Lipid nanoparticle compositions and methods of use

Lipid nanoparticles with ionizable lipids and targeting moieties effectively target HIV-1 tissue reservoirs, improving CRISPR-mediated viral elimination and mRNA translation, addressing the limitations of current gene-delivery methods.

WO2026136642A1PCT designated stage Publication Date: 2026-06-25BOARD OF RGT UNIV OF NEBRASKA

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
BOARD OF RGT UNIV OF NEBRASKA
Filing Date
2025-12-18
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Current gene-delivery approaches for eliminating proviral HIV DNA, such as AAV-based CRISPR delivery, face limitations from immunogenicity and poor targeting of latent viral reservoirs in myeloid cells and memory T-cells, hindering the development of a permanent cure for HIV.

Method used

Lipid nanoparticles comprising ionizable lipids, sterols, PEG-lipid conjugates, and helper lipids, optionally with targeting moieties, are designed to enhance cytosolic delivery, improve mRNA translation efficiency, and selectively target HIV-1 tissue reservoirs, encapsulating CRISPR-based therapeutic agents to eliminate proviral DNA.

Benefits of technology

The lipid nanoparticles demonstrate superior targeting and biodistribution to HIV-1 tissue reservoirs, enhancing CRISPR-mediated viral elimination and maintaining high cell viability, with up to 20-fold higher transfection efficacy compared to existing systems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025060273_25062026_PF_FP_ABST
    Figure US2025060273_25062026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides lipid nanoparticles and methods of use thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] LIPID NANOPARTICLES AND METHODS OF USE THEREOF

[0002] By Howard Gendelman Sudipta Panj a Soumya Sagar Dey Bharatbhai Chaudhary Mohammad Uzair Ali

[0003] This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 735,561, filed December 18, 2024. The foregoing application is incorporated by reference herein.

[0004] This invention was made with government support under Grant No. R01 MH121402, awarded by the National Institutes of Health. The government has certain rights in the invention.

[0005] FIELD OF THE INVENTION

[0006] The present invention relates generally to the delivery of therapeutics. More specifically, the present invention relates to compositions and methods for the delivery of therapeutic agents to a patient.

[0007] BACKGROUND OF THE INVENTION

[0008] The human immunodeficiency virus type (HIV) global epidemic began in 1981 and has led to 40 million deaths and equal numbers of infected people (Holmes, E.C. (2001) Biol. Rev. Camb. Philos. Soc., 76(2):239-254; Senapathi, et al. (2020) Colloids Surf. B Biointerfaces 191 : 1109791; Singh, et al. (2020) Nanomedicine 25: 102172). While human immunodeficiency virus type one (HIV- 1) replication suppressed by antiretroviral therapy (ART) has markedly improved disease outcomes, infection persists. Viral DNA integration into the host cell target genome defines microbial latency, demonstrating that HIV-1 can circumvent the host immunity and persist in the system with continuous antiretroviral immunity with continuous HIV comorbidities (Fotooh Abadi, et al. (2023) J. Nanobiotechnol., 21(1): 19; Chun, et al. (2015) Nat. Immunol., 16(6):584-589; Surve, et al. (2020) Mol. Pharm., 17(10): 3990-4003). Despite the success of ART in managing HIV, a permanent cure remains elusive due to the presence of latent reservoirs in myeloid cells and memory T-cells. These reservoirs, mainly in the spleen and lungs, contain the highest amount of integrated proviral DNA. The existing gene-delivery approaches, such as AAV-based CRISPR delivery, have shown limited efficacy in clinical trials due to poor targeting and immunogenicity -related complications. Improved means of eliminating proviral DNA are needed.

[0009] SUMMARY OF THE INVENTION

[0010] In accordance with the instant invention, lipid nanoparticles are provided. In certain embodiments, the lipid nanoparticles comprise at least one ionizable lipid, at least one sterol, at least one polyethylene glycol (PEG)-lipid conjugate, and at least one helper lipid. In certain embodiments, the lipid nanoparticle further comprises a targeting moiety, e.g., a targeted lipid. In certain embodiments, the ionizable lipid is BAMEA-016B. In certain embodiments, the helper lipid is a phospholipid. In certain embodiments, the helper lipid is selected from the group consisting of 1,2- dioleoyl-sn-glycero-3 -phospho-L-serine (DOPS), di oleoylphosphatidylcholine (DOPC), phosphatidylserine (PS), l,2-dioleoyl-3 -trimethylammonium propane (DOTAP), distearoylphosphatidylcholine (DSPC), and 1,2- dileoyl-sn-3- phosphoethanolamine (DOPE). In certain embodiments, the sterol is P-sitosterol or cholesterol. In certain embodiments, the PEG-lipid conjugate is dimyristoyl glycerol (DMG)-PEG, l,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE)- PEG, or dimyristoylphosphoethanolamine (DMPE)-PEG. In certain embodiments, the lipid nanoparticle comprises BAMEA-016B, DOPC, DMG-PEG, cholesterol, and, optionally, a targeted lipid. In certain embodiments, the lipid nanoparticle comprises 30% to 60% of the ionizable lipid, 1% to 20% of the helper lipid, 25% to 50% of the sterol, 1% to 15% of the PEG-lipid conjugate, and, optionally, 0.01% to 2.5% of the targeted lipid. In certain embodiments, the targeting moiety or targeted lipid binds CCR5. In certain embodiments, the targeted lipid is DSPE-PEG-CCR5. In certain embodiments, the lipid nanoparticle comprises one or more plasma proteins. In certain embodiments, the lipid nanoparticle comprises apolipoprotein H (ApoH), complement factor properdin (CFP), and / or fibrinogen beta (FGB). In certain embodiments, the lipid nanoparticle comprises and / or encapsulates a therapeutic agent. In certain embodiments, the therapeutic agent is an antiviral agent or an antiretroviral agent. In certain embodiments, the therapeutic agent is a nucleic acid molecule. In certain embodiments, the therapeutic agent is a CRISPR based therapeutic (e.g., a gRNA or crRNA, optionally with Cas or a nucleic acid molecule encoding Cas). In certain embodiments, the gRNA or crRNA is complementary to a sequence within an HIV-1 gene. Compositions comprising at least one nanoparticle and a pharmaceutically acceptable carrier are also encompassed by the instant invention.

[0011] According to another aspect of the instant invention, methods of treating, inhibiting, and / or preventing a disease or disorder in a subject in need thereof are provided. The methods comprise administering at least one nanoparticle of the instant invention to the subject. In certain embodiments, the disease or disorder is an HIV (e.g., HIV-1) infection and / or latent reservoir.

[0012] BRIEF DESCRIPTIONS OF THE DRAWING

[0013] Figure 1 A provides the chemical structures of the ionizable lipids D-Lin- MC3-DMA, ALC-0315, and BAMEA-016B. Figure IB provides doughnut charts representing the lipid components (mol%) used to formulate lipid nanoparticles with and without CCR5.

[0014] Figure 2 A provides a graph of the size of BA-LNP and the PDI and zeta potential of the BA-LNP as measured by dynamic light scattering. Figure 2B provides a cryo-EM image of BA-LNP. Particles are designated by arrowhead. Figure 2C provides a graph of the plasma stability of BA-LNP over a period of 24 hours.

[0015] Figure 3 provides a graph of MDM cell viability following treatment with BA-LNP, MC3-LNP, and ALC-LNP. Cell viability was assessed using the CellTiter-Blue™ assay at 48 hours post-treatment. BA-LNP showed a superior cytotoxicity profile to MC3-LNP, and ALC-LNP, maintaining 80% cell viability at a dose as high as 6.25 pg mRNA / 106cells.

[0016] Figure 4 provides a graph of the protein translation efficiency of BA-LNP, MC3-LNP, and ALC-LNP in primary MDMs. Protein translation was evaluated using a luciferase assay 48 hours after LNP incubation. Relative luminescence units (RLU) were used to measure mRNA transfection efficacy. At a constant mRNA dose of 4 pg / 106cells, BA-LNP demonstrated a 20-fold higher transfection efficacy compared to MC3-LNP and ALC-LNP.

[0017] Figure 5 provides the biodistribution of LNPs was in humanized mice. LNPs was visualized using IVIS imaging at 6 hours post-injection (tail vein) with MC3- LNP, ALC-LNP, and BA-LNP, all encapsulated with FLuc mRNA. BA-LNP targeted the lymphoid and pulmonary tissues, which are the primary latent reservoirs of HIV.

[0018] Figure 6A provides a schematic illustrating the workflow for culturing human primary monocytes, differentiating them into macrophages, infecting with HIV-1 ADA, treating with ART and LNPs, and evaluating excision efficiency through PCR and gel electrophoresis. Figure 6B provides an image of the gel electrophoresis. Figure 6C provides a graph of the quantitation of the excision efficiency based on the gel electrophoresis in Fig. 6B.

[0019] Figure 7 provides confocal images showing higher endosomal escape ability of BA-LNP as compared to MC3-LNP. MC3-LNP is trapped in the lysosomal compartment and has higher colocalization coefficient as compared to BA-LNP.

[0020] Figure 8 provides images of Western blots showing higher NLRP3 expression of BA-LNP at 12 hours (top) showing its higher endosomal escape ability as compared to MC3-LNP. 24 hour timepoint is provided below.

