Nucleic acid molecule inhibiting expression of il-33
Nucleic acid molecules targeting IL-33 mRNA with complementary strands effectively inhibit IL-33 expression, addressing the inadequacies of existing treatments for IL-33-related diseases with high inhibition rates and low dosage requirements.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- MOCHIDA PHARM CO LTD
- Filing Date
- 2025-12-25
- Publication Date
- 2026-07-02
AI Technical Summary
Existing treatments for diseases associated with excessive IL-33 activity, such as bronchial asthma and atopic dermatitis, are inadequate in effectively inhibiting IL-33 expression.
Development of nucleic acid molecules, salts, and solvates that can inhibit IL-33 expression by forming complementary double-stranded regions with IL-33 mRNA, utilizing specific sense and antisense strands of varying lengths and modifications to enhance efficacy.
The nucleic acid molecules achieve significant inhibition of IL-33 expression, offering therapeutic potential for diseases like bronchial asthma with inhibition rates up to 95% at concentrations as low as 1000 pM.
Smart Images

Figure JPOXMLDOC01-APPB-C000001 
Figure JPOXMLDOC01-APPB-C000002 
Figure JPOXMLDOC01-APPB-C000003
Abstract
Description
Nucleic acid molecules that inhibit IL-33 expression
[0001] The present invention relates to a pharmaceutical composition characterized by containing a nucleic acid molecule or salt thereof that inhibits the expression of interleukin-33 (IL-33), or a solvate thereof, and one or more thereof as an active ingredient. The invention also relates to a preventive and / or therapeutic agent for diseases or symptoms in which IL-33 is suspected to be involved (e.g., bronchial asthma).
[0002] IL-33 is a cytokine belonging to the IL-1 family and is expressed in the nuclei of various cells, including vascular endothelial cells and epithelial cells. IL-33 is known to function as an alarm that induces inflammation when released extracellularly in response to infection or cell damage. When released extracellularly, it acts on Th2 cells that express the IL-33 receptor, primarily inducing the production of Th2 cytokines.
[0003] Excessive IL-33 activity is thought to influence the onset and severity of various allergic diseases (e.g., bronchial asthma, atopic dermatitis, etc.). Therefore, inhibiting IL-33 expression is expected to lead to the treatment of diseases or symptoms in which IL-33 is suspected to be involved.
[0004] Non-patent documents 1 to 6 disclose the nucleotide sequence of human IL-33 siRNA.
[0005] Biochem Biophys Res Commun. 2012; 421: :305-11.PLoS One. 2013; 8: e72650.EBioMedicine. 2018; 33: 196-210.Cancer Res. 2020; 80: 1981-1990.Cell Death Dis. 2021; 12: 871.J Dermatol Sci. 2022; 105: 113-120.
[0006] In the circumstances described above, the object of the present invention is to provide nucleic acid molecules or salts thereof that can inhibit the expression of IL-33, or solvates thereof, and pharmaceutical compositions characterized by containing one or more thereof as active ingredients, and pharmaceutical uses thereof, in particular, preventive and / or therapeutic agents for diseases or symptoms in which IL-33 is suspected to be involved. Furthermore, the object of the present invention is also to provide a method for producing the nucleic acid molecules or salts thereof, or solvates thereof.
[0007] As a result of diligent research, the inventors have discovered nucleic acid molecules, salts thereof, or solvates thereof that can inhibit the expression of IL-33. Because the nucleic acid molecules, salts thereof, or solvates thereof that can inhibit the expression of IL-33 can inhibit the expression of IL-33, they may have an effect in improving diseases or symptoms in which IL-33 is suspected to be involved (for example, bronchial asthma, etc.).
[0008] The present invention relates to nucleic acid molecules or salts thereof, or solvates thereof, that can inhibit the expression of IL-33 as shown in the following embodiments, and to pharmaceutical compositions characterized by containing one or more thereof as active ingredients, and to pharmaceutical uses thereof, more specifically as follows [1] to [7-1].
[0009] [1] A nucleic acid molecule or a salt thereof comprising a sense strand and an antisense strand, or a solvate thereof, wherein the strands form a double-stranded region, the antisense strand comprises 21 to 23 nucleotides in length, and is complementary to the isolength portion of mRNA encoding IL-33 (SEQ ID NO: 1). [1A] A nucleic acid molecule or a salt thereof comprising a sense strand and an antisense strand, or a solvate thereof, wherein the strands form a double-stranded region, the antisense strand comprises 19 to 23 nucleotides in length, and is complementary to the isolength portion of mRNA encoding IL-33 (SEQ ID NO: 1). [2] The nucleic acid molecule or a salt thereof according to embodiment [1], or a solvate thereof, comprising a nucleotide sequence selected from the combinations of sense strands and antisense strands indicated by identification numbers ILN-1 to ILN-121 in Tables 2-1 to 2-4. [2A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to embodiment [1A], comprising a nucleotide sequence selected from combinations of sense strands and antisense strands indicated by the identification numbers listed in Tables 2-5 to 2-6.
[0010] [2-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to embodiment [2], wherein the sense chain comprises a length of 21 to 23 nucleotides, 21 to 22 nucleotides, 22 to 23 nucleotides, 23 nucleotides, 22 nucleotides, or 21 nucleotides, and the antisense chain comprises a length of 21 to 23 nucleotides, 21 to 22 nucleotides, 22 to 23 nucleotides, 23 nucleotides, 22 nucleotides, or 21 nucleotides.
[0011] [2-1A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to embodiment [2A], wherein the sense chain comprises a length of 19 to 23 nucleotides, 19 to 22 nucleotides, 19 to 21 nucleotides, 19 to 20 nucleotides, 20 to 23 nucleotides, 20 to 22 nucleotides, 20 to 21 nucleotides, 19 nucleotides, or 20 nucleotides, and the antisense chain comprises a length of 19 to 23 nucleotides, 19 to 22 nucleotides, 19 to 21 nucleotides, 19 to 20 nucleotides, 20 to 23 nucleotides, 20 to 22 nucleotides, 20 to 21 nucleotides, 19 nucleotides, or 20 nucleotides.
[0012] [2-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [2] or [2-1], wherein the sense strand and the antisense strand include a nucleotide sequence selected from combinations of sense strands and antisense strands indicated by identification numbers ILN-1 to ILN-5 in Table 2-1.
[0013] [2-2A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2A] or [2-1A], wherein the sense strand and the antisense strand include nucleotide sequences selected from combinations of sense strands and antisense strands indicated by identification numbers LN-65, ILN-68 to ILN-73, ILN-82, ILN-88, and ILN-110 in Tables 2-3 to 2-4.
[0014] [2-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [2] or [2-1], wherein the sense strand and the antisense strand are nucleotide sequences selected from combinations of sense strands and antisense strands shown by identification numbers ILN-1 to ILN-5 in Table 2-1.
[0015] [2-3A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2A] or [2-1A], wherein the sense strand and the antisense strand are nucleotide sequences selected from combinations of sense strands and antisense strands shown by identification numbers ILN-65, ILN-68 to ILN-73, ILN-82, ILN-88, and ILN-110 in Tables 2-3 to 2-4.
[0016] [2-4] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [2] to [2-3A], wherein the nucleic acid base sequence of the antisense strand has at least about 80%, at least about 90%, or 100% complementarity with the isolength portion of the mRNA encoding IL-33 (SEQ ID NO: 1 shows the nucleic acid sequence of human IL-33 mRNA; hereinafter simply referred to as "SEQ ID NO: 1").
[0017] [2-5] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises 21 to 23 nucleotides in length, and the antisense strand comprises 21 to 23 nucleotides in length, and the nucleic acid base sequence of the antisense strand is 108, 111, 114, 11, counting from the 5' position of the mRNA encoding IL-33 (SEQ ID NO: 1). 8, 121, 126, 143, 148, 152, 180, 182, 188, 190, 191, 192, 194, 196, 219, 221, 228, 254, 288, 290, 292, 295, 298, 300, 302, 305, 307, 310, 312, 316, 322, 326, 328, 330, 332, 337, 340, 361, 366, 368, 372, 375, 377, 38 0, 382, 386, 390, 392, 395, 397, 421, 424, 428, 430, 436, 446, 451, 454, 458, 462, 464, 468, 470, 519, 522, 529, 531, 536, 538, 546, 582, 586, 594, 596, 602, 604, 607, 610, 612, 616, 620, 657, 659, 662, 664, 684, 68 A nucleic acid molecule or a salt thereof, or a solvate thereof, having at least about 80% complementarity to the nucleic acid base sequence portion beginning at position 8, 691, 694, 698, 702, 732, 733, 734, 735, 736, 737, 740, 746, 748, 750, 752, 754, 758, 760, 762, 766, 776, 779, 784, 790, 793, 795, or 842.
[0018] [2-5A] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises 19 to 23 nucleotides in length, and the antisense strand comprises 19 to 23 nucleotides in length, and the nucleic acid base sequence of the antisense strand, counting from the 5' position of the mRNA encoding IL-33 (SEQ ID NO: 1), is 108, 111, 114, 118, 121, 126, 143, 14 8, 152, 180, 182, 188, 190, 191, 192, 194, 196, 219, 221, 228, 254, 288, 290, 292, 295, 298, 300, 302, 305, 307, 310, 312, 316, 322, 326, 328, 330, 332, 337, 340, 361, 366, 368, 372, 375, 377, 380, 382, 386, 390, 392, 395, 397, 421, 424 ,428,430,436,446,451,454,458,462,464,465,467,468,469,470,519520,522,524,529,530,531,532,536,538,546,582,583,584,585,586,594,596,602,604,607,608,609,610,612,616,620,657,659,660,662,664,684,6 A nucleic acid molecule or a salt thereof, or a solvate thereof, having at least approximately 80% complementarity to the nucleic acid base sequence portion beginning at position 88, 691, 694, 698, 702, 703, 704, 732, 733, 734, 735, 736, 737, 740, 746, 748, 750, 752, 754, 758, 760, 762, 766, 776, 779, 784, 785, 787, 790, 793, 795, or 842.
[0019] [2-5-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises 21 to 23 nucleotides in length, the antisense strand comprises 21 to 23 nucleotides in length, and the nucleic acid base sequence of the antisense strand has at least about 80% complementarity with the nucleic acid base sequence portion of the mRNA encoding IL-33 (SEQ ID NO: 1) shown below.Nucleic acid base sequence portion of Sequence ID No. 1: 108-130, 111-133, 114-136, 118-140, 121-143, 126-148, 143-165, 148-170, 152-174, 180-202, 182-204, 188-210, 190-212, 191-213, 192-214, 194-216, 196-218, 219-241, 221-243, 228-250, 254-276, 288-310, 290-312, 292-314, 295-317, 298-320, 300-322, 302-324 , 305-327, 307-329, 310-332, 312-334, 316-338, 322-344, 326-348, 328-350, 330-352, 332-354, 337-359, 340-362, 361-383, 366-388, 368-390, 372-394, 375-397, 377-399, 380-402, 382-404, 386-408, 390-412, 392-414, 395-417, 397-419, 421-443, 424-446, 428-450, 430-452, 436-4 58, 446-468, 451-473, 454-476, 458-480, 462-484, 464-486, 468-490, 470-492, 519-541, 522-544, 529-551, 531-553, 536-558, 538-560, 546-568, 582-604, 586-608, 594-616, 596-618, 602-624, 604-626, 607-629, 610-632, 612-634, 616-638, 620-642, 657-679, 659-681, 662-684, 664 ~686, 684~706, 688~710, 691~713, 694~716, 698~720, 702~724, 732~754, 733~755, 734~756, 735~757, 736~758, 737~759, 740~762, 746~768, 748~770, 750~772, 752~774, 754~776, 758~780, 760~782, 762~784, 766~788, 776~798, 779~801, 784~806, 790~812, 793~815, 795~817, or 842~864.
[0020] [2-5-1A] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises 19 to 23 nucleotides in length, the antisense strand comprises 19 to 23 nucleotides in length, and the nucleic acid base sequence of the antisense strand has at least about 80% complementarity with the nucleic acid base sequence portion of the mRNA encoding IL-33 (SEQ ID NO: 1) shown below. Nucleic acid base sequence portion of Sequence ID No. 1: 108-130, 111-133, 114-136, 118-140, 121-143, 126-148, 143-165, 148-170, 152-174, 180-202, 182-204, 188-210, 190-212, 191-213, 192-214, 194-216, 196-218, 219-241, 221-243, 228-250, 254-276, 288-310, 290- 312, 292-314, 295-317, 298-320, 300-322, 302-324, 305-327, 307-329, 310-332, 312-334, 316-338, 322-344, 326-348, 328-350, 330-352, 332-354, 337-359, 340-362, 361-383, 366-388, 368-390, 372-394, 375-397, 377-399, 380-402, 382-404, 386-408, 390-412, 392-414, 395-417, 397-419, 421-443, 424-446, 428-450, 430-452, 436-458, 446-468, 451-473, 454-476, 458-480, 462-484, 464-486, 465-486, 467-486, 468-490, 469-490, 470-490, 470-492, 472-490, 519- 541, 520-541, 522-544, 524-544, 529-551, 530-551, 531-553, 532-551, 532-553, 536-558, 538-560, 546-568, 582-604, 583-604, 584-604, 585-604, 586-608, 594-616, 596-618, 602-624, 604-626, 607-629, 608-629, 609-629, 610-632,612-634, 616-638, 620-642, 657-679, 659-681, 660-681, 662-684, 664-686, 684-706, 688-710, 691-713, 694-716, 698-720, 702-724, 703-724, 704-724, 732-754, 733-755, 734-755, 734-756, 735-755, 735-757, 736-7 55, 736-758, 737-757, 737-759, 740-762, 746-768, 748-770, 750-772, 752-774, 754-776, 758-780, 760-782, 762-784, 766-788, 776-798, 779-801, 784-806, 785-806, 787-806, 790-812, 793-815, 795-817, or 842-864.
[0021] [2-5-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-5] to [2-5-1A], wherein the nucleic acid base sequence of the antisense strand has at least about 90% or 100% complementarity with the isolength portion of the mRNA encoding IL-33 (SEQ ID NO: 1). [2-5-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-5] to [2-5-2], wherein the region of the antisense strand complementary to the isolength portion of the mRNA encoding IL-33 (SEQ ID NO: 1) is 21 to 23 nucleotides long, 21 to 22 nucleotides long, 22 to 23 nucleotides long, 21 nucleotides long, 22 nucleotides long, or 23 nucleotides long. [2-5-3A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-5] to [2-5-2], wherein the antisense strand region complementary to the isolength portion of the mRNA encoding IL-33 (SEQ ID NO: 1) is 19 to 23 nucleotides long, 19 to 22 nucleotides long, 19 to 21 nucleotides long, 19 to 20 nucleotides long, 20 to 23 nucleotides long, 20 to 22 nucleotides long, 20 to 21 nucleotides long, 22 to 23 nucleotides long, 19 nucleotides long, or 20 nucleotides long.
[0022] [2-6] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2] to [2-5-3A], wherein at least one of the sense strand and the antisense strand has an overhang (protrusion) consisting of a single strand of 1 to 8 nucleotides, 1 to 3 nucleotides, or 2 nucleotides at its 5' end and / or 3' end. [2-6-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2] to [2-5-3A], wherein the overhang (protrusion) at the 5' end and / or 3' end is stabilized against degradation.
[0023] [2-7] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2] to [2-5-3A], wherein at least one of the sense strand and the antisense strand contains at least one modified nucleotide. [2-7-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2] to [2-5-3A], wherein substantially all of the nucleotides of the sense strand contain modified nucleotides. [2-7-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2] to [2-5-3A], wherein substantially all of the nucleotides of the antisense strand contain modified nucleotides. [2-7-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2] to [2-5-3A], wherein substantially all of the nucleotides of the sense strand and the antisense strand contain modified nucleotides.
[0024] [2-8] A nucleic acid molecule or a salt thereof according to any one of the embodiments [2-7] to [2-7-3], wherein the modified nucleotide comprises modification of one or more sugar groups selected from the group consisting of 2'-deoxynucleotide, 2'-O-alkyl-modified nucleotide (2'-O-methyl (2'-OMe)-modified nucleotide, etc.), 2'-deoxy-2'-fluoro (2'-F)-modified nucleotide, 2'-deoxy-2'-NHAc (2'-NHAc)-modified nucleotide, acyclic nucleotide (e.g., selinol nucleic acid, etc.), debasalized nucleotide, and 4'-vinyl phosphate-modified nucleotide, or a solvate thereof.
[0025] [2-9] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-7] to [2-8], wherein the modified nucleotide comprises modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds, phosphorodithioate bonds, and boranophosphate bonds. [2-9A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-7] to [2-8], wherein the modified nucleotide comprises modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds and phosphorodithioate bonds.
[0026] [2-9-1] A nucleic acid molecule or a salt thereof according to any one of embodiments [2-7] to [2-9], wherein at least one of the sense strand and the antisense strand contains at least one phosphorothioate bond or phosphorodithioate bond at the 5' end, the 3' end, or both the 5' and 3' ends, or a solvate thereof. [2-9-2] A nucleic acid molecule or a salt thereof according to any one of embodiments [2-7] to [2-9], wherein the sense strand and the antisense strand contain two phosphorothioate bonds at the 5' and 3' ends, respectively, or a solvate thereof. [2-9-3] A nucleic acid molecule or a salt thereof according to any one of embodiments [2-7] to [2-9], wherein the sense strand or the antisense strand contains two phosphorodithioate bonds at the 5' or 3' end, respectively, or a solvate thereof.
[0027] [2-10] A nucleic acid molecule or a salt thereof according to any one of embodiments [2-7] to [2-9-3], wherein the modified nucleotide comprises modification of one or more sugar groups selected from the group consisting of 2'-deoxynucleotides, 2'-O-methyl (2'-OMe) modified nucleotides, and 2'-fluoro (2'-F) modified nucleotides, and further comprises at least one modification of internucleoside bonds which is a phosphorothioate bond at each of the 5' and 3' ends of the sense strand and / or antisense strand.
[0028] [2-10-1] A nucleic acid molecule or a salt thereof according to any one of embodiments [2-7] to [2-9-3], wherein the modified nucleotide comprises modification of one or more sugar groups selected from the group consisting of 2'-deoxynucleotide, 2'-O-methyl (2'-OMe) modified nucleotide, 2'-deoxy-2'-fluoro (2'-F) modified nucleotide, 2'-deoxy-2'-NHAc (2'-NHAc) modified nucleotide, acyclic nucleotide (e.g., selinol nucleic acid), and debasalized nucleotide, and further comprises at least one modification of an internucleoside bond which is a phosphorothioate bond or a phosphorodithioate bond at each of the 5' and 3' ends of the sense strand and / or antisense strand.
