine or arginine (Table 5).

[0138] Sequence Number Amino Acid Sequence (NC) 3334353637383940KYRQRKKNKYKYRQRKRNKYKYRQRRKNKYKYRQRRRNKYKYRQKKKNKYKYRQKRKNKYKYRQKKRNKYKYRQKRRNKY

[0139] Next, the peptide of group 6 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with arginine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, and substituting the 8th amino acid with serine (Table 6).

[0140] Peptide Sequence Number of Group 6 Amino Acid Sequence (NC) 4142434445464748KYRQRKKSKYKYRQRKRSKYKYRQRRKSKYKYRQRRRSKYKYRQKKKSKYKYRQKRKSKYKYRQKKRSKYKYRQKRRSKY

[0141] Next, the peptide of group 7 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with arginine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, substituting the 9th amino acid with tyrosine, and substituting the 10th amino acid with lysine (Table 7).

[0142] Sequence Number Amino Acid Sequence (NC) 4950515253545556KYRQRKKNYKKYRQRKRNYKKYRQRRKNYKKYRQRRRNYKKYRQKKKNYKKYRQKRKNYKKYRQKKRNYKKYRQKRRNYK

[0143] Next, the peptide of group 8 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with arginine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, substituting the 8th amino acid with serine, substituting the 9th amino acid with tyrosine, and substituting the 10th amino acid with lysine (Table 8).

[0144] Sequence Number Amino Acid Sequence (NC) 5758596061626364KYRQRKKSYKKYRQRKRSYKKYRQRRKSYKKYRQRRRSYKKYRQKKKSYKKYRQKRKSYKKYRQKKRSYKKYRQKRRSYK

[0145] Next, the peptide of group 9 was synthesized by substituting amino acid 3 of the peptide of SEQ ID NO. 1 with lysine, amino acid 4 with glutamine, and amino acids 5 through 7 with lysine or arginine (Table 9).

[0146] Sequence Number Amino Acid Sequence (NC) 6566676869707172KYKQRKKNKYKYKQRKRNKYKYKQRRKNKYKYKQRRRNKYKYKQKKKNKYKYKQKRKNKYKYKQKKRNKYKYKQKRRNKY

[0147] Next, the peptide of group 10 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with lysine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, and substituting the 8th amino acid with serine (Table 10).

[0148] Sequence Number Amino Acid Sequence (NC) 7374757677787980KYKQRKKSKYKYKQRKRSKYKYKQRRKSKYKYKQRRRSKYKYKQKKKSKYKYKQKRKSKYKYKQKKRSKYKYKQKRRSKY

[0149] Next, the peptide of group 11 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with lysine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, substituting the 9th amino acid with tyrosine, and substituting the 10th amino acid with lysine (Table 11).

[0150] Sequence Number Amino Acid Sequence (NC) 8182838485868788KYKQRKKNYKKYKQRKRNYKKYKQRRKNYKKYKQRRRNYKKYKQKKNYKKYKQKRKNYKKYKQKKRNYKKYKQKRRNYK

[0151] Finally, the peptide of group 12 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with lysine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, substituting the 8th amino acid with serine, substituting the 9th amino acid with tyrosine, and substituting the 10th amino acid with lysine (Table 12).

[0152] Sequence Number Amino Acid Sequence (NC) 8990919293949596KYKQRKKSYKKYKQRKRSYKKYKQRRKSYKKYKQRRRSYKKYKQKKKSYKKYKQKRKSYKKYKQKKRSYKKYKQKRRSYK

[0153]

[0154] 2. Silico analysis for predicting the anti-inflammatory function of peptides

[0155]

[0156] The function of the peptide synthesized through Example 1 as an anti-inflammatory peptide was predicted using the AlPpred predictor (http: / kurata14.bio.kyutech.ac.jp / PreAIP / ).

[0157] The function of peptides as anti-inflammatory peptides was predicted using the AlPpred predictor. As shown in Table 13, to predict anti-inflammatory peptide function, peptides with a score range of 0.388 or higher and a specificity of 80% or higher were predicted as anti-inflammatory peptides.

