RNA inhibitors of alpha-2-antiplasmin, compositions, and methods of use thereof

WO2026176399A1PCT designated stage Publication Date: 2026-08-27HEMAB APS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2026/051689
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2026-01-15
Filing Date
2026-02-20
Publication Date
2026-08-27

Smart Images

  • Figure IMGF000120_0001
    Figure IMGF000120_0001
  • Figure IMGF000028_0001_TABLE
    Figure IMGF000028_0001_TABLE
  • Figure IMGF000029_0001_TABLE
    Figure IMGF000029_0001_TABLE
Patent Text Reader

Abstract

Double-stranded RNA agents for inhibiting expression of Alpha-2 antiplasmin (A2AP; also known as SERPINF2) are provided. Also provided are compositions and methods to treat A2AP-associated disorders such as thrombosis.
Need to check novelty before this filing date? Find Prior Art

Description

RNA INHIBITORS OF ALPHA-2-ANTIPLASMIN, COMPOSITIONS, AND METHODS OF USE THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims the priority benefit of U. S. Provisional Application Nos. 63 / 761,620, filed February 21, 2025; and 63 / 961,104, filed January 15, 2026, each of which is hereby incorporated by reference in its entirety.BACKGROUND

[0002] Alpha-2-antiplasmin (“A2AP”), also known as SERPINF2, is a member of the serine proteinase inhibitor (serpin) superfamily. A2AP is the primary inhibitor of plasmin and rapidly inactivates plasmin by forming a covalent plasmin - A2AP (protease - serpin) complex, whose presence in the blood is a marker of plasmin generation in clinical states associated with plasminogen activation. Activated factor XIII cross links A2AP to fibrin during fibrin formation, which significantly enhances the resistance of fibrin to degradation by plasmin.

[0003] Plasminogen deficiency (PLGD) is a congenital disease in which the fibrinolytic system is insufficiently active due to the low levels of plasminogen. Plasminogen replacement is currently the only approved therapy; however, it requires intravenous and frequent administration. A2AP is a key downregulator of fibrinolysis. There remains a need in the art for alternative treatment for PLGD.

[0004] Increased levels of A2AP are associated with increased risk of developing disorders associated with thrombosis, the formation of a blood clot within a blood vessel. A common treatment for thrombosis is non-selective anti-coagulant therapy. Unfortunately, the lack of specificity of such therapies can lead to excessive bleeding. Accordingly, there remains a need in the art for specific and effective treatments for disorders associated with thrombosis.BRIEF SUMMARY

[0005] In some aspects, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent, wherein the dsRNA agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 37, 312, 396, 624, 626, 732, 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 39, 41, 43, 45, 47, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346,348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566. 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 734, 736, 738, 740, 742, 744, or 746, and an antisense strand hybridized to the sense strand.