[0029] [2-11] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-7] to [2-10], wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from combinations of sense strands and antisense strands indicated by identification numbers ILM-1 to ILM-30 in Tables 3-1 to 3-3.
[0030] [2-11A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-7] to [2-10-1], wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from combinations of sense strands and antisense strands indicated by the identification numbers listed in Tables 3-4 to 3-14.
[0031] [2-11-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-7] to [2-10], wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from the combinations shown in Table 3-1 by identification numbers ILM-1 to ILM-5.
[0032] [2-11-1A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [2-7] to [2-10-1], wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from combinations shown by identification numbers ILM-7, ILM-9, ILM-14, ILM-20, ILM-28, ILM-37, ILM-38, ILM-42, ILM-43, ILM-47, ILM-48, ILM-49, ILM-50, ILM-51, ILM-54, ILM-62, ILM-63, ILM-66, ILM-67, ILM-71, ILM-73, ILM-74, ILM-75, ILM-78, ILM-79, ILM-132 in Tables 3-1 to 3-8 and Table 3-14.
[0033] [2-11-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [2-7] to [2-10], wherein the sense strand and the antisense strand are modified nucleotide sequences selected from combinations shown by identification numbers ILM-1 to ILM-5 in Table 3-1.
[0034] [2-11-2A] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [2-7] to [2-10-1], wherein the sense strand and the antisense strand are modified nucleotide sequences selected from combinations shown by identification numbers ILM-7, ILM-9, ILM-14, ILM-20, ILM-28, ILM-37, ILM-38, ILM-42, ILM-43, ILM-47, ILM-48, ILM-49, ILM-50, ILM-51, ILM-54, ILM-62, ILM-63, ILM-66, ILM-67, ILM-71, ILM-73, ILM-74, ILM-75, ILM-78, ILM-79, ILM-132 in Tables 3-1 to 3-8 and 3-14.
[0035] [2-12] A nucleic acid molecule or salt thereof according to any one of the embodiments [2] to [2-11-2A], or a solvate thereof, that inhibits the expression of IL-33. [2-12-1] Inhibition rate of IL-33 expression IC 50 However, 0 < IC 50[2-12-2] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [2] to [2-11-2A], wherein the inhibition rate of IL-33 expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more, according to any one of the embodiments [2] to [2-11-2A], wherein the inhibition rate of IL-33 expression is or a solvate thereof. [2-12-4] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [2] to [2-11-2A], wherein the inhibition rate of IL-33 expression is approximately 80% or more, approximately 90% or more, or approximately 95% or more. [2-12-5] The inhibition rate of IL-33 expression is approximately 30% or more, or the inhibition rate of IL-33 expression IC 50 However, 0 < IC 50 A nucleic acid molecule or salt thereof according to any one of the embodiments [2] to [2-11-2A], or a solvate thereof, having a concentration of approximately 1000 pM. [2-12-5A] The inhibition rate of IL-33 expression is approximately 50% or more, or the inhibition rate of IL-33 expression IC 50 However, 0 < IC 50 A nucleic acid molecule or salt thereof according to any one of the embodiments [2] to [2-11-2A], or a solvate thereof, having a concentration of ≤ approximately 1000 pM. [2-12-6] The inhibition rate of IL-33 expression is approximately 80% or more, or the inhibition rate of IL-33 expression IC 50 However, 0 < IC 50 A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [2] to [2-11-2A], having a concentration of approximately ≤ 1000 pM.
[0036] [2-13] A nucleic acid molecule or a salt thereof according to any one of embodiments [2] to [2-12-6], comprising one or two mismatched bases (non-complementary nucleic acid bases) at any position in the double-stranded region.
[0037] [2-14] A nucleic acid molecule or a salt thereof according to any one of the embodiments [2] to [2-13], wherein the nucleic acid molecule is siRNA.
[0038] [3] A pharmaceutical composition comprising a nucleic acid molecule or a salt thereof, or a solvate thereof, as described in any one of the embodiments [1] to [2-14] above, and a pharmaceutically acceptable carrier.
[0039] [4] The pharmaceutical composition according to embodiment [3], for use in the treatment of a disease in which IL-33 is presumed to be involved. [4-1] The disease or symptom in which IL-33 is presumed to be involved is allergic inflammation, bronchial asthma, atopic dermatitis, allergic rhinitis, viral lung infection, chronic bronchitis, respiratory failure, rheumatoid arthritis, acute kidney injury, systemic sclerosis, hepatic fibrosis, dermatofibrosis, hepatic fibrosis, inflammatory bowel disease, arteriosclerotic disease, psoriasis, multiple sclerosis, hay fever, anaphylactic shock, sinusitis (including eosinophilic sinusitis), systemic lupus erythematosus, pemphigus, chronic obstructive pulmonary disease (COPD), Sjögren's syndrome, cancer (e.g., brain tumor, laryngeal cancer, oral cancer, hypopharyngeal cancer) The pharmaceutical composition according to embodiment [4], wherein the disease is cancer, thyroid cancer, esophageal cancer, breast cancer, lung cancer, gastric cancer, adrenocortical carcinoma, bile duct cancer, gallbladder cancer, liver cancer, pancreatic cancer, bladder cancer, colorectal cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, Ewing's tumor, Hodgkin's disease, non-Hodgkin lymphoma, melanoma, mesothelioma, multiple myeloma, etc.), endometriosis, myasthenia gravis, sepsis, eosinophilic pneumonia, pneumonia and immunodeficiency due to SARS-CoV-2 infection, idiopathic pulmonary fibrosis, cystic fibrosis, age-related macular degeneration, periodontitis, uveitis, and chronic urticaria. [4-2] The pharmaceutical composition according to embodiment [4], wherein the disease in which the involvement of IL-33 is presumed is bronchial asthma or COPD.
[0040] [5] A method for inhibiting the expression of IL-33 in cells, comprising contacting the cells with the nucleic acid molecule or its salt according to any one of the above aspects [1] to [2-14], or its solvate, or the pharmaceutical composition according to the above aspect [3], said method. [5-1] The method according to the above aspect [5], wherein the nucleic acid molecule is siRNA. [5-2] The method according to the above aspect [5] or [5-1], wherein the cells are present in the body of a subject. [5-3] The method according to the above aspect [5-2], wherein the subject is a human. [5-4] The inhibition rate of IL-33 expression is about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 95% or more, the method according to any one of the above aspects [5] to [5-3]. [5-5] The inhibition rate IC 50 is such that 0 < IC 50 ≤ about 1000 pM, the method according to any one of the above aspects [5] to [5-3].
[0041] [6] A method for inhibiting the expression of IL-33 in a subject, comprising administering to the subject, in a therapeutically effective amount, the nucleic acid molecule or its salt according to any one of the above aspects [1] to [2-14], or its solvate, or the pharmaceutical composition according to the above aspect [3], said method. [6-1] The method according to the above aspect [6], wherein the nucleic acid molecule is siRNA. [6-2] The method according to the above aspect [6] or [6-1], wherein the subject is a human. [6-3] The inhibition rate of IL-33 expression is about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 95% or more, the method according to any one of the above aspects [6] to [6-2]. [6-4] The inhibition rate IC 50 is such that 0 < IC 50 ≤ about 1000 pM, the method according to any one of the above aspects [6] to [6-2].
[0042] [7] A method for treating a subject suffering from a disease involving IL-33, comprising administering to the subject a therapeutically effective amount of a nucleic acid molecule or a salt thereof, or a solvate thereof, as described in any one of the embodiments [1] to [2-14], or the pharmaceutical composition described in embodiment [3]. [7-1] The method according to embodiment [7], wherein the nucleic acid molecule is siRNA. [7-2] The method according to embodiment [7] or [7-1], wherein the subject is a human.
[0043] [8] A nucleic acid molecule comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double-stranded region, the sense strand is 19 to 23 nucleotides long, and the antisense strand is 19 to 23 nucleotides long and contains 7 to 11 2'-deoxy-2'-fluoro-modified nucleotides (2'-F-modified nucleotides). [8-1] The nucleic acid molecule according to embodiment [8], wherein the antisense strand contains 7 to 10, 7 to 9, 7 to 8, or 7 2'-F-modified nucleotides. [8-2] The nucleic acid molecule according to embodiment [8], wherein the 1st and 21st positions of the sense strand and the 21st and 1st positions of the antisense strand are complementary, respectively.
[0044] [9] The nucleic acid molecule according to embodiment [8], wherein the sense strand contains five 2'-F modified nucleotides. [9-1] The nucleic acid molecule according to embodiment [9], wherein the sense strand contains 2'-F modified nucleotides at positions 9, 10, 11 and 15 in the 5'→3' direction of its sequence.
[0045]
[10] The nucleic acid molecule according to embodiment [8], wherein the sense strand comprises five 2'-F modified nucleotides and sixteen 2'-O-methyl (2'OMe) modified nucleotides (2'-OMe modified nucleotides). [10-1] The nucleic acid molecule according to embodiment
[10] , wherein the sense strand comprises 2'-F modified nucleotides at positions 9, 10, 11 and 15 in the 5'→3' direction of its sequence.
[0046]
[11] The nucleic acid molecule according to embodiment [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides. [11-1] The nucleic acid molecule according to embodiment [8], wherein in the sense strand, only the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [11-2] The nucleic acid molecule according to embodiment [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides.
[0047]
[12] The nucleic acid molecule according to embodiment [8], wherein the antisense chain comprises 2 to 16 2'-OMe modified nucleotides.
[0048]
[13] The nucleic acid molecule according to embodiment [8], wherein in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and any nucleotide at positions 4, 8, 9, 10, 12, 18, 20 or 22 may also be 2'-F modified nucleotides, and the antisense strand contains 7 to 11 2'-F modified nucleotides. [13-1] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and two or more nucleotides selected from positions 4, 8, 9, 10 and 12 include 2'-F modified nucleotides.
[0049] [13-2-1] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and three or more nucleotides selected from positions 4, 8, 9, 10 and 12 include 2'-F modified nucleotides, and the antisense strand contains 7 to 10 2'-F modified nucleotides. [13-2-2] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and three nucleotides selected from positions 4, 8, 9, 10 and 12 include 2'-F modified nucleotides, and the antisense strand contains 7 2'-F modified nucleotides.
[0050] [13-3-1] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [13-3-2] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [13-3-3] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0051] [13-3-4] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [13-3-5] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0052] [13-3-6] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [13-3-7] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [13-3-8] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0053] [13-4-1] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [13-4-2] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0054] [13-4-3] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [13-4-4] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0055] [13-4-5] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [13-4-6] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0056] [13-4-7] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense chain, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [13-4-8] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0057] [13-4-9] The nucleic acid molecule according to any one of embodiments [13-4-1] to [13-4-8], wherein the nucleotide at position 1 in the 5'→3' direction of the sequence in the antisense chain includes a nucleotide other than a 2'-F modified nucleotide. [13-4-10] The nucleic acid molecule according to any one of embodiments [13-4-1] to [13-4-8], wherein the nucleotide at position 1 in the 5'→3' direction of the sequence in the antisense chain includes a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (t).
[0058] [13-4-11] The nucleic acid molecule according to any one of embodiments [13-4-1] to [13-4-8], wherein the antisense chain further comprises a 5' phosphorus-stabilizing moiety at the 5' end. [13-4-12] The nucleic acid molecule according to embodiment [13-4-11], wherein the 5' phosphorus-stabilizing moiety is a 5'-vinylphosphonate-modified nucleotide.
[0059]
[14] The nucleic acid molecule according to embodiment [8], wherein the antisense strand contains a nucleotide at position 7 in the 5'→3' direction of its sequence that is a 2'-OMe modified nucleotide, and the sense strand contains a 2'-F modified nucleotide complementary to the nucleotide at position 7 in the 5'→3' direction of the sequence of the antisense strand. [14-1] The nucleic acid molecule according to embodiment
[14] , wherein the antisense strand contains a nucleotide at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence that is a 2'-F modified nucleotide, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 contain a 2'-OMe modified nucleotide, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides in which the 2' position is modified with any group.
[0060] [14-2] The nucleic acid molecule according to embodiment
[14] , wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [14-3] The nucleic acid molecule according to embodiment
[14] , wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0061] [14-4] The nucleic acid molecule according to embodiment
[14] , wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [14-5] The nucleic acid molecule according to embodiment
[14] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0062] [14-6] The nucleic acid molecule according to embodiment
[14] , wherein the antisense strand contains nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 contain nucleotides with 2'-OMe modification, and 0 to 3 of the 2'-OMe modification nucleotides may contain nucleotides in which the 2' position is modified with any group. [14-7] The nucleic acid molecule according to embodiment
[14] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0063] [14-8] The nucleic acid molecule according to embodiment
[14] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [14-9] The nucleic acid molecule according to any one of embodiments [14-1] to [14-8], wherein in the antisense strand, the nucleotide at position 1 in the 5'→3' direction of its sequence includes a nucleotide other than a 2'-F modified nucleotide.
[0064] [14-10] The nucleic acid molecule according to any one of embodiments [14-1] to [14-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain comprises a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (t). [14-11] The nucleic acid molecule according to any one of embodiments [14-1] to [14-8], wherein the antisense chain further comprises a 5'-phosphorus stabilizing moiety at the 5' end. [14-12] The nucleic acid molecule according to embodiment [14-11], wherein the 5'-phosphorus stabilizing moiety is a 5'-vinylphosphonate modified nucleotide.
[0065]
[15] The nucleic acid molecule according to embodiment [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and any nucleotide at positions 4, 8-10, 12, 18, 20 or 22 may be a 2'-F modified nucleotide, and the antisense strand contains 7 to 11 2'-F modified nucleotides. [15-1-1] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0066] [15-1-2] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [15-1-3] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0067] [15-1-4] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [15-1-5] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0068] [15-1-6] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [15-1-7] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0069] [15-1-8] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0070] [15-2-1] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [15-2-2] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0071] [15-2-3] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [15-2-4] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0072] [15-2-5] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [15-2-6] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0073] [15-2-7] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [15-2-8] The nucleic acid molecule according to embodiment
[15] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0074] [15-2-9] The nucleic acid molecule according to any one of embodiments [15-2-1] to [15-2-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a nucleotide other than a 2'-F modified nucleotide. [15-2-10] The nucleic acid molecule according to any one of embodiments [15-2-1] to [15-2-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (t). [15-2-11] The nucleic acid molecule according to any one of embodiments [15-2-1] to [15-2-8], wherein the antisense chain further contains a 5'-phosphorus stabilizing moiety at the 5' end. [15-2-12] The nucleic acid molecule according to embodiment [15-2-11], wherein the 5'-phosphorus stabilizing portion is a 5'-vinylphosphonate modified nucleotide.
[0075]
[16] The sense strand is arranged in order from the 3' side to the 5' side of the sense strand as 3'-A-B-C-D-E-F-G-H-I-5' and comprises a nucleotide unit consisting of: 2'-F modified nucleotide A; three consecutive 2'-OMe modified nucleotides B to D; three consecutive 2'-F modified nucleotides E to G; 2'-OMe modified nucleotide H; and 2'-F modified nucleotide I; the antisense strand comprises: a 2'-OMe modified nucleotide complementary to 2'-F modified nucleotide A; a 2'-OMe modified nucleotide complementary to 2'-F modified nucleotide E; a 2'-OMe modified nucleotide complementary to 2'-F modified nucleotide G; a 2'-F modified nucleotide complementary to 2'-OMe modified nucleotide H; and a 2'-OMe modified nucleotide complementary to 2'-F modified nucleotide I; The nucleic acid molecule according to embodiment [8], wherein the sense strand and the antisense strand may each independently contain nucleotides whose 2' position is modified with any group instead of 0 to 3 2'-OMe modified nucleotides. [16-1] The nucleic acid molecule according to embodiment
[16] , wherein the antisense strand contains a 2'-F modified nucleotide that complements the 2'-F modified nucleotide F of the sense strand.
[0076]
[17] The nucleic acid molecule according to embodiment [8], wherein the antisense chain includes alternating units in which 2'-F modified nucleotides and 2'-OMe modified nucleotides are arranged alternately, and three or more of the alternating units are arranged consecutively, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0077]
[18] The nucleic acid molecule according to embodiment [8], wherein the antisense strand, in the 5'→3' direction of its sequence, contains alternating repeats of 2'-F modified nucleotides and 2'-OMe modified nucleotides at positions 12 to 21, contains a 2'-F modified nucleotide or a 2'-OMe modified nucleotide at position 22, contains a 2'-OMe modified nucleotide at position 23, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides whose 2' position is modified with any group, and positions 22 and 23 are overhang regions.
[0078] [19-1] The nucleic acid molecule according to embodiment [8], wherein the sense strand and the antisense strand each contain one or more, two or more, four or more, or four phosphorothioate bonds. [19-2] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence.
[0079] [20-1] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [20-2] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0080] [20-3] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [20-4] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0081] [20-5] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [20-6] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0082] [20-7] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [20-8] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0083] [21-1] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O The nucleic acid molecule according to embodiment [8], comprising a Me-modified nucleotide, wherein in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence comprise a 2'-F modified nucleotide, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 comprise a 2'-OMe modified nucleotide, and 0 to 3 of the 2'-OMe modified nucleotides may comprise nucleotides in which the 2' position is modified with any group. [21-2] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides. The nucleic acid molecule according to embodiment [8], comprising a decorative nucleotide, wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0084] [21-3] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OM modified nucleotides. The nucleic acid molecule according to embodiment [8], comprising an e-modified nucleotide, wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence comprise a 2'-F modified nucleotide, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 comprise a 2'-OMe modified nucleotide, and 0 to 3 of the 2'-OMe modified nucleotides may comprise nucleotides in which the 2' position is modified with any group. [21-4] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'- The nucleic acid molecule according to embodiment [8], comprising an OMe-modified nucleotide, wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence comprise a 2'-F-modified nucleotide, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 comprise a 2'-OMe-modified nucleotide, and 0 to 3 of the 2'-OMe-modified nucleotides may comprise nucleotides in which the 2' position is modified with any group.