[0021] Figure 9A provides a graph showing that the presence of a disulfide bond helps in higher mRNA translation as compared to non-disulfide analogue. Figure 9B provides a graph showing inhibition of the ROS production in primary MDMs using a ROS inhibitor (apocynin) showing reduced mRNA translation in the presence of apocynin.

[0022] Figures 10A and 10B provide graphs of the uptake of DiD labelled BA-LNP (Fig. 10A) and MC3-LNP (Fig. 10B) by MDMs in the presence of amiloride hydrochloride (AML), chlorpromazine (CPZ), cytochalasin D (CyD), or methyl-P- cyclodextrin (MpCD). Controls (Ctrl) in the absence of an inhibitor are also provided.

[0023] Figures 11 A and 1 IB provide graphs of the uptake of BA-LNP (Fig. 11 A) and MC3-LNP (Fig. 1 IB) by MDMs in the presence of amiloride hydrochloride (AML), chlorpromazine (CPZ), cytochalasin D (CyD), or methyl-P-cyclodextrin (MpCD). Relative luminescence units (RLU) indicting uptake are provided. Controls (Ctrl) in the absence of an inhibitor are also provided.

[0024] Figure 12A provides a heatmap of 40 major proteins showing compositional differences between BA-LNP and MC3-LNP. Figure 12B provides a volcano plot analysis of log2 (fold change) versus -logic (p-value), using cutoffs of log2 (fold change) > 1 and p < 0.05. The volcano plot identified 58 proteins significantly enriched on BA-LNP and 163 on MC3-LNP. Figure 12C provides the top 25 biased proteins adsorbed on the corona of BA-LNP plotted in a bubble chart in log2 (fold change) versus average abundance, with bubble shading indicating -loglO (p-value). Figures 12D and 12E provide the results of a luciferase assay of BA-LNP (Fig. 12D) and MC3-LNP (Fig. 12E) incubated with enriched plasma protein.

[0025] DETAILED DESCRIPTION OF THE INVENTION

[0026] There is a current need for more effective delivery systems for targeting proviral HIV DNA as AAV-based CRISPR therapies face limitations from immunogenicity and poor targeting of latent viral reservoirs. Herein, lipid nanoparticles (LNPs) are provided which possess several key features including, without limitation: a disulfide bond in its hydrophobic domain to enhance cytosolic delivery (e.g., in myeloid cells), superior mRNA translation efficiency (e.g., compared to other LNPs comprising other ionizable lipids such as MC3 and ALC- 0315), CRISPR-mediated viral elimination of provirus from infected cells, and selective biodistribution to HIV-1 tissue reservoirs.

[0027] In accordance with the instant invention, lipid nanoparticles are provided. The lipid nanoparticles can comprise one or more lipids. In certain embodiments, the lipid nanoparticle comprises a plurality of lipids. Examples of lipids that can be used in the present lipid nanoparticles include, without limitation, ionizable lipids, cationic lipids, anionic lipids, zwitterionic lipids, sterols, non-polar lipids, lipid conjugates (e.g., PEG-lipid conjugates), and helper lipids. The lipid nanoparticles of the instant invention may also comprise targeting moieties. In certain embodiments, the targeting moiety is attached to a lipid of the lipid nanoparticle. In certain embodiments, the lipid nanoparticles comprise a therapeutic agent. In certain embodiments, the lipid nanoparticles coat, encapsulate, package, and / or encompass a therapeutic agent. In certain embodiments, the therapeutic agent is contained within the interior of the lipid nanoparticle and / or within a lipid layer of the lipid nanoparticle.

[0028] In certain embodiments, the lipid nanoparticles of the present invention have an enhanced ability to target immune cells, including but not limited to monocyte- derived macrophages. In certain embodiments, the lipid nanoparticles preferentially infect the lung and / or spleen (e.g., compared to other organs). In certain embodiments, the lipid nanoparticles preferentially infect the lymphoid and / or pulmonary tissue (e.g., compared to other tissues). Examples of lipids used in the lipid nanoparticles of the instant invention include, but are not limited to: BAMEA-016B, BAMEA-016, LA-DMA, LA- DMDPA, DOTMA (l,2-di-O-octadecenyl-3 -trimethylammonium propane), DOSPA (N-(l-(2,3- dioleyloxy )propyl)-N-2-(sperminecarboxamido)ethyl)-N,N- dimethylammonium trifluoracetate), DOTAP (l,2-dioleoyl-3-trimethylammonium propane), DMRIE (N-(l,2-dimyristyloxyprop-3- yl)-N,N-dimethyl-N-hydroxyethyl ammonium), DC-cholesterol (30-(N-(N’,N’- dimethylaminoethane)- carbamoyl)cholesterol), DOTAP-cholesterol (l,2-dioleoyl-3- trimethylammonium propane;(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6- methylheptan-2- yl]-2,3,4,7,8,9,l l,12,14,15,16,17-dodecahydro-lH-cyclopenta[a]phenanthren-3- ol), GAP-DMORIE-DPyPE (Vaxfectin; (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3- bis(cis-9- tetradeceneyloxy)-l-propanaminium;l,2-diphytanoyl-sn-glycero-3- phosphoethanolamine), and GL67A (GL67-DOPE-DMPE-polyethylene glycol (PEG) (cholest-5-en-3-ol (30)-,3-[(3- aminopropyl)[4-[(3-aminopropyl)amino]butyl] carbamate; 1,2- dileoyl-sn-3- phosphoethanolamine; dimyristoylphosphoethanolamine; PEG), and pharmaceutically acceptable salts thereof.

[0029] In certain embodiments, the lipid nanoparticle comprises at least one ionizable lipid. Examples of ionizable lipids include, but are not limited to: BAMEA-016B, BAMEA-016, LA-DMA, LA-DMDPA, DLin-MC3-DMA (dilinoleylmethyl-4-dimethylaminobutyrate or MC3), and ALC-0315. In certain embodiments, the ionizable lipid is BAMEA-016B.

[0030] In certain embodiments, the lipid nanoparticle comprises at least one cationic lipid. Examples of cationic lipids include, but are not limited to: 1,2-di-O- octadecenyl-3- trimethylammonium propane (DOTMA), N,N-dioleyl-N,N- dimethylammonium chloride (DODAC), didodecyldimethylammonium bromide (DDAB), N, N-dimethyl2,3- dioleyloxy)propylamine (DODMA), 1,2- DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N- dimethylaminopropane (DLenDMA), 1,2- Dilinoleylcarbamoyloxy-3- dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoley oxy-3 - (dimethylamino)acetoxypropane (DLinDAC), 1,2-Dilinoley oxy-3 - morpholinopropane (DLinMA), l,2-Dilinoleoyl-3 -dimethylaminopropane (DLinDAP), l,2-Dilinoleylthio-3- dimethylaminopropane (DLin-S-DMA), 1- Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2- Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2- Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2- Dilinoleyloxy-3-(Nmethylpiperazino)propane (DLin-MPZ), 3-(N,N- Dilinoleylamino)-1,2- propanediol (DLinAP), 3-(N,N-Diolcylamino)-l,2- propanedio (DOAP), l,2-Dilinoleyloxo-3-(2-N,Ndimethylamino)ethoxypropane (DLin-EG-DMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]- dioxolane (DLin- K-DM A), (3 aR, 5 s, 6aS)-N,N-dimethyl-2,2-di((9Z, 12Z)-octadeca-9, 12- dienyl)tetrahydro-3aH-cyclopenta[d][l,3]dioxol-5-amine (ALNY-100), DODAP (l,2-dioleoyl-3- dimethyl ammonium propane), GL67 (cholest-5-en-3-ol (3P)-,3-[(3- aminopropyl)[4-[(3- aminopropyl)amino]butyl]carbamate), ethyl PC, DOSPA (N-(l- (2,3-dioleyloxy)propyl)-N-2- (sperminecarboxamido)ethyl)-N,N- dimethylammonium trifluoracetate), DOGS (dioctadecylamidoglycyl carboxyspermine), DORIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3- bis(((Z)- octadec-9-en-l-yl)oxy)propan-l-aminium ), DMRIE (N-(l,2-dimyristyloxyprop-3- yl)- N,N-dimethyl-N-hydroxyethyl ammonium), GAP-DLRIE ((+ / -)-N-(3- aminopropyl)-N,Ndimethyl-2,3-bis (dodecyloxy)- 1-propanaminium), diC14- amidine, 3B-[N-(N',N'- dimethylaminoethane)-carbamoyl]cholesterol (DC-Chol), dimethyldioctadecylammonium (DDA), l,2-dioleoyl-3 -trimethylammonium propane (DOTAP), l,2-dimyristoyl-3- trimethylammonium-propane (DMTAP), 1,2-stearoyl- 3 -trimethylammonium -propane (DSTAP) and N-(4-carboxybenzyl)-N,N-dimethyl- 2,3-bis(oleoyloxy)propan-l-aminium (DOBAQ), egg phosphatidylcholine, and cholesterol-polyethylene glycol, 98N12-5 (isomer of triethylenetetraminelaurylaminopropionate with a free internal amine, cholesterol, and mPEG2000-C14 glyceride), Cl 2-200 (CAS#: 1220890-25-4; l,l-((2-(4-(2-((2-(bis(2- hy droxy dodecyl)amino)ethyl)(2 -hydroxy dodecyl) amino)ethyl)piperazin- 1 - yl)ethyl)azanediyl)bis(dodecan-2-ol)), DLin-KC2-DMA (KC2) (CAS#: 1190197- 97-7; 2,2- dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]-dioxolane), , XTC (2,2- dilinoleyl-4- dimethylaminoethyl-[l,3]-di oxolane), MD1 (CKK-E12; 3,6-bis({4- [bis(2- hydroxy dodecyl)amino]butyl})piperazine-2, 5-dione), 7C1 (C15 epoxide- terminated lipid), and pharmaceutically acceptable salts thereof.