[0158]

[0159] Criteria Table for Anti-inflammatory Peptide Screening Label Score range Sensitivity Specificity High Confidence Score ≥0.468 63.22% 90.30% Medium Confidence 0.468 Score ≥0.388 71.90% 80.11% Low Confidence 0.388 Score ≤0.342 78.39% 70.87%

[0160] To identify anti-inflammatory peptides, the sequences of 96 peptides, SEQ ID NOs 1 to 96, were analyzed. As shown in Table 13 above, peptides with an anti-inflammatory peptide analysis score range of 0.388 or higher via AlPpred analysis were selected and are shown in Table 14. Among the 96 peptides, peptides SEQ ID NOs 55, 66, 81, 82, and 85 showed medium confidence, and among the remaining 91 peptides, peptides SEQ ID NOs 1 to 54, SEQ ID NOs 56 to 65, SEQ ID NOs 67 to 80, SEQ ID NOs 83 to 84, and SEQ ID NOs 86 to 96 showed high confidence (Table 14).

[0161] In particular, the peptides of SEQ ID NOs 67, 68, 70, 72, 75, 76, 78, 80, 83, 84, 86, 88, 91, 92, 94 and 96, in the following KY-R1-R2-R3-R4-R5-R6-R7-R8 (General Formula 1), more preferably in terms of the balance of anti-inflammatory activity and various properties, R1 is lysine (K) or glutamine (Q), R2 is glutamine (Q), R3 is lysine (K) or arginine (R), R4 is arginine (R), R5 is arginine (R) or lysine (K), R6 is serine (S) or asparagine (N), and R7 and R8 are tyrosine (Y) or lysine (K), and showed High Confidence in terms of the balance of anti-inflammatory activity and various properties. Such amino acid combinations can optimize the function of peptides.

[0162] Specifically, the arrangement of lysine and glutamine near the N-terminus regulates positive charge distribution, and glutamine at the R2 position enhances anti-inflammatory activity. Serine or asparagine at the R6 position increases structural flexibility, while tyrosine and lysine at the R7 and R8 positions improve cell permeability. The combination of arginine and lysine at the R3, R4, and R5 positions optimizes immunomodulatory functions. This amino acid sequence improves the anti-inflammatory activity, structural stability, cell permeability, and immunomodulatory functions of the peptide, thereby enabling it to effectively treat inflammatory diseases in the oral cavity.

[0163]

[0164] 항염증 펩타이드 (anti-inflammatory peptide, AIP) 스크리닝서열번호SequenceCombined RF Score1KYQRRKKNKY0.5832KYQRRKRNKY0.5463KYQRRRKNKY0.6324KYQRRRRNKY0.595KYQRKKKNKY0.5766KYQRKRKNKY0.5587KYQRKKRNKY0.5068KYQRKRRNKY0.5489KYQRRKKSKY0.5710KYQRRKRSKY0.54511KYQRRRKSKY0.6212KYQRRRRSKY0.59413KYQRKKKSKY0.55714KYQRKRKSKY0.54515KYQRKKRSKY0.50716KYQRKRRSKY0.54417KYQRRKKNYK0.54818KYQRRKRNYK0.52319KYQRRRKNYK0.59120KYQRRRRNYK0.53221KYQRKKKNYK0.52622KYQRKRKNYK0.5123KYQRKKRNYK0.47924KYQRKRRNYK0.49325KYQRRKKSYK0.55926KYQRRKRSYK0.53627KYQRRRKSYK0.60428KYQRRRRSYK0.56129KYQRKKKSYK0.54530KYQRKRKSYK0.53531KYQRKKRSYK0.50932KYQRKRRSYK0.52133KYRQRKKNKY0.51434KYRQRKRNKY0.54835KYRQRRKNKY0.55736KYRQRRRNKY0.57537KYRQKKKNKY0.5638KYRQKRKNKY0.55639KYRQKKRNKY0.54240KYRQKRRNKY0.56241KYRQRKKSKY0.51942KYRQRKRSKY0.55743KYRQRRKSKY0.55844KYRQRRRSKY0.58945KYRQKKKSKY0.56646KYRQKRKSKY0.55547KYRQKKRSKY0.55848KYRQKRRSKY0.56349KYRQRKKNYK0.47250KYRQRKRNYK0.47551KYRQRRKNYK0.4952KYRQRRRNYK0.51453KYRQKKKNYK0.51154KYRQKRKNYK0.4755KYRQKKRNYK0.46256KYRQKRRNYK0.51957KYRQRKKSYK0.51558KYRQRKRSYK0.50359KYRQRRKSYK0.52960KYRQRRRSYK0.55 161KYRQKKKSYK0.55262KYRQKRKSYK0.51563KYRQKKRSYK0.50864KYRQKRRSYK0.54665KYKQRKKNKY0.47766 KYKQRKRNKY0.46367KYKQRRKNKY0.54168KYKQRRRNKY0.58169KYKQKKKNKY0.47770KYKQKRKNKY0.54371KY KQKKRNKY0.47272KYKQKRRNKY0.54773KYKQRKKSKY0.49174KYKQRKRSKY0.49275KYKQRRKSKY0.54576KYKQR RRSKY0.59377KYKQKKKSKY0.49378KYKQKRKSKY0.54179KYKQKKRSKY0.49380KYKQKRRSKY0.55381KYKQRKK NYK0.43582KYKQRKRNYK0.46483KYKQRRKNYK0.47584KYKQRRRNYK0.53885KYKQKKKNYK0.44786KYKQKRKNYK 0.49387KYKQKKRNYK0.47588KYKQKRRNYK0.51389KYKQRKKSYK0.48990KYKQRKRSYK0.50691KYKQRRKSYK0.5 2192KYKQRRRSYK0.57393KYKQKKKSYK0.51194KYKQKRKSYK0.53895KYKQKKRSYK0.52596KYKQKRRSYK0.553.