[0085] [21-5] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides. The nucleic acid molecule according to embodiment [8], wherein the antisense strand comprises nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides in which the 2' position is modified with any group. [21-6] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleos A nucleic acid molecule according to embodiment [8], comprising nucleotides, wherein in the antisense chain, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0086] [21-7] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides. A nucleic acid molecule according to embodiment [8], comprising an ocide, wherein in the antisense chain, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [21-8] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides A nucleic acid molecule according to embodiment [8], comprising a creotide, wherein the antisense chain contains 2'-F modified nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, and 2'-OMe modified nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides in which the 2' position is modified with any group.
[0087] [21-8-1] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides. [21-8-2] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides.
[0088] [21-8-3] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides. [21-8-4] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-OMe modified nucleotides.
[0089] [21-8-5] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and 1-6, 8, 12-14 and 1 The nucleic acid molecule according to embodiment [8], wherein the nucleotides at positions 6 to 21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides. [21-8-6] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides.
[0090] [21-8-7] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides. [21-8-8] The nucleic acid molecule according to embodiment [8], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides.
[0091] [21-9] The nucleic acid molecule according to any one of embodiments [21-1] to [21-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a nucleotide other than a 2'-F modified nucleotide. [21-10] The nucleic acid molecule according to any one of embodiments [21-1] to [21-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (t).
[0092] [21-10-1] The nucleic acid molecule according to any one of embodiments [21-8-1] to [21-8-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain comprises a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (t). [21-11] The nucleic acid molecule according to any one of embodiments [21-1] to [21-8-8], wherein the antisense chain further comprises a 5'-phosphorus stabilizing moiety at the 5' end. [21-12] The nucleic acid molecule according to embodiment [21-11], wherein the 5'-phosphorus stabilizing moiety is a 5'-vinylphosphonate modified nucleotide.
[0093]
[22] A nucleic acid molecule comprising a sense strand and an antisense strand complementary to the sense strand, wherein the sense strand includes the sequence of formula I in the 5'→3' direction of its sequence, and the antisense strand includes the sequence of formula II-(1) in the 5'→3' direction of its sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-3' Formula II-(1): 5'-A1-B1-C1-D1-3' In formula II-(1), A1 is represented as X-F-M-Y-M-F, B1 is represented as M-F-F-M, M-M-F-F, M-F-M-F, or M-M-M-M, C1 is represented as M-Y-M-F-M-F, D1 is represented as M-Y-M-Y-M-Y-M, In each of the above formulas, F is a 2'-F modified nucleotide, M is a 2'-OMe modified nucleotide, X is independently a nucleotide modified with any group, Y is independently F or M, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides whose 2' position is modified with any group.
[0094] [22-1] A nucleic acid molecule comprising a sense strand and an antisense strand complementary to the sense strand, wherein the sense strand includes the sequence of formula I in the 5'→3' direction of its sequence, and the antisense strand includes the sequence of formula II-(1) in the 5'→3' direction of its sequence; Formula I: 5'-Z-Z-Z-Z-Z-Z-F-Z-F-F-F-Z-Z-Z-Z-Z-Z-Z-Z-3', 5'-Z-Z-Z-Z-Z-F-Z-F-F-Z-Z-Z-Z-Z-Z-Z-Z-Z-3', 5'-Z-Z-Z-Z-F-Z-F-F-F-Z-Z-Z-Z-Z-Z-Z-Z-3' Formula II-(1): 5'-A1-B1-C1-D1-3' In formula II-(1), A1 is represented as Z-F-Z-Z'-Z-F, B1 is represented as Z-F-F-Z, Z-Z-F-F, Z-F-F-F, Z-F-Z-F, or Z-Z-Z-Z, C1 is represented as Z-Z'-Z-F-Z-F, D1 is represented as Z-Z'-Z-Z'-Z-Z'-Z, Z-Z'-Z-Z'-Z'-Z', or Z-Z'-Z-Z'-Z, In each of the above formulas, F is a 2'-F modified nucleotide, and Z is independently a nucleotide whose 2' position is 2'-OR 1 , 2'-R 1 , 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 1 2 , 2'- N 3 , 2'-CN, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR 3 (In each group, R 1 R is alkyl or aryl; 2 is an alkylene; X is an oxygen atom, NH or NR 1 And; R 3 Modified nucleotides comprising nucleotides, deoxynucleotides, or crosslinked nucleotide glycol nucleic acids substituted with a group selected from the group consisting of (where is alkyl), Z' independently being 2'-OR at the 2' position of the nucleotide 1, 2'-R 1 , 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 1 2 , 2'- N 3 , 2'-CN, 2'-F, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR 3 (In each group, R 1 R is alkyl or aryl; 2 is an alkylene; X is an oxygen atom, NH or NR 1 And; R 3 Modified nucleotides, including nucleotides, deoxynucleotides, or crosslinked nucleotides substituted with a group selected from the group consisting of (where is alkyl).
[0095] [22-2] The nucleic acid molecule according to embodiment
[22] or [22-1], wherein the sense strand and the antisense strand each contain four phosphorothioate bonds. [22-3] The nucleic acid molecule according to embodiment
[22] or [22-1], wherein in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence, and between nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence.
[0096]
[23] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and the positions of the phosphorothioate bonds in the sense strand and the antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-M-F-M-M-M-M-3', 5'-M-M-M-M-M-F-M-F -F-F-M-M-M-F-M-M-M-3', or 5'-M-M-M-M-F-M-F-F-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented by X-F-M-M-F or X-F-M-F-M-F, and B2 is M-F-M, M-M-F-F, M-F-M-F, or Represented as M-M-M-M, C2 is represented as M-F-M-F-M-F or M-M-M-F-M-F, D2 is M-M-M-M-M-M-M, M-M-M-M-M-M, M-M-M-M-M, M-M-M-M, or M-M-M, M-F-M-M-M-M-M, M-F-M-M-M, M-F-M-M, M-F-M-M, or M-F-M, M-F-M-F-M-M-M, M-F-M-F-M, M-F-M-F-M, or M-F-M, or Represented as M-F-M-F-M-F-M, M-F-M-F-M-F, M-F-M-F-M, M-F-M-F, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide, M is a 2'-OMe modified nucleotide, and X is independently any modified nucleotide.
[0097] [23-1] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and the positions of the phosphorothioate bonds in the sense strand and the antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, and B2 is represented by M-F-F-M or M-M-F-F, C2 is represented as M-F-M-F-M-F or M-M-M-F-M-F, D2 is represented as M-M-M-M-M-M-M, M-M-M-M-M-M, M-M-M-M-M, M-M-M-M, or M-M-M, or M-F-M-M-M-M-M, M-F-M-M-M-M, M-F-M-M-M, M-F-M-M, or M-F-M, where F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0098] [23-2] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented by M-F-F-M, C2 is represented by M-F-M-F-M-F, D2 is represented as M-M-M-M-M-M-M, M-M-M-M-M-M, M-M-M-M-M, M-M-M-M, or M-M-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0099] [23-3] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented by M-F-F-M, C2 is represented by M-F-M-F-M-F, D2 is represented as M-F-M-M-M-M-M, M-F-M-M-M-M, M-F-M-M-M, M-F-M-M, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0100] [23-4] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and the positions of the phosphorothioate bonds in the sense strand and the antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented by M-F-F-M, C2 is represented by M-M-M-F-M-F, D2 is represented as M-M-M-M-M-M-M, M-M-M-M-M-M, M-M-M-M-M, M-M-M-M, M-M-M-M, or M-M-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0101] [23-5] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented by M-F-F-M, C2 is represented by M-M-M-F-M-F, D2 is represented as M-F-M-M-M-M-M, M-F-M-M-M-M-M, M-F-M-M-M-M, M-F-M-M-M, M-F-M-M, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0102] [23-6] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence, and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented by M-M-F-F, C2 is represented by M-F-M-F-M-F, D2 is represented as M-M-M-M-M-M-M, M-M-M-M-M-M, M-M-M-M-M, M-M-M-M, or M-M-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0103] [23-7] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented by M-M-F-F, C2 is represented by M-F-M-F-M-F, D2 is represented as M-F-M-M-M-M-M, M-F-M-M-M-M, M-F-M-M-M, M-F-M-M, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0104] [23-8] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented by M-M-F-F, C2 is represented by M-M-M-F-M-F, D2 is represented as M-M-M-M-M-M-M, M-M-M-M-M-M, M-M-M-M-M, M-M-M-M, or M-M-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0105] [23-9] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-M-M-F, B2 is represented by M-M-F-F, C2 is represented by M-M-M-F-M-F, D2 is represented as M-F-M-M-M-M-M, M-F-M-M-M-M, M-F-M-M-M, M-F-M-M, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0106] [23-10] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and the positions of the phosphorothioate bonds in the sense strand and the antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-F-M-F, B2 is represented by M-F-M-F or M-M-M-M, C2 is represented by M-F-M-F-M-F, D2 is represented as M-F-M-F-M-M-M, M-F-M-F-M-M, M-F-M-F-M, M-F-M-F, or M-F-M, or M-F-M-F-M-F-M, M-F-M-F-M-F, M-F-M-F-M, M-F-M-F, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0107] [23-11] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-F-M-F, B2 is represented by M-M-M-M, C2 is represented by M-F-M-F-M-F, D2 is represented as M-F-M-F-M-M-M, M-F-M-F-M-M, M-F-M-F-M, M-F-M-F, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0108] [23-12] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and the positions of the phosphorothioate bonds in the sense strand and the antisense strand are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-F-M-F, B2 is represented by M-M-M-M, C2 is represented by M-F-M-F-M-F, D2 is represented as M-F-M-F-M-F-M, M-F-M-F-M-F, M-F-M-F-M, M-F-M-F, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0109] [23-13] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-F-M-F, B2 is represented by M-F-M-F, C2 is represented by M-F-M-F-M-F, D2 is represented as M-F-M-F-M-M-M, M-F-M-F-M-M, M-F-M-F-M, M-F-M-F, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0110] [23-14] The nucleic acid molecule according to embodiment
[22] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3', 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-M-M-3', or 5'-M-M-M-M-M-M-F-M-F-F-F-M-M-M-M-F-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In Formula II-(2), A2 is represented by X-F-M-F-M-F, B2 is represented by M-F-M-F, C2 is represented by M-F-M-F-M-F, D2 is represented as M-F-M-F-M-F-M, M-F-M-F-M-F, M-F-M-F-M, M-F-M-F, or M-F-M, where in each of the above formulas, F is a 2'-F modified nucleotide and M is a 2'-OMe modified nucleotide.
[0111]
[24] The nucleic acid molecule according to
[22] wherein the sense strand includes the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand includes the sequence of formula III below in the 5'→3' direction of its sequence, the 22nd and 23rd positions being overhang regions, and the antisense strand comprises 10 or fewer 2'-OMe modified nucleotides; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-F-M-M-M-M-M-M-3' Formula III: 5'-X-F-M-Y-M-F-M-Y-Y-Y-M-Y-M-F-M-F-M-Y-M-Y-M-3' In each of the above formulas, F is a 2'-F modified nucleotide, M is a 2'-OMe modified nucleotide, and X is independently any modified nucleotide. Y is independently either F or M.
[0112] [24-1] The nucleic acid molecule according to
[22] wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula III in the 5'→3' direction of its sequence, the 21st and 22nd positions are overhang regions, and the antisense strand contains 10 or fewer 2'-OMe modified nucleotides; Formula I: 5'-M-M-M-M-F-M-F-F-F-M-M-F-M-M-M-M-M-M-3' Formula III: 5'-X-F-M-Y-M-F-M-Y-Y-Y-Y-M-Y-M-F-M-F-M-Y-M-Y-3' In each of the above formulas, F is a 2'-F modified nucleotide, M is a 2'-OMe modified nucleotide, and X is independently any modified nucleotide. Y is independently either F or M.
[0113] [24-2] The nucleic acid molecule according to
[22] wherein the sense strand includes the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand includes the sequence of formula III in the 5'→3' direction of its sequence, the 20th and 21st positions being overhang regions, and the antisense strand comprises 10 or fewer 2'-OMe modified nucleotides; Formula I: 5'-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-3' Formula III: 5'-X-F-M-Y-M-F-M-Y-Y-Y-M-Y-M-F-M-Y-M-Y-M-3' In each of the above formulas, F is a 2'-F modified nucleotide, M is a 2'-OMe modified nucleotide, and X is independently any modified nucleotide. Y is independently F or M. [24-3] X is independently 2'-OR 1 , 2'-R 1 , 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 1 2 , 2'- N 3 , 2'-CN, 2'-F, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR3 (In each group, R 1 R is alkyl or aryl; 2 is an alkylene; X is an oxygen atom, NH or NR 1 And; R 3 A nucleic acid molecule according to any one of the embodiments
[22] to [24-2], which is a modified nucleotide comprising a nucleotide, deoxynucleotide, or crosslinked nucleotide such as LNA, substituted with a group selected from the group consisting of (where is alkyl).
[0114] [25-1] The nucleic acid molecule according to any one of embodiments
[22] to [24-3], wherein the antisense chain comprises any modified nucleotide except F. [25-2] The nucleic acid molecule according to any one of embodiments
[22] to
[24] , wherein the antisense chain comprises a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (t).
[0115]
[26] A nucleic acid molecule comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double-stranded region, the sense strand is 21 nucleotides long and contains 5 2'-F modified nucleotides, and the antisense strand is 23 nucleotides long and contains 7 to 11 2'-F modified nucleotides, wherein in the sense strand, the nucleotide at position 15 in the 5'→3' direction of its sequence is represented by F, and in the antisense strand, the nucleotide at position 7 in the 5'→3' direction of its sequence is represented by M, where F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides in which the 2' position is modified with any group, and positions 1 and 21 of the sense strand and positions 21 and 1 of the antisense strand are complementary, respectively.
[0116] [26-1] The nucleic acid molecule according to embodiment
[26] , wherein in the antisense strand, the nucleotides at positions 6 to 8 in the 5'→3' direction of the sequence are represented as F-M-M or F-M-F. [26-2] The nucleic acid molecule according to embodiment
[26] , wherein in the sense strand, the nucleotides at positions 14 to 18 in the 5'→3' direction of the sequence are represented as M-F-M-M-M, and in the antisense strand, the nucleotides at positions 6 to 8 in the 5'→3' direction of the sequence are represented as F-M-M or F-M-F. [26-3] The nucleic acid molecule according to embodiment
[26] , wherein in the sense strand, the nucleotides at positions 13 to 20 in the 5'→3' direction of its sequence are represented as M-M-F-M-M-M-M-M, and in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of its sequence are represented as F-M-M-F-M-M-F, F-M-M-F-M-F-F, F-M-F-M-F-M-M-M, or F-M-F-M-F-M-F-M.
[0117] [26-3-1] The nucleic acid molecule according to embodiment [26-3], wherein in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-M-M-F-M-M-F, and the antisense strand contains seven 2'-F modified nucleotides. [26-3-2] The nucleic acid molecule according to embodiment [26-3], wherein in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-M-M-F-M-F-F, and the antisense strand contains seven 2'-F modified nucleotides.
[0118] [26-3-3] The nucleic acid molecule according to embodiment [26-3], wherein in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-F-M-F-M-M-M, and the antisense strand contains 8 or 9 2'-F modified nucleotides. [26-3-4] The nucleic acid molecule according to embodiment [26-3], wherein in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-F-M-F-M-F-M, and the antisense strand contains 10 or 11 2'-F modified nucleotides.
[0119] [27-1] The nucleotide modified at the 2' position with any group is independently a 2'-deoxyribonucleotide or a 2'-O-alkyl-modified nucleotide (in this embodiment, for example, the alkyl is a carbon chain C 1-18 A nucleic acid molecule according to any one of the embodiments [13-4-1] to [13-4-12], [14-1] to [14-12], [15-2-1] to [15-2-12],
[16] to [16-1],
[22] to [26-3-4], which also includes 2'-O-alkyl modified nucleotides that are alkyl groups. [27-2] A nucleic acid molecule according to any one of the embodiments [13-4-1] to [13-4-12], [14-1] to [14-12], [15-2-1] to [15-2-12],
[16] to [16-1],
[22] to [26-3-4], wherein a nucleotide modified with an arbitrary group at the 2' position is present in the sense strand.
[0120] [27-2-1] The nucleotides in the sense chain whose 2' position is modified with any group are independently 2'-O-alkyl-modified nucleotides (in this embodiment, for example, alkyl is a carbon chain C 1-18 A nucleic acid molecule according to embodiment [27-2], which also includes a 2'-O-alkyl modified nucleotide that is an alkyl group. [27-3] A nucleic acid molecule according to any one of embodiments [13-4-1] to [13-4-12], [14-1] to [14-12], [15-2-1] to [15-2-12],
[16] to [16-1],
[22] to [26-3-4], wherein a nucleotide modified at the 2' position with an arbitrary group is present in the antisense chain.
[0121] [27-3-1] The nucleic acid molecule according to embodiment [27-3], wherein each nucleotide in the antisense chain whose 2' position is modified with an arbitrary group is independently a 2'-deoxyribonucleotide. [27-4] The nucleic acid molecule according to any one of embodiments [13-4-1] to [13-4-12], [14-1] to [14-12], [15-2-1] to [15-2-12],
[16] to [16-1],
[22] to [26-3-4], wherein there are zero nucleotides whose 2' position is modified with an arbitrary group.
[0122]
[28] A nucleic acid molecule comprising a sense strand and an antisense strand that can inhibit the expression of a target protein or target gene, wherein the sense strand is 19, 20, 21, 22, or 23 nucleotides long, and the antisense strand is 19, 20, 21, 22, or 23 nucleotides long, the sense strand comprises a 2'-F modified nucleotide and a modified nucleotide, the 2'-F modified nucleotide is located at positions 7, 9, 10, 11, and 15 from the 5' end of the sense strand, and the modified nucleotide is independently such that the 2' position of the nucleotide is 2'-OR 1 , 2'-R 1 , 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 12 , 2'-N 3 , 2'-CN, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR 3 (In each group, R 1 R is alkyl or aryl; 2 is an alkylene; X is an oxygen atom, NH or NR 1 And; R 3 A nucleic acid molecule comprising a nucleotide, deoxynucleotide, or cross-linked nucleotide such as LNA, which is substituted with a group selected from the group consisting of (where is alkyl).
[0123] [28-1] The nucleic acid molecule according to embodiment
[28] , wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the sense strand are 2'-O-alkyl modified nucleotides. [28-2] The nucleic acid molecule according to embodiment
[28] , wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the sense strand are 2'-OMe modified nucleotides.