[0031] In certain embodiments, the lipid nanoparticle comprises at least one zwitterionic lipid. Examples of zwitterionic (neutral) lipids include, but are not limited to: BAMEA-O16B, BAMEA-016, LA-DMA, LA-DMDPA, DSPC (distearoylphosphatidylcholine), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dioleoyl- phosphatidylethanolamine 4- (Nmaleimidomethyl)-cyclohexane-l- carboxylate (DOPE- mal), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 16-0- monomethyl PE, 16-Odimethyl PE, 18-1 -trans PE, 1 -stearoyl-2-oleoyl- phosphatidy ethanolamine (SOPE), DPSC (distearoylphosphatidylcholine), DPPC (dipalmitoylphosphatidylcholine), POPC (palmitoyloleoylphosphatidylcholine), DOPE (1,2- dileoyl-sn-3-phosphoethanolamine), DSPE (1,2-distearoyl-sn-glycero- 3 -phosphoethanolamine), DMG (dimyristoyl glycerol), phosphatidylserines, phosphatidylethanolamines, phosphatidylcholines, sphingomyelins, sphingophospholipids, betaine lipids (e.g. lauramidopropyl betaine), and SM (sphingomyelin).

[0032] In certain embodiments, the lipid nanoparticle comprises at least one anionic lipid. Examples of anionic lipids include, but are not limited to: phosphatidylglycerols (PG), phosphatidic acid, and phosphatidylinositol phosphates.

[0033] In certain embodiments, the lipid nanoparticle comprises at least one nonpolar lipid. Examples of non-polar lipids may include, but are not limited to: glycerides (mono, di, and triglycerides) and other non-charged lipids.

[0034] In certain embodiments, the lipid nanoparticle comprises at least one conjugated lipid. In certain embodiments, the lipid is conjugated to a polymer. In certain embodiments, the polymer is polyethylene glycol (PEG). In certain embodiments, the PEG has a molecular weight from about 200 g / mol to 10,000 g / mol. In certain embodiments, the PEG has a molecular weight from about 200 g / mol to 1,000 g / mol. In certain embodiments, the PEG has a molecular weight from about 200 g / mol to 800 g / mol. In certain embodiments, the PEG is any molecular weight form of PEG including but not limited to PEG200, PEG300, PEG400, PEG600, PEG1000, PEG2000, PEG3000, PEG6000, and PEG8000. In certain embodiments, the PEG is PEG2000. Examples of PEG-lipid conjugates include, but are not limited to: DMG-PEG, DSPE-PEG, and DMP-PEG.

[0035] In certain embodiments, the lipid nanoparticle comprises at least one sterol. Examples of sterols include, but are not limited to: P-sitosterol, cholesterol, phytosterol, fucosterol, and stigmastanol. In certain embodiments, the sterol is cholesterol. In certain embodiments, the lipid nanoparticle comprises at least one helper lipid. In certain embodiments, a helper lipid is a lipid that increase particle stability and / or fluidity of a lipid nanoparticle. In certain embodiments, the helper lipid is a phospholipid. Examples of helper lipids include, but are not limited to: 1,2- dioleoyl-sn-glycero-3 -phospho-L-serine (DOPS), di oleoylphosphatidylcholine (DOPC), phosphatidylserine (PS), DOTAP, DSPC, and DOPE. In certain embodiments, the helper lipid is DOPC.

[0036] As stated hereinabove, the lipid nanoparticles of the instant invention may further comprise at least one targeting moiety (e.g., for a specific tissue or cell type). In certain embodiments, the lipid nanoparticle comprises at least one targeted lipid (e.g., a lipid conjugated and / or linked to a targeting moiety). In certain embodiments, the targeting moiety binds a receptor on the surface of a cell or tissue. In certain embodiments, the targeting moiety is an antibody or antigen-binding domain thereof (e.g., specific for a cell-surface receptor). In certain embodiments, the targeting moiety is a ligand for a cell-surface receptor. In certain embodiments, the targeting moiety is an agonist or antagonist of a cell-surface receptor. In certain embodiments, the targeting moiety binds C-C chemokine receptor type 5 (CCR5 or CD 195) or CXCR4. CCR5 targeting moi eties include, but are not limited to: maraviroc, aplaviroc, vicriviroc, INCB009471, leronlimab, CCR5 peptides such as Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-NEE (SEQ ID NO: 1, optionally comprising one or more D-amino acids), and pharmaceutically acceptable salts thereof. CXCR4 targeting moieties include, but are not limited to: plerixafor, AMD3100, AMD3465, ITlt, KRH-3955, AMD070, FC131, HF51116, BPRCX807; and peptides such as the cyclic peptide D-Tyr-Om-Arg-Nal-Gly- (CycPep; SEQ ID NO: 2), and pharmaceutically acceptable salts thereof. In certain embodiments, the targeting moiety is linked to a lipid, such as a PEG-lipid conjugate (e.g., attached to the PEG). In certain embodiments, the targeting moiety is linked to a phospholipid, such as a PEG-phospholipid conjugate (e.g., attached to the PEG). In certain embodiments, the PEG-lipid conjugate is DSPE-PEG. In certain embodiments, the targeted lipid comprises the peptide D-ASTTTNYT-NH2 (SEQ ID NO: 1) conjugated to DSPE-PEG. In certain embodiments, the targeted lipid is DSPE-PEG- CCR5.

[0037] The lipid nanoparticles of the instant invention can be of any shape, but are typically round or spherically shaped. In certain embodiments, the diameter (e.g., average diameter) or longest dimension of the lipid nanoparticle is about 1 nm to about 1000 nm, about 1 nm to about 500 nm, about 1 nm to about 250 nm, about 10 to about 500 nm, about 20 nm to about 400 nm, about 20 nm to about 300 nm, about 25 nm to about 200 nm, about 50 nm to about 200 nm, about 50 nm to about 150 nm, about 50 nm to about 125 nm, about 25 nm to about 100 nm, about 50 nm to about 100 nm, about 35 nm to about 75 nm, about 25 nm to about 60 nm, about 75 nm to about 100 nm, or about 90 nm. In certain embodiments, the lipid nanoparticle has an average diameter less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. In certain embodiments, the lipid nanoparticle has an average diameter greater than 1 nm, greater than 5 nm, greater than 10 nm, greater than 20 nm, greater than 30 nm, greater than 40 nm, greater than 50 nm, greater than 60 nm, greater than 70 nm, or greater than 75 nm.

[0038] In certain embodiments, the lipid nanoparticle comprises at least one ionizable lipid (e.g., BAMEA-016B), at least one sterol (e.g., cholesterol), at least one PEG-lipid conjugate (e.g., DMG-PEG), and at least one helper lipid (e.g., DOPC). In certain embodiments, the lipid nanoparticle further comprises a targeted lipid (e.g., DSPE-PEG-CCR5). In certain embodiments, the lipid nanoparticle comprises BAMEA-016B, DOPC, DMG-PEG, cholesterol, and, optionally, DSPE- PEG-CCR5. In certain embodiments, the lipid nanoparticle is comprised of about 50% BAMEA-016B, about 10% DOPC, about 1.5% DMG-PEG, about 38.5% cholesterol, and, optionally, about 0.2% DSPE-PEG-CCR5. In certain embodiments, the percentages of the components of the lipid nanoparticle are mole percentage (mol %).

[0039] In certain embodiments, the lipid nanoparticle comprises about 25% to about 75%, about 30% to about 70%, about 30% to about 60%, about 40% to about 60%, about 45% to about 55%, about 48% to about 52%, or about 50% ionizable lipid (e.g., BAMEA-016B). In certain embodiments, the lipid nanoparticle comprises at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, or at least about 70% ionizable lipid (e.g., BAMEA-016B). In certain embodiments, the lipid nanoparticle has less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, or less than about 40% ionizable lipid (e.g., BAMEA-016B). In certain embodiments, the lipid nanoparticle comprises about 20% to about 60%, about 25% to about 55%, about 25% to about 50%, about 30% to about 50%, about 35% to about 45%, about 35% to about 40%, or about 38.5% sterol (e.g., cholesterol). In certain embodiments, the lipid nanoparticle comprises at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, or at least about 60% sterol (e.g., cholesterol). In certain embodiments, the lipid nanoparticle has less than about 65%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, or less than about 35% sterol (e.g., cholesterol).

[0040] In certain embodiments, the lipid nanoparticle comprises about 1% to about 40%, 1% to about 30%, about 1% to about 20%, about 5% to about 15%, about 7% to about 13%, or about 10% helper lipid (e.g., DOPC). In certain embodiments, the lipid nanoparticle comprises at least about 1%, at least about 3%, at least about 5%, at least about 7%, at least about 10%, or at least about 15% helper lipid (e.g., DOPC). In certain embodiments, the lipid nanoparticle has less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 13%, or less than about 10% helper lipid (e.g., DOPC).

