Novel peptide
A novel peptide promotes the regeneration of dentin, bone, and cementum, addressing the limitations of existing treatments for dentin-pulp and periodontal diseases by enhancing gene expression and tissue regeneration.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- HYSENSBIO CO LTD
- Filing Date
- 2025-12-15
- Publication Date
- 2026-06-25
AI Technical Summary
Current treatments for dentin-pulp and periodontal diseases, such as pulpitis and periodontitis, often result in weakened teeth, reinfection risks, and aesthetic issues, with materials like MTA and gutta-percha presenting limitations in efficacy and compatibility.
A novel peptide composed of specific amino acid sequences, capable of promoting the regeneration of hard tissues including dentin, bone, and cementum, and pulp tissue, is developed, along with a polynucleotide encoding the peptide and an expression vector for its delivery.
The peptide enhances the expression of genes associated with odontoblast, osteoblast, and cementoblast differentiation, leading to effective regeneration of dentin, bone, and cementum, and treats conditions like tooth hypersensitivity and periodontal diseases.
Smart Images

Figure KR2025021691_25062026_PF_FP_ABST
Abstract
Description
Novel peptide
[0001] The present invention relates to a novel peptide, and more specifically, to a peptide for regenerating hard tissues including dentin, bone, and cementum, promoting the regeneration of pulp tissue and periodontal tissue, and treating dentin hypersensitivity, a polynucleotide encoding said peptide, an expression vector including said polynucleotide, and a pharmaceutical composition for preventing or treating dentin disease, pulp disease, or periodontal disease including said peptide, a quasi-drug composition for preventing or improving dentin disease, pulp disease, or periodontal disease, and a health functional food composition for prevention or improvement.
[0002]
[0003] The pulp is the soft connective tissue filling the pulp cavity inside the tooth; it is richly supplied with nerves and blood vessels and extends to the surface layer of the dentin. Lesions occurring in this pulp are called pulp diseases.
[0004] The causes of pulp disease are very diverse, but in most cases, it is caused by bacterial infection from tooth decay or infection entering the pulp through tooth perforation, fracture, crack, or periodontal pockets. Additionally, trauma, abrasion, tooth cracks, and heat and friction from dental instruments during treatment can also trigger it. Pulpitis caused by bacterial infection can escalate into periapical disease and periodontal disease. When pulp disease occurs, it progresses in the order of pulp hyperemia, pulpitis, and pulp necrosis. In the case of pulp necrosis, the pulp dies and receives no blood supply, causing the entire periodontal tissue to disappear; this can eventually lead to periapical disease or abnormalities of the entire tooth.
[0005] The treatment of pulp and periapical diseases utilizes pulp replicas and root canal filling materials; generally, calcium hydroxide, MTA (Mineral Trioxide Aggregate), and gutta-percha have been used. While MTA is effective due to its sealing ability and biocompatibility, it presents challenges such as relatively high costs as a dental treatment and aesthetic issues caused by discoloration. Gutta-percha is economical and highly fluid, but it is an unphysiological treatment method that results in the loss of pulp vitality. To date, conservative treatments for dentin-pulp diseases have resulted in weakened or brittle treated teeth and carried a risk of reinfection.
[0006] Periodontal tissue is a complex organ composed of epithelial tissue, soft connective tissue, and calcified connective tissue. The structures of periodontal tissue include the gingiva, periodontal ligament (PDL), cementum, and alveolar bone. Gingival fibroblasts and periodontal ligament fibroblasts are major cellular components of gingival soft connective tissue and play a role in forming and maintaining the extracellular matrix. Among these, gingival fibroblasts are primarily involved in maintaining gingival connective tissue, whereas periodontal ligament fibroblasts are known to not only form the periodontal ligament due to their specific function but also to be involved in the restoration and regeneration of adjacent alveolar bone and cementum in vivo. Clinically, the occurrence of periodontal disease leads to tooth loss due to gingival bleeding and swelling, the formation of periodontal pockets, and the destruction of alveolar bone.
[0007] Since the ultimate goal of treating periodontal disease is to restore damaged connective tissue, cementum, and alveolar bone, this requires not only the regeneration of the periodontal ligament that supports the alveolar bone, but also the regeneration of alveolar bone and cementum to which the periodontal ligament can attach.
[0008] Accordingly, research is actively underway to develop therapeutic agents capable of effectively treating the aforementioned dentin pulp disease. For example, Korean Patent Publication No. 2012-0089547 discloses a composition for hard tissue formation and dentin or pulp tissue regeneration comprising ameloblasts, apical bud cells, or culture media thereof as active ingredients, and Korean Patent Publication No. 2009-0033643 discloses novel dental stem cells derived from dental cysts and a method for culturing them. Additionally, Korean Patent Publication No. 2016-0105627 discloses a composition for treating periodontal disease comprising ameloblast culture media.
[0009] Against this backdrop, the inventors, through diligent research efforts to develop a formulation capable of more effectively treating dentin-pulp disease and / or periodontal disease causing damage to alveolar bone and cementum, developed a peptide exhibiting effects of regenerating hard tissues including dentin, bone, and cementum, promoting the regeneration of pulp tissue and periodontal tissue, and treating dentin hypersensitivity, thereby completing the present invention.
[0010] The peptide according to an embodiment of the present invention is intended to provide cell therapy for promoting hard tissue regeneration or pulp tissue regeneration and / or therapeutic use for dentin hypersensitivity.
[0011] Another objective of the present invention is to provide a polynucleotide encoding the peptide.
[0012] Another objective of the present invention is to provide an expression vector comprising the polynucleotide.
[0013] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of periodontal disease that causes damage to periodontal tissues, including periodontal ligaments, bone, and cementum, comprising the above peptide.
[0014] Another objective of the present invention is to provide a quasi-drug composition for the prevention or improvement of periodontal disease that causes edema and / or pulp-related diseases and / or damage to periodontal tissues including periodontal ligaments, bone and cementum, comprising the above peptide.
[0015] Another objective of the present invention is to provide a method for preventing or treating periodontal disease that causes damage to periodontal tissues including periodontal ligaments, bone, and cementum, comprising the step of administering a composition containing the peptide to an individual.
[0016] Another object of the present invention is to provide a method for regenerating or promoting the regeneration of hard tissues including dentin, bone and cementum and / or pulp tissue and periodontal ligament, comprising the step of administering a composition containing the peptide to an individual other than a human.
[0017]
[0018] The objectives of the present invention are not limited to those mentioned above, and other unmentioned objectives will be clearly understood by those skilled in the art from the description below.
[0019]
[0020] As an embodiment for achieving the above-mentioned objective, the present invention provides a peptide composed of an amino acid sequence of the following general formula 1:
[0021] P-R1-R2-R3-R4-R5-R6-R7-R8-R9 (General Formula 1)
[0022] In the above general formula 1, R1 to R3 are each lysine (K) or arginine (R); R4 is each glycine (G), cysteine (C), lysine (K) or arginine (R); R5 to R8 are each lysine (K) or arginine (R); and R9 is each lysine (K), arginine (R) or tyrosine (Y).
[0023] According to one embodiment, the peptide may be composed of any one of the amino acid sequences of SEQ ID NOs 1 to 70.
[0024] According to one embodiment, the peptide may be acetylated, amidated, or methylated at the N-terminus or C-terminus; introduced with a D-amino acid; modified peptide bonds such as CH2-NH, CH2-S, CH2-S=O, or CH2-CH2; modified backbone; or modified side chain.
[0025] In another aspect, the present invention provides a polynucleotide encoding the peptide.
[0026] In another aspect, the present invention provides an expression vector comprising the polynucleotide.
[0027] In another aspect, the present invention provides a pharmaceutical composition for the prevention or treatment of dentin-pulp disease or periodontal disease comprising the above peptide.
[0028] According to one embodiment, the dentin-pulp disease is tooth hypersensitivity, dental caries, pain due to tooth fracture, pulp congestion, pulpitis, pulp degeneration, or necrosis and gangrene of the pulp, and the periodontal disease may be gingivitis, periodontitis, periodontal pocket, or periodontal abscess.
[0029] In another aspect, the present invention provides a quasi-drug composition for the prevention or improvement of periodontal disease that causes diarrhea and / or pulp-related diseases and / or bone and cementum damage, comprising the above peptide.
[0030] In another aspect, the present invention provides a health functional food composition for the prevention or improvement of periodontal disease that causes edema and / or pulp-related diseases and / or damage to periodontal tissues including periodontal ligaments, bone and cementum, comprising the above peptide.
[0031] In another aspect, the present invention provides a method for preventing or treating dentin-pulp disease comprising the step of administering a composition containing the peptide to an individual.
[0032] In another aspect, the present invention provides a method for preventing or treating periodontal disease comprising the step of administering a composition containing the peptide to an individual.
[0033] In another aspect, the present invention provides a method for promoting the regeneration of hard tissues including dentin, bone and cementum and / or pulp tissue and periodontal ligament, comprising the step of administering a composition containing the peptide to an individual.
[0034] The peptide according to an embodiment of the present invention can be used for cell therapy to promote hard tissue regeneration or pulp tissue regeneration and / or for the treatment of dentin hypersensitivity.
[0035] Another objective of the present invention is to provide a polynucleotide encoding the peptide.
[0036] Another objective of the present invention is to provide an expression vector comprising the polynucleotide.