[0006] In some aspects, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent, wherein the dsRNA agent comprises a sense strand hybridized to an antisense strand, wherein the sense strand and the antisense strand comprise the nucleotide sequences of (a) SEQ ID NOs: 37 and 38, respectively; (b) SEQ ID NOs: 312 and 313, respectively; (c) SEQ ID NOs: 396 and 397, respectively; (d) SEQ ID NOs: 624 and 625, respectively; (e) SEQ ID NOs: 626 and 627, respectively; (f) SEQ ID NOs: 732 and 733, respectively; (g) SEQ ID NOs: 1 and 2, respectively; (h) SEQ ID NOs: 3 and 4, respectively; (i) SEQ ID NOs: 5 and 6, respectively; (j) SEQ ID NOs: 7 and 8, respectively; (k) SEQ ID NOs: 9 and 10, respectively; (1) SEQ ID NOs: 11 and 12, respectively; (m) SEQ ID NOs: 13 and 14, respectively; (n) SEQ ID NOs: 15 and 16, respectively; (o) SEQ ID NOs: 15 and 238, respectively; (p) SEQ ID NOs: 15 and 239, respectively; (q) SEQ ID NOs: 17 and 18, respectively; (r) SEQ ID NOs: 19 and 20, respectively; (s) SEQ ID NOs: 19 and 240, respectively; (t) SEQ ID NOs: 21 and 22, respectively; (u) SEQ ID NOs: 23 and 24, respectively; (v) SEQ ID NOs: 23 and 241, respectively; (w) SEQ ID NOs: 25 and 26, respectively; (x) SEQ ID NOs: 27 and 28, respectively; (y) SEQ ID NOs: 29 and 30, respectively; (z) SEQ ID NOs: 29 and 242, respectively; (aa) SEQ ID NOs: 31 and 32, respectively; (bb) SEQ ID NOs: 33 and 34, respectively; (cc) SEQ ID NOs: 35 and 36, respectively; (dd) SEQ ID NOs: 37 and 243, respectively; (ee) SEQ ID NOs: 39 and 40, respectively; (ff) SEQ ID NOs: 41 and 42, respectively; (gg) SEQ ID NOs: 41 and 244, respectively; (hh) SEQ ID NOs: 43 and 44, respectively; (ii) SEQ ID NOs: 45 and 46, respectively; (jj) SEQ ID NOs: 47 and 48, respectively; (kk) SEQ ID NOs: 248 and 249, respectively; (11) SEQ ID NOs: 250 and 251, respectively; (mm) SEQ ID NOs: 252 and 253, respectively; (nn) SEQ ID NOs: 254 and 255,respectively; (oo) SEQ ID NOs: 256 and 257, respectively; (pp) SEQ ID NOs: 258 and 259, respectively; (qq) SEQ ID NOs: 260 and 261, respectively; (rr) SEQ ID NOs: 262 and 263, respectively; (ss) SEQ ID NOs: 264 and 265, respectively; (tt) SEQ ID NOs: 266 and 267, respectively; (uu) SEQ ID NOs: 268 and 269, respectively; (vv) SEQ ID NOs: 270 and 271, respectively; (ww) SEQ ID NOs: 272 and 273, respectively; (xx) SEQ ID NOs: 274 and 275, respectively; (yy) SEQ ID NOs: 276 and 277, respectively; (zz) SEQ ID NOs: 278 and 279, respectively; (aaa) SEQ ID NOs: 280 and 281, respectively; (bbb) SEQ ID NOs: 282 and 283, respectively; (ccc) SEQ ID NOs: 284 and 285, respectively; (ddd) SEQ ID NOs: 286 and 287, respectively; (eee) SEQ ID NOs: 288 and 289, respectively; (fff) SEQ ID NOs: 290 and 291, respectively; (ggg) SEQ ID NOs: 292 and 293, respectively; (hhh) SEQ ID NOs: 294 and 295, respectively; (iii) SEQ ID NOs: 296 and 297, respectively; (jjj) SEQ ID NOs: 298 and 299, respectively; (kkk) SEQ ID NOs: 300 and 301, respectively; (111) SEQ ID NOs: 302 and 303, respectively; (mmm) SEQ ID NOs: 304 and 305, respectively; (nnn) SEQ ID NOs: 306 and 307, respectively; (ooo) SEQ ID NOs: 308 and 309, respectively; (ppp) SEQ ID NOs: 310 and 311, respectively; (qqq) SEQ ID NOs: 314 and 315, respectively; (rrr) SEQ ID NOs: 316 and 317, respectively; (sss) SEQ ID NOs: 318 and 319, respectively; (ttt) SEQ ID NOs: 320 and 321, respectively; (uuu) SEQ ID NOs: 322 and 323, respectively; (vvv) SEQ ID NOs: 324 and 325, respectively; (www) SEQ ID NOs: 326 and 327, respectively; (xxx) SEQ ID NOs: 328 and 329, respectively; (yyy) SEQ ID NOs: 330 and 331, respectively; (zzz) SEQ ID NOs: 332 and 333, respectively; (aaaa) SEQ ID NOs: 334 and 335, respectively; (bbbb) SEQ ID NOs: 336 and 337, respectively; (cccc) SEQ ID NOs: 338 and 339, respectively; (dddd) SEQ ID NOs: 340 and 341, respectively; (eeee) SEQ ID NOs: 342 and 343, respectively; (ffff) SEQ ID NOs: 344 and 345, respectively; (gggg) SEQ ID NOs: 346 and 347, respectively; (hhhh) SEQ ID NOs: 348 and 349, respectively; (iiii) SEQ ID NOs: 350 and 351, respectively; (jjjj) SEQ ID NOs: 352 and 353, respectively; (kkkk) SEQ ID NOs: 354 and 355, respectively; (1111) SEQ ID NOs: 356 and 357, respectively; (mmmm) SEQ ID NOs: 358 and 359, respectively; (nnnn) SEQ ID NOs: 360 and 361, respectively; (oooo) SEQ ID NOs: 362 and 363, respectively; (pppp) SEQ ID NOs: 364 and 365, respectively; (qqqq) SEQ ID NOs: 366 and 367, respectively; (rrrr) SEQ ID NOs: 368 and 369, respectively; (ssss) SEQ ID NOs: 370 and 371, respectively; (tttt) SEQ ID NOs: 372 and 373, respectively; (uuuu) SEQ ID NOs: 374 and 375, respectively; (vvvv) SEQ ID NOs: 376 and 377, respectively; (wwww) SEQ ID NOs: 378 and 379, respectively; (xxxx) SEQ ID NOs: 380 and 381, respectively; (yyyy) SEQ ID NOs: 382 and 383, respectively; (zzzz) SEQ ID NOs: 384 and 385, respectively; (aaaaa) SEQ ID NOs:386 and 387, respectively; (bbbbb) SEQ ID NOs: 388 and 389, respectively; (ccccc) SEQ ID NOs: 390 and 391, respectively; (ddddd) SEQ ID NOs: 392 and 393, respectively; (eeeee) SEQ ID NOs: 394 and 395, respectively; (fffff) SEQ ID NOs: 398 and 399, respectively; (ggggg) SEQ ID NOs: 400 and 401, respectively; (hhhhh) SEQ ID NOs: 402 and 403, respectively; (iiiii) SEQ ID NOs: 404 and 405, respectively; (jjjjj) SEQ ID NOs: 406 and 407, respectively; (kkkkk) SEQ ID NOs: 408 and 409, respectively; (11111) SEQ ID NOs: 410 and 411, respectively; (mmmmm) SEQ ID NOs: 412 and 413, respectively; (nnnnn) SEQ ID NOs: 414 and 415, respectively; (ooooo) SEQ ID NOs: 416 and 417, respectively; (ppppp) SEQ ID NOs: 418 and 419, respectively; (qqqqq) SEQ ID NOs: 420 and 421, respectively; (rrrrr) SEQ ID NOs: 422 and 423, respectively; (sssss) SEQ ID NOs: 424 and 425, respectively; (ttttt) SEQ ID NOs: 426 and 427, respectively; (uuuuu) SEQ ID NOs: 428 and 429, respectively; (vvvvv) SEQ ID NOs: 430 and 431, respectively; (wwwww) SEQ ID NOs: 432 and 433, respectively; (xxxxx) SEQ ID NOs: 434 and 435, respectively; (yyyyy) SEQ ID NOs: 436 and 437, respectively; (zzzzz) SEQ ID NOs: 438 and 439, respectively; (aaaaaa) SEQ ID NOs: 440 and 441, respectively; (bbbbbb) SEQ ID NOs: 442 and 443, respectively; (cccccc) SEQ ID NOs: 444 and 445, respectively; (dddddd) SEQ ID NOs: 446 and 447, respectively; (eeeeee) SEQ ID NOs: 448 and 449, respectively; (ffffff) SEQ ID NOs: 450 and 451, respectively; (gggggg) SEQ ID NOs: 452 and 453, respectively; (hhhhhh) SEQ ID NOs: 454 and 455, respectively; (iiiiii) SEQ ID NOs: 456 and 457, respectively; (jjjjjj) SEQ ID NOs: 458 and 459, respectively; (kkkkkk) SEQ ID NOs: 460 and 461, respectively; (111111) SEQ ID NOs: 462 and 463, respectively; (mmmmmm) SEQ ID NOs: 464 and 465, respectively; (nnnnnn) SEQ ID NOs: 466 and 467, respectively; (oooooo) SEQ ID NOs: 468 and 469, respectively; (pppppp) SEQ ID NOs: 470 and 471, respectively; (qqqqqq) SEQ ID NOs: 472 and 473, respectively; (rrrrrr) SEQ ID NOs: 474 and 475, respectively; (ssssss) SEQ ID NOs: 476 and 477, respectively; (tttttt) SEQ ID NOs: 478 and 479, respectively; (uuuuuu) SEQ ID NOs: 480 and 481, respectively; (vvvvvv) SEQ ID NOs: 482 and 483, respectively; (wwwwww) SEQ ID NOs: 484 and 485, respectively; (xxxxxx) SEQ ID NOs: 486 and 487, respectively; (yyyyyy) SEQ ID NOs: 488 and 489, respectively; (zzzzzz) SEQ ID NOs: 490 and 491, respectively; (aaaaaaa) SEQ ID NOs: 492 and 493, respectively; (bbbbbbb) SEQ ID NOs: 494 and 495, respectively; (ccccccc) SEQ ID NOs: 496 and 497, respectively; (ddddddd) SEQ ID NOs: 498 and 499, respectively; (eeeeeee) SEQ ID NOs: 500 and 501, respectively; (fffffff) SEQ ID NOs: 502 and 503, respectively; (ggggggg) SEQ ID NOs: 504 and 505, respectively; (hhhhhhh) SEQ ID NOs: 506 and 507, respectively; (iiiiiii) SEQ ID NOs: 508 and 509, respectively; (jjjjjjj) SEQID NOs: 510 and 511, respectively; (kkkkkkk) SEQ ID NOs: 512 and 513, respectively; (1111111) SEQ ID NOs: 514 and 515, respectively; (mmmmmmm) SEQ ID NOs: 516 and 517, respectively; (nnnnnnn) SEQ ID NOs: 518 and 519, respectively; (ooooooo) SEQ ID NOs: 520 and 521, respectively; (ppppppp) SEQ ID NOs: 522 and 523, respectively; (qqqqqqq) SEQ ID NOs: 524 and 525, respectively; (rrrrrrr) SEQ ID NOs: 526 and 527, respectively; (sssssss) SEQ ID NOs: 528 and 529, respectively; (ttttttt) SEQ ID NOs: 530 and 531, respectively; (uuuuuuu) SEQ ID NOs: 532 and 533, respectively; (vvvvvvv) SEQ ID NOs: 534 and 535, respectively; (wwwwwww) SEQ ID NOs: 536 and 537, respectively; (xxxxxxx) SEQ ID NOs: 538 and 539, respectively; (yyyyyyy) SEQ ID NOs: 540 and 541, respectively; (zzzzzzz) SEQ ID NOs: 542 and 543, respectively; (aaaaaaaa) SEQ ID NOs: 544 and 545, respectively; (bbbbbbbb) SEQ ID NOs: 546 and 547, respectively; (cccccccc) SEQ ID NOs: 548 and 549, respectively; (dddddddd) SEQ ID NOs: 550 and 551, respectively; (eeeeeeee) SEQ ID NOs: 552 and 553, respectively; (ffffffff) SEQ ID NOs: 554 and 555, respectively; (gggggggg) SEQ ID NOs: 556 and 557, respectively; (hhhhhhhh) SEQ ID NOs: 558 and 559, respectively; (iiiiiiii) SEQ ID NOs: 560 and 561, respectively; (jjjjjjjj) SEQ ID NOs: 562 and 563, respectively; (kkkkkkkk) SEQ ID NOs: 564 and 565, respectively; (11111111) SEQ ID NOs: 566 and 567, respectively; (mmmmmmmm) SEQ ID NOs: 568 and 569, respectively; (nnnnnnnn) SEQ ID NOs: 570 and 571, respectively; (oooooooo) SEQ ID NOs: 572 and 573, respectively; (pppppppp) SEQ ID NOs: 574 and 575, respectively; (qqqqqqqq) SEQ ID NOs: 576 and 577, respectively; (rrrrrrrr) SEQ ID NOs: 578 and 579, respectively; (ssssssss) SEQ ID NOs: 580 and 581, respectively; (tttttttt) SEQ ID NOs: 582 and 583, respectively; (uuuuuuuu) SEQ ID NOs: 584 and 585, respectively; (vvvvvvvv) SEQ ID NOs: 586 and 587, respectively; (wwwwwwww) SEQ ID NOs: 588 and 589, respectively; (xxxxxxxx) SEQ ID NOs: 590 and 591, respectively; (yyyyyyyy) SEQ ID NOs: 592 and 593, respectively; (zzzzzzzz) SEQ ID NOs: 594 and 595, respectively; (aaaaaaaaa) SEQ ID NOs: 596 and 597, respectively; (bbbbbbbbb) SEQ ID NOs: 598 and 599, respectively; (ccccccccc) SEQ ID NOs: 600 and 601, respectively; (ddddddddd) SEQ ID NOs: 602 and 603, respectively; (eeeeeeeee) SEQ ID NOs: 604 and 605, respectively; (fffffffff) SEQ ID NOs: 606 and 607, respectively; (ggggggggg) SEQ ID NOs: 608 and 609, respectively; (hhhhhhhhh) SEQ ID NOs: 610 and 611, respectively; (iiiiiiiii) SEQ ID NOs: 612 and 613, respectively; (jjjjjjjjj) SEQ ID NOs: 614 and 615, respectively; (kkkkkkkkk) SEQ ID NOs: 616 and 617, respectively; (111111111) SEQ ID NOs: 618 and 619, respectively; (mmmmmmmmm) SEQ ID NOs: 620 and 621, respectively; (nnnnnnnnn) SEQ ID NOs: 622 and 623, respectively; (ooooooooo) SEQ ID NOs: 628 and629, respectively; (ppppppppp) SEQ ID NOs: 630 and 631, respectively; (qqqqqqqqq) SEQ ID NOs: 632 and 633, respectively; (rrrrrrrrr) SEQ ID NOs: 634 and 635, respectively; (sssssssss) SEQ ID NOs: 636 and 637, respectively; (ttttttttt) SEQ ID NOs: 638 and 639, respectively; (uuuuuuuuu) SEQ ID NOs: 640 and 641, respectively; (vvvvvvvv) SEQ ID NOs: 642 and 643, respectively; (wwwwwwwww) SEQ ID NOs: 644 and 645, respectively; (xxxxxxxxx) SEQ ID NOs: 646 and 647, respectively; (yyyyyyyyy) SEQ ID NOs: 648 and 649, respectively; (zzzzzzzzz) SEQ ID NOs: 650 and 651, respectively; (aaaaaaaaaa) SEQ ID NOs: 652 and 653, respectively; (bbbbbbbbbb) SEQ ID NOs: 654 and 655, respectively; (cccccccccc) SEQ ID NOs: 656 and 657, respectively; (dddddddddd) SEQ ID NOs: 658 and 659, respectively; (eeeeeeeeee) SEQ ID NOs: 660 and 661, respectively; (ffffffffff) SEQ ID NOs: 662 and 663, respectively; (gggggggggg) SEQ ID NOs: 664 and 665, respectively; (hhhhhhhhhh) SEQ ID NOs: 666 and 667, respectively; (iiiiiiiiii) SEQ ID NOs: 668 and 669, respectively; (jjjjjjjjjj) SEQ ID NOs: 670 and 671, respectively; (kkkkkkkkkk) SEQ ID NOs: 672 and 673, respectively; (1111111111) SEQ ID NOs: 674 and 675, respectively; (mmmmmmmmmm) SEQ ID NOs: 676 and 677, respectively; (nnnnnnnnnn) SEQ ID NOs: 678 and 679, respectively; (oooooooooo) SEQ ID NOs: 680 and 681, respectively; (pppppppppp) SEQ ID NOs: 682 and 683, respectively; (qqqqqqqqqq) SEQ ID NOs: 684 and 685, respectively; (rrrrrrrrrr) SEQ ID NOs: 686 and 687, respectively; (ssssssssss) SEQ ID NOs: 688 and 689, respectively; (tttttttttt) SEQ ID NOs: 690 and 691, respectively; (uuuuuuuuuu) SEQ ID NOs: 692 and 693, respectively; (vvvvvvvvvv) SEQ ID NOs: 694 and 695, respectively; (wwwwwwwwww) SEQ ID NOs: 696 and 697, respectively; (xxxxxxxxxx) SEQ ID NOs: 698 and 699, respectively; (yyyyyyyyyy) SEQ ID NOs: 700 and 701, respectively; (zzzzzzzzzz) SEQ ID NOs: 702 and 703, respectively; (aaaaaaaaaaa) SEQ ID NOs: 704 and 705, respectively; (bbbbbbbbbbb) SEQ ID NOs: 706 and 707, respectively; (ccccccccccc) SEQ ID NOs: 708 and 709, respectively; (ddddddddddd) SEQ ID NOs: 710 and 711, respectively; (eeeeeeeeeee) SEQ ID NOs: 712 and 713, respectively; (fffffffffff) SEQ ID NOs: 714 and 715, respectively; (ggggggggggg) SEQ ID NOs: 716 and 717, respectively; (hhhhhhhhhhh) SEQ ID NOs: 718 and 719, respectively; (iiiiiiiiiii) SEQ ID NOs: 720 and 721, respectively; (jjjjjjjjjjj) SEQ ID NOs: 722 and 723, respectively; (kkkkkkkkkkk) SEQ ID NOs: 724 and 725, respectively; (11111111111) SEQ ID NOs: 726 and 727, respectively; (mmmmmmmmmmm) SEQ ID NOs: 728 and 729, respectively; (nnnnnnnnnnn) SEQ ID NOs: 730 and 731, respectively; (ooooooooooo) SEQ ID NOs: 734 and 735, respectively; (ppppppppppp) SEQ ID NOs: 736 and 737, respectively; (qqqqqqqqqqq) SEQ ID NOs: 738 and 739, respectively; (rrrrrrrrrrr) SEQ ID NOs: 740 and 741, respectively;(sssssssssss) SEQ ID NOs: 742 and 743, respectively; (ttttttttttt) SEQ ID NOs: 744 and 745, respectively; or (uuuuuuuuuuu) SEQ ID NOs: 746 and 747, respectively.