[0124] [28-3] The nucleic acid molecule according to embodiment
[28] , wherein the sense strand and antisense strand have a double-stranded region with a blunt end at the 3' end of the sense strand, and the antisense strand, when 19 nucleotides long, has the sequence of formula IV-(1-1) in the 5'→3' direction of the antisense strand; when 20 nucleotides long, has the sequence of formula IV-(1-2) in the 5'→3' direction of the antisense strand; when 21 nucleotides long, has the sequence of formula IV-(1-3) in the 5'→3' direction of the antisense strand; when 22 nucleotides long, has the sequence of formula IV-(1-4) in the 5'→3' direction of the antisense strand; and when 23 nucleotides long, has the sequence of formula IV-(1-5) in the 5'→3' direction of the antisense strand; Formula IV-(1-1): 5'-Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z-Z'-Z-F-Z-F-Z-Z'-Z-Z'-Z-3' Formula IV-(1-2): 5'-Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z-Z'-Z-F-Z-F-Z-Z'-Z-Z'-Z-3' Formula IV-(1-3): 5'-Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z-Z'-Z-F-Z-F-Z-Z'-Z-Z'-Z-3' Formula IV-(1-4): 5'-Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-Z-F-Z-F-Z-Z'-Z'-Z'-Z'-Z'-3' Formula IV-(1-5): 5'-Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-Z'-Z'-F-Z-F-Z-Z'-Z'-Z'-Z'-Z'-3' In each of the above formulas, F is a 2'-F modified nucleotide, Z' and Z are modified nucleotides, and Z' independently has a 2'-OR at the 2' position of the nucleotide 1 , 2'-R 1 , 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 1 2 , 2'- N 3 , 2'-CN, 2'-F, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR 3 (In each group, R1 is alkyl or aryl; R 2 is alkylene; X is an oxygen atom, NH or NR 1 ; R 3 is alkyl), a modified nucleotide comprising a nucleotide, a deoxynucleotide, or a cross-linked nucleotide such as LNA substituted with a group selected from the group consisting of, Z is independently, the 2'-position of the nucleotide is 2'-OR 1 , 2'-R 1 , 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 1 2 , 2'-N 3 , 2'-CN, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR 3 (in each group, R 1 is alkyl or aryl; R 2 is alkylene; X is an oxygen atom, NH or NR 1 ; R 3 is alkyl), a modified nucleotide comprising a nucleotide, a deoxynucleotide, or a cross-linked nucleotide such as LNA substituted with a group selected from the group consisting of).
[0125] [28-3-1] The nucleic acid molecule according to embodiment [28-3] wherein the sense strand and antisense strand are complementary at positions 1-8, 2-8, 3-8, 4-8, 5-8, 6-8, or 7-8 from the following positional relationships: position 1 from the 3' end of the sense strand and position 1 from the 5' end of the antisense strand; position 2 from the 3' end of the sense strand and position 2 from the 5' end of the antisense strand; position 3 from the 3' end of the sense strand and position 3 from the 5' end of the antisense strand; position 4 from the 3' end of the sense strand and position 4 from the 5' end of the antisense strand; position 5 from the 3' end of the sense strand and position 5 from the 5' end of the antisense strand; position 6 from the 3' end of the sense strand and position 6 from the 5' end of the antisense strand; position 7 from the 3' end of the sense strand and position 7 from the 5' end of the antisense strand; The 3' end to position 8 of the sense strand, and the 5' end to position 8 of the antisense strand.
[0126] [28-4] The nucleic acid molecule according to embodiment [28-3], wherein the Z' at position 12 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [28-5] The nucleic acid molecule according to embodiment [28-3], wherein the Z' at positions 9 and 10 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [28-6] The nucleic acid molecule according to embodiment [28-3], wherein the Z' at positions 8 and 9 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F.
[0127] [28-7] The nucleic acid molecule according to embodiment [28-3], wherein Z' at the 8th, 9th, and 10th positions in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [28-8] Z' is a dehydronucleotide, or the 2' position of a nucleotide is 2'-OR 1 A nucleotide modified with a group selected from the group consisting of , and 2'-F, wherein Z is a dehydronucleotide, or the 2' position of the nucleotide is 2'-OR 1 A nucleic acid molecule according to any one of the embodiments [28-3] to [28-7], which is a nucleotide modified with
[0128] [28-9] The nucleic acid molecule according to any one of the embodiments [28-3] to [28-8], wherein the antisense chain includes a sequence represented by any one of the following formulas IV-(2-1) to (2-3) in the direction of its 5'→3': Formula IV-(2-1): 5'-Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-F-Z-Z-3', Formula IV-(2-1): 5'-Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-F-Z-Z-Z-3', Formula IV-(2-1): 5'-Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-F-Z-Z-Z-Z-3', Formula IV-(2-2): 5'-Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-3', Formula IV-(2-3): 5'-Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-3'. In the above formulas, Z and F are the same as defined in the above formula [28-3].
[0129] [28-10] The nucleic acid molecule according to any one of the embodiments [28-3] to [28-8], wherein the antisense chain includes the sequence of formulas IV-(3-1) to (3-3) below in the 5'→3' direction of its sequence; Formula IV-(3-1): 5'-Z-F-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-3', Formula IV-(3-1): 5'-Z-F-Z-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-3', Formula IV-(3-1): 5'-Z-F-Z-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-3', Formula IV-(3-2): 5'-Z-F-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-3', Formula IV-(3-3): 5'-Z-F-Z-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-F-Z-Z-Z-3'. In the above formulas, Z and F are the same as defined in the above formula [28-3].
[0130] [28-11] The nucleic acid molecule according to any one of the embodiments [28-3] to [28-8], wherein the antisense chain includes the sequence of formulas IV-(4-1) to (4-3) below in the 5'→3' direction of its sequence; Formula IV-(4-1): 5'-Z-F-Z-Z-Z-F-Z-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-3', Formula IV-(4-1): 5'-Z-F-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-3', Formula IV-(4-1): 5'-Z-F-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-3', Formula IV-(4-2): 5'-Z-F-Z-Z-Z-F-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-3', Formula IV-(4-3): 5'-Z-F-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-3'. In the above formulas, Z and F are the same as defined in the above formula [28-3].
[0131] [28-12] The nucleic acid molecule according to any one of the embodiments [28-3] to [28-8], wherein the antisense chain includes the sequence of formulas IV-(5-1) to (5-3) below in the 5'→3' direction of its sequence; Formula IV-(5-1): 5'-Z-F-Z-Z-Z-F-Z-F-F-Z-Z-F-Z-Z-F-Z-Z-Z-3', Formula IV-(5-1): 5'-Z-F-Z-Z-Z-F-Z-F-F-Z-Z-F-Z-Z-Z-F-Z-Z-Z-3', Formula IV-(5-1): 5'-Z-F-Z-Z-Z-F-Z-F-F-Z-F-Z-Z-F-Z-Z-Z-Z-Z-3', Formula IV-(5-2): 5'-Z-F-Z-Z-Z-F-Z-F-F-Z-Z-F-Z-Z-F-Z-Z-Z-Z-Z-Z-3', Formula IV-(5-3): 5'-Z-F-Z-Z-Z-F-Z-F-F-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-Z-Z-Z-3'. In the above formulas, Z and F are the same as defined in the above formula [28-3].
[0132] [28-13] The nucleic acid molecule according to any one of the embodiments [28-3] to [28-8], wherein the antisense chain includes the sequence of formulas IV-(6-1) to (6-3) below in the 5'→3' direction of its sequence; Formula IV-(6-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(6-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(6-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(6-2): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-3', Formula IV-(6-3): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3'. In the above formulas, Z and F Definition are the same as the definitions in the above-mentioned model [28-3].
[0133] [28-14] The nucleic acid molecule according to any one of the embodiments [28-3] to [28-8], wherein the antisense chain includes the sequence of formulas IV-(7-1) to (7-3) below in the 5'→3' direction of its sequence; Formula IV-(7-1): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-3', Formula IV-(7-1): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(7-1): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-3', Formula IV-(7-2): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-3', Formula IV-(7-3): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3'. In the above formulas, Z and F Definition are the same as the definitions in the above formula [28-3].
[0134] [28-15] The nucleic acid molecule according to any one of the embodiments [28-3] to [28-8], wherein the antisense chain includes the sequence of formulas IV-(8-1) to (8-3) below in the 5'→3' direction of its sequence; Formula IV-(8-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-3', Formula IV-(8-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(8-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-3', Formula IV-(8-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(8-2): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(8-3): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-3'. In the above formulas, Z and F are the same as defined in the above formula [28-3].
[0135] [28-16] The nucleic acid molecule according to any one of the embodiments [28-3] to [28-8], wherein the antisense chain includes the sequence of formulas IV-(9-1) to (9-3) below in the 5'→3' direction of its sequence; Formula IV-(9-1): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-F-Z-Z-F-Z-3', Formula IV-(9-1): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-3', Formula IV-(9-1): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-3', Formula IV-(9-2): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-Z-3', Formula IV-(9-3): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-Z-F-Z-Z-3'. In the above formulas, Z and F are the same as defined in the above model [28-3].
[0136] [28-16-1] The nucleic acid molecule according to any one of embodiments [28-3] to [28-8], wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the antisense chain are 2'-O-alkyl modified nucleotides. [28-16-2] The nucleic acid molecule according to any one of embodiments [28-3] to [28-8], wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the antisense chain are 2'-OMe modified nucleotides.
[0137] [28-17] The nucleic acid molecule according to any one of embodiments
[28] to [28-16-2], wherein the modified nucleotide comprises modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds and phosphorodithioate bonds. [28-18] A phosphate group (P(O)(OH)) is attached to the hydroxyl groups at the 3' and / or 5' positions of the nucleotides at the 3' and / or 5' ends of the sense strand and / or antisense strand. 2 ) or thiophosphate group (P(S)(OH) 2 A nucleic acid molecule according to any one of the embodiments
[28] to [28-17], comprising a nucleotide in which ) is substituted.
[0138] [28-19] A nucleic acid molecule according to any one of embodiments
[28] to [28-18], wherein the nucleotide at position 1 from the 5' and / or 3' end of the sense strand and / or antisense strand is a deoxynucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate (t). [28-20] A nucleic acid molecule according to any one of embodiments
[28] to [28-19], wherein a functional molecule, a debasalized nucleotide (invAb), a nucleotide, a modified nucleotide, or a combination thereof is bound to the nucleotide at the 5' or 3' end of the sense strand and / or antisense strand.
[0139] [28-20-1] A nucleic acid molecule in which one or two functional molecules are bound to the nucleotides at the 5' and / or 3' ends of the antisense strand of the nucleic acid molecule described in any one of the embodiments
[28] to [28-19]. [28-20-1-2] A nucleic acid molecule in which one or two functional molecules are bound to the nucleotides at the 5' and / or 3' ends of the sense strand of the nucleic acid molecule described in any one of the embodiments
[28] to [28-19]. [28-20-2] A nucleic acid molecule in which one to ten, one to eight, one to five, one to four, one to three, one to two, or one debasalized nucleotide is bound to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand of the nucleic acid molecule described in any one of the embodiments
[28] to [28-19].
[0140] [28-20-3] A nucleic acid molecule in which 1 to 10, 1 to 8, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 nucleotide is bound to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand of the nucleic acid molecule according to any one of the embodiments
[28] to [28-19]. [28-20-4] A nucleic acid molecule in which 1 to 10, 1 to 8, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 modified nucleotide is bound to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand of the nucleic acid molecule according to any one of the embodiments
[28] to [28-19]. [28-20-4-1] A nucleic acid molecule according to any one of embodiments [28-20] to [28-20-4], wherein the sense strand and / or the antisense strand includes modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds and phosphorodithioate bonds.
[0141] [28-20-4-2] A phosphate group (P(O)(OH) is attached to the hydroxyl groups at the 3' and / or 5' positions of the nucleotides at the 3' and / or 5' ends of the sense strand and / or antisense strand. 2 ) or thiophosphate group (P(S)(OH) 2A nucleic acid molecule according to any one of embodiments [28-20] to [28-20-4-1], comprising a nucleotide substituted with (). [28-20-4-3] A nucleic acid molecule according to any one of embodiments [28-20] to [28-20-4-2], wherein the nucleotide at position 1 from the 5' end and / or 3' end of the sense strand and / or antisense strand is a deoxynucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate (t).
[0142]
[29] A nucleic acid molecule according to any one of the embodiments [8] to [28-20-4-3] that inhibits the expression of IL-33. [29-1] Inhibition rate of IL-33 expression IC 50 However, 0 < IC 50 A nucleic acid molecule according to any one of the embodiments [8] to [28-20-4-3], wherein the concentration is ≤ approximately 1000 pM. [29-2] A nucleic acid molecule according to any one of the embodiments [8] to [28-20-4-3], wherein the inhibition rate of IL-33 expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more.
[0143]
[30] A nucleic acid molecule according to any one of embodiments [8] to [29-2], wherein the nucleic acid molecule is siRNA.
[31] A nucleic acid molecule or a salt of siRNA according to any one of embodiments [8] to
[30] , or a solvate thereof.
[32] A pharmaceutical composition comprising a nucleic acid molecule or siRNA according to any one of embodiments [8] to
[31] , or a salt thereof, or a solvate thereof, and a pharmaceutically acceptable carrier.
[0144] The present invention provides nucleic acid molecules or salts thereof that can inhibit the expression of IL-33, or solvates thereof, and pharmaceutical compositions containing one or more thereof. Furthermore, the nucleic acid molecules or salts thereof that can inhibit the expression of IL-33, or solvates thereof, contain a region complementary to a part of the gene (mRNA) that codes for IL-33, and by inhibiting the expression of IL-33 in complement to the gene, they have the effect of preventing and / or treating diseases or symptoms in which IL-33 is suspected to be involved.
[0145] By using the nucleic acid molecule of the present invention, it becomes possible to target genes involved in IL-33 expression in mammals and degrade those genes. In in vitro tests of the nucleic acid molecule shown in the examples described below, it was demonstrated that the nucleic acid molecule of the present invention that can inhibit IL-33 expression significantly inhibits the expression of IL-33 mRNA (in other words, the expression of IL-33). Therefore, the nucleic acid molecule of the present invention that can inhibit IL-33 expression is a useful nucleic acid molecule for the prevention or treatment of diseases or symptoms in which IL-33 is suspected to be involved, such as bronchial asthma.
[0146] The embodiments of the present invention will be described in detail below. However, the present invention is not limited to the embodiments described below, and can be implemented in any form without departing from the spirit of the invention. Furthermore, preferred and more preferred embodiments exemplified below can be combined with each other as appropriate, regardless of expressions such as "for example," "preferred," and "more preferred." In addition, the numerical ranges are described as examples, and the upper or lower limits of each range can be combined with the numerical values described in the examples as appropriate.
[0147] Definitions: "Nucleic acid" refers to a molecule composed of monomeric nucleotides. "Nucleic acid molecule" is not particularly limited, but may include, for example, oligonucleotides, ASOs, siRNA, shRNA, miRNA, single-stranded nucleic acid molecules, double-stranded nucleic acid molecules, RNA, DNA, etc. The nucleic acid molecule is capable of mediating RNA interference with IL-33 gene expression, and is preferably siRNA. "Target protein" refers to a protein whose regulation is desired.
[0148] A "target nucleic acid" (sometimes called a "target sequence") refers to a nucleic acid that can be targeted by a nucleic acid molecule.
[0149] "Target segment" means the sequence of nucleotides of a target nucleic acid that is targeted by the siRNA or nucleic acid molecule of the present invention.
[0150] "Nucleic acid base sequence" refers to a continuous sequence of nucleic acid bases independent of any sugar moiety, binding site, or modified nucleic acid base. "Nucleoside" refers to a compound in which a nucleic acid base and a sugar moiety are bonded. "Ribonucleoside" refers to a nucleoside in which the sugar moiety is ribose. "Deoxyribonucleoside" refers to a nucleoside in which the sugar moiety is D-2-deoxyribose. "Nucleotide" refers to a compound in which a phosphate group is bonded to the sugar moiety of a nucleoside. "Oligononucleotide" refers to a compound having a structure in which nucleotides are polymerized by phosphodiester bonds or modified phosphodiester bonds. Naturally occurring oligonucleotides include, for example, 2'-deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and oligonucleotides in which the sugar moiety, phosphate moiety, or nucleic acid base moiety are modified independently of each other.
[0151] RNA interference (RNAi) refers to sequence-specific post-transcriptional gene silencing in animals mediated by small interfering RNA (siRNA). It has been reported that intracellular RNAi responses are induced by double-stranded RNA (dsRNA). Certain intracellular dsRNAs are affected by the enzymes Dicer and ribonuclease III. Dicer can cleave dsRNA into short fragments, producing siRNA.
[0152] siRNA is known to be involved in the endonuclease complex, which is part of the RNA-induced silencing complex (RISC). siRNA possesses an AS (also called the guide strand) that is incorporated into the RISC, and this AS mediates the cleavage of target mRNA with a complementary sequence. The other strand of the AS in siRNA is called the SS (also called the passenger strand). Cleavage of the target nucleic acid occurs near the region complementary to the AS of the siRNA. siRNA has been reported to downregulate or knock down gene expression by mediating sequence-specific RNA interference.
[0153] A "double-stranded region (dsRNA)" refers to a region that has a double-stranded structure containing two complementary, antiparallel nucleic acid strands (sense strand / antisense strand).
[0154] The "sense strand (sometimes abbreviated as SS)" refers to the nucleotide sequence of a nucleic acid molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand of the nucleic acid molecule (for example, siRNA, and more specifically, siRNA capable of inhibiting IL-33 expression (hereinafter sometimes referred to as IL-33 siRNA). The same applies to the hereafter defined "nucleic acid molecule"). The sense strand of a nucleic acid molecule may include a nucleic acid sequence homologous to the base sequence of the target nucleic acid.
[0155] The “antisense strand (sometimes abbreviated as AS)” refers to the nucleotide sequence of a nucleic acid molecule that is partially or completely complementary to at least a portion of the base sequence of the target nucleic acid. The antisense strand of a nucleic acid molecule may include a nucleic acid sequence that is at least partially or completely complementary to the corresponding sense strand of the nucleic acid molecule. If the complementary region is not completely complementary to the target sequence (referred to as a “mismatch”), such mismatch may be located, for example, within the 10, 9, 8, 7, 6, 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.