[0037] Another objective of the present invention is to provide a pharmaceutical composition comprising the above peptide for the prevention or treatment of periodontal disease that causes dentin and / or pulp-related diseases and / or damage to periodontal tissues including periodontal ligaments, bone and cementum.
[0038] Another objective of the present invention is to provide a quasi-drug composition comprising the above peptide for the prevention or improvement of periodontal disease that causes edema and / or pulp-related diseases and / or damage to periodontal tissues including periodontal ligaments, bone and cementum.
[0039] Another objective of the present invention is to provide a method for preventing or treating periodontal disease that causes damage to periodontal tissues including periodontal ligaments, bone, and cementum, comprising the step of administering a composition containing the peptide to an individual.
[0040] Another objective of the present invention is to provide a method for regenerating or promoting the regeneration of hard tissues including dentin, bone and cementum and / or pulp tissue and periodontal ligament, comprising the step of administering a composition containing the peptide to an individual other than a human.
[0041] The peptide of the present invention for promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissue and periodontal ligament, and for treating dentin-pulp disease and / or periodontal disease, exhibits an excellent regeneration-promoting effect on hard tissues and / or pulp tissue and periodontal ligament, so it can be widely used in the development of agents for the prevention or treatment of various dentin-pulp diseases, or in the development of agents for the prevention or treatment of periodontal disease that causes damage to the periodontal ligament, bone, and / or cementum.
[0042]
[0043] The effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by those skilled in the art from the description below.
[0044]
[0045] Figure 1 shows the results of the effects of peptides of SEQ ID NO. 1 and SEQ ID NO. 48, among novel peptides with substituted amino acid base sequences, on the expression of DSPP (Dentin sialophosphoprotein), a marker gene for odontoblast differentiation, in human pulp cells.
[0046] Figure 2 shows the results of quantitative real-time PCR measuring the effect of peptides of SEQ ID NO. 1 and SEQ ID NO. 48, among novel peptides with substituted amino acid base sequences, on the expression of bone and cementum differentiation marker genes DMP1 (Dentin matrix protein 1) (A) and BSP (Bone sialoprotein) (B) in human periodontal ligament fibroblasts.
[0047] Figure 3 shows the results of quantitative real-time PCR measuring the effect of peptides of SEQ ID NO. 1 and SEQ ID NO. 48, among novel peptides with substituted amino acid base sequences, on the expression of CAP (Cementum attachment protein), a gene that attaches periodontal ligament fiber bundles to cementum and bone in human periodontal ligament fibroblasts.
[0048] Figure 4 shows the histological analysis of hard tissue regenerated in vivo using human-derived pulp cells (hDPCs). 100 mg HA / TCP alone (AC) and peptides of SEQ ID NO. 1 (DF) and SEQ ID NO. 48 (GI) (10 µg), respectively, were mixed into a 0.5% fibrin gel and implanted subcutaneously into immune-weakened mice for 12 weeks. The resulting tissue was then stained with hematoxin-eosin (HE) and observed (size bars, A, D, G: 500 µm / B, E, H: 200 µm / C, F, I: 100 µm).
[0049] Figure 5 shows the results of immunohistochemical analysis of the expression of DSP, an odontoblast differentiation marker, after staining hard tissues regenerated in vivo using human-derived pulp cells (hDPCs). (A) 100 mg HA / TCP alone, (B) and (C) mixed with the peptide of SEQ ID NO. 1 (10 µg) and the peptide of SEQ ID NO. 48 (10 µg), respectively, in a 0.5% fibrin gel and implanted subcutaneously in mice with compromised immune systems for 12 weeks. The formed hard tissues were immunostained using an anti-DSP antibody. A is the control group, and B and C represent the results of treatment with the peptides of SEQ ID NO. 1 and SEQ ID NO. 48, respectively (Size bar: 50 µm).
[0050] Figure 6 shows the results of immunohistochemical analysis on the expression of BSP, a marker for the differentiation of cementoblasts and osteoblasts, after staining hard tissues regenerated in vivo using human-derived pulp cells (hDPCs) using immunostaining. The results show the subcutaneous implantation of hDPCs in immune-compromised mice for 12 weeks, mixed in a 0.5% fibrin gel with (A) 100 mg HA / TCP alone, and (B) and (C) the peptide of SEQ ID NO. 1 (10 µg) and the peptide of SEQ ID NO. 48 (10 µg), respectively. The formed hard tissues were immunostained using an anti-BSP antibody. A is the control group, and B and C represent the results of treatment with the peptides of SEQ ID NO. 1 and SEQ ID NO. 48, respectively (Size bar: 50 µm).
[0051] Figure 7 shows the results of confirming the effects of peptides SEQ NO. 1 and SEQ NO. 48, respectively, on dentin regeneration in an animal model of tooth damage. The dentin of adult dog teeth was exposed using a dental bur, and 10 µg of each peptide was applied. The tooth tissue was analyzed after 3 weeks (Control (AC), peptide application of SEQ NO. 1 (DF), peptide application of SEQ NO. 48 (GI)). The area indicated by the dotted line in the figure represents the newly generated dentin (size bar: 100 µm, 50 µm).
[0052]
[0053] In order to develop a formulation capable of treating dentin-pulp disease and / or periodontal disease more effectively, the inventors conducted various studies and developed a novel peptide composed of 10 amino acids.
[0054] The novel peptide developed above is produced by partially substituting the amino acid sequence of a peptide capable of exhibiting therapeutic effects on dentin-pulp disease and / or periodontal disease. It can increase the expression levels of the odontoblast differentiation marker gene DSPP (Dentin sialophosphoprotein), the bone and cementum differentiation markers DMP1 (Dentin matrix protein 1) and BSP (Bone sialoprotein), and the gene CAP (Cementum attachment protein) that attaches periodontal ligament fiber bundles to cementum and bone, thereby exhibiting an effect that promotes dentin regeneration, as well as an effect that promotes the regeneration of periodontal ligaments, bone, and cementum.
[0055] In addition, an implant containing the peptide was prepared together with human pulp cells, and the prepared implant was transplanted into the subcutaneous tissue of a mouse with a compromised immune system. After 12 weeks, the transplanted tissue was analyzed, and it was confirmed that dentin-pulp-like tissue most similar to in vivo dentin-pulp tissue was formed, bone-like tissue most similar to in vivo bone tissue was formed, the expression of BSP, DMP1, and CAP genes related to bone and cementum regeneration increased, and the expression level of DSPP mRNA, an odontoblast-specific differentiation marker gene, increased.
[0056] Therefore, it was found that the peptide of the present invention can promote the regeneration of hard tissues and / or pulp tissues and exhibit effects on dentin-pulp disease and / or periodontal disease. The peptide of the present invention exhibiting such effects has never been reported before and was developed for the first time by the inventors.
[0057] In one embodiment, the present invention provides a peptide composed of an amino acid sequence of the following general formula 1:
[0058] P-R1-R2-R3-R4-R5-R6-R7-R8-R9 (General Formula 1)
[0059] In the above general formula 1, R1 to R3 are each lysine (K) or arginine (R); R4 is each glycine (G), cysteine (C), lysine (K) or arginine (R); R5 to R8 are each lysine (K) or arginine (R); and R9 is each lysine (K), arginine (R) or tyrosine (Y).
[0060] The term "hard tissue" in the present invention refers to relatively hard skeletal tissues including bone, hyaline cartilage, and fibrocartilage. In one embodiment according to the present invention, the hard tissue may include dentin, bone, and cementum.
[0061] The term "dentine" in the present invention refers to a hard, yellowish-white tissue that makes up most of the tooth, also called "dental tissue." Since the dentine is covered by enamel in the crown portion and cementum in the root portion, it is not exposed on the surface of the tooth; however, as age increases and the enamel wears away, the dentine may be exposed at the tip of the crown or on the occlusal surface. Although the dentine is a type of bone-like tissue, it is distinguished from general bone tissue in that the main body of the cells that make up the dentine is located within the dental pulp, and only the projections extend into the dentine.
[0062] The term "cementum" in the present invention refers to a thin membrane in the form of slightly deformed bone covering the tooth roots and other parts of mammals. The cementum is composed of 50% minerals and 50% water-organic matter, has a yellowish color, and exhibits lower hardness than dentin or enamel. The cementum contains periodontal ligament fibers that anchor the tooth to the alveolar bone; however, if bacteria infect the gums, degeneration of the cementum surrounding the tooth occurs, and the periodontal ligament fibers connecting the tooth to the alveolar bone cannot adhere to the degenerated cementum, causing the tooth to become loose. To treat such degeneration of the cementum, a method is used to remove the degenerated cementum and promote the formation of new cementum.
[0063] The peptide provided in the present invention can increase the expression levels of the DSPP gene, which is an odontoblast differentiation marker gene, and the DMP1 and BSP genes, which are osteoblast and cementoblast differentiation marker genes. When transplanted in vivo together with human pulp cells, the human pulp cells may exhibit the characteristic of forming dentin / pulp-like tissue and bone-like tissue. In addition, it can increase the expression level of CAP (Cementum attachment protein), a gene that attaches periodontal ligament fiber bundles to cementum and bone, thereby exhibiting an effect of promoting dentin regeneration as well as promoting bone and cementum regeneration.
[0064] Insofar as the peptide provided in the present invention can promote the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissue, and have therapeutic effects on dentin-pulp disease and / or periodontal disease, variant peptides having a sequence different from the amino acid sequence constituting the peptide and one or more amino acid residues are also included in the category of peptides provided in the present invention.