[0041] In certain embodiments, the lipid nanoparticle comprises about 0.1% to about 20%, about 0.5% to about 15%, 1% to about 15%, about 1% to about 10%, about 1% to about 5%, about 1% to about 3%, or about 1.5% PEG-lipid conjugate (e.g., DMG-PEG). In certain embodiments, the lipid nanoparticle comprises at least about 0.01%, at least about 0.05%, at least about 0.1%, at least about 0.5%, at least about 1%, or at least about 1.5% PEG-lipid conjugate (e.g., DMG-PEG). In certain embodiments, the lipid nanoparticle has less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 3%, or less than about 1% PEG-lipid conjugate (e.g., DMG-PEG).

[0042] In certain embodiments, the lipid nanoparticle comprises about 0.01% to about 5%, about 0.01% to about 2.5%, about 0.05% to about 2%, about 0.1% to about 1%, or about 0.2% targeted lipid (e.g., DSPE-PEG-CCR5). In certain embodiments, the lipid nanoparticle comprises at least about 0.01%, at least about 0.05%, at least about 0.1%, or at least about 0.5% targeted lipid (e.g., DSPE-PEG- CCR5). In certain embodiments, the lipid nanoparticle has less than about 5%, less than about 3%, less than about 2%, less than about 1%, or less than about 0.5% targeted lipid (e.g., DSPE-PEG-CCR5). In certain embodiments, the lipid nanoparticles of the instant invention further comprise plasma proteins. In certain embodiments, the lipid nanoparticle comprises the plasma protein on its surface and / or in the lipid membrane. In certain embodiments, the lipid nanoparticles comprise a corona of plasma protein and / or are coated with plasma protein. In certain embodiments, the plasma protein is human plasma protein. Examples of plasma proteins include, without limitation: ApoE, ApoH, CFP, and FGB, particularly ApoH, CFP, and FGB, more particularly ApoH and CFP. In certain embodiments, the lipid nanoparticle further comprises ApoE, ApoH, CFP, and / or FGB (e.g., on its surface). In certain embodiments, the lipid nanoparticle further comprises ApoH, CFP, and / or FGB (e.g., on its surface). In certain embodiments, the lipid nanoparticle further comprises ApoH and / or CFP (e.g., on its surface). In certain embodiments, the lipid nanoparticle further comprises CFP (e.g., on its surface).

[0043] The lipid nanoparticles of the present invention can be used to package or encapsulate a therapeutic agent. Examples of therapeutic agents include, without limitation: nucleic acid molecules, small molecules, peptides, antibodies, antibodybased therapeutics, and proteins. In certain embodiments, the lipid nanoparticle comprises or encapsulates at least one nucleic acid molecule. In certain embodiments, the nucleic acid molecule is encapsulated by the ionizable lipid, which is in turn encapsulated by the remaining lipids of the lipid nanoparticle. In certain embodiments, the nucleic acid molecule is crRNA, mRNA, guide RNA, siRNA, shRNA, antisense oligonucleotide, locked nucleic acids, microRNA, RNA aptamer, DNA aptamer, RNA decoy, ribozyme, circular RNA, RNA sponge, selfamplifying RNA, and combinations thereof. In certain embodiments, the therapeutic agent is CRISPR-based. The use of CRISPR can greatly reduce or eliminate (e.g., by 50-100%) HIV-1 replication or HIV-1 provirus.

[0044] Clustered, regularly interspaced, short palindromic repeat (CRISPR) / Cas9 (e.g., from Streptococcus pyogenes) technology and gene editing are well known in the art (see, e.g., Shi et al. (2015) Nat. Biotechnol., 33(6):661-7; Sander et al. (2014) Nature Biotech., 32:347-355; Jinek et al. (2012) Science, 337:816-821; Cong et al. (2013) Science 339:819-823; Ran et al. (2013) Nature Protocols 8:2281-2308; Mali et al. (2013) Science 339:823-826; Sapranauskas et al. (2011) Nucleic Acids Res. 39:9275-9282; Nishimasu et al. (2014) Cell 156(5):935-49; Swarts et al. (2012) PLoS One, 7:e35888; Sternberg et al. (2014) Nature 507(7490):62-7; addgene.org / crispr / guide). Typically, the RNA-guided CRISPR / Cas9 system involves using Cas9 (e.g., a nucleic acid molecule (e.g., mRNA) encoding Cas9) along with a guide RNA molecule (gRNA). Guidelines and computer-assisted methods for generating gRNAs are available and well known in the art (see, e.g, CRISPR Design Tool (crispr.mit.edu); Hsu et al. (2013) Nat. Biotechnol. 31 :827- 832; addgene.org / CRISPR; and CRISPR gRNA Design tool - DNA2.0 (dna20.com / eCommerce / startCas9)). gRNAs bind and recruit Cas9 to a specific target sequence (e.g., viral genome) where it mediates a double strand DNA (dsDNA) break. More than one gRNA (e.g., two) may be administered to make multiple breaks within the target nucleic acid. The double strand break can be repaired by non-homologous end joining (NHEJ) pathway yielding a deletion of the target nucleic acid.

[0045] While CRISPR is described herein as utilizing Cas9, other nucleases such as other Cas proteins or Cas9 variants and homologs can be used. In certain embodiments, the Cas protein is a Cas9, CasPhi (Cas <b), Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl Csy2, Csy3, CaslO, Csm2, Cmr5, CaslO, Csxl 1, CsxlO, Csfl, Csn2, Cas4, C2cl, C2c3, Cas 12a (Cpfl), Cas 12b, Casl2e, Cas 13 a, Cas 13, Cas 13c, or Cas 13d. Other examples include, without limitation, Streptococcus pyogenes Cas9, Cas9 D10A, high fidelity Cas9 (KI einstiver et al. (2016) Nature, 529:490-495; Slaymaker et al. (2016) Science, 351 :84-88), Cas9 nickase (Ran et al. (2013) Cell, 154: 1380-1389), Streptococcus pyogenes Cas9 with altered PAM specificities (e.g., SpCas9_VQR, SpCas9_EQR, and SpCas9_VRER; Kleinstiver et al. (2015) Nature, 523:481-485), Staphylococcus aureus Cas9, casl2a (Cpfl) (Rusk, N., Nat. Methods (2019) 16(3):215), the CRISPR / Cpfl system of Acidaminococcus, and the CRISPR / Cpfl system of Lachnospiraceae . In certain embodiments, the Cas9 is S. pyogenes Cas9.

[0046] The binding specificity of the CRISPR / Cas9 complex depends on two different elements. First, the binding complementarity between the targeted sequence (e.g., viral genome) and the complementary recognition sequence of the gRNA (e.g., -18-22 nucleotides, particularly about 20 nucleotides). Second, the presence of a protospacer-adjacent motif (PAM) juxtaposed to the target DNA / gRNA complementary region (linek et al. (2012) Science 337:816-821; Hsu et al. (2013) Nat. Biotech., 31 :827-832; Sternberg et al. (2014) Nature 507:62-67). The PAM motif for S. Pyogenes Cas9 has been fully characterized, and is NGG or NAG (Jinek et al. (2012) Science 337:816-821; Hsu et al. (2013) Nat. Biotech., 31 : 827-832). Other PAMs of other Cas9 proteins are also known (see, e.g., addgene.org / crispr / guide / #pam-table). Examples of PAM sequences include, without limitation: S. pyogenes (spCas9) - NGG; S. aureus Cas9 (saCas9) - NNGRRT or NGRRN; Neisseria meningitidis (NmeCas9) -NNNNGATT; Campylobacter jejuni (CjCas9) - NNNNRYAC; Streptococcus thermophilus (StCas9) - NNAGAAW; Lachnospiraceae bacterium (LbCpfl) - TTTV; and Acidaminococcus sp. (AsCpfl) - TTTV. Typically, the PAM sequence is 3’ of the target sequence in the genomic sequence.

[0047] The guide RNA may comprise separate nucleic acid molecules wherein one RNA may specifically hybridize to a target sequence (crRNA) and another RNA (trans-activating crRNA (tracrRNA)) specifically hybridizes with the crRNA. The crRNA and a tracrRNA may be bound together. The gRNA binds to a Cas enzyme (e.g., Cas9) and guides the Cas enzyme to the target sequence. As used herein, the term “crRNA” means a non-coding short RNA sequence which binds to a complementary target DNA sequence. The crRNA sequence may bind to a Cas enzyme (e.g., Cas9) and the crRNA sequence guides the complex via pairing to a specific target DNA sequence. As used herein, the term “tracrRNA” or trans- activating CRISPR RNA means an RNA sequence that base pairs with the crRNA (e.g., a scaffold sequence to form a functional guide RNA (gRNA)). The tracrRNA sequence binds to a Cas enzyme (e.g., Cas9), while the crRNA sequence of the gRNA directs the complex to a target sequence. Any suitable tracrRNA sequence is contemplated for use with a gRNA disclosed herein (e.g., 5’-GUUUUAGAGC UAGAAAUAGC AAGUUAAAAU AAGGCUAGUC CGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGCUUUU; SEQ ID NO: 3).