[0007] In some aspects, the sense strand comprises at least one chemically modified nucleotide and / or at least one modified internucleoside linkage. In some aspects, the antisense strand comprises at least one chemically modified nucleotide and / or at least one modified intemucleoside linkage.

[0008] In some aspects, the at least one chemically modified nucleotide comprises a deoxynucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C- alkyl-modified nucleotide, 2'-hydroxyl-modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5- anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'-phosphate, a nucleotide comprising a 5'-phosphate mimic, a thermally destabilizing nucleotide, a glycol modified nucleotide (GNA), a 2-O-(N- methylacetamide) modified nucleotide, or any combination thereof.

[0009] In some aspects, the at least one chemically modified nucleotide comprises a 2'- deoxy-modified nucleotide. In some aspects, the 2'-deoxy-modified nucleotide is a 2'-deoxy- 2'-fluoro modification. In some aspects, the at least one chemically modified nucleotide comprises a 2'-O-methyl modified nucleotide. In some aspects, the at least one chemically modified nucleotide comprises a 2'-fluoro modified nucleotide. In some aspects, the at least one chemically modified nucleotide comprises a 2'-methoxy ethyl modified nucleotide. In some aspects, the at least one chemically modified nucleotide comprises, a phosphorothioate group. In some aspects, the at least one chemically modified nucleotide comprises a 5'-phosphate mimic. In some aspects, the 5'-phosphate mimic is 5'-vinyl phosphonate.

[0010] In some aspects, the at least one modified intemucleoside linkage comprises an intemucleoside linkage of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, an alkenylene phosphonate linkage, a phosphinate linkage, aphosphoramidate linkage, and an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, a boranophosphate linkage, and combinations thereof. In some aspects, the at least one modified internucleoside linkage comprises a phosphorothioate linkage. In some aspects, wherein the at least one modified internucleoside linkage comprises an alkenylene phosphonate linkage. In some aspects, the alkenylene phosphonate linkage is vinyl phosphonate linkage.