[0065] In general, amino acid exchanges in proteins and polypeptides that do not alter the overall activity of the molecule are known in the art. The most common exchanges occur between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. Additionally, Gly and Cys are both small amino acids that can provide similar flexibility in protein structure. Both amino acids play important roles in protein bending sites or loop structures and have been evolutionarily conserved. Therefore, the exchange of Gly / Cys can enable fine-tuning without significantly altering the overall structure and function of the protein.
[0066] In addition, it may include peptides in which structural stability against heat, pH, etc. is increased by mutation or modification in the amino acid sequence, or in which the ability to promote the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissue is increased.
[0067] Amino acid variation is based on the relative similarity of amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, etc. Since most of the 10 amino acids constituting the peptide of the present invention correspond to the hydrophilic amino acids lysine (K) and arginine (R), the relative similarity of the amino acid side chain substituents is high. In addition, since glycine (G) and cysteine (C) are small amino acids that provide structural flexibility, even if the amino acids constituting the peptide of the present invention are substituted with other amino acids having similar properties, the effects of the peptide provided by the present invention can be exhibited as they are due to their structural similarity. In particular, the exchange between lysine (K) and arginine (R), and the exchange between glycine (G) and cysteine (C), can introduce subtle structural changes while maintaining the overall characteristics of the peptide.
[0068] For example, lysine (K), a basic amino acid located at positions 2, 3, and 4 of the peptide (PKKKGKKKKY) of SEQ ID NO. 1 provided in the present invention, can exhibit the same effects of the peptide provided in the present invention even if it is substituted with arginine (R), another basic amino acid. Glycine (G), located at position 5 of the peptide of SEQ ID NO. 1, can maintain structural flexibility and exhibit the same effects of the peptide even if it is substituted with cysteine (C), a small amino acid. Lysine (K), located at positions 6, 7, and 8 of the peptide of SEQ ID NO. 1, can also exhibit the same effects of the peptide provided in the present invention even if it is substituted with arginine (R). Finally, tyrosine (Y), located at position 10, can maintain the overall characteristics of the peptide even if it is substituted with lysine (K) or arginine (R). These substitutions enable fine control without significantly changing the overall charge and structure of the peptide.
[0069] As such, even if lysine (K) and arginine (R), which are basic amino acids constituting the peptide of the present invention, are substituted for each other, the effects of the peptide provided by the present invention can be exhibited as they are. In addition, glycine (G) and cysteine (C) can also be substituted for each other. The tyrosine (Y) at the last position can be replaced with lysine (K) or arginine (R). Therefore, it can be seen that variant peptides having a sequence in which one or more amino acid residues differ from the amino acid sequence constituting the peptide of the present invention are also included in the category of the peptide provided by the present invention. These variants can enable fine functional control while maintaining the overall charge characteristics and structural flexibility of the peptide.
[0070] In addition, the peptide of the present invention is included in the category of the peptide provided by the present invention, as it can exhibit the same effects as the peptide provided by the present invention even if it has a form in which any amino acid is added to its N-terminus or C-terminus. As one example, the peptide may have a form in which 1 to 300 amino acids are added to its N-terminus or C-terminus, as another example, the peptide may have a form in which 1 to 100 amino acids are added to its N-terminus or C-terminus, and as yet another example, the peptide may have a form in which 1 to 24 amino acids are added to its N-terminus or C-terminus.
[0071] The peptide of the present invention may be in a modified form in which its N-terminus and / or C-terminus, etc. are chemically modified or protected by an organic group, or amino acids are added to the peptide terminals, etc., in order to protect against protein-cleaving enzymes in vivo and increase stability. In particular, in the case of a chemically synthesized peptide, since the N- and C-terminus carry charges, the N-terminus may be acetylated, the N-terminus may be methylated and / or the C-terminus may be amidated to remove these charges, or may include the introduction of D-amino acids, peptide bond modifications such as CH2-NH, CH2-S, CH2S=O, and CH2-CH2, backbone modifications, and side chain modifications, but are not limited thereto. Methods for preparing peptide mimic compounds are known in the art, for example, refer to the contents described in Quantitative Drug Design, CA Ramsden Gd., Choplin Pergamon Press (1992).
[0072] The term "backbone modification" in the present invention refers to the process of directly modifying the amino acids constituting the peptide backbone into amino acid analogs, wherein the main chain-like or ring-like framework of the amino acids constituting the peptide backbone is called the backbone. An amino acid analog refers to an amino acid in which a hydrogen atom at the nitrogen or carbon of the amino acid backbone is modified by substitution.
[0073] The term "side-chain modification" in the present invention refers to the modification of amino acid side-chains, which are groups of atoms branching off like branches from the main chain-shaped or ring-shaped backbone of the amino acids constituting the peptide, using chemical substances. Examples of peptide side-chain modification include: reduction alkylation; amidiation by methylacetimidate; alkylation by acetic anhydride; carbamorylation of an amino group by cyanate; trinitrobenzylation of an amino acid by 2,4,6-trinitrobenzenesulfonic acid (TNBS); alkylation of an amino group by succin anhydride; or modification of an amino group such as pyridoxylation, which is reduced to NaBH4 after treatment with pyridoxal-5 phosphate.
[0074] In addition, the peptide of the present invention may be used alone, but may also be used in combination with a carrier approved as a drug, such as an organic solvent, and may be used with antioxidants such as ascorbic acid, glutathione, chelating agents, low molecular weight proteins, or other stabilizers to increase stability and efficacy.
[0075] According to one embodiment of the present invention, 70 types of peptides corresponding to General Formula 1 provided by the present invention were synthesized, and the effect of the synthesized peptides on the expression level of the DSPP gene, an odontoblast differentiation marker gene, was verified. As a result, it was confirmed that compared to the mRNA level of the DSPP gene, an odontoblast differentiation marker measured in human pulp cells not treated with the peptides of the present invention (control group), the mRNA level of the DSPP gene in human pulp cells treated with the 70 types of peptides was at least 14 times, or at least 6 times, or at least 2 times, or at least at least 1.7 times (Fig. 1 and Table 3).
[0076] As reported so far, it is known that an increase in the mRNA expression level of DSPP promotes odontoblast differentiation and dentin regeneration; therefore, it was found that the 70 types of peptides exhibiting the effect of increasing the mRNA level of the DSPP gene also exhibit the effect of promoting odontoblast differentiation and dentin regeneration (Taduru Sreenath et al., THE JOURNAL OF BIOLOGICAL CHEMISTRY, Vol. 278, No. 27, Issue of J㎕y 4, pp. 24874-24880, 2003; William T. Butler et al, Connective Tissue Research, 44(Suppl. 1): 171178, 2003).
[0077] In addition, the effects of the synthesized peptides on the expression of the DMP1 gene, BSP gene, and CAP gene, which are osteoblast / cementoblast differentiation marker genes, were verified. As a result, compared to the mRNA level of the BSP gene, an osteoblast / cementoblast differentiation marker measured in human pulp cells not treated with the peptides of the present invention (control group), it was confirmed that the DMP1 mRNA expression in human pulp cells treated with the 70 types of peptides increased by approximately 1.8 to 14 times or more, and the mRNA level of the BSP gene increased by approximately 1.7 to 5 times or more (see Tables 4, 5 and Fig. 2). Furthermore, it was confirmed that the mRNA level of the CAP gene increased by approximately 1.8 to 4 times or more (see Table 6 and Fig. 3). These results suggest that the peptides of the present invention have an effect of promoting the regeneration of bone and cementum.
[0078] The DMP1 and BSP genes are used as differentiation markers for osteoblasts and cementoblasts and are known to be genes involved in the calcification process of bone and cementum. Additionally, the CAP gene is known to be a gene that attaches periodontal ligament fiber bundles to cementum and bone. Therefore, it can be seen that the 70 types of peptides of the present invention have the effect of promoting osteoblast / cementoblast differentiation and promoting the regeneration of bone and cementum, and these results demonstrate that the peptides of the present invention can potentially play an important role in the field of periodontal tissue regeneration and dental regenerative medicine.
[0079] In another aspect, the present invention provides a polynucleotide encoding the peptide.
[0080] The above polynucleotide may be modified by substitution, deletion, insertion, or a combination thereof, of one or more bases. When preparing a nucleotide sequence by chemical synthesis, synthesis methods widely known in the art, such as the method described in the literature (Engels and Uhlmann, Angew Chem IntEd Engl., 37:73-127, 1988), may be used, and synthesis may be performed using the triester, phosphite, phosphoramidite, and H-phosphate methods, PCR and other autoprimer methods, and solid support oligonucleotide synthesis methods.
[0081] In another aspect, the present invention provides an expression vector comprising the polynucleotide, a transformant comprising the expression vector, and a method for producing the peptide using the transformant.
[0082] The term "expression vector" in the present invention refers to a recombinant vector capable of expressing a target peptide in a target host cell, comprising a genetic construct that includes essential regulatory elements operably linked to enable the expression of a gene insert. The expression vector comprises expression regulatory elements such as a start codon, a stop codon, a promoter, and an operator, wherein the start codon and the stop codon are generally considered to be part of a nucleotide sequence encoding a polypeptide, must exhibit action in the individual when the genetic construct is administered, and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.