[0048] In certain embodiments, the guide RNA is a single molecule (sgRNA) which comprises a sequence (crRNA; complementary sequence) which specifically hybridizes (e.g., complete complementary) with a target sequence and a sequence (e.g., a tracrRNA sequence; scaffold sequence) recognized by Cas9, which are well known in the art. In other words, an sgRNA is a single RNA construct comprising a crRNA sequence and a tracrRNA sequence. Fore simplicity, the term gRNA is generally used herein to encompass sgRNA unless the context clearly dictates otherwise. The greater the complementarity reduces the likelihood of undesired cleavage events at other sites of the genome. In a particular embodiment, the region of complementarity (e.g., between a guide RNA (or crRNA) and a target sequence) is at least about 10, at least about 12, at least about 15, at least about 17, at least about 20, at least about 25, at least about 30, at least about 35, or more nucleotides. In a particular embodiment, the region of complementarity (e.g., between a guide RNA and a target sequence) is about 15 to about 25 nucleotides, about 15 to about 23 nucleotides, about 16 to about 23 nucleotides, about 17 to about 21 nucleotides, about 18 to about 22 nucleotides, or about 20 nucleotides. In a particular embodiment, the guide RNA (or crRNA) targets a sequence or comprises a sequence (e.g., RNA version) which has at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% homology or identity to the target sequence. In certain embodiments, the gRNA (or crRNA) targets (and inactivates or deletes) all or part of integrated HIV-1 DNA. In certain embodiments, the gRNA (or crRNA) targets (and inactivates or deletes) tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and / or nef. In certain embodiments, the gRNA (or crRNA) targets (and inactivates or deletes) tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, CCR5, LTR-1, gagD, and / or nef. In certain embodiments, the gRNA (or crRNA) targets (and inactivates or deletes) all or part of the transactivator of transcription (tat) gene. In certain embodiments, at least two different gRNA (or crRNA) are used. For example, one gRNA (or crRNA) may target the transactivator of transcription (tat) gene and the other gRNA (or crRNA) may target another region of the integrated HIV-1 genome. In a particular embodiment, at least one of the CRISPR and gRNA (or crRNA) are selected from those described in Dash et al. (Nat. Comm. (2019) 10(l):2753 or WO 2021 / 178924), each incorporated by reference herein.

[0049] In certain embodiments, the gRNA or crRNA may be constructed from a multiple sequence alignment of separate viral strains and / or bind to a plurality of nucleic acids of an overlapping exon. In certain embodiments, the overlapping exon is part of a nucleic acid sequence of at least two HIV genes (e.g., HIV-1 genes). In certain embodiments, the HIV (e.g., HIV-1) genes are selected from the group consisting of: tat, rev, env-gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef. In certain embodiments, the overlapping exon is part of a nucleic acid sequence of at least three HIV (e.g., HIV-1) genes selected from the group consisting of: tat, rev, env- gp41, gag-pl, gag-p6, vif, vpr, vpu, and nef. In certain embodiments, the overlapping exon is part of a nucleic acid sequence of HIV (e.g., HIV-1) genes tat, rev, and env. In certain embodiments, the crRNA or gRNA comprises one of the following nucleic acid sequences and / or targets the indicated sequence:

[0050] 1) UAGAUCCUAACCUAGAGCCC (SEQ ID NO: 4; TatA2), wherein the target DNA complementary sequence is TAGATCCTAACCTAGAGCCC (SEQ ID NO: 5);

[0051] 2) UCUCCUAUGGCAGGAAGAAG (SEQ ID NO: 6; TatD), wherein the target DNA complementary sequence is TCTCCTATGGCAGGAAGAAG (SEQ ID NO: 7);

[0052] 3) GAAGGAAUCGAAGAAGAAGG (SEQ ID NO: 8, TatE), wherein the target DNA complementary sequence is GAAGGAATCGAAGAAGAAGG (SEQ ID NO: 9);

[0053] 4) GAAAGAAUCGAAGAAGGAGG (SEQ ID NO: 10; TatE2), wherein the target DNA complementary sequence is GAAAGAATCGAAGAAGGAGG (SEQ ID NO: 11);

[0054] 5) CCGAUUCCUUCGGGCCUGUC (SEQ ID NO: 12; TatF), wherein the target DNA complementary sequence is CCGATTCCTTCGGGCCTGTC (SEQ ID NO: 13);

[0055] 6) UCUCCGCUUCUUCCUGCCAU (SEQ ID NO: 14; TatG), wherein the target DNA complementary sequence is TCTCCGCTTCTTCCTGCCAT (SEQ ID NO: 15);

[0056] 7) GCUUAGGCAUCUCCUAUGGC (SEQ ID NO: 16; TatH), wherein the target DNA complementary sequence is GCTTAGGCATCTCCTATGGC (SEQ ID NO: 17); and

[0057] 8) GGCUCUAGGUUAGGAUCUAC (SEQ ID NO: 18; Tati), wherein the target DNA complementary sequence is GGCTCTAGGTTAGGATCTAC (SEQ ID NO: 19).

[0058] In certain embodiments, the crRNA or gRNA comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 97% identical to one of the sequences set forth above (e.g., SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, or 18).

[0059] In certain embodiments, the gRNA (or crRNA) targets (and inactivates or deletes) HIV-1 LTR1, CCR5, and / or gagD. In certain embodiments, the crRNA or gRNA comprises one of the following nucleic acid sequences (or RNA form) and / or targets the sequence:

[0060] LTR1 : 5'-GCAGAACTACACACCAGGGCC-3' (SEQ ID NO: 20); gagD: 5'-GGATAGATGTAAAAGACACCA-3' (SEQ ID NO: 21);

[0061] CCR5 A: 5'-GCGGCAGCATAGTGAGCCCAG-3' (SEQ ID NO: 22); or CCR5 B: 5'-TCAGTTTACACCCGATCCAC-3' (SEQ ID NO: 23).

[0062] In certain embodiments, the crRNA or gRNA comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 97% identical to one of the sequences set forth above (e.g., SEQ ID NOs: 20, 21, 22, or 23).

[0063] CRISPR can be incorporated into lipid nanoparticles in various ways. In certain embodiments, the lipid nanoparticle comprises at least one Cas (e.g., the protein and / or a nucleic acid molecule encoding Cas) and at least one gRNA, crRNA, and / or tracrRNA or a nucleic acid molecule encoding the gRNA, crRNA, and / or tracrRNA. In certain embodiments, the lipid nanoparticle comprises 1) at least one gRNA, crRNA, and / or tracrRNA or a nucleic acid molecule encoding the gRNA, crRNA, and / or tracrRNA and 2) a nucleic acid molecule (e.g., mRNA) encoding Cas. In certain embodiments, the lipid nanoparticle comprises a Cas ribonucleoprotein (RNP) with the gRNA, crRNA, and / or tracrRNA. In certain embodiments, at least one gRNA, crRNA, and / or tracrRNA and the Cas are in separate lipid nanoparticles. For example, a first lipid nanoparticle may comprise at least one gRNA, crRNA, and / or tracrRNA or a nucleic acid molecule encoding the gRNA, crRNA, and / or tracrRNA and a second lipid nanoparticle comprises Cas and / or a nucleic acid molecule encoding Cas.

[0064] In certain embodiments, the crRNA, gRNA, tracrRNA, and / or nucleic acid sequence encoding the Cas protein is part of any suitable delivery vehicle. In certain embodiments, the delivery vehicle is a plasmid. In certain embodiments, the delivery vehicle is a vector (e.g., expression vector). In certain embodiments, a nucleic acid molecule encoding the gRNA, crRNA, and / or tracrRNA and a nucleic acid encoding Cas are contained in a vector. In certain embodiments, a nucleic acid molecule encoding the gRNA, crRNA, and / or tracrRNA and a nucleic acid encoding Cas are contained in separate vectors. In certain embodiments, the nucleic acid encoding Cas is contained in a vector.

[0065] The instant invention also encompasses compositions (e.g., pharmaceutical compositions) comprising at least one lipid nanoparticle of the instant invention and at least one carrier (e.g., pharmaceutically acceptable carrier). As stated hereinabove, the lipid nanoparticles may comprise more than one therapeutic agent. In certain embodiments, the pharmaceutical composition comprises a first lipid nanoparticle comprising a first therapeutic agent and a second lipid nanoparticle comprising a second therapeutic agent, wherein the first and second therapeutic agents are different. The compositions (e.g., pharmaceutical compositions) of the instant invention may further comprise (e.g., not contained within the lipid nanoparticles) other therapeutic agents (e.g., other anti-HIV compounds).

[0066] In accordance with another aspect of the instant invention, the lipid nanoparticles of the instant invention may be used to deliver at least one therapeutic agent to a cell (e.g., T-cell) or a subject (including non-human animals). The present invention also encompasses methods for preventing (e.g., prophylactically protecting), inhibiting, and / or treating a disease or disorder. The present invention also encompasses methods for reducing and / or eliminating a provirus (e.g., HIV provirus or latent reservoir) from a cell or subject. The present invention also provides methods for delivering a therapeutic agent to the spleen and / or lung. The present invention also provides methods for delivering a therapeutic agent to lymphoid and / or pulmonary tissue. In certain embodiments, the methods comprise administering lipid nanoparticles of the instant invention (optionally in a composition) to a cell and / or subject in need thereof. In certain embodiments, the methods comprise administering lipid nanoparticles of the instant invention (optionally in a composition) to a cell and administering the cell to a subject in need thereof.