[0165]

[0166] 3. 사람유래 치은섬유아세포 및 치주인대세포 분리 및 배양

[0167]

[0168] Human gingival fibroblasts and periodontal ligament cells were isolated from the gingival tissue and wisdom tooth periodontal ligament tissue of 10 adults (aged 18–22) at Seoul National University Dental Hospital. Specifically, all experiments were conducted after obtaining approval from the hospital's Institutional Review Board and informed consent from the patients. Gingival tissue and periodontal ligament tissue attached to the roots of wisdom teeth were isolated, finely sliced ​​on both sides, placed in 60 mm dishes, covered with coverslips, and cultured in α-MEM / 10% FBS medium. To establish an in vitro inflammatory cell model, the cells were treated with lipopolysaccharide (LPS) isolated from Porphyromonas gingivalis or LPS isolated from E. coli at a concentration of 1 µg / ml. Peptides for evaluating anti-inflammatory efficacy were treated at a concentration of 10 µg / ml.

[0169] Each cell was washed with α-MEM / 10% FBS culture medium and 2.5×10⁶ in the same culture medium 5 Cells were cultured in a 60 mm culture dish at a rate of cells / mL.

[0170]

[0171] The next day, the culture medium was exchanged, and the experiment was performed under the following conditions.

[0172] - Negative control group

[0173] - LPS alone treatment group (inflammation induction)

[0174] - SEQ ID No. 96 peptide single treatment group

[0175] - LPS treatment group + SEQ ID NO. 96 peptide treatment group (Verification of preventive effect)

[0176] - Group treated with LPS 24 hours prior + SEQ ID NO. 96 peptide (Verification of therapeutic effect)

[0177] After 48 hours, RNA was extracted to synthesize cDNA for real-time gene analysis, and the following gene expressions were analyzed using a real-time gene amplifier.

[0178]

[0179] 4. Real-time PCR analysis

[0180]

[0181] Total RNA from human periodontal ligament cells was isolated using the TRIzol reagent. cDNA was synthesized using 2 µg of total RNA, 1 µl of reverse transcriptase, and 0.5 µg of oligo (dT). The synthesized cDNA from human gingival fibroblasts and periodontal ligament cells was used in real-time polymerase chain reaction (RePCR) using the primers listed in Table 1. The RePCR was performed using SYBR GREEN PCR Master Mix (Takara, Japan) on an ABI PRISM 7500 sequence detection system (Applied Biosystems). The RePCR was conducted under conditions of 94°C for 1 min; 95°C for 15 sec; and 60°C for 34 sec, repeated for 40 cycles. The results were evaluated using the comparative cycle threshold (CT) method.