[0083] The term "operably linked" in this invention refers to a state in which a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding a target protein or RNA are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to influence the expression of the coding sequence. Operatory linkage with an expression vector can be prepared using gene recombination technology well known in the art, and site-specific DNA cleavage and linkage can be performed using enzymes or the like generally known in the art.
[0084] Additionally, the expression vector may include a signal sequence for the release of the peptide to facilitate the separation of the peptide from the cell culture medium. A specific initiation signal may also be required for the efficient translation of the inserted nucleic acid sequence. These signals include an ATG start codon and adjacent sequences. In some cases, an exogenous translation regulatory signal that may include an ATG start codon must be provided. These exogenous translation regulatory signals and start codons may be from various natural and synthetic sources. Expression efficiency may be increased by the introduction of appropriate transcription or translation enhancing factors.
[0085] In addition, the expression vector may additionally include a protein tag that can be removed using an endopeptidase, optionally, to facilitate the detection of the peptide.
[0086] The term "tag" in the present invention refers to a molecule exhibiting quantifiable activity or characteristics, and may be a fluorescent molecule including a chemical fluorescent substance (fluoracer) such as fluorescein, a polypeptide fluorescent substance such as fluorescent protein (GFP) or related protein; or may be an epitope tag such as a Myc tag, Flag tag, histidine tag, leucine tag, IgG tag, streptavidin tag, etc. In particular, when using an epitope tag, a peptide tag composed preferably of 6 or more amino acid residues, and more preferably composed of 8 to 50 amino acid residues, may be used.
[0087] In the present invention, the expression vector may include a nucleotide sequence encoding a peptide for promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissues and for treating dentin-pulp diseases and / or periodontal diseases as described above. The vector used is not particularly limited to this, as long as it can produce the peptide, but preferably may be plasmid DNA, phage DNA, etc., and more preferably may be a commercially developed plasmid (pUC18, pBAD, pIDTSAMRT-AMP, etc.), an E. coli-derived plasmid (pYG601BR322, pBR325, pUC118, pUC119, etc.), a Bacillus subtilis-derived plasmid (pUB110, pTP5, etc.), a yeast-derived plasmid (YEp13, YEp24, YCp50, etc.), or phage DNA (Charon4A, Charon21A, EMBL3, It can be EMBL4, λgt10, λgt11, λZAP, etc.), animal virus vectors (retrovirus, adenovirus, vaccinia virus, etc.), or insect virus vectors (baculovirus, etc.). Since the expression amount and modification of the protein vary depending on the host cell, it is desirable to select and use the host cell most suitable for the purpose.
[0088] The transformant provided in the present invention can be produced by introducing the expression vector provided in the present invention into a host and transforming it, and can be used to produce the peptide by expressing the polynucleotide contained in the expression vector. The transformation can be performed by various methods, and is not particularly limited thereto as long as the peptide can be produced, but methods such as the CaCl2 precipitation method, the Hanahan method which increases efficiency by using a reducing agent called DMSO (dimethyl suloxide) in the CaCl2 precipitation method, electroporation, calcium phosphate precipitation method, protoplasmic fusion method, stirring method using silicon carbide fibers, Agrobacterium-mediated transformation method, PEG-mediated transformation method, dextran sulfate, lipofectamine, and drying / inhibition-mediated transformation method may be used. In addition, the host used for the production of the above-mentioned transforming agent may also be bacterial cells such as Escherichia coli, Streptomyces, and Salmonella typhimurium, as long as it can produce the above-mentioned peptide, although it is not particularly limited thereto; yeast cells such as Saccharomyces cerevisiae and Schizoscaromyces pombe; fungal cells such as Pichia pastoris; insect cells such as Drosophila and Spodoptera Sf9 cells; animal cells such as CHO, COS, NSO, 293, and Bow melanoma cells; or plant cells.
[0089] The above-described transformant may also be used in a method of the present invention for producing peptides for promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissues and for treating dentin-pulp disease and / or periodontal disease. Specifically, the method of the present invention for producing peptides for promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissues and for treating dentin-pulp disease and / or periodontal disease may include: (a) a step of culturing the transformant to obtain a culture; and (b) a step of recovering the peptide of the present invention from the culture.
[0090] The term "culture" in the present invention refers to a method of growing microorganisms under appropriately artificially controlled environmental conditions. In the present invention, the method of culturing the transformant may be carried out using methods widely known in the art. Specifically, the culture may be performed continuously in a batch process or a fed batch or repeated fed batch process, provided that it can be produced by expressing the peptide of the present invention for promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissues and for treating dentin-pulp disease and / or periodontal disease.
[0091] The culture medium used for cultivation must satisfy the requirements of a specific strain in an appropriate manner under aerobic conditions, while controlling temperature, pH, etc., within a conventional medium containing suitable carbon sources, nitrogen sources, amino acids, vitamins, etc. Carbon sources that can be used include mixed sugars of glucose and xylose as the primary carbon source, as well as sugars and carbohydrates such as sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture. Nitrogen sources that can be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, and glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products may be used. These nitrogen sources may be used alone or in combination. The medium may contain monopotassium phosphate, dipotassium phosphate, and corresponding sodium-containing salts as phosphorus. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts may be used as phosphorus. Additionally, inorganic compounds such as sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate may be used. Finally, essential growth substances such as amino acids and vitamins may be used in addition to the above materials.
[0092] In addition, suitable precursors may be used in the culture medium. The aforementioned raw materials may be added to the culture in a batch, fed-batch, or continuous manner in a manner suitable for the culture process, but are not particularly limited thereto. The pH of the culture may be controlled by using basic compounds such as sodium hydroxide, potassium hydroxide, and ammonia, or acid compounds such as phosphoric acid or sulfuric acid in a suitable manner.
[0093] In addition, bubble formation can be suppressed using antifoaming agents such as fatty acid polyglycol esters. Oxygen or an oxygen-containing gas (e.g., air) is injected into the culture to maintain an aerobic state. The temperature of the culture is typically 27°C to 37°C, preferably 30°C to 35°C. Culture is continued until the maximum amount of the peptide is obtained. For this purpose, it is usually achieved in 10 to 100 hours.
[0094] In addition, the step of recovering the peptide from the culture may be performed by methods known in the art. Specifically, the recovery method is not particularly limited to methods that can be used to recover the produced peptide, but preferably, methods such as centrifugation, filtration, extraction, spraying, drying, vaporization, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobic, and size exclusion) may be used.
[0095] In another aspect, the present invention provides a pharmaceutical composition for the prevention or treatment of dentin-pulp disease comprising the above peptide.
[0096] As described above, the peptide of the present invention can provide effects of promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissue, and treating dentin-pulp disease and / or periodontal disease. When implanted in vivo together with human pulp cells, it can promote the formation of dentin / pulp tissue-like tissue by the human pulp cells, and thus can be used as an active ingredient in a pharmaceutical composition for treating dentin-pulp disease caused by damage to pulp tissue.
[0097] The peptide included in the above pharmaceutical composition may be used in the form of a peptide alone, may be used in the form of a polypeptide in which the peptide is repeated two or more times, or may be used in the form of a complex in which a drug exhibiting a therapeutic effect on dentin-pulp disease is bound to the N-terminus or C-terminus of the peptide.
[0098] The term "dentin-pulp disease" in the present invention refers to a disease that develops as a result of damage to the pulp tissue and the dentin bonded thereto due to damage to the pulp tissue.
[0099] In the present invention, the dentin-pulp disease is not particularly limited to the above as long as it exhibits a therapeutic effect by the peptide of the present invention, but as an example, it may be tooth hypersensitivity, dental caries, pain due to tooth fracture, pulp congestion, pulpitis, pulp degeneration, or necrosis and gangrene of the pulp.
[0100] In another aspect, the present invention provides a pharmaceutical composition for the prevention or treatment of periodontal disease comprising the above peptide.
[0101] As described above, the peptide of the present invention for promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissues and for treating dentin-pulp disease and / or periodontal disease can be used as an active ingredient in a pharmaceutical composition for treating periodontal disease that causes damage to bone and / or cementum, because when implanted in vivo together with human pulp cells, it can promote the formation of bone-like tissue by said human pulp cells.
[0102] The peptide included in the above pharmaceutical composition may be used in the form of a peptide alone, may be used in the form of a polypeptide in which the peptide is repeated two or more times, or may be used in the form of a complex in which a drug exhibiting a periodontal disease treatment effect is bound to the N-terminus or C-terminus of the peptide.
[0103] The term "periodontal disease" in this invention, also known as gum disease, refers to a disease in which bacteria infect the gap between the gingiva (gums) and the teeth, damaging the periodontal ligament and adjacent tissues; it is classified into gingivitis and periodontitis depending on the severity of the disease. It is known that when the above periodontal disease occurs, inflammation progresses and more tissues are damaged, forming a periodontal pocket, and the more severe the periodontitis, the deeper the periodontal pocket becomes. As the periodontal pocket deepens, inflammation occurs in the periodontal ligament, and ultimately, bone loss is induced.
[0104] In the present invention, the periodontal disease is not particularly limited thereto as long as it exhibits a therapeutic effect by the peptide of the present invention, but as an example, it may be gingivitis, periodontitis, periodontal pocket, or periodontal abscess.
[0105] The term "prevention" of the present invention means any act of inhibiting or delaying the occurrence of dentin-pulp disease by administering a pharmaceutical composition for the prevention or treatment of dentin-pulp disease containing the peptide of the present invention, or any act of inhibiting or delaying the occurrence of periodontal disease by administering a pharmaceutical composition for the prevention or treatment of periodontal disease containing the peptide of the present invention.