[0067] Examples of diseases and disorders to be treated include, without limitation: cancer, CNS and neurological diseases, neurodegenerative diseases (e.g., Parkinson’s Disease, Alzheimer’s Disease, and Huntington’s Disease), neuropsychiatric diseases, inflammatory diseases, autoimmune diseases, metabolic diseases, cardiovascular diseases, pulmonary diseases, gastrointestinal diseases, skin diseases, ophthalmological diseases, and infectious diseases including bacterial, fungal, and viral infections (e.g., HIV). In certain embodiments, the disease or disorder is a viral infection, particularly an HIV infection. Viral infections to be treated by the instant invention include, but are not limited to infections by: HIV, flavivirus, togaviruses, non-HIV retroviruses, lentiviruses, coronaviruses, orthomyxoviruses, paramyxovirus, rhabdoviruses, filoviruses, arenaviruses, bunyaviruses, and delta viruses. In a particular embodiment, the viral infection is a retroviral infection or a lentiviral infection. In a particular embodiment, the viral infection is a HIV infection. In certain embodiments, the lipid nanoparticles are used to transfect T-cells and generate T-cell-based therapeutics.

[0068] The lipid nanoparticles of the instant invention (optionally in a composition) can be administered to an animal, in particular a mammal, more particularly a human, in order to treat / inhibit / prevent the viral infection (e.g., a retroviral infection such as an HIV infection). The pharmaceutical compositions of the instant invention may also comprise at least one other therapeutic agent such as an antiviral agent, particularly at least one other anti -HIV compound / agent. The additional anti -HIV compound may also be administered in a separate pharmaceutical composition from the lipid nanoparticles or compositions of the instant invention. The pharmaceutical compositions may be administered at the same time or at different times (e.g., sequentially).

[0069] The dosage ranges for the administration of the lipid nanoparticles and / or compositions of the invention are those large enough to produce the desired effect (e.g., curing, relieving, treating, and / or preventing the viral infection (e.g., HIV infection), the symptoms of it (e.g., AIDS, ARC), or the predisposition towards it). The dosage should not be so large as to cause significant adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any counter indications.

[0070] The lipid nanoparticles described herein will generally be administered to a patient as a pharmaceutical composition. The term “patient” as used herein refers to human or animal subjects. These lipid nanoparticles may be employed therapeutically, under the guidance of a physician.

[0071] The pharmaceutical compositions comprising the lipid nanoparticles of the instant invention may be conveniently formulated for administration with any pharmaceutically acceptable carrier(s). For example, the complexes may be formulated with an acceptable medium such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents, or suitable mixtures thereof, particularly an aqueous solution. The concentration of the lipid nanoparticles in the chosen medium may be varied and the medium may be chosen based on the desired route of administration of the pharmaceutical composition. Except insofar as any conventional media or agent is incompatible with the lipid nanoparticles to be administered, its use in the pharmaceutical composition is contemplated.

[0072] The dose and dosage regimen of lipid nanoparticles according to the invention that are suitable for administration to a particular patient may be determined by a physician considering the patient’s age, sex, weight, general medical condition, and the specific condition for which the lipid nanoparticles are being administered and the severity thereof. The physician may also take into account the route of administration, the pharmaceutical carrier, and the lipid nanoparticle’s biological activity.

[0073] Selection of a suitable pharmaceutical composition will also depend upon the mode of administration chosen. For example, the lipid nanoparticles of the invention may be administered by direct injection or intravenously. In this instance, a pharmaceutical composition comprises the lipid nanoparticles dispersed in a medium that is compatible with the site of injection.

[0074] Lipid nanoparticles of the instant invention may be administered by any method. For example, the lipid nanoparticles of the instant invention can be administered, without limitation parenterally, subcutaneously, orally, nasally, enterally, gastroenterolly, topically, transdermally, pulmonarily, rectally, vaginally, intravenously, intraperitoneally, intrathecally, intracerbrally, epidurally, intramuscularly, intradermally, intravenously, or intracarotidly. Lipid nanoparticles of the present invention may be administered to a subject in need by any appropriate route including but not limited to enteral, gastroenteral, oral, transdermal, subcutaneous, nasal, intravenous, intravenous bolus, intravenous drip, intraarterial, intramuscular, transmucosal, insufflation, sublingual, buccal, conjunctival, cutaneous, and intrathecal. In a particular embodiment, the lipid nanoparticles are administered parenterally. In a particular embodiment, the lipid nanoparticles are administered orally, intramuscularly, subcutaneously, or to the bloodstream (e.g., intravenously). In a particular embodiment, the lipid nanoparticles are administered intramuscularly or subcutaneously. Pharmaceutical compositions for injection are known in the art. If injection is selected as a method for administering the lipid nanoparticles, steps must be taken to ensure that sufficient amounts of the molecules or cells reach their target cells to exert a biological effect. Dosage forms for parenteral administration include, without limitation, solutions, emulsions, suspensions, dispersions and powders / granules for reconstitution.

[0075] Pharmaceutical compositions containing lipid nanoparticles of the present invention as the active ingredient in intimate admixture with a pharmaceutically acceptable carrier can be prepared according to conventional pharmaceutical compounding techniques. The carrier may take a wide variety of forms depending on the form of pharmaceutical composition desired for administration, e.g., intravenous, oral, direct injection, intracranial, and intravitreal.

[0076] A pharmaceutical composition of the invention may be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form, as used herein, refers to a physically discrete unit of the pharmaceutical composition appropriate for the patient undergoing treatment. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate dosage unit are well known to those skilled in the art.

[0077] Dosage units may be proportionately increased or decreased based on the weight of the patient. Appropriate concentrations for alleviation of a particular pathological condition may be determined by dosage concentration curve calculations, as known in the art.

[0078] In accordance with the present invention, the appropriate dosage unit for the administration of lipid nanoparticles may be determined by evaluating the toxicity of the molecules or cells in animal models. Various concentrations of lipid nanoparticles in pharmaceutical composition may be administered to mice, and the minimal and maximal dosages may be determined based on the beneficial results and side effects observed as a result of the treatment. Appropriate dosage unit may also be determined by assessing the efficacy of the lipid nanoparticle treatment in combination with other standard drugs. The dosage units of lipid nanoparticles may be determined individually or in combination with each treatment according to the effect detected.

[0079] The pharmaceutical composition comprising the lipid nanoparticles may be administered at appropriate intervals until the pathological symptoms are reduced or alleviated, after which the dosage may be reduced to a maintenance level. The appropriate interval in a particular case would normally depend on the condition of the patient. Definitions

[0080] The following definitions are provided to facilitate an understanding of the present invention.

[0081] The singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.

[0082] “Pharmaceutically acceptable” indicates approval by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0083] A “carrier” refers to, for example, a diluent, adjuvant, preservative (e.g., Thimersol, benzyl alcohol), anti-oxidant (e.g., ascorbic acid, sodium metabisulfite), solubilizer (e.g., polysorbate 80), emulsifier, buffer (e.g., Tris HC1, acetate, phosphate), antimicrobial, bulking substance (e.g., lactose, mannitol), excipient, auxiliary agent or vehicle with which an active agent of the present invention is administered. Pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin. Water or aqueous saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W. Martin (Mack Publishing Co., Easton, PA); Gennaro, A. R., Remington: The Science and Practice of Pharmacy, (Lippincott, Williams and Wilkins); Liberman, et al., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y.; and Kibbe, et al., Eds., Handbook of Pharmaceutical Excipients, American Pharmaceutical Association, Washington.

[0084] The term “prodrug” refers to a compound that is metabolized or otherwise converted to a biologically active or more active compound or drug, typically after administration. A prodrug, relative to the drug, is modified chemically in a manner that renders it, relative to the drug, less active, essentially inactive, or inactive. However, the chemical modification is such that the corresponding drug is generated by metabolic or other biological processes, typically after the prodrug is administered.

[0085] The term “treat” as used herein refers to any type of treatment that imparts a benefit to a patient afflicted with a disease, including improvement in the condition of the patient (e.g., in one or more symptoms), delay in the progression of the condition, etc. In a particular embodiment, the treatment of a viral infection results in at least an inhibition / reduction in the number of infected cells and / or detectable viral levels.

[0086] As used herein, the term “prevent” refers to the prophylactic treatment of a subject who is at risk of developing a condition (e.g., viral infection) resulting in a decrease in the probability that the subject will develop the condition.

[0087] A “therapeutically effective amount” of a compound or a pharmaceutical composition refers to an amount effective to prevent, inhibit, treat, or lessen the symptoms of a particular disorder or disease. The treatment of a viral infection herein may refer to curing, relieving, and / or preventing the viral infection, the symptom(s) of it, or the predisposition towards it.

[0088] As used herein, the term “therapeutic agent” refers to a chemical compound or biological molecule including, without limitation, nucleic acids, peptides, proteins, and antibodies that can be used to treat a condition, disease, or disorder or reduce the symptoms of the condition, disease, or disorder.

[0089] As used herein, the term “small molecule” refers to a substance or compound that has a relatively low molecular weight (e.g., less than 4,000, less than 2,000, particularly less than 1 kDa or 800 Da). Typically, small molecules are organic, but are not proteins, polypeptides, or nucleic acids, though they may be amino acids or dipeptides.

[0090] The term “antimicrobials” as used herein indicates a substance that kills or inhibits the growth of microorganisms such as bacteria, fungi, viruses, or protozoans.

[0091] As used herein, the term “antiviral” refers to a substance that destroys a virus and / or suppresses replication (reproduction) of the virus. For example, an antiviral may inhibit and or prevent: production of viral particles, maturation of viral particles, viral attachment, viral uptake into cells, viral assembly, viral release / budding, viral integration, etc.