[0182]

[0183] Nucleotide Sequences of Real-Time PCR PrimersGenePrimer (5'-3')서열번호hTNF-αforwardCCTGGTATGAGCCCATCTATCTG97reverseGCAATGATCCCAAAGTAGACCTG98hIL-1αforwardTGTATGTGACTGCCCAAGATGAAG99reverseAGAGGAGGTTGGTCTCACTACC100hIL-1βforwardCCAGGGACAGGATATGGAGCA101reverseTTCAACACGCAGGACAGGTACAG102hIL-6forwardCGAAAGTCAACTCCATCTGCC103reverseGGCAACTGGCTGGAAGTCTCT104hCXCL10forwardTGCCATTCTGATTTGCTGCC105reverseTGCAGGTACAGCGTACAGTT106hCOX2forwardTTCTCCTTGAAAGGACTTATGGGTAA107reverseAGAACTTGCATTGATGGTGACTGTTT108hGAPDHforwardCCATGGAGAAGGCTGGGG109reverseCAAAGTTCTCATGGATGACC110

[0184]

[0185] 5. 웨스턴 분석

[0186]

[0187] To isolate proteins, cells were washed with PBS. Under general conditions for cell harvesting, and to effectively precipitate cells without damaging them, cells were collected by centrifuging at a rate of 1,000 xg for approximately 5 minutes at a low temperature (approx. 4 °C). After removing the supernatant, the pellet was dissolved in lysis buffer (100 mM Tris, pH 7.4, 350 mM NaCl, 10% glycerol, 1% Nonidet P-40, 1 mM EDTA, 1 mM dithiothreitol, 1x protease inhibitor (Sigma-Aldrich, St. Louis, MO, USA)) and incubated on ice for 15 minutes. Cell debris was removed by centrifugation at 16,000 xg for 15 minutes at a low temperature, and only the supernatant was collected. 30 μg of protein was separated by electrophoresis and transferred to a PVDF membrane. The membrane was blocked with 5% nonfat dry milk in PBS (PBS-T) containing 0.1% Tween 20, washed with PBS-T, and then reacted with anti-TLR2 and pNfkb antibodies at a 1:1000 ratio. After washing, the membrane was reacted with anti-rabbit IgG conjugated horseradish peroxidase (1:5000) (Santa Cruz Biotechnology) for about one hour, and then the bands were checked using an enhanced chemiluminescence system (Amersham Biosciences).

[0188]

[0189] 6. Immunohistochemical analysis in an animal model of single-wall periodontal tissue defects

[0190]

[0191] The first premolar, third premolar, and first molar of experimental animals are extracted, and 8 weeks after extraction, 5x5 mm box-type 1-wall periodontal defects are formed in the distal portion of the second premolar and the mesial and distal portions of the fourth premolar. Each defect is fixed using a metal strip. 4 weeks after the formation of the periodontal defects, regenerative treatment is performed on experimental groups with different concentrations of peptide SEQ No. 96, randomly assigned.

[0192] Group 1: No treatment (control group).

[0193] Group 2: Bone graft material + Membrane + PBS.

[0194] Group 3: Bone graft material + membrane + peptide of sequence number 96 50 μg (TBD).

[0195] Group 4: Bone graft material + membrane + peptide of sequence number 96 100 μg (TBD).

[0196] Group 5: Bone graft material + membrane + peptide of sequence number 96 250 μg (TBD).

[0197] Animals with periodontal tissue defects were sacrificed at 6 and 12 weeks after regenerative treatment, and tissue samples were collected. Immunohistochemical staining was performed to determine the effect of peptide SEQ No. 96 on the expression of the inflammatory factor iNOS. Approximately, the excised tissues were fixed in 4% paraformaldehyde, decalcified in 10% EDTA (pH 7.4), embedded in paraffin, and then immunostained using an anti-iNOS antibody diluted 1:150 as the primary antigen. Afterward, an immune response was performed using biotin-labeled goat anti-rabbit IgG (Vector Labs) as the secondary antigen to measure the level of iNOS.

[0198]

[0199] 7. Statistical Analysis

[0200]

[0201] All experimental data were expressed as the difference between the mean and standard deviation (mean standard deviation). The significance of the results for each group was determined by one-way analysis of variance using SPSS 26, and a P-value of less than 0.05 was considered statistically significant.

[0202]

[0203]

[0204] Experimental Example:

[0205]

[0206] 1. Effects of synthesized peptides on TNF-α gene expression in LPS-induced inflammatory response of gingival fibroblasts

[0207]

[0208] The peptide of sequence number 96 showed good performance in the prediction model, with a Combined RF Score of approximately 0.553, which falls into the High Confidence AIP category and is an above-average score. This score suggests that the peptide is highly likely to possess anti-inflammatory activity and demonstrates balanced performance without the risk of overfitting or reduced specificity. Therefore, the peptide of sequence number 96 is expected to function effectively in actual biological environments, and based on this, the following analysis was conducted.