[0106] The term "treatment" in the present invention means any act of administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to an individual requiring treatment for dentin-pulp disease to promote the regeneration of dentin or pulp tissue thereby performing treatment for pulp disease, or any act of administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to an individual requiring treatment for periodontal disease to promote the regeneration of bone and / or cementum thereby performing treatment for periodontal disease.
[0107] The pharmaceutical composition of the present invention may be prepared in the form of a pharmaceutical composition for treating dentin-pulp disease and / or periodontal disease, which further comprises a suitable carrier (natural or non-natural carrier), excipient, or diluent commonly used in the preparation of pharmaceutical compositions to the peptide. Specifically, the pharmaceutical composition may be formulated and used in the form of a sterile injectable solution that can be administered to a site where dentin-pulp disease and / or periodontal disease has been induced, each according to a conventional method. In the present invention, carriers, excipients, and diluents that may be included in the pharmaceutical composition may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, collagen, etc. When formulating, the composition may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. In particular, sterile aqueous solutions, non-aqueous solvents, suspending agents, emulsions, lyophilized preparations, suppositories, ointments (e.g., pulp relining agents, etc.) may be included. As non-aqueous solvents and suspending agents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, Witepsol, Macrogol, Tween 61, cocoa oil, laurin oil, glycerogelatin, etc. may be used.
[0108] The content of the peptide included in the pharmaceutical composition of the present invention is not particularly limited thereto, but may be included in an amount of 0.0001 to 50 weight%, more preferably 0.01 to 20 weight% based on the total weight of the final composition.
[0109] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" in this invention refers to an amount sufficient to treat or prevent a disease with a reasonable benefit / risk ratio applicable to medical treatment or prevention. The effective dose level may be determined based on factors including the severity of the disease, the activity of the drug, the patient's age, weight, health, gender, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and elimination rate, the duration of treatment, drugs combined or used concurrently with the composition of the present invention, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered alone or in combination with known pharmaceutical compositions for the treatment of dentin-pulp disease and / or periodontal disease. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects, taking all of the above factors into consideration.
[0110] The dosage of the pharmaceutical composition of the present invention may be determined by a person skilled in the art by taking into consideration the purpose of use, the degree of toxicity of the disease, the patient's age, weight, gender, medical history, or the type of substance used as an active ingredient. For example, the pharmaceutical composition of the present invention may be administered at a dose of about 0.1 ng to about 100 mg / kg, preferably 1 ng to about 10 mg / kg per adult. The frequency of administration of the composition of the present invention is not particularly limited thereto, but may be administered once a day or divided into several doses. The above dosage does not limit the scope of the present invention in any way.
[0111] In another aspect, the present invention provides a method for treating dentin-pulp disease comprising the step of administering the pharmaceutical composition in a pharmaceutically effective amount to an individual other than a human having developed dentin-pulp disease. In yet another aspect, the present invention provides a method for treating periodontal disease comprising the step of administering the pharmaceutical composition in a pharmaceutically effective amount to an individual other than a human having developed periodontal disease.
[0112] The term "individual" in the present invention may include, without limitation, humans requiring treatment for dentin-pulp disease and / or periodontal disease, or mammals including rats, livestock, etc., excluding humans.
[0113] The administration route of the pharmaceutical composition of the present invention for treating dentin-pulp disease and / or periodontal disease may be any general route as long as it can reach the target tissue. The pharmaceutical composition of the present invention may be administered via routes such as intraoral administration or intraoral injection, although it is not particularly limited thereto, depending on the purpose.
[0114] In another aspect, the present invention provides a quasi-drug composition for the prevention or improvement of dentin-pulp disease comprising the above peptide, or a quasi-drug composition for the prevention or improvement of periodontal disease comprising the above peptide.
[0115] The term "improvement" in this invention refers to any action that at least reduces parameters related to the condition being treated, such as the degree of symptoms.
[0116] In the present invention, the improvement may be interpreted to mean any act of administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to an individual requiring treatment for dentin-pulp disease to promote the regeneration of dentin or pulp tissue, thereby improving or benefiting the symptoms of dentin-pulp disease, or any act of administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to an individual requiring treatment for periodontal disease to promote the regeneration of bone and / or cementum, thereby improving or benefiting the symptoms of periodontal disease.
[0117] The term "quasi-drug" in the present invention refers to articles used for the purpose of diagnosing, treating, improving, alleviating, managing, or preventing diseases of humans or animals, which have a milder effect than pharmaceuticals. For example, according to the Pharmaceutical Affairs Act, quasi-drugs are defined as articles excluding those used for pharmaceutical purposes. These include fiber and rubber products used for the treatment or prevention of diseases in humans and animals, items that have a mild or no direct effect on the human body and are not instruments or machines, and similar items, as well as disinfectants and insecticides for preventing infectious diseases.
[0118] In the present invention, the type or formulation of the quasi-drug composition containing the peptide is not particularly limited, but as an example, it may be an oral disinfectant cleaner, an oral cleaning product, toothpaste, dental floss, an oral ointment, etc.
[0119] In another aspect, the present invention provides a health functional food composition comprising the above peptide for the prevention or improvement of periodontal disease that causes diarrhea and / or pulp-related diseases and / or bone and cementum damage.
[0120] The term "food" in the present invention includes meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, health functional foods, and health foods, and includes all foods in the conventional sense.
[0121] The above-mentioned "functional food" is synonymous with "food for special health use (FosHU)" and refers to a food with high medical or therapeutic effects that is processed to efficiently exhibit bio-regulatory functions in addition to providing nutrition. Here, "functionality" means obtaining useful effects for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body. The food of the present invention can be manufactured by methods commonly used in the industry, and during such manufacturing, raw materials and ingredients commonly added in the industry may be added. Furthermore, the formulation of the food can be manufactured without restriction as long as it is a formulation recognized as a food. The food composition of the present invention can be manufactured in various forms of formulations. Unlike general pharmaceuticals, it has the advantage of being made from food ingredients and thus avoiding side effects that may occur with long-term use of pharmaceuticals. Additionally, due to its excellent portability, the food of the present invention can be consumed as an adjuvant to enhance the effects of preventing or improving dentin-pulp disease and / or periodontal disease.
[0122] The aforementioned "health food" refers to a food that has active effects in maintaining or promoting health compared to general food, and "health supplement food" refers to a food intended for the purpose of supporting health. In some cases, the terms health functional food, health food, and health supplement food may be used interchangeably.
[0123] Specifically, the above-mentioned health functional food is a food prepared by adding the peptide of the present invention to food materials such as beverages, teas, spices, chewing gums, and confectionery, or by encapsulating, powdering, or suspension, and means that consuming it brings about specific health effects. Unlike general medicines, it has the advantage of not having side effects that may occur when taking medicine for a long period of time because it is made from food.
[0124] The food composition of the present invention can be very usefully employed because it can be consumed on a daily basis, and thus high efficacy can be expected for the prevention or improvement of dentin-pulp disease and / or periodontal disease.
[0125] The above food composition may further include a physiologically acceptable carrier, the type of carrier is not particularly limited, and any carrier commonly used in the relevant technical field may be used.
[0126] In addition, the above food composition may include additional ingredients that are commonly used in food compositions to improve odor, taste, visual appearance, etc. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), and copper (Cu). In addition, it may include amino acids such as lysine, tryptophan, cysteine, and valine.
[0127] In addition, the above food composition may include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), disinfectants (bleaching powder and high-grade bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA), butylhydroxytoluene (BHT), etc.), coloring agents (tar dyes, etc.), colorants (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (sizing agents), coating agents, gum bases, antifoaming agents, solvents, and improvers. The above additives can be selected according to the type of food and used in appropriate amounts.
[0128] The peptide of the present invention may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient may be appropriately determined according to its purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing food or beverages, the food composition of the present invention may be added to the food or beverage in an amount of 50 parts by weight or less, specifically 20 parts by weight or less. However, when consumed over a long period for the purpose of health and hygiene, the content may be below the above range, and since there are no safety issues, the active ingredient may also be used in an amount greater than the above range.
[0129] As an example of the food composition of the present invention, it may be used as a health drink composition, in which case it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The natural carbohydrates described above may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. Sweeteners may include natural sweeteners such as thaumatin and stevia extract; and synthetic sweeteners such as saccharin and aspartame. The proportion of the natural carbohydrates may generally be about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g per 100 ml of the health drink composition of the present invention.
[0130] In addition to the above, the health drink composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. Furthermore, it may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, or vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not critical, it is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health drink composition of the present invention.
[0131] The food composition of the present invention may be included in various weight percent as long as it can exhibit a preventive or improving effect on dentin-pulp disease and / or periodontal disease, but specifically, the peptide of the present invention may be included in 0.00001 to 100 weight percent or 0.01 to 80 weight percent relative to the total weight of the food composition, but is not limited thereto.
[0132] In another aspect of the present invention, a method for preventing or treating dentin-pulp disease and / or periodontal disease is provided, comprising the step of administering a composition containing the above-mentioned peptide to an individual.
[0133] In another aspect, a method for promoting the regeneration of dentin or pulp tissue and / or the regeneration of bone or cementum is provided, comprising the step of administering a composition containing the above-mentioned peptide to an individual.