[0156] "Complementarity" refers to the ability of an oligonucleotide or polynucleotide containing a second nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing a first nucleotide sequence to form a double-stranded structure under specific conditions (specifically, stringent conditions). Examples include the ability to form base pairs (hybridization) between the nucleic acid bases of the antisense strand of a nucleic acid molecule and the corresponding nucleic acid bases in the target nucleic acid, and the ability to form base pairs between the nucleic acid bases of the antisense strand of a nucleic acid molecule and the nucleic acid bases of the sense strand. Base pairs are formed by Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between the corresponding nucleic acid bases. Methods for determining whether the antisense strand and sense strand of a nucleic acid molecule, or the antisense strand of a nucleic acid molecule and the target nucleic acid, are specifically capable of hybridization are well known in the art. "Complementarity" is sometimes also referred to as "base complementarity."
[0157] "Complementary" nucleotide sequences may include base pairs formed from non-Watson-Crick base pairs, non-natural and modified nucleotides, as long as the requirements for hybridization are met. Examples of such non-Watson-Crick base pairs include, but are not limited to, G-U fluctuations and Hoogsteen-type base pairs.
[0158] The "subject" may include, but is not limited to, humans, non-human mammals (e.g., dogs, cats, rats, mice, rabbits, monkeys, chimpanzees, cows, horses, pigs, sheep, goats, etc.), birds (e.g., chickens), etc. The "subject" is preferably humans.
[0159] A "mismatched base (non-complementary nucleic acid base)" refers to a nucleic acid base of a first nucleic acid that cannot pair with the corresponding nucleic acid base of a second nucleic acid or target nucleic acid. Introducing a mismatched base into the antisense strand of a nucleic acid molecule involves (i) substituting some nucleic acid bases of the antisense strand with nucleic acid bases that cannot pair with the target nucleic acid, (ii) including some nucleic acid bases of the antisense strand with nucleic acid bases that cannot pair with the target nucleic acid, resulting in an increase in the length of the consecutive nucleotides by the amount of those nucleic acid bases (insertion), and (iii) in the complementary portion of the antisense strand and the target nucleic acid, the oligonucleotides of the antisense strand lack nucleic acid bases that can pair with the target nucleic acid, resulting in a decrease in the length of the consecutive nucleotides by the amount of those nucleic acid bases (deletion).
[0160] The term "equal-length portion" refers to the portion formed by the hybridization of the antisense strand of the nucleic acid molecule and the corresponding nucleic acid base of the target nucleic acid. If the mismatched base described above is not introduced into the antisense strand of the nucleic acid molecule, the length (number of nucleosides) of the nucleotides of the antisense strand and the target segment are the same. If the mismatched base described in (i) above is introduced into the antisense strand of the nucleic acid molecule, the length (number of nucleosides) of the nucleotides of the antisense strand and the target segment are the same. If the insertion described in (ii) above is introduced into the antisense strand of the nucleic acid molecule, the equal-length portion of the target nucleic acid is shorter than the nucleotides of the antisense strand by the amount of the insertion base (also referred to as having a reduced number of nucleosides). If the deletion described in (iii) above is introduced into the antisense strand of the nucleic acid molecule, the equal-length portion of the target nucleic acid is longer than the nucleotides of the antisense strand by the amount of the deletion base (also referred to as having an increased number of nucleosides).
[0161] "Expression" may refer to gene expression or target protein expression. The presence or level of such expression can be measured by the methods described in the examples of this specification, or by methods known to those skilled in the art. Expression includes all functions by which the information encoded by a gene is converted into structures that exist and function within the cell. Such structures may include, but are not limited to, the products of transcription and translation.
[0162] "Inhibition" means that a certain event is reduced compared to a control condition. For example, it means that the level of gene expression or mRNA encoding one or more proteins, or the activity of one or more encoded proteins, measured in the presence of nucleic acid molecules, is lower than the activity measured in the absence of nucleic acid molecules.
[0163] For example, the level of expression, mRNA level, or encoded protein activity level is reduced by at least approximately 5%, at least approximately 10%, at least approximately 30%, at least approximately 50%, at least approximately 70%, at least approximately 90%, and at least approximately 95% compared to the activity level observed in the absence of the nucleic acid molecule. Note that "inhibit" can also be expressed as "suppress" or "downregulate."
[0164] When describing a product as "inhibiting IL-33 expression," it may also include "inhibiting IL-33 mRNA expression," and vice versa.
[0165] The nucleic acid molecule of the present invention is a compound capable of regulating the expression of IL-33 or IL-33 mRNA.
[0166] "Expression regulation" refers to the ability of oligonucleotides to alter the amount of IL-33 protein or IL-33 mRNA compared to the amount of IL-33 or IL-33 mRNA before administration of the nucleic acid molecule. Expression regulation is determined by comparison with a control. One form of "regulation" is understood as the ability of oligonucleotides to inhibit, downregulate, reduce, suppress, remove, stop, block, prevent, decrease, reduce, avoid, or terminate IL-33 expression, for example, by degrading or blocking the translation of IL-33 mRNA.
[0167] "Modified nucleotides" refer to nucleotides having modifications to the sugar group of a nucleotide, modifications to the internucleoside bond, modifications to the nucleic acid base of a nucleotide, and / or modifications to the structure of one or more nucleotides at the end of a nucleic acid molecule, or combinations thereof. "Modification of sugar group" refers to substitution, conversion, etc., from the natural sugar portion.
[0168] A "modified oligonucleotide" refers to an oligonucleotide containing at least one modified nucleoside bond, modified sugar, modified nucleic acid base, etc.
[0169] A nucleotide is a nucleoside containing a phosphate group covalently bonded to the sugar portion of the nucleoside. In nucleosides containing pentofuranosyl sugars, the phosphate group can be bonded to the 2', 3', or 5' hydroxyl portion of the sugar. Oligonucleotides are formed through covalent bonds between adjacent nucleosides, forming linear polymers. Within the oligonucleotide structure, the phosphate group typically forms internucleoside bonds. "Internucleoside bond" refers to a chemical bond between nucleosides. The natural internucleoside bond in RNA or DNA is a 3'-to-5' phosphodiester bond. Oligonucleotides having one or more modified internucleoside bonds may be used to obtain desirable properties such as high intracellular uptake, high affinity for target nucleic acids, and high stability in the presence of nucleases.
[0170] "5'-vinylphosphonate modified nucleotide" is a nucleotide with -CH at the 4' position. 2 The OH group is -CH=CH-P(O)(OH) 2 This refers to a modified nucleotide, where a base has been substituted. "5'-vinylphosphonate modified nucleotide" is sometimes also called "4'-vinylphosphate modified nucleotide."
[0171] The "5'-phosphorus stabilization moiety" refers to a nucleotide structure in which a phosphate residue containing a phosphate ester or modified phosphate ester (e.g., phosphorothioate, phosphodiester, etc.) is substituted at the 5' end. Examples of the 5'-phosphorus stabilization moiety structure are shown in the following formulas (PSt1) to (PSt3): Examples of substructures represented by the formula [wherein Base represents a nucleic acid base; X represents any substituent; Y represents a hydrogen atom, alkyl group, hydroxyl group protecting group, etc. (excluding the area outside the dashed line)] include, but are not limited to, these.
[0172] A "crosslinked nucleotide" refers to any nucleotide in which the sugar portion (ribofuranose ring) of the nucleic acid is crosslinked with a methylene group or the like. For example, "LNA," one type of "crosslinked nucleotide," is a ribonucleotide (RNA) where the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked with methylene (4'-CH 2 This refers to a cross-linked modified nucleic acid (Locked Nucleic Acid) in which ribose is immobilized by an O-2' cross-linking mechanism. For example, its nucleoside structure is given by the following formula: [In the formula, Base represents a nucleic acid base; outside the dashed line, it can be bound to other nucleosides via phosphodiester bonds, etc.]. Examples of cross-linking nucleotides other than LNA include ENA (4'-(CH4). 2 ) 2 -O-2' bridge), cEt(4'-CH(CH 3 )-O-2' bridge), AmNA(4'-C(=O)-N(CH 3 )-2' cross-linked), scpBNA (4'-C(-CH 2 CH 2 (-)-O-2' bridges) and other similar structures are known.
[0173] "Acyclic nucleotides" refer to any nucleotide having an acyclic ribose sugar, which is formed by modifying the ribose ring, the main chain structure of a nucleotide, into an acyclic structure. Specifically, acyclic nucleotides are, for example, those represented by the following formulas (Ncn1) to (Ncn3): [In the formula, Base is a nucleic acid base; R 1 and R 2 These are independently hydrogen atoms, halogen atoms, alkyl groups, and -OR groups. 3 and R 3 is a hydrogen atom, alkyl, C 3-8 Cycloalkyl, C 6-10 Examples include, but are not limited to, substructures represented by [aryl, aralkyl, heteroaryl, or sugar; capable of binding to other nucleotides outside the dashed line]. In this specification, formula (Ncn-1) may also be referred to as serinol nucleic acid (SNA).
[0174] Unless otherwise specified, "alkyl" refers to groups such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, and hexyl, but is not limited to these. Also, unless otherwise specified, "alkyl" includes linear or branched groups. 1-18 "Alkyl" refers to a linear or branched alkyl group having 1 to 18 carbon atoms, and in addition to the alkyl groups exemplified above, heptyl (C) 7 ), Octyl (C 8 ), nonil (C 9 ), Decyl (C 10 ), Undecyl (C 11 ), dodecyl (C 12 ), tridecyl (C 13 ), tetradecyl (C 14 ), pentadecyl (C 15 ), hexadecyl (C 16 ), heptadecyl (C 17 ), octadecyl (C 18 Examples of groups include the following. The alkyl group may be substituted with, for example, one to three halogens, alkoxy (-O-alkyl), cyano, nitro, etc.
[0175] "Aryl" or "C" 6-10 Unless otherwise specified, "aryl" refers to groups such as phenyl, naphthyl, and indanyl, but is not limited to these. Unless otherwise specified, "heteroaryl" refers to 5-6 membered unsaturated heterocycles such as triazolyl, pyridyl, pyridadinyl, pyrimidinyl, and pyrazinyl, but is not limited to these. "Aralkyl" refers to a group in which "aryl" is substituted with "alkyl," and unless otherwise specified, refers to groups such as benzyl and phenethyl, but is not limited to these. 3-8 "Cycloalkyl" refers to a cyclic alkyl group having 3 to 8 carbon atoms, and unless otherwise specified, examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. The aforementioned aryl, heteroaryl, aralkyl or C 3-8The cycloalkyl group may be substituted with, for example, one to three halogens, alkoxy (-O-alkyl), cyano, or nitro atoms.
[0176] Unless otherwise specified, "halogens" include, but are not limited to, fluorine atoms, chlorine atoms, bromine atoms, and iodine atoms.
[0177] Unless otherwise specified, "alkylene" is defined by formula - (CH 2 ) n This refers to a group represented by - (for example, n = 1 to 18). 1-18 Specifically, "alkylene" includes, but is not limited to, methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, 2-(ethyl)trimethylene, 1-(methyl)tetramethylene, heptylene, octylene, nonylene, decylene, undecylene, dodecylene, tridecylene, tetradecylene, pentadecylene, etc. The hydrogen atoms of the alkylene may be substituted with, for example, one to three halogens, alkoxy (-O-alkyl), cyano, nitro, etc.
[0178] "Diseases or symptoms in which IL-33 is suspected to be involved" include, but are not limited to, the diseases or symptoms listed in "8. Diseases or symptoms involving IL-33" below.
[0179] "Effective dose" refers to the amount of siRNA that is effective in achieving the desired pharmacological, prophylactic, therapeutic, or inhibitory effect.
[0180] "Pharmacologically acceptable carrier" refers to a carrier for administering a prophylactic or therapeutic drug.
[0181] Unless otherwise specified, "improvement" means a change in the state of the disease or symptoms, prevention or delay of the worsening of the disease or symptoms, reversal, prevention or delay of the progression of the disease or symptoms, or treatment of the disease or symptoms.
[0182] Unless otherwise specified, "prevention" means preventing or delaying the onset of a disease or symptom in the subject, or reducing the risk of developing a disease or symptom.
[0183] Unless otherwise specified, "treatment" means any treatment of a disease or symptom in the subject (e.g., improvement of the disease or symptom, reduction of the disease or symptom, recovery from the disease or symptom, alleviation of the disease or symptom, suppression of the progression of the disease or symptom, etc.). It may also include preventing the onset and / or progression of the disease or symptom in the subject.
[0184] The term "approximately" may include values up to ±20% of the given value, preferably up to ±10%. For example, when stating "IL-33 expression was inhibited by approximately 80%", the level of inhibition may include inhibition within the range of 64% to 96%, preferably within the range of 72% to 88%.
[0185] "Substantially" means that the scope or degree of what is being covered is complete or nearly complete. For example, "substantially all" means 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.
[0186] 1. Nucleic Acid Molecules that Inhibit IL-33 Expression The nucleic acid molecules of the present invention have inhibitory activity against IL-33 expression and contain a nucleic acid base sequence complementary to the IL-33 mRNA transcribed from the gene encoding IL-33. Furthermore, the nucleic acid molecules of the present invention can downregulate the expression of the gene encoding IL-33. Furthermore, the nucleic acid molecules of the present invention contain a nucleotide sequence that can mediate the silencing of IL-33 gene expression. In some embodiments, the nucleic acid molecules of the present invention have a double-stranded region (dsRNA) of 19 to 23 nucleotides in length, and include a sense strand of 19 to 23 nucleotides in length and an antisense strand of 19 to 23 nucleotides in length. One embodiment of the nucleic acid molecules of the present invention is siRNA, and the description of nucleic acid molecules herein also applies to siRNA.
[0187] In some embodiments, the double-stranded region of the nucleic acid molecule of the present invention may contain 19 or more, 20 or more, 21 or more, 22 or more, or 23 or more base pairs; 23 or less, 22 or less, 21 or less, 20 or less, 19 or less; or 19, 20, 21, 22, or 23 base pairs.
[0188] Generally, the majority of nucleotides in the sense and antisense strands are ribonucleotides, but one or both of these strands may contain at least one non-ribonucleotide, such as a deoxyribonucleotide and / or a modified nucleotide.
[0189] In some embodiments, the nucleic acid molecule of the present invention may have a continuous region of 21 to 23 nucleotides in length of antisense strands in its double-stranded region, which is complementary to the sequence of IL-33 mRNA transcribed from the gene encoding IL-33.
[0190] In some embodiments, the nucleic acid molecule of the present invention may have a continuous region of 21 to 23 nucleotides in length of antisense strand that is complementary to the sequence of IL-33 mRNA transcribed from the gene encoding IL-33.
[0191] In some embodiments, the antisense strand of the nucleic acid molecule of the present invention may have a nucleotide length of 19 or more, 20 or more, 21 or more, 22 or more, 23 or more; 23 or less, 22 or less, 21 or less, 20 or less, 19 or less; 19, 20, 21, 22, or 23, and the sense strand may have a nucleotide length of 19 or more, 20 or more, 21 or more, 22 or more, 23 or more; 23 or less, 22 or less, 21 or less, 20 or less, 19 or less; 19, 20, 21, 22, or 23.
[0192] The sense strand of the nucleic acid molecule of the present invention is SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 ,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,246,247,248,249,250,251,252,253,254,255,256,257,258,259,260 ,261,262,263,264,265,266,267,268,269,270,271,272,273,274,275,306,307,308,309,310,311,313,314,315,316,317,318,319,320,321,322,323,324,325,326,327,328,329,330,331,332,333,334,335,336,337,338,339,340,341,342,343,345,346,347,348,349 It may contain 19, 20, 21, 22, or 23 consecutive nucleotides as shown in 350, 351, 352, 353, 355, 356, 357, 358, 359, 360, 361, 401, 403, 404, 405, 406, 408, 410, 411, 412, 414, 415, 416, 417, 418, 419, 420, 421, 423, 424, 425, 426, 428, 429, 430, 431, 432, 434, 436, 437, 438, 439, 440, 441, 442, 443, or 445.
[0193] The antisense chain of the nucleic acid molecule of the present invention is SEQ ID NOs: 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181 ,182,183,184,185,186,187,188,189,190,191,192,193,194,195,196,197,198,199,200,201,202,203,204,205,206,207,208,209,210,211,212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 2 44, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 3 62, 363, 364, 365, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 39 5, 396, 397, 399, 400, 446, 447, 449, 450, 451, 452, 453, 454, 456, 457, 458, 460, 461, 462, 463, 464, 465, 466, 468, 469, 470, 471, 472, 473, 474, 475, 476 ,477,478,480,481,482,483,484,485,486,487,488,489,490,491,493,494,495,496,497,498,499,500,501,502,505,506,507,508,509,510,511,It may contain 19, 20, 21, 22, or 23 consecutive nucleotides as shown in 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 531, 532, 533, 534, or 535.
[0194] In one embodiment, the sense strand and antisense strand of a nucleic acid molecule may consist of nucleic acid base sequences or fragments thereof represented by the following sequence number combinations. (Sense chain: Antisense chain) = (SEQ ID NO: 4: SEQ ID NO: 125), (SEQ ID NO: 5: SEQ ID NO: 126), (SEQ ID NO: 6: SEQ ID NO: 127), (SEQ ID NO: 7: SEQ ID NO: 128), (SEQ ID NO: 8: SEQ ID NO: 534), (SEQ ID NO: 68: SEQ ID NO: 189), (SEQ ID NO: 71: SEQ ID NO: 192), (SEQ ID NO: 72: SEQ ID NO: 193), (SEQ ID NO: 73: SEQ ID NO: 194), (SEQ ID NO: 74: SEQ ID NO: 195), (SEQ ID NO: 75: SEQ ID NO: 196), (SEQ ID NO: 76: SEQ ID NO: 197), (SEQ ID NO: 85: SEQ ID NO: 206), (SEQ ID NO: 91: SEQ ID NO: 212), (SEQ ID NO: 113: SEQ ID NO: 234), (SEQ ID NO: 246: SEQ ID NO: 276), (SEQ ID NO: 247: SEQ ID NO: 277), (SEQ ID NO: 248: SEQ ID NO: 278), (SEQ ID NO: 249: SEQ ID NO: 279), (SEQ ID NO: 250: SEQ ID NO: 280), (SEQ ID NO: 252: SEQ ID NO: 282), (SEQ ID NO: 254: SEQ ID NO: 284), (Array Number 259: Sequence ID 289), (Sequence ID 265: Sequence ID 295), (Sequence ID 273: Sequence ID 303), (Sequence ID 405: Sequence ID 452), (Sequence ID 405: Sequence ID 453), (Sequence ID 408: Sequence ID 457), (Sequence ID 408: Sequence ID 458), (Sequence ID 411: Sequence ID 277), (Sequence ID 411: Sequence ID 462), (Sequence ID 411: Sequence ID 463), (Sequence ID 411: Sequence ID 464), (Sequence ID 411: Column number 465), (Sequence ID 411:Sequence ID 468), (Sequence ID 416:Sequence ID 476), (Sequence ID 416:Sequence ID 477), (Sequence ID 423:Sequence ID 279), (Sequence ID 423:Sequence ID 480), (Sequence ID 423:Sequence ID 482), (Sequence ID 423:Sequence ID 484), (Sequence ID 423:Sequence ID 485), (Sequence ID 423:Sequence ID 486), (Sequence ID 423:Sequence ID 489), (Sequence ID 423:Sequence ID 490).