[0011] In some aspects, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent, wherein the dsRNA agent comprises a sense strand hybridized to an antisense strand, wherein the sense strand and the antisense strand have the nucleotide sequences of (a) SEQ IDNOs: 197 and 198, respectively; (b) SEQ IDNOs: 812 and 813, respectively; (c) SEQ ID NOs: 896 and 897, respectively; (d) SEQ ID NOs: 1124 and 1125, respectively; (e) SEQ ID NOs: 1126 and 1127, respectively; (f) SEQ ID NOs: 1232 and 1233, respectively; (g) SEQ ID NOs: 49 and 50, respectively; (h) SEQ ID NOs: 51 and 52, respectively; (i) SEQ ID NOs: 51 and 54, respectively; (j) SEQ ID NOs: 53 and 54, respectively; (k) SEQ ID NOs: 55 and 54, respectively; (1) SEQ ID NOs: 56 and 54, respectively; (m) SEQ ID NOs: 57 and 54, respectively; (n) SEQ ID NOs: 58 and 54, respectively; (o) SEQ ID NOs: 59 and 54, respectively; (p) SEQ ID NOs: 60 and 61, respectively; (q) SEQ ID NOs: 49 and 62, respectively; (r) SEQ ID NOs: 63 and 64, respectively; (s) SEQ ID NOs: 65 and 66, respectively; (t) SEQ ID NOs: 67 and 68, respectively; (u) SEQ ID NOs: 67 and 69, respectively; (v) SEQ ID NOs: 70 and 69, respectively; (w) SEQ ID NOs: 71 and 69, respectively; (x) SEQ ID NOs: 72 and 69, respectively; (y) SEQ ID NOs: 73 and 69, respectively; (z) SEQ ID NOs: 74 and 69, respectively; (aa) SEQ ID NOs: 75 and 69, respectively; (bb) SEQ ID NOs: 76 and 77, respectively; (cc) SEQ ID NOs: 67 and 78, respectively; (dd) SEQ ID NOs: 67 and 79, respectively; (ee) SEQ ID NOs: 80 and 81, respectively; (ff) SEQ ID NOs: 82 and 83, respectively; (gg) SEQ ID NOs: 84 and 85, respectively; (hh) SEQ ID NOs: 84 and 86, respectively; (ii) SEQ ID NOs: 87 and 86, respectively; (jj) SEQ ID NOs: 88 and 86, respectively; (kk) SEQ ID NOs: 89 and 86, respectively; (11) SEQ ID NOs: 90 and 86, respectively; (mm) SEQ ID NOs: 91 and 86, respectively; (nn) SEQ ID NOs: 92 and 86, respectively; (oo) SEQ ID NOs: 93 and 94, respectively; (pp) SEQ ID NOs: 95 and 96, respectively; (qq) SEQ ID NOs: 97 and 98, respectively; (rr) SEQ ID NOs: 99 and 100, respectively; (ss) SEQ ID NOs: 99 and 101, respectively; (tt) SEQ ID NOs: 102 and 103, respectively; (uu) SEQ ID NOs: 104 and 105,respectively; (vv) SEQ ID NOs: 104 and 106, respectively; (ww) SEQ ID NOs: 107 and 106, respectively; (xx) SEQ ID NOs: 108 and 106, respectively; (yy) SEQ ID NOs: 109 and 106, respectively; (zz) SEQ ID NOs: 110 and 106, respectively; (aaa) SEQ ID NOs: 111 and 106, respectively; (bbb) SEQ ID NOs: 112 and 106, respectively; (ccc) SEQ ID NOs: 113 and 114, respectively; (ddd) SEQ ID NOs: 104 and 115, respectively; (eee) SEQ ID NOs: 104 and 116, respectively; (fff) SEQ ID NOs: 117 and 118, respectively; (ggg) SEQ ID NOs: 119 and 120, respectively; (hhh) SEQ ID NOs: 121 and 122, respectively; (iii) SEQ ID NOs: 121 and 123, respectively; (jjj) SEQ ID NOs: 124 and 125, respectively; (kkk) SEQ ID NOs: 126 and 127, respectively; (111) SEQ ID NOs: 128 and 129, respectively; (mmm) SEQ ID NOs: 130 and 131, respectively; (nnn) SEQ ID NOs: 130 and 132, respectively; (ooo) SEQ ID NOs: 130 and 133, respectively; (ppp) SEQ ID NOs: 134 and 135, respectively; (qqq) SEQ ID NOs: 136 and 137, respectively; (rrr) SEQ ID NOs: 138 and 139, respectively; (sss) SEQ ID NOs: 140 and 139, respectively; (ttt) SEQ ID NOs: 141 and 139, respectively; (uuu) SEQ ID NOs: 142 and 139, respectively; (vvv) SEQ ID NOs: 143 and 139, respectively; (www) SEQ ID NOs: 144 and 139, respectively; (xxx) SEQ ID NOs: 145 and 139, respectively; (yyy) SEQ ID NOs: 146 and 147, respectively; (zzz) SEQ ID NOs: 148 and 149, respectively; (aaaa) SEQ ID NOs: 150 and 151, respectively; (bbbb) SEQ ID NOs: 152 and 153, respectively; (cccc) SEQ ID NOs: 152 and 154, respectively; (dddd) SEQ ID NOs: 155 and 154, respectively; (eeee) SEQ ID NOs: 156 and 154, respectively; (ffff) SEQ ID NOs: 157 and 154, respectively; (gggg) SEQ ID NOs: 158 and 154, respectively; (hhhh) SEQ ID NOs: 159 and 154, respectively; (iiii) SEQ ID NOs: 160 and 154, respectively; (jjjj) SEQ ID NOs: 161 and 162, respectively; (kkkk) SEQ ID NOs: 152 and 163, respectively; (1111) SEQ ID NOs: 152 and 164, respectively; (mmmm) SEQ ID NOs: 165 and 166, respectively; (nnnn) SEQ ID NOs: 167 and 168, respectively; (oooo) SEQ ID NOs: 169 and 170, respectively; (pppp) SEQ ID NOs: 169 and 171, respectively; (qqqq) SEQ ID NOs: 172 and 171, respectively; (rrrr) SEQ ID NOs: 173 and 171, respectively; (ssss) SEQ ID NOs: 174 and 171, respectively; (tttt) SEQ ID NOs: 175 and 171, respectively; (uuuu) SEQ ID NOs: 176 and 171, respectively; (vvvv) SEQ ID NOs: 177 and 171, respectively; (wwww) SEQ ID NOs: 178 and 179, respectively; (xxxx) SEQ ID NOs: 169 and 180, respectively; (yyyy) SEQ ID NOs: 169 and 181, respectively; (zzzz) SEQ ID NOs: 182 and 183, respectively; (aaaaa) SEQ ID NOs: 184 and 185, respectively; (bbbbb) SEQ ID NOs: 186 and 185, respectively; (ccccc) SEQ ID NOs: 187 and 185, respectively; (ddddd) SEQ ID NOs: 188 and 189, respectively; (eeeee) SEQ ID NOs: 188 and 190, respectively; (fffff) SEQ ID NOs: 191 and 190, respectively; (ggggg) SEQ ID NOs: 192 and 190, respectively; (hhhhh)SEQ ID NOs: 193 and 190, respectively; (iiiii) SEQ ID NOs: 194 and 190, respectively; (jjjjj) SEQ ID NOs: 195 and 190, respectively; SEQ ID NOs: 196 and 190, respectively; (kkkkk) (11111) SEQ ID NOs: 184 and 199, respectively; (mmmmm) SEQ ID NOs: 197 and 200, respectively; (nnnnn) SEQ ID NOs: 197 and 201, respectively; (ooooo) SEQ ID NOs: 202 and 203, respectively; (ppppp) SEQ ID NOs: 204 and 205, respectively; (qqqqq) SEQ ID NOs: 206 and 207, respectively; (rrrrr) SEQ ID NOs: 206 and 208, respectively; (sssss) SEQ ID NOs: 209 and 208, respectively; (ttttt) SEQ ID NOs: 210 and 208, respectively; (uuuuu) SEQ ID NOs: 211 and 208, respectively; (vvvvv) SEQ ID NOs: 212 and 208, respectively; (wwwww) SEQ ID NOs: 213 and 208, respectively; (xxxxx) SEQ ID NOs: 214 and 208, respectively; (yyyyy) SEQ ID NOs: 215 and 216, respectively; (zzzzz) SEQ ID NOs: 206 and 217, respectively; (aaaaaa) SEQ ID NOs: 206 and 218, respectively; (bbbbbb) SEQ ID NOs: 219 and 220, respectively; (cccccc) SEQ ID NOs: 221 and 222, respectively; (dddddd) SEQ ID NOs: 224 and 225, respectively; (eeeeee) SEQ ID NOs: 224 and 226, respectively; (ffffff) SEQ ID NOs: 227 and 226, respectively; (gggggg) SEQ ID NOs: 228 and 226, respectively; (hhhhhh) SEQ ID NOs: 229 and 226, respectively; (iiiiii) SEQ ID NOs: 230 and 226, respectively; (jjjjjj) SEQ ID NOs: 231 and 226, respectively; (kkkkkk) SEQ ID NOs: 232 and 226, respectively; (111111) SEQ ID NOs: 233 and 234, respectively; (mmmmmm) SEQ ID NOs: 