[0134] In another aspect of the present invention, a peptide comprising the amino acid sequence of the following general formula 1 or a composition comprising said peptide is provided for use in promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissue, and for use in preventing or treating dentin-pulp disease or periodontal disease.
[0135] P-R1-R2-R3-R4-R5-R6-R7-R8-R9 (General Formula 1)
[0136] In the above general formula 1, R1 to R3 are each lysine (K) or arginine (R), R4 is each glycine (G), cysteine (C), lysine (K) or arginine (R), R5 to R8 are each lysine (K) or arginine (R), and R9 is each lysine (K), arginine (R), or tyrosine (Y).
[0137] In another aspect, the present invention provides a peptide comprising any one of the amino acid sequences of SEQ ID NOs. 1 to 70 or a composition comprising said peptide for the use of promoting the regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissue, and for the prevention or treatment of dentin-pulp disease and / or periodontal disease.
[0138]
[0139] The present invention will be explained in more detail below through embodiments. However, these embodiments are intended to illustrate the invention and the scope of the invention is not limited to these embodiments.
[0140]
[0141] Example 1: Experimental Method and Materials
[0142] Example 1-1. Synthesis of peptides for promoting regeneration of hard tissues including dentin, bone, and cementum and / or pulp tissue, and for treating dentin-pulp diseases and / or periodontal diseases
[0143] The inventors synthesized a peptide (Sequence No. 1) exhibiting a regeneration-promoting effect on hard tissues including dentin, bone, and cementum and / or pulp tissue by the 9-fluorenylmethyloxycarbonyl (Fmoc) method, and synthesized a representative group of peptides by substituting the amino acids of the synthesized peptide (Table 1).
[0144]
[0145] N- PKKKGKKKKY -C(Sequence No. 1)
[0146] The peptides of SEQ ID NO. 1-9 were synthesized by synthesizing the peptide of SEQ ID NO. 1 (PKKKGKKKKY) and then substituting the lysine (K) at positions 2 and 3 of the peptide of SEQ ID NO. 1 with arginine (R), and the tyrosine (Y) at position 10 with lysine (K) or arginine (R).
[0147] Next, the peptide of SEQ ID NO. 10-15 was synthesized by synthesizing the peptide of SEQ ID NO. 10 (PKKKGKKKRY) and then substituting the lysine (K) at positions 2 and 3 of the peptide of SEQ ID NO. 10 with arginine (R), and the lysine (K) at positions 6, 7, and 8 with arginine (R).
[0148] Next, the peptide of SEQ ID NO. 16-23 was synthesized by synthesizing the peptide of SEQ ID NO. 16 (PKKKRKKKKK), and then substituting the lysine (K) at positions 2 and 3 of the peptide of SEQ ID NO. 16 with arginine (R), the lysine (K) at positions 6, 7, 8, and 9 with arginine (R), and the lysine (K) at position 10 with arginine (R).
[0149] Next, the peptide of SEQ ID NO. 24-31 was synthesized by synthesizing the peptide of SEQ ID NO. 24 (PKKKKKKKKKK) and then substituting the lysine (K) at positions 2 and 3 of the peptide of SEQ ID NO. 24 with arginine (R), and the lysine (K) at positions 6, 7, 8, 9, and 10 with arginine (R).
[0150] Next, the peptides of SEQ ID NO. 32-40 were synthesized by synthesizing the peptide of SEQ ID NO. 32 (PKKKRKKKKY) and then substituting the lysine (K) at positions 2 and 3 of the peptide of SEQ ID NO. 32 with arginine (R), the lysine (K) at positions 6, 7, and 8 with arginine (R), and the tyrosine (Y) at position 10 with lysine (K) or arginine (R).
[0151] Next, the peptides of SEQ ID NO. 41-58 were synthesized by synthesizing the peptide of SEQ ID NO. 41 (PKKKCKKKKY) and then substituting the lysine (K) at positions 2 and 3 of the peptide of SEQ ID NO. 41 with arginine (R), the lysine (K) at positions 6, 7, 8, and 9 with arginine (R), and the tyrosine (Y) at position 10 with lysine (K) or arginine (R).
[0152] Finally, the peptides of SEQ ID NO. 59-70 were synthesized by synthesizing the peptide of SEQ ID NO. 59 (PRKKRKKKKK), and then substituting the lysine (K) at positions 3 and 4 of the peptide of SEQ ID NO. 59 with arginine (R), the lysine (K) at positions 6, 7, 8, and 9 with arginine (R), and the lysine (K) at position 10 with tyrosine (Y) or arginine (R).
[0153]
[0154] 시이번호아미노산 시이 (NC)
[0155]
[0156] example 1-2. 사람유래 치수세타 자자주인대 사로아세타 사스트 사랑의 자다
[0157] Human-derived pulp cells and periodontal ligament fibroblasts were obtained by isolating pulp tissue cells from the wisdom teeth of 10 adults (ages 18–22) at Seoul National University Dental Hospital. Specifically, all experiments were conducted after obtaining approval from the hospital's Institutional Review Board and consent from the patients. Wisdom teeth were cut to expose the pulp according to the method of Jung HS et al. (J Mol Histol. (2011)), and the pulp was separated using forceps. The separated pulp was finely sliced on both sides, placed in a 60 mm cell culture dish, covered with a coverslip, and cultured in Dulbecco's Eagle Modified Medium. Periodontal ligament fibroblasts were obtained by detaching the periodontal ligament tissue attached to the wisdom tooth root using forceps, finely slicing it on both sides, placing it in a 60 mm cell culture dish, covering it with a coverslip, and culturing it in Dulbecco's Eagle Modified Medium.
[0158]
[0159] Examples 1-3. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and Real-Time PCR Analysis
[0160] Total RNA from human pulp cells and mesenchymal stem cells was isolated using the TRIzol reagent. cDNA was synthesized using 2 µg of total RNA, 1 µl of reverse transcriptase, and 0.5 µg of oligo (dT). The synthesized cDNA was used in real-time polymerase chain reaction (RPCR). The RCR was performed using SYBR GREEN PCR Master Mix (Takara, Japan) on an ABI PRISM 7500 sequence detection system (Applied Biosystems). The RCR was conducted under conditions of 94°C for 1 min; 95°C for 15 sec; and 60°C for 34 sec for 40 cycles. The results were evaluated using the comparative cycle threshold (CT) method, and the primer sequences are listed in Table 2.
[0161]
[0162] GenePrimer (5'-3')SEQ ID NO:hBSPforwardGAATGGCCTGTGCTTTCTCAA71reverseTCGGATGAGTCACTACTGCCC72hDMP1forwardACAGGCAAATGAAGACCC73reverseTTCACTGGCTTGTATGG74hCAPforwardGACGAGGACGGCACCAAC GG75reverseCGCGGTCATGGGCGATGTCGT76hDSPPforwardCAACCATAGAGAAAGCAAACGCG77reverseTTTCTGTTGCCACTGCTGGGAC78hGAPDHforwardCCATGGAGAAGGCTGGGG79reverseCAAAGTTCTCATGGATGACC80
[0163] Examples 1-4. In vivo implantation and histological analysis
[0164] Human pulp cells (hDPCs) were isolated and used for in vivo transplantation experiments. hDPCs (2 x 10⁶ cells) were mixed with 0.5% fibrin gel using 100 mg of hydroxy apatite / tricalcium phosphate (HA / TCP) ceramic powder (Zimmer, USA) alone or with 10 µg of peptide, and then transplanted into immune-deficient mice (NIH-bg-nu-xid; Harlan Laboratories, Indianapolis, IN) for 12 weeks. Samples were harvested, fixed in 4% paraformaldehyde, decalcified in 10% EDTA (pH 7.4), and embedded in paraffin to obtain 5 µm thick tissue sections. The obtained tissue sections were stained with hematoxylin-eosin (HE) (Vector Labs) and subjected to immunohistochemical analysis. To perform immunohistochemical analysis, proteins were detected using anti-DSP antibody and anti-BSP antibody diluted 1:150 as primary antigens, and biotin-labeled goat anti-rabbit IgG (Vector Labs) as secondary antigens.
[0165]
[0166] Examples 1-5. Effects of a novel peptide on dentin regeneration in a dentin damage model
[0167] Three adult dogs (12 to 16 kg; 6 to 8 weeks old) were anesthetized by inhaling Geloran, and then Zoletil (5 mg / kg) and xylazine (0.2–0.5 mg / kg) were intravenously administered, followed by treatment with lidocaine (Lidocaine 2% with 1:80,000 epinephrine). After damaging the dentin of the premolars and molars in the mandibles of the adult dogs using a dental bur, 10 µg of peptide Group 1 SEQ No. 1 was applied per tooth. After 6 weeks, the adult dogs were sacrificed by administering an overdose (90–120 mg / kg) of pentobarbital. The tooth portion of the adult dog was excised, fixed with 10% formalin, calcium was removed by adding 5% formic acid, molded, and embedded in paraffin to obtain a 5㎛ thick tissue section. The obtained tissue section was stained with hematoxylin and eosin, and then analyzed using an optical microscope (LEICA DM750, Germany) equipped with a digital camera (LEICA ICC50 camera, Germany).
[0168]
[0169] Examples 1-6. Statistical Analysis
[0170] Statistical analysis was performed using the Student's t-test. All statistical analyses were performed using SPSS software ver. 19.0.