[0195] In some embodiments, the nucleic acid molecule of the present invention comprises a sense strand selected from the sequences shown in Tables 2-1 to 2-6 and Tables 3-1 to 3-14, or 19, 20, 21, 22, or 23 nucleotide fragments thereof, and an antisense strand selected from the sequences shown in Tables 2-1 to 2-6 and Tables 3-1 to 3-14, or 19, 20, 21, 22, or 23 nucleotide fragments thereof.
[0196] The nucleic acid molecule of the present invention may have a blunt end. The nucleic acid molecule of the present invention may have one or more 3' overhangs.
[0197] The nucleic acid molecule of the present invention is a compound that, when administered to a target, can inhibit the expression of IL-33 or the expression of the gene encoding IL-33 in the target cells, tissues, organs, etc. Therefore, as a result of administration, the expression of IL-33 in the target cells, tissues, organs, etc. can be inhibited, thereby inhibiting the action of IL-33.
[0198] In some embodiments, the nucleic acid base sequence of the antisense strand of the nucleic acid molecule of the present invention has complementarity to the isolength portion of the gene (mRNA) encoding IL-33 (SEQ ID NO: 1) of, for example, at least 80%, at least 85%, at least 90%, at least 95%, or 100%; preferably at least 85%, at least 90%, at least 95%, or 100%; more preferably at least 90%, at least 95%, or 100%.
[0199] The antisense or sense strand of a nucleic acid molecule can have its continuous nucleotide length increased or decreased, and it is also possible to introduce mismatched bases (non-complementary nucleic acid bases) while maintaining activity.
[0200] The antisense strand of the nucleic acid molecule of the present invention may contain nucleotide sequences in the isolength portion of the mRNA encoding the target nucleic acid IL-33 (SEQ ID NO: 1) that have complete complementarity (100%) or substantial complementarity (for example, at least 80% to 100%, at least 85% to 100%, at least 90% to 100%, or at least 95% to 100%) with consecutive nucleic acid bases in the nucleotide sequence. "Consecutive nucleic acid bases" refers to nucleic acid bases that are directly adjacent to each other.
[0201] In some embodiments, the nucleic acid molecules of the present invention can inhibit the expression of IL-33 mRNA by, for example, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, and about 95% or more. The degree of inhibition of IL-33 mRNA expression can be considered as the inhibition rate of IL-33 expression.
[0202] The inhibition rates of IL-33 expression are, for example, approximately 5-100%, 15-100%, 30-100%, 50-100%, 70-100%, 80-100%, and 90-100%. In the examples described later, the degree of inhibition of IL-33 mRNA expression (the degree of inhibition of IL-33 expression) is confirmed by measuring the expression level of IL-33 mRNA in cells.
[0203] The nucleic acid molecule of the present invention exhibits an IC50 of less than approximately 1000 pM in in vitro tests. 50 It possesses the ability to advantageously inhibit the expression of mRNA encoding IL-33. Furthermore, some of these can inhibit the expression level of mRNA encoding IL-33 by at least approximately 80%.
[0204] In some embodiments, the nucleic acid molecule of the present invention is, for example, a highly active IC at less than about 1000 pM, less than about 500 pM, less than about 300 pM, or less than about 100 pM. 50 It has a value that can inhibit the expression of IL-33 mRNA.
[0205] Nucleic acid molecules can be constructed from separate polynucleotide chains (SS and AS). The SS and AS are at least partially complementary. The SS and AS can form a double-stranded region having, for example, 19 to 23 base pairs.
[0206] The nucleic acid molecule of the present invention can target the gene encoding IL-33. For example, any homologous sequence of the gene encoding IL-33 can be targeted using a complementary sequence or a sequence incorporating a non-standard base pair (e.g., a mismatched base pair).
[0207] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 23, and the nucleic acid base sequence of the AS is such that, in the nucleic acid base sequence of Sequence ID No. 1 (human IL-33 mRNA nucleic acid sequence (GenBank accession number: NM_033439.4)), counting from the 5' position, for example, 108, 111, 114, 118, 121, 126, 143, 148, 152, 180, 182, 188, 190, 191, 192, 194, 196, 219, 221, 228, 254, 288, 290, 292, 295, 298, 300, 302, 305, 307, 310, 312, 316, 322, 326, 328, 330, 332, 337, 340, 361, 366, 368, 372, 375, 377, 380, 382, 386, 390, 392, 395, 397, 421, 424, 428, 430, 436, 446, 451, 54, 458, 62, 464, 465, 467, 468, 469, 470, 519, 520, 522, 524 ,529,530,531,532,536,538,546,582,583,584,585,586,594,596,602,604,607,608,609,610,612,616,620,657,659,660,662,664,684,688,691,694,698,702,703,704,732,733,734,735,736, The bases starting at positions 737, 740, 746, 748, 750, 752, 754, 758, 760, 762, 766, 776, 779, 784, 785, 787, 790, 793, 795, or 842 are complementary by 19 to 23 lengths. The complementarity is, for example, approximately 80% to 100%, 85% to 100%, 90% to 100%, or 95% to 100%.
[0208] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 23, and the nucleic acid base sequence of the AS is the nucleic acid base of SEQ ID NO: 1 (human IL-33 mRNA nucleic acid sequence (GenBank) Accession number: NM_033439.4) For example, 108-130, 111-133, 114-136, 118-140, 121-143, 126-148, 143-165, 148-170, 152-174, 180-202, 182-204, 188-210, 190-212, 191-213, 192-214, 194-216, 196-218, 219-241, 221-243, 228-250, 254-276, 288-310, 290-312, 292-314, 29 5-317, 298-320, 300-322, 302-324, 305-327, 307-329, 310-332, 312-334, 316-338, 322-344, 326-348, 328-350, 330-352, 332-354, 337-359, 340-362, 361-383, 366-388, 368-390, 372-394, 375-397, 377-399, 380-402, 382-404, 386-408, 390-412, 392-414, 395-417, 397- 419, 421-443, 424-446, 428-450, 430-452, 436-458, 446-468, 451-473, 54-476, 458-480, 462-484, 464-486, 465-486, 467-486, 468-490, 469-490, 470-490, 470-492, 472-490, 519-541, 520-541, 522-544, 524-544, 529-551, 530-551, 531-553, 532-551, 532-553, 536-55 8, 538-560, 546-568, 582-604, 583-604, 584-604, 585-604, 586-608, 594-616, 596-618, 602-624, 604-626, 607-629, 608-629, 609-629, 610-632, 612-634, 616-638, 620-642, 657-679, 659-681, 660-681, 662-684, 664-686, 684-706, 688-710, 691-713, 694-716, 698-720,702-724, 703-724, 704-724, 732-754, 733-755, 734-755, 734-756, 735-755, 735-757, 736-755, 736-758, 737-757, 737-759, 740-762, 746-768, 748-770, 750-772 These bases are complementary to the base portions 752–774, 754–776, 758–780, 760–782, 762–784, 766–788, 776–798, 779–801, 784–806, 785–806, 787–806, 790–812, 793–815, 795–817, or 842–864. Furthermore, this complementarity is, for example, approximately 80%–100%, 85%–100%, 90%–100%, or 95%–100%.
[0209] IL-33 may include IL-33 derived from any species. Examples of species include humans or non-human mammals (dogs, cats, rats, mice, monkeys, cattle, horses, pigs, sheep, etc.), preferably humans or non-human mammals (rats or mice), and more preferably humans.
[0210] 2. Modification The antisense strand (AS) and sense strand (SS) of the nucleic acid molecule of the present invention may each independently contain at least one modified nucleotide (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.). Such modifications may yield properties such as increased gene silencing activity and potency. Specifically, it may be possible to obtain siRNA with excellent serum stability without loss of siRNA activity (potency), or siRNA with reduced off-target effects.
[0211] In some embodiments, the present invention may provide nucleic acid molecules having various modifications (including chemical modifications) that can enhance the stability and potency of the nucleic acid molecules.
[0212] The nucleic acid molecules of the present invention may have chemical modifications in the antisense strand (AS) or sense strand (SS), such as "modification of the sugar group of the nucleotide," "modification of the internucleoside bond," or "modification of the nucleic acid base of the nucleotide." In some embodiments, the chemical modifications in the nucleic acid molecule can be included in all oligonucleotides of the nucleic acid molecule.
[0213] Modifications of the sugar group of a nucleotide include, but are not limited to, 2'-deoxynucleotides, 2'-O-alkyl-modified nucleotides, 2'-deoxy-2'-fluoro-modified nucleotides, debasalized nucleotides, or any combination thereof. Preferably, the modification of the sugar group of a nucleotide is a 2'-deoxynucleotide, a 2'-O-methyl (2'-OMe)-modified nucleotide, a 2'-fluoro (2'-F)-modified nucleotide, or any combination thereof.
[0214] Modifications of nucleoside bonds include, but are not limited to, phosphorothioate bonds, phosphorodithioate bonds, boranophosphate bonds, or any combination thereof. Preferably, the modification of the nucleoside bond is a phosphorothioate bond or a phosphorodithioate bond.
[0215] In some embodiments, the nucleic acid molecule of the present invention may have an antisense strand (AS) and a sense strand (SS) in which positions 1 and 2 from the 5' end of the AS and / or positions 1 and 2 from the 3' end are modified with phosphorothioate bonds, and positions 1 and 2 from the 5' end of the SS and / or positions 1 and 2 from the 3' end are also modified with phosphorothioate bonds.
[0216] In some embodiments, the nucleic acid molecule of the present invention may have an antisense strand (AS) and a sense strand (SS) in which positions 1 and 2 from the 5' end of the AS and / or positions 1 and 2 from the 3' end are modified by phosphorodithioate bonds, and positions 1 and 2 from the 5' end of the SS and / or positions 1 and 2 from the 3' end are also modified by phosphorodithioate bonds.
[0217] In some embodiments, the nucleic acid molecule of the present invention may have an antisense strand (AS) and a sense strand (SS) in which positions 1 and 2 from the 5' end of the AS and / or positions 1 and 2 from the 3' end are modified with phosphorothioate bonds and phosphorodithioate bonds, and positions 1 and 2 from the 5' end of the SS and / or positions 1 and 2 from the 3' end are modified with phosphorothioate bonds and phosphorodithioate bonds.
[0218] The nucleic acid bases of the nucleotides constituting the oligonucleotide are not particularly limited, but for example, adenine (A), guanine (G), thymine (T), cytosine (C), uracil (U), inosine (I), 2'-O-methyl-2-aminoadenosine-3'-phosphate, hypoxanthine, or modified nucleic acid bases thereof can be used.
[0219] Modifications of the nucleic acid bases of nucleotides include, but are not limited to, 2-aminoadenosine, 5-alkylcytosine, 5-alkyluracil, or any combination thereof.
[0220] In some embodiments, the nucleic acid molecules of the present invention may include, for example, nucleic acid molecules having modifications at the 5' end, 3' end, or both ends of the AS or SS.
[0221] In some embodiments, the nucleic acid molecule of the present invention may have multiple deoxynucleotides (e.g., deoxythymidine (t), inverted debasic deoxyribose (invAb)) attached to the 3' end of AS or SS.
[0222] In some embodiments, the nucleic acid molecule of the present invention may have an inverted non-basic nucleotide (invAb) attached to the 5' or 3' end of the SS.
[0223] In some embodiments, the nucleic acid molecules of the present invention may include, for example, nucleic acid molecules having modifications that result in a mismatch in complementarity between AS and SS.
[0224] The nucleic acid molecule of the present invention may include one or more overhangs from the double-stranded region formed from AS and SS. An overhang is a single-stranded region in which no base pairs are formed. In some embodiments, the length of the overhang may be, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. The overhang may be a 3'-terminal overhang at the 3' end of AS or SS having a single-stranded region of, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides, or a 5'-terminal overhang at the 5' end of AS or SS having a single-stranded region of, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. Furthermore, the lengths of each overhang may be the same or different.
[0225] The nucleic acid molecule of the present invention may have one or more blunt ends in which the double-stranded region ends without an overhang and the AS and SS bases are base-paired to the end of the double-stranded region. The nucleic acid molecule of the present invention may have one or more blunt ends, or one or more overhangs, or a combination of blunt ends and overhangs.
[0226] In some embodiments, the nucleic acid molecule of the present invention may contain at least one modified nucleotide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) within the double-stranded region formed by AS and SS.
[0227] In some embodiments, the nucleic acid molecule of the present invention is a nucleic acid molecule for inhibiting the expression of IL-33, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand and the antisense strand each independently comprises 19 to 29 nucleotides in length (preferably the sense strand being 19 to 21 nucleotides long and the antisense strand being 19 to 23 nucleotides long), wherein the sense strand and the antisense strand each comprises at least a nucleotide sequence selected from the sense strand and antisense strand combinations indicated by the identification numbers in Tables 2-1 to 2-6 and Tables 3-1 to 3-14, and the nucleic acid base sequence of the antisense strand has at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementarity with respect to the isolength portion of the mRNA encoding IL-33 (SEQ ID NO: 1). The nucleic acid molecule may comprise salts thereof or solvates thereof.
[0228] 3. Salts and Solvates The nucleic acid molecules of the present invention may form salts. Such salts are not particularly limited as long as they are pharmaceutically acceptable, but examples include alkali metal salts such as sodium salts, potassium salts, and lithium salts; alkaline earth metal salts such as calcium salts and magnesium salts; metal salts such as aluminum salts, iron salts, zinc salts, copper salts, nickel salts, and cobalt salts; ammonium salts; t-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts, ethylenediamine salts, N-methylglucamine salts, guanidine salts, diethylamine salts, triethylamine salts, dicyclohexylamine salts, N,N'-dibenzylethylenediamine salts, chloroprocaine salts, procaine salts, diethanolamine salts, and N-benzylphenethylamine salts. Examples include organic amine salts such as piperazine salts, tetramethylammonium salts, and tris(hydroxymethyl)aminomethane salt; hydrohalides such as hydrofluoric acid, hydrochloride, hydrobromide, and hydroiodide; inorganic salts such as nitrates, perchlorates, sulfates, and phosphates; lower alkanesulfonates such as methanesulfonates, trifluoromethanesulfonates, and ethanesulfonates; arylsulfonates such as benzenesulfonates and p-toluenesulfonates; organic salts such as acetates, malates, fumarates, succinates, citrates, tartrates, oxalates, and maleates; and amino acid salts such as glycine salts, lysine salts, arginine salts, ornithine salts, glutamates, and aspartates. These salts can be produced by known methods.
[0229] The nucleic acid molecules of the present invention, or salts thereof, may exist in non-solvated or solvated forms. In this specification, "solvate" means a molecular complex comprising the nucleic acid molecule of the present invention, or a salt thereof, and one or more pharmaceutically acceptable solvent molecules (e.g., water, ethanol, etc.). When the solvent molecule is water, it is specifically referred to as a "hydrate." These solvates can be prepared by known methods.
[0230] The description of nucleic acid molecules in this invention may include descriptions of salts of nucleic acid molecules, solvates of nucleic acid molecules, and solvates of salts of nucleic acid molecules.
[0231] 4. Nucleic acid molecules can also be bound with any functional molecule to enhance their activity, intracellular distribution, intracellular uptake, delivery to specific organs (target sites), etc. The functional molecule may be directly bound to the oxygen atom at the 3' position of the nucleotide at the 3' end of the oligonucleotide of the sense strand (SS) of the nucleic acid molecule, or to the oxygen atom at the 5' position of the nucleotide at the 5' end, or the functional molecule may be bound to the aforementioned site of the oligonucleotide of the SS via a binding group (e.g., a degradable group, a non-degradable group, etc.), or via a binding group and an optional linker. Methods for binding functional molecules to oligonucleotides can be found by referring to methods described in known literature, etc.
[0232] Functional molecules are not particularly limited, but they are molecules that, when bound, impart a desired function to nucleic acid molecules. Desired functions include, for example, delivery to target sites (various organs, tissues, cells, etc.). Functional molecules are not particularly limited, but include a wide variety of molecules such as lipids, proteins, peptides, antibodies, glycans, and small molecule compounds.
[0233] 5. Target nucleic acids of IL-33: Genes encoding IL-33 from species such as humans, rats, mice, and cynomolgus monkeys have been cloned and sequenced and are available from GenBank. As a nucleotide sequence encoding human IL-33, for example, the nucleic acid sequence of human IL-33 mRNA (GenBank accession number: NM_033439.4 [Homo sapiens interleukin 33 (IL33), transcript variant 1, mRNA]) (incorporated herein as SEQ ID NO: 1) is available; as a nucleotide sequence encoding cynomolgus monkey IL-33, for example, the nucleic acid sequence of cynomolgus monkey IL-33 mRNA (GenBank accession number: XM_005581767.3 [Macaca fascicularis interleukin 33 (IL33), transcript variant X1, mRNA]) (incorporated herein as SEQ ID NO: 2) is available; as a nucleotide sequence encoding mouse IL-33, for example, the nucleic acid sequence of mouse IL-33 mRNA (GenBank accession number: NM_133775.3 [Mus musculus interleukin 33 (IL33), transcript variant X1, mRNA]) is available; Variant 2, mRNA) (incorporated herein as Sequence ID No. 3), etc., are available, but are not limited to these. As reported sequences may change over time, those skilled in the art can incorporate the necessary changes into the nucleic acid molecules herein accordingly.
[0234] The nucleic acid molecule of the present invention is sequenced such that its antisense strand (AS) can complement (hybridize) at least one target region of a target nucleic acid to achieve the desired effect.
[0235] In some embodiments, the desired effect is, for example, a decrease in the expression level of IL-33, a decrease in the expression level of mRNA encoding IL-33, or a decrease in the amount of protein encoded by IL-33 mRNA, but is not limited to these.
[0236] The target region may contain one or more target segments. The antisense strand (AS) of a nucleic acid molecule can complement at least one target segment within the target region. Furthermore, the antisense strand (AS) of a nucleic acid molecule may complement multiple target segments.