224 and 235, respectively; (nnnnnn) SEQ ID NOs: 236 and 237, respectively; (oooooo) SEQ ID NOs: 748 and 749, respectively; (pppppp) SEQ ID NOs: 750 and 751, respectively; (qqqqqq) SEQ ID NOs: 752 and 753, respectively; (rrrrrr) SEQ ID NOs: 754 and 755, respectively; (ssssss) SEQ ID NOs: 756 and 757, respectively; (tttttt) SEQ ID NOs: 758 and 759, respectively; (uuuuuu) SEQ ID NOs: 760 and 761, respectively; (vvvvvv) SEQ ID NOs: 762 and 763, respectively; (wwwwww) SEQ ID NOs: 764 and 765, respectively; (xxxxxx) SEQ ID NOs: 766 and 767, respectively; (yyyyyy) SEQ ID NOs: 768 and 769, respectively; (zzzzzz) SEQ ID NOs: 770 and 771, respectively; (aaaaaaa) SEQ ID NOs: 772 and 773, respectively; (bbbbbbb) SEQ ID NOs: 774 and 775, respectively; (ccccccc) SEQ ID NOs: 776 and 777, respectively; (ddddddd) SEQ ID NOs: 778 and 779, respectively; (eeeeeee) SEQ ID NOs: 780 and 781, respectively; (fffffff) SEQ ID NOs: 782 and 783, respectively; (ggggggg) SEQ ID NOs: 784 and 785, respectively; (hhhhhhh) SEQ ID NOs: 786 and 787, respectively; (iiiiiii) SEQ ID NOs: 788 and 789, respectively; (jjjjjjj) SEQ ID NOs: 790 and 791, respectively; (kkkkkkk) SEQ ID NOs: 792 and 793, respectively; (1111111) SEQ ID NOs: 794 and 795, respectively; (mmmmmmm) SEQ ID NOs: 796 and 797, respectively; (nnnnnnn) SEQ ID NOs: 798 and 799, respectively; (ooooooo) SEQ ID NOs: 800 and 801, respectively;(ppppppp) SEQ ID NOs: 802 and 803, respectively; (qqqqqqq) SEQ ID NOs: 804 and 805, respectively; (rrrrrrr) SEQ ID NOs: 806 and 807, respectively; (sssssss) SEQ ID NOs: 808 and 809, respectively; (ttttttt) SEQ ID NOs: 810 and 811, respectively; (uuuuuuu) SEQ ID NOs: 814 and 815, respectively; (vvvvvvv) SEQ ID NOs: 816 and 817, respectively; (wwwwwww) SEQ ID NOs: 818 and 819, respectively; (xxxxxxx) SEQ ID NOs: 820 and 821, respectively; (yyyyyyy) SEQ ID NOS: 822 and 823, respectively; (zzzzzzz) SEQ ID NOs: 824 and 825, respectively; (aaaaaaaa) SEQ ID NOs: 826 and 827, respectively; (bbbbbbbb) SEQ ID NOs: 828 and 829, respectively; (cccccccc) SEQ ID NOs: 830 and 831, respectively; (dddddddd) SEQ ID NOs: 832 and 833, respectively; (eeeeeeee) SEQ ID NOs: 834 and 835, respectively; (ffffffff) SEQ ID NOs: 836 and 837, respectively; (gggggggg) SEQ ID NOs: 838 and 839, respectively; (hhhhhhhh) SEQ ID NOs: 840 and 841, respectively; (iiiiiiii) SEQ ID NOs: 842 and 843, respectively; (jjjjjjjj) SEQ ID NOs: 844 and 845, respectively; (kkkkkkkk) SEQ ID NOs: 846 and 847, respectively; (llllllll) SEQ ID NOs: 848 and 849, respectively; (mmmmmmmm) SEQ ID NOs: 850 and 851, respectively; (nnnnnnnn) SEQ ID NOs: 852 and 853, respectively; (oooooooo) SEQ ID NOs: 854 and 855, respectively; (pppppppp) SEQ ID NOs: 856 and 857, respectively; (qqqqqqqq) SEQ ID NOs: 858 and 859, respectively; (rrrrrrrr) SEQ ID NOs: 860 and 861, respectively; (ssssssss) SEQ ID NOs: 862 and 863, respectively; (tttttttt) SEQ ID NOs: 864 and 865, respectively; (uuuuuuuu) SEQ ID NOs: 866 and 867, respectively; (vvvvvvvv) SEQ ID NOs: 868 and 869, respectively; (wwwwwwww) SEQ ID NOs: 870 and 871, respectively; (xxxxxxxx) SEQ ID NOs: 872 and 873, respectively; (yyyyyyyy) SEQ ID NOS: 874 and 875, respectively; (zzzzzzzz) SEQ ID NOs: 876 and 877, respectively; (aaaaaaaaa) SEQ ID NOs: 878 and 879, respectively; (bbbbbbbbb) SEQ ID NOs: 880 and 881, respectively; (ccccccccc) SEQ ID NOs: 882 and 883, respectively; (ddddddddd) SEQ ID NOs: 884 and 885, respectively; (eeeeeeeee) SEQ ID NOs: 886 and 887, respectively; (fffffffff) SEQ ID NOs: 888 and 889, respectively; (ggggggggg) SEQ ID NOs: 890 and 891, respectively; (hhhhhhhhh) SEQ ID NOs: 892 and 893, respectively; (iiiiiiiii) SEQ ID NOs: 894 and 895, respectively; (jjjjjjjjj ) SEQ ID NOs: 898 and 899, respectively; (kkkkkkkkk) SEQ ID NOs: 900 and 901, respectively; (lllllllll) SEQ ID NOs: 902 and 903, respectively; (mmmmmmmmm) SEQ ID NOs: 904 and 905, respectively; (nnnnnnnnn) SEQ ID NOs: 906 and 907, respectively; (ooooooooo) SEQ ID NOs: 908 and 909, respectively; (ppppppppp) SEQ ID NOs: 910 and 911, respectively; (qqqqqqqqq) SEQ ID NOs: 912 and 913, respectively; (rrrrrrrrr) SEQ ID NOs: 914 and 915, respectively; (sssssssss) SEQ ID NOs: 916 and 917, respectively; (ttttttttt) SEQ ID NOs: 918 and 919, respectively; (uuuuuuuuu) SEQ ID NOs: 920and 921, respectively; (vvvvvvvvv) SEQ ID NOs: 922 and 923, respectively; (wwwwwwwww) SEQ ID NOs: 924 and 925, respectively; (xxxxxxxxx) SEQ ID NOs: 926 and 927, respectively; (yyyyyyyyy) SEQ ID NOS: 928 and 929, respectively; (zzzzzzzzz) SEQ ID NOs: 930 and 931, respectively; (aaaaaaaaaa) SEQ ID NOs: 932 and 933, respectively; (bbbbbbbbbb) SEQ ID NOs: 934 and 935, respectively; (cccccccccc) SEQ ID NOs: 936 and 937, respectively; (dddddddddd) SEQ ID NOs: 938 and 939, respectively; (eeeeeeeeee) SEQ ID NOs: 940 and 941, respectively; (ffffffffff) SEQ ID NOs: 942 and 943, respectively; (gggggggggg) SEQ ID NOs: 944 and 945, respectively; (hhhhhhhhhh) SEQ ID NOs: 946 and 947, respectively; (iiiiiiiiii) SEQ ID NOs: 948 and 949, respectively; (jjjjjjjjjj) SEQ ID NOs: 950 and 951, respectively; (kkkkkkkkkk) SEQ ID NOs: 952 and 953, respectively; (llllllllll) SEQ ID NOs: 954 and 955, respectively; (mmmmmmmmmm) SEQ ID NOs: 956 and 957, respectively; (nnnnnnnnnn) SEQ ID NOs: 958 and 959, respectively; (oooooooooo) SEQ ID NOs: 960 and 961, respectively; (pppppppppp) SEQ ID NOs: 962 and 963, respectively; (qqqqqqqqqq) SEQ ID NOs: 964 and 965, respectively; (rrrrrrrrrr) SEQ ID NOs: 966 and 967, respectively; (ssssssssss) SEQ ID NOs: 968 and 969, respectively; (tttttttttt) SEQ ID NOs: 970 and 971, respectively; (uuuuuuuuuu) SEQ ID NOs: 972 and 973, respectively; (vvvvvvvvvv) SEQ ID NOs: 974 and 975, respectively; (wwwwwwwwww) SEQ ID NOs: 976 and 977, respectively; (xxxxxxxxxx) SEQ ID NOs: 978 and 979, respectively; (yyyyyyyyyy) SEQ ID NOs: 980 and 981, respectively; (zzzzzzzzzz) SEQ ID NOs: 982 and 983, respectively; (aaaaaaaaaaa) SEQ ID NOs: 984 and 985, respectively; (bbbbbbbbbbb) SEQ ID NOs: 986 and 987, respectively; (ccccccccccc) SEQ ID NOs: 988 and 989, respectively; (ddddddddddd) SEQ ID NOs: 990 and 991, respectively; (eeeeeeeeeee) SEQ ID NOs: 992 and 993, respectively; (fffffffffff) SEQ ID NOs: 994 and 995, respectively; (ggggggggggg) SEQ ID NOs: 996 and 997, respectively; (hhhhhhhhhhh) SEQ ID NOs: 998 and 999, respectively; (iiiiiiiiiii) SEQ ID NOs: 1000 and 1001, respectively; (jjjjjjjjjjj) SEQ ID NOs: 1002 and 1003, respectively; (kkkkkkkkkkk) SEQ ID NOs: 1004 and 1005, respectively; (lllllllllll) SEQ ID NOs: 1006 and 1007, respectively; (mmmmmmmmmmm) SEQ ID NOs: 1008 and 1009, respectively; (nnnnnnnnnnn) SEQ ID NOs: 1010 and 1011, respectively; (ooooooooooo) SEQ ID NOs: 1012 and 1013, respectively; (ppppppppppp) SEQ ID NOs: 1014 and 1015, respectively; (qqqqqqqqqqq) SEQ ID NOs: 1016 and 1017, respectively; (rrrrrrrrrrr) SEQ ID NOs: 1018 and 1019, respectively; (sssssssssss) SEQ ID NOs: 1020 and 1021, respectively; (ttttttttttt) SEQ ID NOs: 1022 and 1023, respectively; (uuuuuuuuuuu) SEQ ID NOs: 1024 and 1025, respectively; (vvvvvvvvvvv) SEQ ID NOs: 1026 and 1027, respectively; (wwwwwwwwwww) SEQ ID NOs: 1028 and 1029,respectively; (xxxxxxxxxxx) SEQ ID NOs: 1030 and 1031, respectively; (yyyyyyyyyyy) SEQ ID NOs: 1032 and 1033, respectively; (zzzzzzzzzzz) SEQ ID NOs: 1034 and 1035, respectively; (aaaaaaaaaaaa) SEQ ID NOs: 1036 and 1037, respectively; (bbbbbbbbbbbb) SEQ ID NOs: 1038 and 1039, respectively; (cccccccccccc) SEQ ID NOs: 1040 and 1041, respectively; (dddddddddddd) SEQ ID NOs: 1042 and 1043, respectively; (eeeeeeeeeeee) SEQ ID NOs: 1044 and 1045, respectively; (ffffffffffff) SEQ ID NOs: 1046 and 1047, respectively; (gggggggggggg) SEQ ID NOs: 1048 and 1049, respectively; (hhhhhhhhhhhh) SEQ ID NOs: 1050 and 1051, respectively; (iiiiiiiiiiii) SEQ ID NOs: 1052 and 1053, respectively; (jjjjjjjjjjjj) SEQ ID NOs: 1054 and 1055, respectively; (kkkkkkkkkkkk) SEQ ID NOs: 1056 and 1057, respectively; (llllllllllll) SEQ ID NOs: 1058 and 1059, respectively; (mmmmmmmmmmmm) SEQ ID NOs: 1060 and 1061, respectively; (nnnnnnnnnnnn) SEQ ID NOs: 1062 and 1063, respectively; (oooooooooooo) SEQ ID NOs: 1064 and 1065, respectively; (pppppppppppp) SEQ ID NOs: 1066 and 1067, respectively; (qqqqqqqqqqqq) SEQ ID NOs: 1068 and 1069, respectively; (rrrrrrrrrrrr) SEQ ID NOs: 1070 and 1071, respectively; (ssssssssssss) SEQ ID NOs: 1072 and 1073, respectively; (tttttttttttt) SEQ ID NOs: 1074 and 1075, respectively; (uuuuuuuuuuuu) SEQ ID NOs: 1076 and 1077, respectively; (vvvvvvvvvvvv) SEQ ID NOs: 1078 and 1079, respectively; (wwwwwwwwwwww) SEQ ID NOs: 1080 and 1081, respectively; (xxxxxxxxxxxx) SEQ ID NOs: 1082 and 1083, respectively; (yyyyyyyyyyyy) SEQ ID NOs: 1084 and 1085, respectively; (zzzzzzzzzzzz) SEQ ID NOs: 1086 and 1087, respectively; (aaaaaaaaaaaaa) SEQ ID NOs: 1088 and 1089, respectively; (bbbbbbbbbbbbb) SEQ ID NOs: 1090 and 1091, respectively; (ccccccccccccc) SEQ ID NOs: 1092 and 1093, respectively; (ddddddddddddd) SEQ ID NOs: 1094 and 1095, respectively; (eeeeeeeeeeeee) SEQ ID NOs: 1096 and 1097, respectively; (fffffffffffff) SEQ ID NOs: 1098 and 1099, respectively; (ggggggggggggg) SEQ ID NOs: 1100 and 1101, respectively; (hhhhhhhhhhhhh) SEQ ID NOs: 1102 and 1103, respectively; (iiiiiiiiiiiii) SEQ ID NOs: 1104 and 1105, respectively; (jjjjjjjjjjjjj) SEQ ID NOs: 1106 and 1107, respectively; (kkkkkkkkkkkkk) SEQ ID NOs: 1108 and 1109, respectively; (lllllllllllll) SEQ ID NOs: 1110 and 1111, respectively; (mmmmmmmmmmmmm) SEQ ID NOs: 1112 and 1113, respectively; (nnnnnnnnnnnnn) SEQ ID NOs: 1114 and 1115, respectively; (ooooooooooooo) SEQ ID NOs: 1116 and 1117, respectively; (ppppppppppppp) SEQ ID NOs: 1118 and 1119, respectively; (qqqqqqqqqqqqq) SEQ ID NOs: 1120 and 1121, respectively; (rrrrrrrrrrrrr) SEQ ID NOs: 1122 and 1123, respectively; (sssssssssssss) SEQ ID NOs: 1128 and 1129, respectively; (ttttttttttttt) SEQ ID NOs: 1130 and 1131, respectively; (uuuuuuuuuuuuu) SEQ ID NOs: 1132 and 1133,respectively; (vvvvvvvvvvvvv) SEQ ID NOs: 1134 and 1135, respectively; (wwwwwwwwwwwww) SEQ ID NOs: 1136 and 1137, respectively; (xxxxxxxxxxxxx) SEQ ID NOs: 1138 and 1139, respectively; (yyyyyyyyyyyyy) SEQ ID NOs: 1140 and 1141, respectively; (zzzzzzzzzzzzz) SEQ ID NOs: 1142 and 1143, respectively; (aaaaaaaaaaaaaa) SEQ ID NOs: 1144 and 1145, respectively; (bbbbbbbbbbbbbb) SEQ ID NOs: 1146 and 1147, respectively; (cccccccccccccc) SEQ ID NOs: 1148 and 1149, respectively; (dddddddddddddd) SEQ ID NOs: 1150 and 1151, respectively; (eeeeeeeeeeeeee) SEQ ID NOs: 1152 and 1153, respectively; (ffffffffffffff) SEQ ID NOs: 1154 and 1155, respectively; (gggggggggggggg) SEQ ID NOs: 1156 and 1157, respectively; (hhhhhhhhhhhhhh) SEQ ID NOs: 1158 and 1159, respectively; (iiiiiiiiiiiiii) SEQ ID NOs: 1160 and 1161, respectively; (jjjjjjjjjjjjjj) SEQ ID NOs: 1162 and 1163, respectively; (kkkkkkkkkkkkkk) SEQ ID NOs: 1164 and 1165, respectively; (llllllllllllll) SEQ ID NOs: 1166 and 1167, respectively; (mmmmmmmmmmmmmm) SEQ ID NOs: 1168 and 1169, respectively; (nnnnnnnnnnnnnn) SEQ ID NOs: 1170 and 1171, respectively; (oooooooooooooo) SEQ ID NOs: 1172 and 1173, respectively; (pppppppppppppp) SEQ ID NOs: 1174 and 1175, respectively; (qqqqqqqqqqqqqq) SEQ ID NOs: 1176 and 1177, respectively; (rrrrrrrrrrrrrr) SEQ ID NOs: 1178 and 1179, respectively; (ssssssssssssss) SEQ ID NOs: 1180 and 1181, respectively; (tttttttttttttt) SEQ ID NOs: 1182 and 1183, respectively; (uuuuuuuuuuuuuu) SEQ ID NOs: 1184 and 1185, respectively; (vvvvvvvvvvvvvv) SEQ ID NOs: 1186 and 1187, respectively; (wwwwwwwwwwwwww) SEQ ID NOs: 1188 and 1189, respectively; (xxxxxxxxxxxxxx) SEQ ID NOs: 1190 and 1191, respectively; (yyyyyyyyyyyyyy) SEQ ID NOs: 1192 and 1193, respectively; (zzzzzzzzzzzzzz) SEQ ID NOs: 1194 and 1195, respectively; (aaaaaaaaaaaaaaa) SEQ ID NOs: 1196 and 1197, respectively; (bbbbbbbbbbbbbbb) SEQ ID NOs: 1198 and 1199, respectively; (ccccccccccccccc) SEQ ID NOs: 1200 and 1201, respectively; (ddddddddddddddd) SEQ ID NOs: 1202 and 1203, respectively; (eeeeeeeeeeeeeee) SEQ ID NOs: 1204 and 1205, respectively; (fffffffffffffff) SEQ ID NOs: 1206 and 1207, respectively; (ggggggggggggggg) SEQ ID NOs: 1208 and 1209, respectively; (hhhhhhhhhhhhhhh) SEQ ID NOs: 1210 and 1211, respectively; (iiiiiiiiiiiiiii) SEQ ID NOs: 1212 and 1213, respectively; (jjjjjjjjjjjjjjj) SEQ ID NOs: 1214 and 1215, respectively; (kkkkkkkkkkkkkkk) SEQ ID NOs: 1216 and 1217, respectively; (lllllllllllllll) SEQ ID NOs: 1218 and 1219, respectively; (mmmmmmmmmmmmmmm) SEQ ID NOs: 1220 and 1221, respectively; (nnnnnnnnnnnnnnn) SEQ ID NOs: 1222 and 1223, respectively; (ooooooooooooooo) SEQ ID NOs: 1224 and 1225, respectively; (ppppppppppppppp) SEQ ID NOs: 1226 and 1227,respectively; (qqqqqqqqqqqqqqq) SEQ ID NOs: 1228 and 1229, respectively; (rrrrrrrrrrrrrrr) SEQ ID NOs: 1230 and 1231, respectively; (sssssssssssssss) SEQ ID NOs: 1234 and 1235, respectively; (ttttttttttttttt) SEQ ID NOs: 1236 and 1237, respectively; (uuuuuuuuuuuuuuu) SEQ ID NOs: 1238 and 1239, respectively; (vvvvvvvvvvvvvvv) SEQ ID NOs: 1240 and 1241, respectively; (wwwwwwwwwwwwwww) SEQ ID NOs: 1242 and 1243, respectively; (xxxxxxxxxxxxxxx) SEQ ID NOs: 1244 and 1245, respectively; or (yyyyyyyyyyyyyyy) SEQ ID NOs: 1246 and 1247, respectively.