[0209] To evaluate the anti-inflammatory effect of the peptide, the anti-inflammatory effect was evaluated after treatment with the peptide of SEQ ID NO. 96 (hereinafter referred to as the peptide) at a concentration of 10 µg / ml. Gingival fibroblasts were tested for the expression of the inflammatory factor TNF-α gene under the following conditions.

[0210] - Negative control group

[0211] - LPS alone treatment group (inflammation induction)

[0212] - Group treated alone with peptide SEQ No. 96

[0213] - LPS treatment group + SEQ ID No. 96 peptide treatment group (Periodontitis prevention effect confirmed)

[0214] - Group treated with 24-hour LPS pretreatment + Sequence No. 96 peptide (Confirmation of periodontitis treatment effect)

[0215]

[0216] To confirm the anti-inflammatory effect of the peptide on LPS-induced inflammatory responses, TNF-α gene expression was measured after treatment with the peptide (SEQ No. 96) under the above experimental conditions. In the group treated with LPS alone, TNF-α gene expression was observed to increase by more than twofold. However, in the group treated with the peptide alone, TNF-α gene expression was observed to decrease by approximately fivefold. To confirm the preventive effect against gingivitis, the group treated with both LPS and the peptide was found to suppress TNF-α gene expression similarly to the group treated with the peptide alone. Furthermore, to confirm the therapeutic effect of the peptide on periodontitis, an inflammatory response was induced by pre-treatment with LPS for 24 hours, followed by treatment with the peptide to verify the therapeutic effect on the inflammatory response. As a result, it was confirmed that even when the peptide was treated after inducing an inflammatory response with LPS, TNF-α gene expression was significantly reduced, similar to other experimental groups (Fig. 1, A).

[0217] Therefore, among the remaining 91 peptides at the High confidence level including SEQ ID NO. 96, peptides SEQ ID NOs 1 to 54, SEQ ID NOs 56 to 65, SEQ ID NOs 67 to 80, SEQ ID NOs 83 to 84, and SEQ ID NOs 86 to 95 can be expected to exhibit not only a preventive effect against gingivitis but also a therapeutic effect in vitro.

[0218]

[0219] 2. Effects of Peptides on IL-1-α, IL-1β, and IL-6 Gene Expression in the LPS-Induced Inflammatory Response of Gingival Fibroblasts

[0220]

[0221] To confirm the anti-inflammatory effect of the peptide, gene expression of other inflammatory factors, IL1-a (Fig. 1, B), IL-1b (Fig. 1, C), and IL-6 (Fig. 1, D), was checked after treatment with the peptide under the above experimental conditions. Similar to the TNF-α gene expression results, it was confirmed that the gene expression of IL1-a, IL-1b, and IL-6 was significantly reduced in the group treated with peptide SEQ No. 96 alone, with LPS, and in the group treated with peptide SEQ No. 96 after 24 hours of LPS pretreatment, compared to the control group and the LPS-treated group.

[0222]

[0223] 3. Effects of Peptide SEQ No. 96 on CXCL10 and COX2 Gene Expression in LPS-Induced Inflammatory Response of Gingival Fibroblasts

[0224]

[0225] To confirm the anti-inflammatory effect of the selected peptide, the peptide was treated under the above experimental conditions, and then the gene expression of another inflammatory chemokine (Fig. 2) (CXCL10) and an inflammatory enzyme (Fig. 3) COX2 was checked.

[0226]

[0227] Similar to the previous results on inflammatory factor gene expression, it was confirmed that the expression of CXCL10 and COX2 genes was significantly reduced in the group treated with peptide number 96 alone, with LPS, and in the group treated with peptide number 96 after 24 hours of LPS pretreatment, compared to the control group and the LPS-treated group.

[0228]

[0229] 4. Effects of Selected Peptides on TNF-α Gene Expression in LPS-Induced Inflammatory Response of Periodontal Ligament Cells

[0230]

[0231] To evaluate the anti-inflammatory effect of the selected peptides, the anti-inflammatory effect was evaluated after treatment with the peptides at a concentration of 10 µg / ml. Periodontal ligament cells were tested for the expression of the inflammatory factor TNF-α gene under the following conditions.

[0232] - Negative control group

[0233] - LPS alone treatment group (inflammation induction)

[0234] - Group treated alone with peptide SEQ No. 96

[0235] - LPS treatment group + SEQ ID No. 96 peptide treatment group (Periodontitis prevention effect confirmed)

[0236] - Group treated with 24-hour LPS pretreatment + Sequence No. 96 peptide (Confirmation of periodontitis treatment effect)

[0237]

[0238] To confirm the anti-inflammatory effect of the selected peptide on the LPS-induced inflammatory response, TNF-α gene expression was measured after treatment with peptide SEQ No. 96 under the above experimental conditions. In the group treated with LPS alone, TNF-α gene expression was observed to increase by more than twofold. However, in the group treated with peptide SEQ No. 96 alone, TNF-α gene expression was observed to decrease by approximately fivefold. To confirm the preventive effect against periodontitis, the group treated with LPS and peptide SEQ No. 96 together was confirmed to suppress TNF-α gene expression similarly to the group treated with peptide SEQ No. 96 alone. In addition, to confirm the therapeutic effect of peptide SEQ No. 96 on periodontitis, an inflammatory response was induced by pretreatment with LPS for 24 hours, followed by treatment with peptide SEQ No. 96 to confirm the therapeutic effect on the inflammatory response. As a result, it was confirmed that even when peptide of sequence number 96 was treated after inducing an inflammatory response with LPS, TNF-α gene expression was significantly reduced, similar to other experimental groups (Fig. 4, A).

[0239] Therefore, among the remaining 91 peptides at the High confidence level including SEQ ID NO 96, peptides SEQ ID NO 1 to 54, SEQ ID NO 56 to 65, SEQ ID NO 67 to 80, SEQ ID NO 83 to 84, and SEQ ID NO 86 to 95 can be expected to exhibit not only a preventive effect against periodontitis but also a therapeutic effect in vitro.

[0240]

[0241] 5. Effects of Selected Peptides on IL1-α, IL-1β, and IL-6 Gene Expression in the LPS-Induced Inflammatory Response of Periodontal Ligament Cells

[0242]

[0243] To confirm the anti-inflammatory effect of the selected peptide, the gene expression of other inflammatory factors, IL1-a (Fig. 4, B), IL-1b (Fig. 4, C), and IL-6 (Fig. 4, D), was checked after treating with the peptide under the above experimental conditions. Similar to the TNF-α gene expression results, it was confirmed that the gene expression of IL1-a, IL-1b, and IL-6 was significantly reduced in the groups treated with the peptide alone, with LPS, and treated with the peptide after 24 hours of LPS pretreatment, compared to the control group and the LPS-treated group.

[0244]

[0245] 6. Effects of Peptide SEQ No. 96 on CXCL10 and COX2 Gene Expression in LPS-Induced Inflammatory Response of Periodontal Ligament Cells

[0246]

[0247] To confirm the anti-inflammatory effect of the selected peptide, peptide SEQ No. 96 was treated under the above experimental conditions, and then the gene expression of another inflammatory chemokine, (Fig. 5) (CXCL10), and the inflammatory enzyme, (Fig. 6) COX2 was checked. Similar to the results of the previous inflammatory factor gene expression, it was confirmed that the gene expression of CXCL10 and COX2 was significantly reduced in the group treated with peptide SEQ No. 96 alone, with LPS, and in the group treated with peptide SEQ No. 96 after 24 hours of LPS pretreatment, compared to the control group and the LPS-treated group.

[0248]

[0249] 7. Effects of Selected Peptides on the Phosphorylation of LPS Receptor TLR2 and Downstream Factor Nfkb in LPS-Induced Periodontal Ligament Cells

[0250]

[0251] The gingival epithelium serves as the first barrier against bacterial infection. Gingival epithelial cells express Toll-like receptors (TLRs), which can assist inflammatory cells in eliminating pathogens. Toll-like receptors (TLRs) can subsequently increase the expression of certain chemokines in epithelial cells via the NF-κB signaling pathway. LPS upregulates TLR2 expression in gingivitis and periodontitis. Western blot analysis was performed on the expression levels of TLR2 and p-NF-κB proteins in human periodontal ligament cells treated with LPS and / or peptide SEQ No. 96. The Western blot results showed that LPS significantly increased TLR2 protein expression compared to the control saline-treated group and the group treated with peptide SEQ No. 96 alone. Conversely, the LPS + peptide SEQ No. 96 treatment group showed significantly reduced results (Fig. 7, A).