[0237] In some embodiments, the target segment within the target region may consist of, for example, 10 to 20, 15 to 25, 19 to 29, or 20 to 30 nucleotides on the target nucleic acid, and may be the same length as or different from the nucleotide length of the antisense strand (AS) of the siRNA.
[0238] In some embodiments, a decrease in IL-33 mRNA expression indicates inhibition of IL-33 expression. A decrease in IL-33 protein expression indicates inhibition of IL-33 mRNA expression. For example, improvement, prevention, or treatment of diseases or symptoms involving IL-33 can be achieved by inhibiting IL-33 expression or IL-33 mRNA expression.
[0239] 6. Complementarity with Target Genes The antisense strand (AS) of the nucleic acid molecule of the present invention specifically hybridizes with the nucleic acid (mRNA) encoding the target nucleic acid IL-33 to form a double-stranded structure. The antisense strands of the nucleic acid molecule of the present invention become fully complementary or substantially complementary to each other if a sufficient number of their nucleic acid bases can form hydrogen bonds with the corresponding nucleic acid bases of the target nucleic acid. As a result, the desired effects described above are obtained.
[0240] In some embodiments, the complementary region of the AS of the nucleic acid molecule of the present invention has a nucleotide length of at least 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the complementary region includes 19, 20, 21, 22, or 23 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NOs: 125, 126, 127, 128, 129, 189, 192, 193, 194, 195, 196, 197, 206, 212, 234, 276, 277, 278, 279, 282, 284, 289, 295, 303, 452, 453, 457, 458, 462, 463, 464, 465, 468, 476, 477, 480, 482, 484, 485, 486, 489, 490, 534.
[0241] In some embodiments, the AS of the nucleic acid molecule of the present invention or a particular portion thereof is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the target nucleic acid, its target region, target segment, or particular portion.
[0242] The complementarity (%) between the AS of the nucleic acid molecule of the present invention and a certain region of the target nucleic acid can be calculated using known methods in the art. For example, if 18 of the 20 nucleic acid bases of the oligonucleotide contained in the AS complement the target region of the target nucleic acid and can specifically hybridize, then the AS will have a 90% complementarity.
[0243] In some embodiments, the AS of the nucleic acid molecule of the present invention or a specific portion thereof may be completely complementary (i.e., 100% complementary) to the target nucleic acid or a specific portion thereof. "Completely complementary (100% complementary)" means that each nucleic acid base of the AS can form a complete base pair with the corresponding nucleic acid base of the target nucleic acid.
[0244] Non-complementary nucleic acid bases (mismatched bases) may be located at the 5' or 3' end of the asthma nucleotide (AS), or they may be located within the AS. If two or more non-complementary nucleic acid bases are present, they may be consecutive or discontinuous.
[0245] In some embodiments, the antisense strand of the nucleic acid molecule of the present invention may contain, for example, four or fewer, three or fewer, two or fewer, or one or fewer non-complementary nucleic acid bases relative to the target nucleic acid or a specific portion thereof.
[0246] 7. Design and Manufacturing Method of Nucleic Acid Molecules When the nucleic acid molecule of the present invention is siRNA, the nucleic acid sequences of GenBank's human IL-33 mRNA (NM_033439.4), cynomolgus monkey IL-33 mRNA (XM_005581767.3), and mouse IL-33 mRNA (NM_133775.3) can be used. For example, the siRNA can be designed to contain an antisense strand with approximately 80% to 100% homology to each of these IL-33 genes.
[0247] siRNA according to one aspect of the present invention can be prepared by appropriately selecting a method known to those skilled in the art. For example, after synthesizing the antisense strand and sense strand according to the method described in the examples below, siRNA can be obtained by performing annealing according to a known method. Even when the nucleic acid molecule of the present invention is something other than siRNA, it can be prepared by appropriately selecting a method known to those skilled in the art.
[0248] 8. Diseases or symptoms suspected to be related to IL-33 IL-33 is expressed in cells, tissues, organs, etc. in the body, and a variety of diseases or symptoms can develop due to its physiological effects. Therefore, if the nucleic acid molecule of the present invention can be administered to target sites such as cells, tissues, organs, etc. in the body, thereby inhibiting the expression of IL-33 or the gene encoding IL-33 (IL-33 mRNA), it may be possible to prevent, improve, and / or treat diseases or symptoms suspected to be related to IL-33.
[0249] Diseases or symptoms in which IL-33 is suspected to be involved are not particularly limited, but include, for example, allergic inflammation, bronchial asthma, atopic dermatitis, allergic rhinitis, viral lung infections, chronic bronchitis, respiratory failure, rheumatoid arthritis, acute kidney injury, systemic sclerosis, hepatic fibrosis, dermatofibrosis, hepatic fibrosis, inflammatory bowel disease, arteriosclerotic disease, psoriasis, multiple sclerosis, hay fever, anaphylactic shock, sinusitis (including eosinophilic sinusitis), systemic lupus erythematosus, pemphigus, chronic obstructive pulmonary disease (COPD), Sjögren's syndrome, and cancer (e.g., brain tumors, laryngeal cancer). Examples of diseases or symptoms include oral and lip cancer, hypopharyngeal cancer, thyroid cancer, esophageal cancer, breast cancer, lung cancer, stomach cancer, adrenocortical cancer, bile duct cancer, gallbladder cancer, liver cancer, pancreatic cancer, bladder cancer, colorectal cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, Ewing's tumor, Hodgkin's disease, non-Hodgkin lymphoma, melanoma, mesothelioma, multiple myeloma, etc.), endometriosis, myasthenia gravis, sepsis, eosinophilic pneumonia, pneumonia and immunodeficiency due to SARS-CoV-2 infection, idiopathic pulmonary fibrosis, cystic fibrosis, age-related macular degeneration, periodontitis, uveitis, and chronic urticaria (see table below).
[0250]
[0251] 9. Composition, Preventive / Therapeutic Agent The present invention provides a pharmaceutical composition characterized by containing a nucleic acid molecule that inhibits the expression of IL-33 as an active ingredient.
[0252] In some embodiments, a pharmaceutical composition is provided characterized by containing at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient. Furthermore, the present invention can provide a pharmaceutical composition containing at least one nucleic acid molecule or salt thereof that inhibits IL-33 expression, or a solvate thereof, as an active ingredient, and further containing a pharmaceutically acceptable carrier.
[0253] A pharmaceutical composition according to one aspect of the present invention is useful for the prevention or treatment of diseases or symptoms related to IL-33. The pharmaceutical composition according to one aspect of the present invention can be administered to a subject in a sufficiently effective amount (therapeutic effective amount) to inhibit the expression of the IL-33 gene.
[0254] In some embodiments, pharmaceutical compositions are provided for preventing, improving and / or treating diseases or symptoms in which IL-33 is suspected to be involved, comprising at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient.
[0255] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, of the present invention is provided for the manufacture of agents for preventing, improving and / or treating diseases or conditions in which IL-33 is suspected to be involved.
[0256] In some embodiments, an agent for preventing, improving, and / or treating diseases or symptoms in which IL-33 is suspected to be involved is provided, characterized by containing at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient.
[0257] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided for the prevention, improvement and / or treatment of diseases or symptoms in which IL-33 is suspected to be involved.
[0258] In some embodiments, an IL-33 expression inhibitor is provided that contains (or comprises) at least one nucleic acid molecule or salt thereof, or a solvate thereof.
[0259] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, for inhibiting IL-33 expression are provided.
[0260] In some embodiments, the use of at least one nucleic acid molecule or salt thereof, or solvate thereof, as a pharmaceutical is provided.
[0261] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, of the present invention for the manufacture of pharmaceuticals is provided.
[0262] In some embodiments, the use of at least one nucleic acid molecule or salt thereof, or solvate thereof, as an IL-33 expression inhibitor is provided.
[0263] In some embodiments, a method is provided for preventing, improving and / or treating a disease or symptom in which IL-33 is suspected to be involved, comprising administering a nucleic acid molecule or salt thereof, or a solvate thereof, to a subject in need of prevention, improvement and / or treatment of the disease or symptom.
[0264] Treatment methods for diseases or symptoms suspected to involve IL-33 include administering a therapeutically effective amount of nucleic acid molecules targeting IL-33 to the patient in need of such treatment. The dosage of the nucleic acid molecule will be determined after considering the indications for the disease, the characteristics of the patient, etc., to ensure that a therapeutically effective amount is administered to the patient.
[0265] Examples of "pharmaceutically acceptable carriers" include, but are not limited to, sterile water, physiological saline, PBS, vegetable oil, solvents, bases, emulsifiers, suspending agents, surfactants, pH adjusters, stabilizers, flavoring agents, fragrances, excipients, vehicles, preservatives, binders, diluents, isotonic agents, analgesics, bulking agents, disintegrants, buffering agents, coating agents, lubricants, colorants, sweeteners, viscosity modifiers, flavor and odor modifiers, solubilizers, and other additives, as well as combinations thereof. Furthermore, such carriers may include, for example, inert solid diluents or fillers, sterile aqueous solutions, and various organic solvents.
[0266] The administration method of the composition containing the nucleic acid molecule of the present invention is not particularly limited as long as it is a pharmaceutically acceptable administration method, and examples include oral administration, intravenous administration, intra-arterial administration, intramuscular administration, intraperitoneal administration, subcutaneous administration, intradermal administration, intratissue administration, transdermal administration, intra-airway administration, transpulmonary administration, rectal administration, administration by intravenous fluid, and transnasal administration, which can be selected according to the treatment method.
[0267] The composition containing nucleic acid molecules of the present invention can be formulated by known pharmaceutical methods. The dosage form is not particularly limited and includes, for example, tablets, capsules, granules, fine granules, powders, pills, aerosols, inhalants, ointments, patches, topical preparations, transdermal preparations, lotions, suppositories, injections, lozenges, liquids, alcoholic preparations, suspensions, extracts, elixirs, lyophilized preparations, etc., which can be selected according to the method of administration.
[0268] The aqueous solvent that can be used to dissolve the nucleic acid molecules of the present invention is not particularly limited as long as it is pharmaceutically acceptable. Examples include aqueous solvents such as water for injection, distilled water for injection, electrolyte solutions such as PBS and physiological saline, glucose solution, and maltose solution.
[0269] The dosage of the composition of the present invention should preferably be adjusted considering the type of nucleic acid molecule contained in the present invention, the dosage form, the age, weight, and condition of the recipient, the route of administration, and the nature and severity of the disease or symptom. The dosage may also vary depending on the type of disease or symptom targeted, the form of administration, and the target molecule. Furthermore, the number of administrations will be appropriately selected depending on whether it is for prevention or treatment.
[0270] The nucleic acid molecule of the present invention is expected to be a nucleic acid molecule that can improve, for example, activity level, stability, toxicity, resistance to enzymatic degradation, target tissue targeting, intracellular distribution, cytoplasmic distribution, pharmacokinetics, and administration method.
[0271] The present invention will be described in more detail below with reference to examples, but the embodiments of the present invention are not limited to the following examples.
[0272] (Example of siRNA production) Single-chain RNA was produced by solid-phase synthesis on a scale of 1 μmol using an NTS-M8 synthesizer (Nippon Techno Service Co., Ltd.), the corresponding phosphoramidite, and controlled-pore glass (Glen UnySupport® 1000, Glen Research) as a solid support. For solid-phase synthesis, a standard nucleoside phosphoramidite chemical reaction, as described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, was used. Furthermore, the iodine oxidizing agent solution was replaced with a solution of DDTT (CAS: 1192027-04-5) (pyridine / acetonitrile = 6 / 4) to introduce a phosphorothioate bond. The phosphorodithioate bond was introduced by replacing phosphoramidite with thiophosphoramidite.
[0273] Crude oligoribonucleotides were purified and deprotected using the Presep® DNA / RNA Type A reverse-phase solid-phase extraction column, following established procedures. Yield and concentration were determined by UV absorption of each RNA solution at a wavelength of 260 nm using a spectrophotometer (NanoDrop 1000, Thermo Fisher Scientific Inc.). Double-stranded RNA was generated by mixing equimolar solutions of complementary strands in water (0.1 mM), heating at 90°C for 5 minutes, and cooling to room temperature over approximately 30 minutes. The annealed RNA solutions were freeze-dried and stored in a freezer.
[0274] The manufactured siRNAs are shown in the table below by their identification numbers, along with the sequence information for their sense and antisense strands. In the table, identification numbers beginning with "ILN-" represent siRNAs consisting of a natural nucleic acid base sequence without chemical modification, while identification numbers beginning with "ILM-" represent siRNAs consisting of a nucleic acid base sequence with some or all chemical modification. In the table, the chemical structure (modified) sense strand (5'→3') or chemical structure (modified) antisense strand (5'→3') indicates the modification form of the sugar portion, nucleoside bond, or nucleic acid base portion of the oligonucleotide. The nucleic acid base sequence and the modified nucleic acid base sequence are described in the 5' to 3' direction. Furthermore, "U" in the table is represented as "T" in the sequence listing attached to this specification.
[0275]
[0276] (#1) This refers to the start position of the complementary region of the antisense strand of IL-33 siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1). (#2) This refers to the end position of the complementary region of the antisense strand of IL-33 siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1).
[0277]
[0278] (#1) This refers to the start position of the complementary region of the antisense strand of IL-33 siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1). (#2) This refers to the end position of the complementary region of the antisense strand of IL-33 siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1).
[0279] In the notation of nucleic acid base sequences and chemical structures in the examples, the nucleotide monomers used are represented by the following abbreviations: A is adenosine-3'-phosphate; C is cytidine-3'-phosphate; G is guanosine-3'-phosphate; U is uridine-3'-phosphate; I is inosine-3'-phosphate; A(2N) is 2'-O-methyl-2-aminoadenosine-3'-phosphate, represented by the following formula: And; a is 2'-deoxyadenosine-3'-phosphate; c is 2'-deoxycytidine-3'-phosphate; g is 2'-deoxyguanosine-3'-phosphate; t is thymidine-3'-phosphate; A(M) is 2'-O-methyladenosine-3'-phosphate; C(M) is 2'-O-methylcytidine-3'-phosphate; G(M) is 2'-O-methylguanosine-3'-phosphate; U(M) is 2'-O-methyluridine-3'-phosphate; A(F) is 2'-fluoroadenosine-3'-phosphate; C(F) is 2'-fluorocytidine-3'-phosphate; G(F) is 2'-fluoroguanosine-3'-phosphate; U(F) is 2'-fluorouridine-3'-phosphate; invAb is inverted debasic deoxyribose (inverted non-base nucleotide); C(SNA) is an acyclic nucleotide represented by the following formula (Serinol nucleic acid). acid: SNA): [The formula includes the phosphodiester bond between nucleosides] (when the substitution is at the 5' end of the sequence, a hydroxyl group is substituted at position 1 in the formula, and when the substitution is at the 3' end, a hydroxyl group is substituted at position 3 in the formula); A (SNA) is an acyclic nucleotide (serinol nucleic acid) represented by the following formula: [The formula includes the phosphodiester bond between nucleosides] (When the substitution is at the 5' end of the sequence, a hydroxyl group is substituted at position 1 in the formula; when the substitution is at the 3' end, a hydroxyl group is substituted at position 3 in the formula); G (SNA) is an acyclic nucleotide (serinol nucleic acid) represented by the following formula: [The formula includes the phosphodiester bond between nucleosides] (When the substitution is at the 5' end of the sequence, a hydroxyl group is substituted at position 1 in the formula; when the substitution is at the 3' end, a hydroxyl group is substituted at position 3 in the formula); U (SNA) is an acyclic nucleotide (serinol nucleic acid) represented by the following formula: [The formula includes the phosphodiester bond between nucleosides] (When the substitution is at the 5' end of the sequence, a hydroxyl group is substituted at position 1 in the formula; when the substitution is at the 3' end, a hydroxyl group is substituted at position 3 in the formula); U(VP) is a modified nucleotide (4'-vinyl phosphate-modified nucleotide) represented by the following formula: [Excluding the area outside the dashed line in the formula]; ^ indicates a phosphorothioate bond (5'-3' bond); ¥ indicates a phosphorodithioate bond (5'-3' bond). In nucleic acid base sequence notation, when "^" or "¥" is not indicated between two adjacent nucleosides, the internucleoside bond (5'-3' bond) between those two nucleosides is a phosphodiester bond.
[0280] (In vitro activity evaluation) 1. Evaluation of IL-33 mRNA expression suppression in human cells U-87 cells were used. Using Opti-MEM® (Thermo Fisher Scientific, catalog number 31985) as a medium, siRNA and LipofectamineRNAiMax (Thermo Fisher Scientific, catalog number 13778) were mixed and incubated at room temperature for 5 minutes, then added to a 96-well plate at a volume of 20 μL per well. Next, 100 μL of U-87 cells suspended in DMEM (high-glucose) medium containing 10% inactivated FBS, 100 U / mL penicillin, and 0.1 mg / mL streptomycin was added to 3.0 × 10⁶ wells per well. 4 Transfection was performed by adding the siRNA to form cells. Single-concentration experiments were conducted at 1 nM or 10 nM, and dose-response experiments were conducted at final siRNA concentrations ranging from 0.0002 to 1 nM or 0.002 to 10 nM. (37°C, 5% CO2) 2After culturing the cells for approximately 24 hours under these conditions, RNA was isolated from the cells, and the human IL-33 mRNA expression level was measured by real-time PCR. RNA was extracted from the cells using RNeasy® Mini Kit (QIAGEN, catalog number 74106), and cDNA was obtained by DNase treatment and reverse transcription reaction using SuperScriptIV VILO master mix (Thermo Fisher Scientific, catalog number 11766500). Using the obtained cDNA as a template, real-time PCR was performed using the QuantStudio® 3 Real-Time PCR System (Thermo Fisher Scientific). Human IL-33 and human B2M were measured using TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, catalog number 4444557) as the real-time PCR reagent and TaqMan® Gene Expression Assays (Thermo Fisher Scientific, one of catalog numbers 4331182, 4351372, 4351370, or 4351368) as the primer-probe set. The measurement results were analyzed using the ΔΔCt method with human B2M as the reference gene. The expression level (%) (ii) and expression inhibition rate (%) (100%-ii) were calculated, with the expression level (i) of human IL-33 mRNA in siRNA-untreated cells with only the transfection reagent added set to 100%. The expression level (%) (expression inhibition rate (%)) and IC of human IL-33 at 10 nM or 1 nM obtained by this method using the example compounds were calculated. 50 The values are listed in Tables 4-1 to 5-5.