[0171]
[0172] Example 2: Experimental Results
[0173] Example 2-1. Effects of a peptide for promoting dentin or pulp tissue regeneration and treating dentin hypersensitivity on the expression level of the DSPP gene, an odontoblast differentiation marker.
[0174] The DSPP gene is used as a marker for odontoblast differentiation and is known to be an important gene for dentin calcification. Therefore, in this study, novel peptides were synthesized to promote odontoblast differentiation and dentin formation by increasing the expression of the DSPP gene, an odontoblast differentiation marker, and the effects of each peptide on the mRNA level of the DSPP gene were confirmed by real-time PCR (Table 3).
[0175]
[0176] DSPP 가이 아이아민노산 아이 (NC)서열번호유자이드발현변화PKKKGKKKY12.86PKKKGKKKKK21.77PKKKGKKKKR31.98PKKKGKKRK42.71PKKKGKKRKK52.31PKKKGKRKKK61.99PKKKGKKKK72.78 PKKRGKKKKK82.53PKRKGKKKKK92.78PKKKGKKKRY101.99PKKKGKKRKY112.47PKKKGKRKKY121.81PKKKGRKKKY132.38PKKRGKKKKY141.83PKRKGKKKKY1 52.73PKKKRKKKK162.45PKKKRKKKKR172.27PKKKRKKKRK181.99PKKKRKKRKK191.81PKKKRKKKK202.53PKKKRKKKK211.88PKKRRKKKKK222.49PKRK RKKKKK232.71PKKKKKKKK242.15PKKKKKKKKR252.43PKKKKKKRK262.11PKKKKKKRKK272.01PKKKKKKKK282.16PKKKKRKKKKK292.37PKKKKKKKK302 .33PKKKKKKKK312.12PKKKRKKKY322.32PKKKRKKKR331.87PKKKRKKRY342.67PKRKCKKRKY352.34PKKKRKRKYK362.57PKKKRRKKY372.44PKKRR KKKKY382.18PKRKRKKKY392.61PRKKRKKKKY402.16PKKKCKKKKY411.82PKKKKKKKKY421.76PKKKRKKRRY432.01PKKKRKRKKY442.04PKKKCKKKKK452. 32PKRKKKKKK462.27PRKKGKKKKK472.02PRKKCKKKKY4814.08PRKKCKKKKK4910.53PRKKCKKKKR509.72PRKKCKKRKY519.55PRKKCKRKKY529.51PRKRC KKKKY539.21PRRKCKKKKY548.92PRKKCKKRKK557.58PRKKCKRKKK569.23PRKRCCKKKK575.58PRRKCKKKKK586.92PRKKRKKKKK597.27PRKKKKKKKK606.51PRKKRKRRKY617.32PRKKRKKKKR627.53PRKKRKKRKY635.63PRKKRKRKKY646.46PRKRRKKKKY654.24PRRKRKKKKY663.99PRKKRKKRKK673.85PRKKRKRKKK683.59PRKRRKKKKK693.88PRRKRKKKKK703.48.
[0177] Figure 1 is a graph showing the DSPP mRNA expression values for the peptides of SEQ ID NO. 1 and SEQ ID NO. 48 in Table 1. In Figure 1, DSPP mRNA expression was increased by approximately 2 times or more than 14 times compared to the control group in all peptide groups of all sequences, and in particular, the peptide group of SEQ ID NO. 48 showed the highest DSPP mRNA expression value. Since the DSPP gene is known to be involved in odontoblast differentiation and the calcification process of dentin, it was analyzed that the peptide provided in the present invention would exhibit an effect of promoting dentin regeneration.
[0178]
[0179] Example 2-2. Effects of a peptide for promoting bone or cementum regeneration and treating periodontal disease on the expression levels of BSP, DMP1, and CAP genes, which are osteoblast and cementoblast differentiation marker genes.
[0180] From the results of Example 2-1 above, it was confirmed that the peptides of the present invention can increase the mRNA level of the DSPP gene, for example, that the peptides of all groups can increase the mRNA level of the DSPP gene by more than 1.5 times, and furthermore by more than 3 times, and in particular, that the peptide of SEQ ID NO. 48 can increase the mRNA level of the DSPP gene by more than about 14 times.
[0181] Accordingly, it was confirmed whether the peptides of the present invention could also increase the mRNA levels of BSP, DMP1, and CAP genes, which are important genes for the calcification of bone and cementum. BSP and DMP1 genes are used as differentiation markers for osteoblasts and cementoblasts and are known to be important genes for the calcification of bone and cementum. Additionally, CAP is a gene that attaches periodontal ligament fiber bundles to the alveolar bone and cementum and is known as a differentiation marker for cementoblasts. The effects of each peptide group on BSP, DMP1, and CAP mRNA expression were confirmed by real-time PCR (Tables 4 to 6).
[0182]
[0183] BSP Gene Expression Amino Acid Sequence (NC) Sequence No. Gene Expression Change PKKKGKKKKY 12.84 PKKKGKKKKK 22.52 PKKKGKKKKR 31.81 PKKKGKKKRK 42.14 PKKKGKKRKK 52.44 PKKKGKRKKK 62.50 PKKKGRKKKK 72.58 PKKRGKKKKK 82.45 PKRKGKKKKK 92.37 PKKKGKKKRY 102.17 PKKKGKKRKY 112.19 PKKKGKRKKY 121.82 PKKKGRKKKY 132.49 PKKRGKKKKY 141.99 PKRKGKKKKY 152.5 6PKKKRKKKKK162.01PKKKRKKKKR171.88PKKKRKKKRK182.87PKKKRKKRKK191.86PKKKRKRKKK201.77PKKKRRKKKK211.89PKKRRKKKKK221.98PKRKRKKKK K232.02PKKKKKKKKK241.78PKKKKKKKKKKR252.31PKKKKKKKRK261.99PKKKKKKRKK271.81PKKKKKRKKK282.45PKKKKRKKKK292.331PKKRKKKKKKKK302.01PKR KKKKKKK312.11PKKKRKKKKY322.39PKKKRKKRKR332.07PKKKRKKKRY341.95PKRKCKKRKY352.32PKKKKRKRKYK361.85PKKKRRKKKY371.88PKKRRKKKKY382 .07PKRKRKKKKY392.11PRKKRKKKKY401.98PKKKCKKKKY411.72PKRKCKKKKY421.93PKKKRKKRRY432.29PKRKRKRKKY442.31PKKKCKKKKK452.11PKRKCKKK KK461.83PRKKGKKKKKK472.17PRKKCKKKKY485.61PRKKCKKKKK495.53PRKKCKKKKR505.77PRKKCKKRKY515.54PRKKCKRKKY525.11PRKRCKKKKY535.41PRR KCKKKKY544.89PRKKCKKRKK554.78PRKKCKRKKK564.53PRKRCKKKKK575.18PRRKCKKKKK584.77PRKKRKKKKK594.47PRKKKKKKKK604.81PRKKRKRRKY614.38PRKKRKKKKR624.83PRKKRKKRKY633.73PRKKRKRKKY644.45PRKRRKKKKY654.27PRRKRKKKKY664.99PRKKRKKRKK673.81PRKKRKRKKK683.53PRKRRKKKKK694.28PRRKRKKKKK703.17.
[0184] DMP1 가이 아이아미노산 아이 (NC)서엄번호유자성발현변화PKKKGKKKKY13.41PKKKGKKKKK22.31PKKKGKKKKR32.01PKKKGKKRK42.51PKKKGKKRKK52.42PKKKGKRKKK62.41PKKKKKKKK72.44 KRGKKKKK82.79PKRKGKKKKK92.81PKKKGKKKRY102.77PKKKGKKRKY112.90PKKKGKRKKY122.50PKKKGRKKKY131.84PKKRGKKKKY142.23PKRKGKKKKY152.5 2PKKKRKKKK162.34PKKKRKKKK172.59PKKKRKKKKRK181.99PKKKRKKKK192.18PKKKRKKKK202.42PKKKRKKKK211.89PKKRRKKKK222.73PKKKRKKKK K232.05PKKKKKKKK242.42PKKKKKKKKR252.58PKKKKKKRK262.12PKKKKKKRKKK271.93PKKKKKKKK282.13PKKKKRKKKKK292.33PKKRKKKKKKK302.01PKRK KKKKKK312.27PKKKRKKKY322.09PKKKRKKKR332.58PKKKRKKKRY342.31PKRKCKKRKY352.29PKKKRKRKYK362.33PKKKRRKKY371.99PKKRRKKKKY382. 72PKRKRKKKKY392.01PRKKRKKKKY402.78PKKKCKKKKY412.85PKKKKKKKKY422.51PKKKRKKRRY431.89PKKKRKRKKY442.27PKKKCKKKKK451.92PKRKCKKKK K462.26PRKKGKKKKK472.39PRKKCKKKKY4814.96PRKKCKKKKK497.53PRKKCKKKKR507.47PRKKCKKRKY518.99PRKKCKRKKY528.71PRKRCKKKKY534.31PRR KCKKKKY545.99PRKKCKKRKK554.68PRKKCKRKKK566.53PRKRCKKKKK575.72PRRKCKKKKK586.89PRKKRKKKKK596.47PRKKKKKKKK607.83PRKKRKRRKY614.38PRKKRKKKKR626.85PRKKRKKRKY637.53PRKKRKRKKY647.25PRKRRKKKKY655.25PRRKRKKKKY664.79PRKKRKKRKK676.51PRKKRKRKKK686.51PRKRRKKKKK695.87PRRKRKKKKK707.59.