[0012] In some aspects, dsRNA agent further comprises a GalNAc cluster attached to the sense strand. In some aspects, GalNAc cluster is attached at the 3' end of the sense strand. In some aspects, the GalNAc cluster is attached at the 5' end of the sense strand. In some aspects, the GalNAc cluster comprises a structure of Formula I, Formula II, Formula III, and / or Formula IV.

[0013] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 197 and 198, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

[0014] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 812 and 813, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

[0015] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 896 and 897, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

[0016] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 1124 and 1125, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

[0017] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 1126 and 1127, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

[0018] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 1232 and 1233, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

[0019] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 197 and 198, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5’ end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

[0020] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 812 and 813, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

[0021] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 896 and 897, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

[0022] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 1124 and 1125, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

[0023] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 1126 and 1127, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

[0024] In some aspects, the sense strand and the antisense strand of the dsRNA agent have the nucleotide sequences of SEQ ID NOs: 1232 and 1233, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

[0025] In some aspects, the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent, wherein the dsRNA agent comprises a sense strand hybridized to an antisense strand, wherein the sense strand has a sequence and comprises a GalNAc cluster of a duplex described in Table 4 or Table 7, and the antisense strand has a nucleotide sequence of the same duplex described in Table 4 or Table 7.

[0026] In some aspects, the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 197 and 198, respectively, and the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

[0027] In some aspects, the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 812 and 813, respectively, and the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

[0028] In some aspects, the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 896 and 897, respectively, and the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

[0029] In some aspects, the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1124 and 1125, respectively, and the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

[0030] In some aspects, the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1126 and 1127, respectively, and the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

[0031] In some aspects, wherein the sense strand and the antisense strand have the nucleotide sequences SEQ ID NOs: 1232 and 1233, respectively, and the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

[0032] The present disclosure also provides for a compound comprising the structure set forth in Figure 4A. The present disclosure also provides for a compound comprising the structure set forth in Figure 4B. The present disclosure also provides for a compound comprising the structure set forth in Figure 4C. The present disclosure also provides for a compound comprising the structure set forth in Figure 4D.

[0033] In some aspects, the dsRNA agent or the compound is capable of inhibiting expression of alpha-2 antiplasmin (A2AP).

[0034] In some aspects, the present disclosure provides a cell comprising a dsRNA agent of the disclsoure.

[0035] In some aspects, the present disclosure provides a pharmaceutical composition comprising adsRNA agent of the disclosure.

[0036] In some aspects, the present disclosure provides a lipid nanoparticle compromising a dsRNA agent of the disclosure.

[0037] The present disclosure also provides for a method of treating an A2AP-associated disorder in a mammalian subject in need thereof, the method comprising administering to the subject a dsRNA agent, pharmaceutical composition, or lipid nanoparticle of the disclosure.

[0038] In some aspects, the A2AP-associated disorder comprises plasminogen deficiency, venous thrombosis, venous thromboembolism, deep vein thrombosis, pulmonary embolism, prosthetic valve thrombosis, post-thrombotic syndrome, atherothrombosis, heart attack, stroke, fibrinolytic disorders, hypofibrinolysis, disfibrinolysis, ischemic stroke, atrial fibrillation, myocardial infarction, peripheral arterial disease, dynamic thrombosis, coronary artery disease, microvascular thrombosis, ischemic brain injury, brain swelling, brain hemorrhage, death after thromboembolic stroke, or any combination thereof. In some aspects, the A2AP-associated disorder is plasminogen deficiency. In some aspects, the subject is a human. In some aspects, the administering comprises systemic administration. In some aspects, the systemic administration comprises intravenous administration. In some aspects, systemic administration comprises subcutaneous administration. In some aspets, the method further comprises administering a second agent to the subject.BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIG. 1A depicts plasma levels of A2AP in C57BL / 6 mice after subcutaneous administration of A2AP siRNA (Duplex ID: 3-99) at 3 or 10 mg / kg on day 0.

[0040] FIG. 1B depicts levels of mouse liver A2AP mRNA relative to GAPDH at day 7 following administration of A2AP siRNA (Duplex ID: 3-99) at 3 or 10 mg / kg on day 0.

[0041] FIG. 2A depicts plasma levels of A2AP in C57BL / 6 mice after subcutaneous administration of A2AP siRNA candidates at 3 mg / kg on day 0.

[0042] FIG. 2B depicts levels of mouse liver A2AP mRNA relative to GAPDH at day 7 following administration of A2AP siRNA candidates at 3 mg / kg on day 0.

[0043] FIG. 3A and FIG. 3B depict clot lysis profiles (top panel), clot lysis times (middle panel), and plasma levels of PLG and A2AP (bottom panel) in control Group 1 (FIG. 3A) and treatment Group 2 (FIG.3B). PLG siRNA (0.1 mg / kg) was administered on day 1 in both groups and A2AP siRNA (3 mg / kg) at day 2 in the treatment Group 2.

[0044] FIGs. 4A-4D depict chemical structures of dsRNA agents. FIG. 4A depicts the structure of Compound 6-243. FIG. 4B depicts the structure of Compound 6-190. FIG. 4C depicts the structure of the sense strand (top) and antisense strand (bottom) of Compound 6-243. FIG. 4D depicts the structure of the sense strand (top) and antisense strand (bottom) of Compound 6-190.

[0045] FIGs. 5A-5B depict the time course of wound healing expressed as mean percentage wound area. FIG. 5A depicts the kinetics of wound healing (days 4-14) presented as mean wound area ± SEM (n = 16 per group) over time. FIG. 5B depicts individual wound areas at days 11 (left panel) and 14 (right panel), respectively, with bars representing mean ± SEM of individual wound areas at days 11 and 14.

[0046] FIGs. 6A-6B depicts the effect of dsRNA agent treatment on plasma A2AP levels following weekly or single intravenous (IV) dosing. FIG. 6A depicts plasma A2AP levels (%) following weekly intravenous (IV) dosing at 30 mg / kg (Compounds 3-114 and 6-243) compared to control siRNA (30 mg / kg). FIG. 6B depicts plasma A2AP levels (%) following a single IV dose of Compound 3-114 at 1, 3, or 10 mg / kg.DETAILED DESCRIPTION

[0047] In various aspects, provided are dsRNA agents and methods of using the dsRNA agents for downregulating the expression of the Alpha-2-antiplasmin (A2AP) gene in a cell or a mammal where the dsRNA agent targets a A2AP gene, e.g., by facilitating sequence-specific degradation of A2AP mRNA. Also provided, in various aspects, are compositions and methods for treating A2AP-associated disorders, e.g., plasminogen deficiency, peripheral arterial disease, post-thrombotic syndrome, and conditions of hypofibrinolysis.Definitions

[0048] As used herein, singular forms “a”, “and,” and “the” include plural referents unless the context clearly indicates otherwise.

[0049] As used herein, all numerical values or numerical ranges include whole integers within or encompassing such ranges and fractions of the values or the integers within or encompassing ranges, and includes endpoints of such ranges, unless the context clearly indicates otherwise. Thus, for example, reference to a range of 90-100%, includes 90%, 91%, 92%, 93%, 94%, 95%, 95%, 96%, 97%, etc., as well as 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, etc., 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, etc., and so forth, including 100%. In another example, reference to a range of 1-5,000 fold includes, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, fold, etc., as well as 1.1, 1.2, 1.3, 1.4, 1.5, fold, etc., 2.1, 2.2, 2.3, 2.4, 2.5, fold, etc., and so forth, including 5,000-fold. As used herein, the term “about” or “approximately” refers to a ±10% variation from the recited quantitative value (and includes the recited quantitative value itself) unless otherwise indicated or inferred from the context.