[0092] As used herein, the term “highly active antiretroviral therapy” (HAART) refers to HIV therapy with various combinations of therapeutics such as nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, HIV protease inhibitors, and fusion inhibitors.

[0093] As used herein, the term “amphiphilic” means the ability to dissolve in both water and lipids / apolar environments. Typically, an amphiphilic compound comprises a hydrophilic portion and a hydrophobic portion. “Hydrophobic” designates a preference for apolar environments (e.g., a hydrophobic substance or moiety is more readily dissolved in or wetted by non-polar solvents, such as hydrocarbons, than by water). “Hydrophobic” compounds are, for the most part, insoluble in water. As used herein, the term “hydrophilic” means the ability to dissolve in water.

[0094] As used herein, the term “polymer” denotes molecules formed from the chemical union of two or more repeating units or monomers. The term “block copolymer” most simply refers to conjugates of at least two different polymer segments, wherein each polymer segment comprises two or more adjacent units of the same kind.

[0095] An “antibody” or “antibody molecule” is any immunoglobulin, including antibodies and fragments thereof (e.g., scFv), that binds to a specific antigen. As used herein, antibody or antibody molecule contemplates intact immunoglobulin molecules, immunologically active portions of an immunoglobulin molecule, and fusions of immunologically active portions of an immunoglobulin molecule.

[0096] As used herein, the term “immunologically specific” refers to proteins / polypeptides, particularly antibodies, that bind to one or more epitopes of a protein or compound of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.

[0097] The following example provides illustrative methods of practicing the instant invention and is not intended to limit the scope of the invention in any way.

[0098] EXAMPLE

[0099] In the ongoing battle against HIV, a complete cure remains challenging due to the persistence of latent HIV-1 proviral DNA within viral reservoirs. Current AAV-based CRISPR therapies face limitations from immunogenicity and poor targeting of latent viral reservoirs, highlighting the need for a more effective delivery system. Herein, a compositionally unique lipid nanoparticle (CU-LNP) is provided which contains a disulfide bond in its hydrophobic domain to enhance cytosolic delivery in myeloid cells. This innovation features several key attributes: a unique LNP composition, superior mRNA translation efficiency compared to the FDA-approved gold-standard ionizable lipids (MC3 and ALC-0315) in human primary monocyte-derived macrophages (MDMs), CCR5 -targeted CRISPR-Cas9- mediated viral elimination from infected MDMs, and selective biodistribution to the HIV-1 tissue reservoir in humanized mice (hu mice). The studies show that the CU- LNP yields 20-fold higher luciferase (FLuc) expression in MDMs than MC3-LNP and ALC-LNP, highlighting its superior mRNA translation efficacy.

[0100] Moreover, in hu mice, CU-LNP primarily shows the mRNA translation in the lungs and spleen, major HIV-1 reservoirs, unlike MC3-LNP and ALC-LNP, which mainly translate in the liver. CU-LNP functionalized with a CCR5-targeting peptide showed significantly higher HIV- 1 proviral DNA excision efficacy in infected MDMs compared to the untargeted formulations. This targeted delivery system represents a promising advancement in HIV therapeutics, potentially enhancing CRISPR-based interventions by overcoming the limitations of viral reservoir targeting. Additionally, CU-LNP can serve as a versatile platform for gene-editing applications in other lung and spleen-related diseases.

[0101] Figure 1 A provides the chemical structure of / v.s(2- (dodecyldisulfaneyl)ethyl) 3,3'-((3-methyl-9-oxo-10-oxa-13,14-dithia-3,6- diazahexacosyl)azanediyl)dipropionate (BAMEA-016B (BA)) along with two gold- standard FDA-approved ionizable lipids, Dlin-MC3-DMA (MC3) and ALC-0315. BAMEA-016B is a disulfide bond-containing ionizable cationic lipid.

[0102] Lipid nanoparticles (LNPs) were formulated using ionizable lipids (BA or MC3 or ALC), helper lipids (dioleoylphosphatidylcholine (DOPC)), PEGylated lipids (dimyristoyl glycerol (DMG)-PEG), cholesterol, and, optionally, targeting ligands (DSPE-PEG-CCR5) (Fig. IB). The LNPs also contained firefly luciferase (FLuc) mRNA. The LNPs were prepared via microfluidic mixing (e.g., by LNPs rapidly mixing the lipid and aqueous phases in a microfluidic device ((Precision Nanosystem)) and were named based on the ionizable lipid used, e.g., BA-LNP, MC3-LNP, and ALC-LNP.

[0103] The formulated LNPs were characterized for size and zeta potential using dynamic light scattering (DLS; Zetasizer Nano ZS, Malvern), bulk morphology via cryo-electron microscopy, and mRNA encapsulation efficiency using the Ribogreen® assay. BA-LNP are spherical with a hydrodynamic size of 88 ± 3 nm with a polydispersity index (PDI) of 0.24 ± 0.06 and nearly neutral zeta potential (- 0.344 mV) (Figs. 2A and 2B). BA-LNP also showed mRNA encapsulation efficiency > 94%.

[0104] The plasma stability of BA-LNP was assessed by incubating it in 10% human plasma. As seen in Figure 2C, a slight increase in particle size was observed along with a decrease in concentration over 24 hours, likely due to protein adsorption.

[0105] Monocyte-derived macrophages (MDM) viability following treatment with BA-LNP, MC3-LNP, and ALC-LNP was assessed using the CellTiter-Blue™ assay at 48 hours post-treatment (Fig. 3). Briefly, MDMs were incubated with LNPs at a dose equivalent of mRNA. The cells were further incubated with CTB solution (20 pL / well) and fluorescence intensity was recorded on bench top plate reader. The percentage of cell viability in the treatment group was evaluated by comparing their fluorescence intensity with that of the untreated group. BA-LNP showed a superior cytotoxicity profile compared to MC3-LNP and ALC-LNP. Notably, BA-LNP maintains MDM viability above 80% at therapeutic doses (6 pg / 106cells).

[0106] The mRNA translation efficacy of the LNPs was evaluated in MDMs at the dose of 4 pg / 106cells. MDMs were treated with the LNPs for 48 hours and then a luciferase assay was performed to measure relative luminescence units (RLU). As seen in Fig. 4, BA-LNP showed a dramatic increase (~20-fold higher) in FLuc expression compared to MC3-LNP and ALC-LNP, thereby confirming its superior mRNA translation efficiency.

[0107] Building on these in vitro results, biodistribution studies were conducted in humanized mice (hu mice) to determine tissue-specific mRNA expression. Briefly, humanized mice were tail vein injected with LNPs and mRNA expression was visualized using an In Vivo Imaging System (IVIS). BA-LNP primarily showed the protein translation in the lungs and spleen, while MC3-LNP and ALC-LNP targeted the liver (Figure 5). This finding highlights the HIV reservoir tissue selectivity of BA-LNP over gold-standard MC3-LNP and ALC-LNP.

[0108] To evaluate the potential for eliminating latent HIV-1 proviral DNA, BA- LNP was used to encapsulate Cas9 mRNA and mosaic guide RNAs targeting multiple HIV-1 exons (tatl-2, revl-2, gp41). To further improve HIV reservoir cell targeting, BA-LNP was decorated with a CCR5-receptor targeting D-Ala-peptide T- amide (DAPTA) peptide. The CCR5 targeting peptide was chosen as it is one of the co-receptors used by HIV during host cell infection. MDMs express higher levels of the CCR5 receptor and serve as a cellular reservoir for HIV. Therefore, decorating the LNP surface with a CCR5 ligand can enhance selective uptake by MDMs and improve the efficiency of eliminating latent HIV proviral DNA.

[0109] More specially, the DSPE-PEG-CCR% lipid can be synthesized as follows. A linear peptide with a sequence of D-Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-NH2 (SEQ ID NO: 1) was selected as a CCR5-receptor targeting ligand. The free amine group of the peptide was conjugated with PEG lipid, DSPE-PEG2000 carboxy NHS via an activated acid-amine coupling reaction. The reaction was conducted by dissolving the peptide in anhydrous DMSO followed by the addition of DIP A. After 30 minutes of reaction at room temperature, DMSO dissolved DSPE-PEG2000 carboxy NHS was added to the reaction mixture and allowed to stir for the next 24 hours. After the completion, the crude reaction mixture was dialyzed against deionized (DI) water to remove the unconjugated peptide.

[0110] To examine the viral elimination efficacy, MDMs were infected with HIV- 1 ADA and subsequently treated with CRISPR-encapsulated CCR5 targeted and non-targeted BA-LNPs (Figure 6A). Infected MDMs were treated with LNPs at a concentration of 2.5 pg / 106cells. DNA was extracted 48 hours post-treatment and analyzed by PCR, followed by gel electrophoresis. As seen in Fig. 6B, the gel image shows an intact proviral DNA band at 3 kb and a cleaved excised band at 428 bp. The CCR5-targeted BA-LNP demonstrated a dramatic level of excision (-67%) of integrated proviral DNA compared to the non-targeted formulation (Figs. 6B and 6C). Excision was validated by Sanger sequencing the excised amplicon (428 bp), confirming precise targeting and elimination of proviral DNA in infected myeloid cells.