[0252] Similarly, increased p-NF-κB protein expression is known to be a key transcription factor in the progression of inflammation, including gingivitis and periodontitis. Although LPS administration significantly increased p-NF-κB expression in human periodontal ligament cells, it was confirmed that p-NF-κB levels were significantly reduced when peptide SEQ No. 96 was treated alone or in combination with LPS (Fig. 7, B).

[0253]

[0254] 8. Effects of Selected Peptides on the Expression of Inflammatory Factor iNOS in a Single-Wall Periodontal Tissue Defect Animal Model

[0255]

[0256] To confirm the anti-inflammatory effect of the selected peptide, the expression of another inflammatory factor, iNOS (Fig. 8), was confirmed through immunohistochemical analysis after treatment with the peptide under the above experimental conditions. It was confirmed that the expression of iNOS was significantly reduced in the groups treated with different concentrations of the peptide compared to the control group (Fig. 8A to Fig. 8F) and the group treated only with bone block (Fig. 8B to Fig. 8G) at 6 weeks (Fig. 8AE) and 12 weeks (Fig. 8FJ).

[0257]

[0258] To summarize the above, inflammation is a physiological response of the body to combat bacteria, viruses, pathogenic invaders, and external stressors, and can be classified into two types: acute inflammation and chronic inflammation. Acute inflammation is an important response to injury and infection that protects against microorganisms and pathogens while simultaneously promoting tissue repair. In chronic inflammation, if the underlying stimulus is not removed, the inflammation persists and develops into a chronic state, which may result in persistent symptoms such as pain and redness in the affected area. Therefore, the peptide as an active ingredient in the embodiment of the present invention can be used to prevent or treat oral inflammation, including gingivitis and periodontitis.

[0259]

[0260] The present specification and drawings disclose preferred embodiments of the present invention. Although specific terms have been used, they are used merely in a general sense to facilitate the explanation of the technical content of the present invention and to aid in understanding the invention, and are not intended to limit the scope of the present invention. It is obvious to those skilled in the art that, in addition to the embodiments disclosed herein, other variations based on the technical concept of the present invention are possible.

[0261]

[0262] This research was funded by the Ministry of Health and Welfare and the Korea Health Industry Development Institute in 2024 (2460001057, "Research and Development of Dental Medical Technology")

Claims

A composition for the prevention, improvement, or treatment of oral inflammatory diseases comprising a peptide composed of the amino acid sequence of General Formula 1 below: KY-R1-R2-R3-R4-R5-R6-R7-R8(General Formula 1) In the above general formula 1, R1 is arginine (R), lysine (K), or glutamine (Q); R2 is arginine (R) or glutamine (Q); R3, R4, and R5 are each arginine (R) or lysine (K); R6 is asparagine (N) or serine (S); and R7 and R8 are lysine (K) or tyrosine (Y) am. In paragraph 1, A composition characterized in that the above peptide is an amino acid sequence of any one of SEQ ID NOs 1 to 96. A polynucleotide encoding the peptide of claim 1. An expression vector comprising the polynucleotide of claim 3. In paragraph 1, The above composition is characterized by comprising a polypeptide in which the peptides are repeatedly linked. In paragraph 1, The above composition is characterized by further comprising a pharmaceutically acceptable carrier, excipient, or diluent. In paragraph 1, A quasi-drug composition for the prevention or improvement of oral inflammatory diseases, characterized in that the above oral inflammatory disease is one or more selected from the group consisting of stomatitis, gingivitis, periodontitis, and periapical periodontitis. A quasi-drug composition for the prevention or improvement of oral inflammatory diseases, comprising a peptide composed of the amino acid sequence of General Formula 1 below: KY-R1-R2-R3-R4-R5-R6-R7-R8(General Formula 1) In the above general formula 1, R1 is arginine (R), lysine (K), or glutamine (Q); R2 is arginine (R) or glutamine (Q); R3, R4, and R5 are each arginine (R) or lysine (K); R6 is asparagine (N) or serine (S); and R7 and R8 are lysine (K) or tyrosine (Y). In paragraph 8, The above quasi-drug composition is characterized by being one formulation selected from the group consisting of oral rinses, toothpaste, oral sprays, oral gels, oral patches, tablets, capsules, lozenges, and gums. A method of preventing, improving, or treating inflammatory oral diseases by administering the composition of claim 1 to an individual other than a human.

Images