[0185] CAP Gene Expression Amino Acid Sequence (NC) Sequence No. Gene Expression Change PKKKGKKKKY13.5PKKKGKKKKK23.21PKKKGKKKKR33.33PKKKGKKKRK43.21PKKKGKKRKK53.33PKKKGKRKKK63.32PKKKGRKKKK72.77PKKRGKKKKK82.15PKRKGKKKKK92.17PKKKGKKKRY102.32PKKKGKKRKY112.63PKKKGKRKKY123.11PKKKGRKKKY133.02PKKRGKKKKY142.82PKRKGKKKKY152.1 1PKKKRKKKKK162.42PKKKRKKKKR172.05PKKKRKKKRK181.99PKKKRKKRKK192.54PKKKRKRKKK202.56PKKKRRKKKK212.31PKKRRKKKKK223.11PKRKRKKKK K232.71PKKKKKKKKK242.15PKKKKKKKKKKR252.44PKKKKKKKKKRK262.09PKKKKKKRKK273.27PKKKKKRKKK281.95PKKKKRKKKK291.85PKKRKKKKKK302.31PKRK KKKKKK312.63PKKKRKKKKY322.77PKKKRKKRKR331.85PKKKRKKKRY342.01PKRKCKKRKY351.83PKKKKRKRKYK362.42PKKKRRKKKY372.37PKKRRKKKKY382. 27PKRKRKKKKY392.44PRKKRKKKKY403.18PKKKCKKKKY413.53PKRKCKKKKY422.79PKKKRKKRRY432.94PKRKRKRKKY443.07PKKKCKKKKK452.99PKRKCKKKK K462.51PRKKGKKKKKK472.76PRKKCKKKKY484.46PRKKCKKKKK494.53PRKKCKKKKR503.77PRKKCKKRKY513.99PRKKCKRKKY524.71PRKRCKKKKY534.31PRR KCKKKKY543.99PRKKCKKRKK553.78PRKKCKRKKK563.53PRKRCKKKKK572.78PRRKCKKKKK583.99PRKKRKKKKK593.47PRKKKKKKKK602.81PRKKRKRRKY613.38PRKKRKKKKR623.83PRKKRKKRKY633.73PRKKRKRKKY643.65PRKRRKKKKY652.27PRRKRKKKKY663.39PRKKRKKRKK673.83PRKKRKRKKK683.57PRKRRKKKKK693.78PRRKRKKKKK702.48.
[0186]
[0187] Figure 2 is a graph showing the results of comparing the expression levels of DMP1 and BSP genes, which are differentiation marker genes for bone and cementum, in human-derived mesenchymal stem cells (hBMSCs) treated with the peptide of the present invention, and Figure 3 is a graph showing the results of comparing the expression levels of the CAP gene, which is a gene that attaches periodontal ligament fiber bundles to the alveolar bone and cementum.
[0188] When the peptides of SEQ ID NO. 1 and SEQ ID NO. 48 of the present invention were treated, the effects on the expression of the DMP1 gene, BSP gene, and CAP gene, which are osteoblast / cementoblast differentiation marker genes, were verified. As shown in FIGS. 2 and 3, compared to the mRNA level of the BSP gene, an osteoblast / cementoblast differentiation marker measured in human pulp cells not treated with the peptides of the present invention (control group), it was confirmed that the DMP1 mRNA expression in human pulp cells treated with the 70 types of peptides increased by about 1.8 to 14 times and the mRNA level of the BSP gene increased by about 1.7 to 5 times (see Tables 4, 5 and FIG. 2). In addition, it was confirmed that the mRNA level of the CAP gene increased by about 1.8 to 4 times (see Table 6 and FIG. 3). These results suggest that the peptides of the present invention have an effect of promoting the regeneration of bone and cementum.
[0189] The above-mentioned BSP and DMP1 genes are used as differentiation markers for osteoblasts and cementoblasts and are genes involved in the calcification process of bone and cementum, while the CAP gene is known to be a gene that attaches periodontal ligament fiber bundles to the alveolar bone and cementum. Therefore, it can be seen that the 70 types of peptides of the present invention have the effect of promoting osteoblast / cementoblast differentiation, promoting the regeneration of bone and cementum, and attaching periodontal ligament fiber bundles to the alveolar bone and cementum. These results demonstrate that the peptides of the present invention can potentially play an important role in the field of periodontal tissue regeneration and dental regenerative medicine.
[0190]
[0191] Example 2-3. Hard tissue formation of human dental pulp cells (hDPCs) in vivo by a novel peptide
[0192] Figure 4 is based on the in vitro experimental results shown in Figures 1 to 3 and Tables 3 to 6. To confirm the effect on hard tissue formation in in vivo experiments, peptides SEQ ID NO. 1 and SEQ ID NO. 48 (10 µg), or control (cell only) human-derived pulp cells (hDPCs), were transplanted into the subcutaneous tissue of mice with compromised immune systems. After 12 weeks of transplantation, it was confirmed that the rate of hard tissue formation increased in the groups treated with the peptides SEQ ID NO. 1 and SEQ ID NO. 48 compared to the control group. Histological analysis via hematoxylin-eosin staining revealed that in the groups treated with hDPCs alone, SEQ ID NO. 1 (Fig. 4 DF), and SEQ ID NO. 48 (Fig. 4 GI), more dentin / pulp-like tissue with cells invaginated into the matrix of newly formed calcified tissue around HA / TCP particles was formed.
[0193] Next, the expression of DSP (Fig. 5), an odontoblast-specific differentiation marker gene, and BSP (Fig. 6), a cementoblast and osteoblast differentiation marker gene, was confirmed through immunohistochemical analysis. In the control group, DSP was weakly expressed in newly formed dentin-pulp-like tissue and odontoblast-like cells (Fig. 5A), whereas in the peptide group SEQ ID NO. 1 (Fig. 5B) and peptide SEQ ID NO. 48 (Fig. 5C), DSP was strongly expressed in newly formed calcified tissue and odontoblast-like cells arranged beneath the calcified tissue. Regarding BSP expression, in the control group, BSP was weakly expressed in newly formed hard tissue (Fig. 6A), whereas in the peptide group SEQ ID NO. 1 (Fig. 6B) and peptide SEQ ID NO. 48 (Fig. 6C), BSP was strongly expressed in newly formed calcified tissue compared to the control group. In summary, the above results indicate that the novel peptide used in this experiment has the effect of promoting the regeneration of bone / cementum-like tissue and dentin / pulp tissue complexes.
[0194]
[0195] In Figure 7, to determine whether novel peptides induce physiological dentin regeneration in an animal model of dentin damage, the dentin of adult dog teeth was damaged, and then 10 µg of each peptide of SEQ ID NO. 1 (Fig. 7, DF) and SEQ ID NO. 48 (Fig. 7, GI) were applied, followed by a histological evaluation after 3 weeks. In the control group (Fig. 7, AC), there were no changes beneath the damaged dentin, but in each test group treated with SEQ ID NO. 1 and SEQ ID NO. 48, it was confirmed that physiological dentin formed beneath the damaged dentin. These results suggest that tooth hypersensitivity, dentin caries, and pain caused by tooth fracture resulting from damaged dentin can be treated through physiological dentin regeneration.
[0196]
[0197] This research was funded by the Ministry of SMEs and Startups and the Korea Technology Information Institute for SMEs in 2020 (RS-2023-00281070, "Development of a Liquid Formulation of a Dental Caries Inhibitor Using Functional Peptides from New Biomaterials")
[0198]
[0199] Although embodiments of the present invention have been described above with reference to the attached drawings, those skilled in the art will understand that the present invention may be implemented in other specific forms without changing its technical concept or essential features. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.
Claims
1. A peptide composed of an amino acid sequence of any one of sequence numbers 1 to 70.
2. In Paragraph 1, The above peptide is a peptide that has undergone acetylation, amidation, or methylation of the N-terminus or C-terminus; introduction of a D-amino acid; peptide bond modification such as CH2-NH, CH2-S, CH2-S=O, or CH2-CH2; backbone modification; or side chain modification.
3. A polynucleotide encoding the peptide of claim 1.
4. An expression vector comprising the polynucleotide of claim 3.
5. A composition for promoting the regeneration of hard tissues including dentin, bone, and cementum, and / or pulp tissue and periodontal ligament, comprising the peptide of claim 1 or 2.
6. A pharmaceutical composition for the prevention or treatment of dentin-pulp disease or periodontal disease comprising the peptide of claim 1 or 2.
7. A composition according to claim 6, wherein the dentin-pulp disease is tooth hypersensitivity, dental caries, pain due to tooth fracture, pulp congestion, pulpitis, pulp degeneration, or necrosis and gangrene of the pulp, and the periodontal disease is gingivitis, periodontitis, periodontal pocket, or periodontal abscess.
8. A quasi-drug composition for the prevention or improvement of dentin-pulp disease or periodontal disease comprising the peptide of either claim 1 or 2.
9. A method for the prevention or treatment of dentin-pulp disease or periodontal disease comprising the step of administering a composition containing the peptide of claim 1 or 2 to an individual other than a human.
10. A method for promoting the regeneration of hard tissues including dentin, bone and cementum, or pulp tissue and periodontal ligament, comprising the step of administering a composition containing the peptide of claim 1 or 2 to an individual other than a human.