[0111] The ability of Cy5.5-dye-labeled LNPs (DSPE-PEG-N-Cy5.5 lipid) to escape endosomes was then determined. Lysosomal-Associated Membrane Protein 1 (LAMP-1), which is primarily localized in late endosomes and lysosomes, was used to label endosomes and 4',6-diamidino-2-phenylindole (DAPI) was used to stain nuclei. Figure 7 provides confocal images showing higher endosomal escape ability of BA-LNP as compared to MC3-LNP. Indeed, MC3-LNP is trapped in the lysosomal compartment and has a higher colocalization coefficient compared to BA- LNP.

[0112] Figure 8 provides images of Western blots showing higher NLR family pyrin domain containing 3 (NLRP3) expression of BA-LNP at 12 hours showing its higher endosomal escape ability as compared to MC3-LNP. NLPR3 can be activated by disruptions to endosomal trafficking.

[0113] To further demonstrate that the presence of disulfide bonds in BA promotes intracellular mRNA release and increases mRNA translation, a non-disulfide analog (BA-C2-C12), which contains carbons instead of sulfurs, was utilized. Figure 9 A shows that the presence of a disulfide bond helps in higher mRNA translation compared to the non-disulfide analogue. Figure 9B shows inhibition of reactive oxygen species (ROS) production in primary MDMs by using a ROS inhibitor (apocynin) reduced mRNA translation from LNPs with disulfide bonds but not the non-disulfide analogue.

[0114] The uptake mechanism in MDMs for BA-LNP (Fig. 10A) and MC3-LNP (Fig. 10B) labeled with DiD was determined by inhibiting various endocytosis pathways a detecting uptake by flow cytometry. Specifically, four different endocytosis inhibitors were used: amiloride hydrochloride (AML), which inhibits the macropinocytosis pathway; chlorpromazine (CPZ), which inhibits clathrin mediated endocytosis; cytochalasin D (CyD), which inhibits actin-dependent phagocytosis; and methyl-P-cyclodextrin (MpCD), which inhibits caveolin mediated endocytosis. As seen in Figures 10A and 10B, BA-LNP uptake was effected differently by the inhibitors compared to MC3-LNP, particularly with AML, CPZ, and MPCD.

[0115] The uptake mechanism in MDMs was validated for BA-LNP (Fig. 11 A) and MC3-LNP (Fig. 1 IB) encapsulating Flue by inhibiting various endocytosis pathways and performing a luciferase assay. As seen in Figures 10 and 11, BA-LNP is endocytosed by MDMs via all the four endocytosis pathways, majorly via micropinocytosis. In contrast, MC3-LNP is only endocytosed by MDMs via two prominent pathways.

[0116] The proteomics on the protein corona of BA-LNP and MC3-LNP was determined. Figure 12A provides a heatmap of 40 major proteins grouped into categories such as immunoglobulins, complement, coagulation, apolipoproteins, and other combined functions. The heatmap reveals clear compositional differences between BA-LNP and MC3-LNP. Figure 12B provides a volcano plot analysis of log2 (fold change) versus -logic (p-value), using cutoffs of log2 (fold change) > 1 and p < 0.05. The volcano plot identified 58 proteins significantly enriched on BA- LNP and 163 on MC3-LNP. Among those enriched on BA-LNP, ten proteins, including IGKV2-40 (Immunoglobulin Kappa Variable 2-40), CFP, CD5L, ApoH, CFHR1 (Complement Factor H-Related protein 1), AMBP, FGB (Fibrinogen beta), CFH (Complement Factor H), IGHV3-13, and MST1, were notably more abundant, while ApoE (Apolipoprotein E) was the most enriched on MC3-LNP. Figure 12C provides the top 25 biased proteins adsorbed on the corona of BA-LNP plotted in a bubble chart in log2 (fold change) versus average abundance, with bubble shading indicating -loglO (p-value). Proteins related to complement and coagulation, such as CFP (Complement Factor Properdin; Properdin), CD5L, ApoH (Apolipoprotein H), FGB, CFH, and CFHR1, showed large positive fold changes and high abundance, indicating they are major components of the BA-LNP corona. In contrast, intracellular or metabolic proteins like NDUFS6, AIFM1, and ITGB3 displayed smaller fold changes and lower intensities. Figures 12D and 12E provide the results of a luciferase assay of BA-LNP (Fig. 12D) and MC3-LNP (Fig. 12E) incubated with enriched plasma protein. An increase in mRNA translation of BA-LNP was observed when incubated with CFP, ApoH and FGB (luminescence intensity increases by 15.8, 6, and 2.5 folds, respectively) (Fig. 12D). In contrast, MC3-LNP showed almost no significant increase in the luminescence intensity when incubated with FGB or CFP, but showed a 2.5-fold increase in the luminescence intensity when incubated with ApoE, affirming the hepatic tropism of MC3 LNP.

[0117] In view of the foregoing, the present LNPs are a significant advancement in HIV-1 therapy, providing a safe and efficient CRISPR delivery system for eliminating HIV-1 in infected myeloid cells. Indeed, the novel disulfide-based LNP technology is designed for targeted gene therapy applications, particularly in treating HIV by eliminating latent proviral DNA within myeloid reservoirs. This LNPs address a significant barrier in HIV cure research by improving nucleic acid delivery in primary macrophages, which are difficult to transfect. Beyond HIV, the LNPs can be used for broader gene-editing applications, including treatments in chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, and specific lymphoid malignancies like splenic marginal zone lymphoma and other immune-related diseases. With its unique endosomal escape capability, BA-LNP is well-suited for gene therapy. A number of publications and patent documents are cited throughout the foregoing specification in order to describe the state of the art to which this invention pertains. The entire disclosure of each of these citations is incorporated by reference herein. While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

Claims

1. What is claimed is:

1. A lipid nanoparticle comprising at least one ionizable lipid, at least one sterol, at least one polyethylene glycol (PEG)-lipid conjugate, and at least one helper lipid.

2. The lipid nanoparticle of claim 1, further comprising a targeted lipid.

3. The lipid nanoparticle of claim 1, wherein the lipid nanoparticle comprises 30% to 60% of the ionizable lipid, 1% to 20% of the helper lipid, 25% to 50% of the sterol, and 1% to 15% of the PEG-lipid conjugate.

4. The lipid nanoparticle of any one of claims 1 to 3, wherein said ionizable lipid is BAMEA-016B.

5. The lipid nanoparticle of any one of claims 1 to 4, wherein said helper lipid is a phospholipid.

6. The lipid nanoparticle of any one of claims 1 to 4, wherein said helper lipid is selected from the group consisting of l,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), di oleoylphosphatidylcholine (DOPC), phosphatidylserine (PS), 1,2- dioleoyl-3 -trimethylammonium propane (DOTAP), distearoylphosphatidylcholine (DSPC), and 1,2- dileoyl-sn-3-phosphoethanolamine (DOPE).

7. The lipid nanoparticle of any one of claims 1 to 6, wherein said sterol is P- sitosterol or cholesterol.

8. The lipid nanoparticle of any one of claims 1 to 7, wherein said PEG-lipid conjugate is dimyristoyl glycerol (DMG)-PEG, l,2-distearoyl-sn-glycero-3- phosphoethanolamine (DSPE)-PEG, or dimyristoylphosphoethanolamine (DMPE)- PEG.

9. The lipid nanoparticle of any one of claims 1 to 3, wherein said lipid nanoparticle comprises BAMEA-016B, DOPC, DMG-PEG, and cholesterol.

10. The lipid nanoparticle of claim 2, wherein said targeted lipid binds CCR5.

11. The lipid nanoparticle of claim 10, wherein said targeted lipid comprises a CCR5 targeting moiety selected from the group consisting of maraviroc, aplaviroc, vicriviroc, INCB009471, leronlimab, and Ala-Ser- Thr-Thr-Thr-Asn-Tyr-Thr (SEQ ID NO: 1) optionally comprising one or more D-amino acids.

12. The lipid nanoparticle of claim 2, wherein said targeted lipid is DSPE-PEG- CCR5.

13. The lipid nanoparticle of any one of claims 1 to 12, further comprising a therapeutic agent.

14. The lipid nanoparticle of claim 13, wherein said therapeutic agent is a nucleic acid molecule.

15. The lipid nanoparticle of claim 14, wherein the nucleotide acid molecule is a siRNA, shRNA, or antisense oligonucleotide.

16. The lipid nanoparticle of claim 13, wherein said therapeutic agent comprises a nucleic acid molecule encoding Cas and at least one gRNA.

17. The lipid nanoparticle of claim 16, wherein said nucleic acid molecule encoding Cas is an mRNA.

18. The lipid nanoparticle of claim 16 or claim 17, wherein said gRNA is complementary to a sequence within an HIV-1 gene.

19. The lipid nanoparticle of any one of claims 1-18, further comprising Apolipoprotein H (ApoH), complement factor properdin (CFP), and / or fibrinogen beta (FGB).

20. The lipid nanoparticle of claim 19, further comprising CFP.

21. The lipid nanoparticle of claim 9, further comprising complement factor properdin (CFP).

22. A composition comprising a lipid nanoparticle of any one of claims 1-21 and a pharmaceutically acceptable carrier.

23. A method of treating, inhibiting, and / or preventing a disease or disorder in an individual in need thereof, comprising administering to the individual the lipid nanoparticle according to any one of claims 1-21.

24. The method of claim 23, wherein said disease or disorder is an HIV infection.