[0281] (In vivo study) 1. Effect on bronchial asthma Mice in which bronchial asthma is induced by administration of ovalbumin (OVA) are used. The example compound of the present invention is administered transpulmonaryly at a frequency of once every week to once every month, and airway hyperresponsiveness, the number of inflammatory cells in bronchoalveolar lavage fluid (BALF), etc. are evaluated. The mice used are wild-type or hIL-33 knock-in mice (Common Name: B-hIL-33 mice, Stock Number: 110055) purchased from Biocytogene Pharmaceuticals (Beijing).
[0282] 2. Evaluation of mRNA expression in tissues IL-33 mRNA expression in mouse tissues (lung, liver, kidney) collected after administration of the example compounds was evaluated using real-time PCR. RNA was extracted from the tissues using TRIZOL® Reagent (Thermo Fisher Scientific, catalog number 15596) and RNeasy® Mini Kit (QIAGEN, catalog number 74106). Then, DNase treatment and reverse transcription were performed using SuperScriptIV VILO master mix (Thermo Fisher Scientific, catalog number 11766500) to obtain cDNA. Using the obtained cDNA as a template, real-time PCR was performed using the QuantStudio® 3 Real-Time PCR System (Thermo Fisher Scientific). TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, catalog number 4444557) was used as the real-time PCR reagent, and TaqMan® Gene Expression Assays (Thermo Fisher Scientific, one of catalog numbers 4331182, 4351372, 4351370, or 4351368) was used as the primer-probe set to measure human or mouse IL-33 and mouse B2M. The measurement results were analyzed using the ΔΔCt method with a reference gene, and the expression level of IL-33 mRNA was shown with the expression in the control animal set to 100%.
[0283] Accession Number 1: Human IL-33 mRNA 1 acagagctgc agctcttcag ggaagaaatc aaaacaagat cacaagaata ctgaaaaatg 61 aagcctaaaa tgaagtattc aaccaacaaa atttccacag caaagtggaa gaacacagca 121 agcaaagcct tgtgtttcaa gctgggaaaa tcccaacaga aggccaaaga agtttgcccc 181 atgtacttta tgaagctccg ctctggcctt atgataaaaa aggaggcctg ttactttagg 241 agagaaacca ccaaaaggcc ttcactgaaa acaggtagaa agcacaaaag acatctggta 301 ctcgctgcct gtcaacagca gtctactgtg gagtgctttg cctttggtat atcaggggtc 361 cagaaatata ctagagcact tcatgattca agtatcacag gaatttcacc tattacagag 421 tatcttgctt ctctaagcac atacaatgat caatccatta cttttgcttt ggaggatgaa 481 agttatgaga tatatgttga agacttgaaa aaagatgaaa agaaagataa ggtgttactg 541 agttactatg agtctcaaca cccctcaaat gaatcaggtg acggtgttga tggtaagatg 601 ttaatggtaa ccctgagtcc tacaaaagac ttctggttgc atgccaacaa caaggaacac 661 tctgtggagc tccataagtg tgaaaaacca ctgccagacc aggccttctt tgtccttcat 721 aatatgcact ccaactgtgt ttcatttgaa tgcaagactg atcctggagtgtttataggt 781 gttaaggata atcatcttgc tctgattaaa gtagactctt ctgagaattt gtgtactgaa 841 atatctgt ttaagctctc tgaaacttag ttgatggaaa cctgtgagtc ttgggttgag 901 aaccaatgaggaagtaga ctgtaag c gtgacatcta 961 agggaaatga agagtgctta gcatgtgtgg aatgttcc atattatgta taaaaatatt 1021 tttctaatc ctccagttat tctttatt ccctgtat aactgcatct tcaatacaag 1081 tatttaactaa tatcagcagtata gagatacagt 1141 ctgaccttta ctttctcta gttcagtcc agaaagaact tcatatttag agctaggcc 1201 actgaggaaa gagccatagc ttaagtctct atgtagacag ggatccattt taagagcta 1261 taggtaccactcaccagaaa aaaacactaga gctgctagta 1321 aaaagagac cagatgcttc acagaattat cattttca actggaataa aacaccaggt 1381 ttgttgtag atgtcttagg caacactcag agcagatctc ccttactgtc agggatatg 1441 gaggacagcattcagg tag gtgtgaaaaa gtaagataa 1501 ctaaaaaatt tagaaaata atccagtat ttgtaagtg ataacttca tttctaattg1561 tttaattttt aaaattctga ttttatata ttgagtttaa gcaaggcatt cttacacgag 1621 gaagtgaagt aaattttagt tcagacataa aatttcactt attaggaata tgtaacatgc 1681 taaaactttt ttttttaa agagtactga gtcattga catataatcc aactatcatg gtaaggccag aaatcttcta acctaccaga gcctagatga 1801 gacaccgaat taacattaaa atttcagtaa ctgactgtcc ctcatgtcca tggcctacca 1861 tcccttctga ccctggcttc cagggaccta tgtcttttaa cacatcagc 1921 aaagttgctt ctaatcctta tttcccatgt gcacaagtct ttttgtattc cagcttcctg 1981 ataacactgc ttactgtgga atattcattt gacatctgtc tcttttcatt tcttttaact 2041 accatgccct tgatatatct tttgcaccttg ctgaacctcttcctcctc1010 tggatgccaa aacgtttatt ctgctttgtc tgttgtagaa ttttagataa agctattaat 2161 ggcaatattt tttgctaaa cgtttttgtt ttttactgtc actagggcaa taaaatttat 2221 actcaaccat atataacat ttttaacta ctaaaggatt agttaact 2828 agcaatttct attacaactt ttcttagact taacacttat gataaatgac taacatagta 2341acagaatctt tatgaaatat gaccttttct gaaaatacat acttttacat ttctacttta 2401 ttgagaccta ttagatgtaa gtgctagtag aatataagat aaaagaggct gagaattacc 2461 atacaagggt attacaactg taaaacaatt tatctttgtt tcattgttct gtcaataatt 2521 gttaccaaag agataaaaat aaaagcagaa tgtatatcat cccatctgaa aaacactaat 2581 tattgacatg tgcatctgta caataaactt aaaatgatta ttaaataatc aaatatatct 2641 actacattgt ttatattatt gaataaagta tattttccaa atgta
[0284] Accession Number 2: Cynomolgus Monkey IL-33 mRNA 1 agagctgcag ctcttcaggg aagaaatcaa aacaagacca caagaagcct gaaaaatgaa 61 gcctaaaatg aagtattcaa ccaacaaaat ttccacagca aagcggaaga acacagcaag 121 caaagccttg tgtttcaagc tgggaaaatc ccaacagaag gccaaagaag tttgccacgt 181 gtactttatg aagctccgct ctggccttat gataaaaaag gaggcctgtt actttaggag 241 agaaaccacc aaaaggcctt cactgaaaac aggtggaaac cacaaaggac atctggtact 301 cgctgcctgt caacagcagt ctactgtgga gtgctttgcc tttggtatat caggggtccc 361 gaaatatact agagcacttc atgattcaag tatcacagga atttcaccta ttacagaatc 421 tcttgcttct ctaagcacat acaatgatca atccattact tttgctttgg aggatgaaag 481 ttatgagata tatgttgaag acttgaaaaa agataaaaag aaagataagg tgttactgag 541 ttactatgag tctcaacacc cctcaagtga atcaggtgat ggtgttgatg gtaagatgtt 601 aatggtaacc ctgagtccta caaaagactt ctggttgcaa gccaacaaca aggagcactc 661 tgtggagctc cataagtgtg aaaaaccact gccagaccag gccttctttg tccttcataa 721 taggtccttc aactgtgttt catttgaatg caagactgat cctggagtgtttataggtgt 781 aaaggataat catcttgctc tgattaaagt agactattct gagaatttgg gtagtgagaa 841 tatcttgttt aagctctctg aaatttagtt gatggaaact tgtgggtctt gggttgagta 901 cccaaatgct accactggag aaaggaatgaa agataaagaa agacagta acatctaagg 961 gaaacgaaga gtgcttagca tgctgtggaa tgtttcctt attatacata aaaatattt 1021 ttctaatgct tcagttctt tttctttcc ctctgtataa ctgcatattc aatgcaagta 1081 tcagtatatt aaatagggta ttggtaaaga aactgtcaac attctaaaga gatacaatct 1141 gactttcact tttctctagt ttcagtccag aaagaacttc acatttagag ctaaggccac 1201 tgaggagaga cagagccata gcttgtctct ctgtagacag ggatccattt taaagagcta 1261 cttagagaaa taattttcc ccgttccaaa caataggctc aaacactaga gctctagta 1321 aaaacaagac cagatgcttc acagagttat cattttttca actggaataa aacaccagct 1381 ttgtttgtag atgtcttagg caacactcag agcagctgtc ccttactgtc aggggatacg 1441 gaacttcaaa ggcccacatg gcaagccagg taacgtaaat gtgtgaaaaa gtaaaataa 1501 ttgaaaaatt aagacaaata aattcagtat ttaaaagtg aataacttca tttctaattg1561 tttaattttt aaaattctga ttcttatata ttgaatttac tttaagcaag gcattcttac 1621 attaggaagt gaattttagt tcagacataa aatttcattt attgggaata tgtaacatgc 1681 taaaactttt tttttttta aagtactaag ccacaacatg ttttagagca tccaggtacc 1741 acataattac aatccatggt aaggccagaa atcctctaac ctactacagc ctagatgaga 1801 caccgaatta acattaacat ttcagtaact gactgtccct catgttcatg gcctaccatc 1861 ccttctgacc ctggcttcca cagacctatg tcttttgata tactcgcagt cacactgggt 1921 gaagttgctt ttaatccttg cttcccatgt gctcaagtct ttttgttgtc cagcttcctg 1981 ataaccctgc ttactgtgga atattcattt gacatctgtc tcttttcatt tcttttaact 2041 accatgtcct tgatatacct tttgcacccc ctgaatttca tttctgtatc acctgacctc 2101 tggatgccaa cacatttatt ctgctttttc tattgtagag ttttagataa acctattaat 2161 ggcaatattt tttgctaaac atctttgtt tttactgtca ctagggcaat aacatttata 2221 ctcaaatata taacatttt ttaactacta aaagaatagt ttttaaagtc ttagcaatgt 2281 cttttgcaat tttcttaga cttaatactt atgataaatg actaacatag taacagaata 2341tgaaatatga ccttttctga aagtatgtac ttttaaatt ctactatatt gaaactatt 2401 agatgtaagt gctggtagaa tataagataa aagaggctga gaattactat atcagggtat 2461 tacaattgta aaacaatata tcttgtttc attgttttgt caataattgt taccaaggag 2521 ataaaaataa aagcagaatg tgtatcatcc cttctgaaaa acactaatta ttgatgtgtg 2581 catctgtacg ataaactaa aatgattatt aataaccaa atatatctac tacattgttt 2641 atattattga ataaaatata tttccaaaa gta
[0285] Sequence number 3: Mouse IL-33 mRNA 1 aagaggaact gcagctgcag aagggagaaa tcacggcaga atcatcgaga aacctgaaaa 61 atgagaccta gaatgaagta ttccaactcc aagatttccc cggcaaagtt cagcagcacc 121 gcaggcgaag ccctggtccc gccttgcaaa ataagaagat cccaacagaa gaccaaagaa 181 ttctgccatg tctactgcat gagactccgt tctggcctca ccataagaaa ggagactagt 241 tattttagga aagaacccac gaaaaagatat tcactaaaat cgggtaccaa gcatgaagag 301 aacttctctg cctatccacg ggattctagg aagagatcct tgcttggcag tatccaagca 361 tttgctgcgt ctgttgacac attgagcatc caaggaactt cacttttaac acagtctcct 421 gcctccctga gtacatacaa tgaccaatct gttagtttg ttttggagaa tggatgttat 481 gtgatcaatg ttgacgactc tggaaaagac caagagcaag accaggtgct actacgctac 541 tatgagtctc cctgtcctgc aagtcaatca ggcgacggtg tggatgggaa gaagctgatg 601 gtgaacatga gtcccatcaa agacacagagac atctggctgc atgccaacga caaggactac 661 tccgtggagc ttcaaagggg tgacgtctcg cctccggaac aggccttctt cgtccttcac 721 aaaaagtcct cggactttgt ttcatttgaa tgcaagaatc ttcctggcacttacatagga 781 gtaaaagata accagctggc tctagtggag gagaaagatg agagctgcaa caatattatg 841 tttaagctct cgaaaatcta atgcagtaaa acgcctgtgc gttctgggtt gatgactta 901 atgcttccaa ggtacagagagag cttacgatgt 961 tgtggaatgt tattatgtag aaaacttctt ttatttcctt ttctcagct acatgttcaa 1021 tagactcaca gatatatgac tcagcgttg ggtaagaaa ctgaaggaga ttcagccttg 1081 ctgacttttcctt tgacttgt actcacggac ttcagagag 1141 caggcaccac agtgcatggt ttgctttaga gagggtccat ttcaaaacc ttcataaaa 1201 caatgcaaaa caaaaaaaccgaacaa aaaaccacct atttcctgt tctaaaaccaaa tcattagattgaat 1261 gaccagctag ggggaggatc acctagggga 1321 ggaccagcta gggggac cagctgctgc aagactgac tgtttctcac ttatataaa 1381 atgccaatg cctccgcaga tgccccaggc aaccctcaga tcagcct1tggct4tggctt ctgt4cgattt tggctt tccttcttaa acttccattt tttcttttt aacacattta 1501 acatttaact ttaagcaagc cagcttacat taggagtga aagacatttt agttcccacc1561 cgtgattgaa atcattgact atatctaaca agcttaaagt ctcctgtaag aactgatcag 1621 gatatacact aggacatgcc aatagaatgg gatctcatgg tgcagtctga agccctccaa 1681 ctggagagac gctaacatca tccttctcgc tgatttccaa ggagctatga ctttggatgc 1741 atgcatctgc ttggatgaga tgtctcggct gcttgctttc cttatgcaca cgttctgttc 1801 agcttcacag cagcaatgct cacggtggaa tagcttagct tagcttctgc cccttctttg 1861 gttcttttga ccaccatatc cgtaacggct ctcctactcc ctcagctttc tttctctttg 1921 ctctgacgtc tatatgccaa cacacttatt ccactgtctt taccctgcac tgcagaattt 1981 tacatctacc tactggttac caggttgtcc cctgaacaac cttcctttgt gttttactgt 2041 tattaaagta gtaatatttg tattcaacca tgtagtaata ttttaagcca ctaaaggaat 2101 agttttactt atttagacaa cagcaatttc tactacattt ttataagctt aaaacttaca 2161 tgttttaaaa cttaaaacga taaagacaat aacaacattg atggagtatg atatgacagt 2221 tcagaaaggg ttagctctta tcttccagtc gaggaaacct attgtataca atagctggag 2281 gaatgtatga tcaaagaggc cgggaaccgc cgtgtaggat cgtacggctg taacaggtat 2341aattgtttca ttaatttgtc acagtcttac tgtagaggaa tgtaaaggcg gaatctgcgt 2401 cattcctctg gaaaccacag tgttgactct gtgaatctgt acgatatctt taaagtagta 2461 actacgtagt caaatgtgtt cttgacgttg ttcataactt tgaataaacc atttttcaaa 2521 accacgtgtg accacaaa
Claims
1. A nucleic acid molecule or a salt thereof comprising a sense strand and an antisense strand, or a solvate thereof, wherein the strands form a double-stranded region, the antisense strand comprises 19 to 23 nucleotides in length, and is complementary to the isolength portion of mRNA encoding IL-33 (SEQ ID NO: 1).
2. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 1, comprising a nucleotide sequence selected from the combinations of sense strands and antisense strands shown in the identification numbers in Tables 2-1 to 2-6.
3. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 2, wherein the sense strand comprises 19 to 23 nucleotides in length, and the antisense strand comprises 19 to 23 nucleotides in length.
4. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 2, wherein at least one of the sense strand and the antisense strand comprises at least one modified nucleotide.
5. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 4, wherein the modified nucleotide comprises modification of one or more sugar groups selected from the group consisting of 2'-deoxynucleotide, 2'-O-methyl (2'-OMe) modified nucleotide, 2'-deoxy-2'-fluoro (2'-F) modified nucleotide, 2'-deoxy-2'-NHAc (2'-NHAc) modified nucleotide, acyclic nucleotide, debasalized nucleotide, and 4'-vinyl phosphate-modified nucleotide.
6. The nucleic acid molecule or salt thereof, or solvates thereof, according to claim 4, wherein the modified nucleotide comprises modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds and phosphorodithioate bonds.
7. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 4, wherein at least one of the sense strand and the antisense strand contains at least one phosphorothioate bond or phosphorodithioate bond at its 5' end, 3' end, or 5' end and 3' end.
8. The nucleic acid molecule or salt thereof, or solvates thereof, according to claim 4, wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from combinations of sense strands and antisense strands indicated by the identification numbers in Tables 3-1 to 3-14.
9. A nucleic acid molecule or salt thereof according to any one of claims 1 to 8, or a solvate thereof, which inhibits the expression of IL-33.
10. A nucleic acid molecule or a salt thereof according to any one of claims 1 to 9, or a solvate thereof, comprising one or two mismatched bases at any position in the double-stranded region.
11. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of claims 1 to 10, wherein the nucleic acid molecule is siRNA.
12. A pharmaceutical composition comprising a nucleic acid molecule or a salt thereof according to any one of claims 1 to 11, or a solvate thereof, and a pharmaceutically acceptable carrier.
13. The pharmaceutical composition according to claim 12, used for treating diseases or symptoms involving IL-33.
14. The pharmaceutical composition according to claim 13, wherein the disease or symptom involving IL-33 is selected from the group consisting of allergic inflammation, bronchial asthma, atopic dermatitis, allergic rhinitis, viral lung infection, chronic bronchitis, respiratory failure, rheumatoid arthritis, acute kidney injury, systemic sclerosis, hepatic fibrosis, dermatofibrosis, hepatic fibrosis, inflammatory bowel disease, arteriosclerotic disease, psoriasis, multiple sclerosis, hay fever, anaphylactic shock, sinusitis (including eosinophilic sinusitis), systemic lupus erythematosus, pemphigus, chronic obstructive pulmonary disease (COPD), Sjögren's syndrome, cancer, endometriosis, myasthenia gravis, sepsis, eosinophilic pneumonia, pneumonia and immunodeficiency due to SARS-CoV-2 infection, idiopathic pulmonary fibrosis, cystic fibrosis, age-related macular degeneration, periodontitis, uveitis, and chronic urticaria.