[0050] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C or 70 °C for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences for a given context. “Complementary” sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but not limited to, G: U Wobble or Hoogsteen base pairing.

[0051] Complementary sequences within an dsRNA agent, e.g., within a dsRNA agent as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a secondsequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than five, four, three, or two mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of A2AP gene expression. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA agent comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.

[0052] As used herein, the terms “hybridized,” “hybridizing,” and “hybridization” refer to the sequence-specific association of complementary nucleic acid strands through Watson-Crick base pairing to form a double-stranded or partially double-stranded structure. In the context of sense and antisense strands, an antisense strand is a nucleic acid sequence that is reverse-complementary and antiparallel to a corresponding sense strand and is capable of hybridizing thereto under defined or physiologically relevant conditions. Hybridization includes the formation of duplexes in which only a portion of the sense and antisense strands are base-paired and further includes duplexes comprising one or more single-stranded overhangs at the 5' end, the 3' end, or both. The presence of such overhangs does not negate hybridization, provided that a complementary region of the antisense strand forms a stable duplex with the sense strand. Hybridization may occur between DNA and DNA, DNA and RNA, or RNA and RNA, including hybridization of an antisense strand to a target RNA molecule.

[0053] The term “double-stranded RNA” or “dsRNA,” as used herein, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense and “antisense” orientations with respect to a target RNA, e.g., a target A2AP mRNA. In certain aspects, a substantial portion or a majority of nucleotides of each strand are ribonucleotides, but as described in detail herein, each or both strands can also include at least one non-ribonucleotide, e.g., a deoxyribonucleotide and / or a modified nucleotide. The term “antisense strand” refers to the strand of a dsRNA which includes a region that is substantially complementary to a target sequence. As used herein, the term “region of complementarity” refers to the region on theantisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches are most tolerated in the terminal regions and, if present, are in many aspects in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5' and / or 3' terminus.

[0054] The term “sense strand,” as used herein, refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.

[0055] As used herein, “G,” “C,” “A” and “U” in the context of nucleotide sequences each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. “T” and “dT” are used interchangeably herein and refer to a deoxyribonucleotide wherein the nucleobase is thymine, e.g., deoxyribothymine. However, it will be understood that the term “ribonucleotide” or “nucleotide” or “deoxyribonucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the disclosure by a nucleotide containing, for example, inosine.

[0056] As used herein, “percent (%) identity” refers to the extent to which two sequences (nucleotide or amino acid) have the same residue at the same positions in an alignment. For example, “an amino acid sequence is X% identical to SEQ ID NO: Y” refers to % identity of the amino acid sequence to SEQ ID NO: Y and is elaborated as X% of residues in the amino acid sequence are identical to the residues of sequence disclosed in SEQ ID NO: Y. Generally, computer programs are employed for such calculations. Exemplary programs that compare and align pairs of sequences, include ALIGN (Myers and Miller, 1988), FASTA (Pearson and Lipman, 1988; Pearson, 1990) and gapped BLAST (Altschul et al., 1997), BLASTP, BLASTN, EMBOSS NEEDLE, or GCG (Devereux et al., 1984).

[0057] As used herein, the terms “silence,” “inhibit the expression of,” “down-regulate the expression of,” “suppress the expression of’ and similar terms, when used in reference to a target gene, e.g., the Alpha-2-antiplasmin (A2AP) gene, refer to the at least partial suppression of the expression of the target gene, as manifested by a reduction of the amount of mRNA which may be isolated from a first cell or group of cells in which the target gene is transcribedand which has or have been treated such that the expression of the target gene is inhibited, as compared to a control cell (e.g., a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated).

[0058] Alternatively or additionally, the degree of inhibition may be assessed in terms of a reduction of a parameter that is functionally linked to target gene expression, e.g., the amount of protein encoded by a target gene which is secreted by a cell. In principle, target gene silencing may be determined in any cell expressing the target, either constitutively or by genomic engineering, and by any appropriate assay. For example, in certain instances, expression of the target gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of a dsRNA agent. In some aspects, the target gene is suppressed by at least about 60%, 70%, or 80% by administration of a dsRNA agent. In some aspects, the target gene is suppressed by at least about 85%, 90%, or 95% by administration of a dsRNA agent.

[0059] As used herein, the term “therapeutically effective amount” or “therapeutic amount” generally refers to an amount of an agent, e.g., a therapeutic agent effective to “treat” a disease or disorder in a subject or mammal. In some aspects, a composition described herein is administered to a subject in an amount that is effective for producing some desired therapeutic effect by inhibiting a disease or disorder as described herein at a reasonable benefit / risk ratio applicable to any medical treatment. In some aspects, a therapeutically effective amount is an amount of an agent, e.g., a dsRNA agent, that achieves at least partially a desired therapeutic or prophylactic effect in an organ or tissue. The amount of the agent necessary to bring about prevention and / or therapeutic treatment of a disease or disorder is not fixed per se. In some aspects, the amount of the agent administered varies with the type of disease, extensiveness of the disease, and size of the mammal suffering from the disease or disorder. In some aspects, when used in conjunction with therapeutic methods involving administration of a therapeutic agent after the subject presents symptoms of a disease or disorder, the term “therapeutically effective” means that, after treatment, one or more signs or symptoms of the disease or disorder is ameliorated or eliminated.

[0060] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In the case of conflict, the present specification will control.dsRNA agents

[0061] Described herein, in some aspects, are double stranded ribonucleic acid (dsRNA) agents for inhibiting expression of Alpha-2-antiplasmin (A2AP), the dsRNA agents generally comprising a sense strand and an anti-sense strand. Provided dsRNA agents generally bind to an inhibit or repress an A2AP mRNA, e.g. human A2AP mRNA. Exemplary A2AP mRNA sequences are shown below (SEQ ID NOs: 245-247).

[0062] Homo sapiens serpin family F member 2 (SERPINF2), transcript variant 1 (GenBank accession number NM_000934.4) AGAGGAACGTTGTGTGTGGCAGCAAGGAGCCCGCAGAGGAACATGGCGCTGCTCTGGGGGCT CCTGGTGCTCAGCTGGTCCTGCCTGCAAGGCCCCTGCTCCGTGTTCTCCCCTGTGAGCGCCA TGGAGCCCTTGGGCCGGCAGCTAACTAGCGGGCCGAACCAGGAGCAGGTGTCCCCACTTACC CTCCTCAAGTTGGGCAACCAGGAGCCTGGTGGCCAGACTGCCCTGAAGAGTCCCCCAGGAGT CTGCAGCAGAGACCCCACCCCAGAGCAGACCCACAGGCTGGCCCGGGCCATGATGGCCTTCA CTGCCGACCTGTTCTCCCTGGTGGCTCAAACGTCCACCTGCCCCAACCTCATCCTGTCACCC CTGAGTGTGGCCCTGGCGCTGTCTCACCTGGCACTAGGTGCTCAGAACCACACGTTGCAGAG GCTGCAACAGGTGCTGCACGCAGGCTCAGGGCCCTGCCTCCCCCATCTGCTGAGCCGCCTCT GCCAGGACCTGGGCCCCGGCGCGTTCCGACTGGCTGCCAGGATGTACCTGCAGAAAGGATTT CCCATCAAAGAAGATTTCCTGGAACAATCCGAACAGCTATTTGGGGCAAAGCCCGTGAGCCT GACGGGAAAGCAGGAAGATGACCTGGCAAACATCAACCAATGGGTGAAGGAGGCCACGGAGG GGAAGATTCAGGAATTCCTCTCTGGGCTGCCGGAAGACACCGTGTTGCTTCTCCTCAACGCC ATCCACTTCCAGGGTTTCTGGAGGAACAAGTTTGACCCGAGCCTTACCCAGAGAGACTCCTT CCACCTGGACGAGCAGTTCACGGTGCCCGTGGAAATGATGCAGGCCCGCACGTACCCGCTGC GCTGGTTCTTGCTGGAGCAGCCTGAGATCCAGGTGGCTCATTTCCCCTTTAAGAACAACATG AGCTTTGTGGTCCTTGTACCCACCCACTTTGAATGGAACGTGTCCCAGGTACTGGCCAACCT GAGTTGGGACACCCTGCACCCACCTCTGGTGTGGGAGAGGCCCACCAAGGTCCGGCTGCCTA AGCTGTATCTGAAACACCAAATGGACCTGGTGGCCACCCTCAGCCAGCTGGGCCTGCAGGAG TTGTTCCAGGCCCCAGACCTGCGTGGGATCTCCGAGCAGAGCCTGGTGGTGTCCGGCGTGCA GCATCAGTCCACCCTGGAGCTCAGCGAGGTCGGCGTGGAGGCGGCGGCGGCCACCAGCATTG CCATGTCCCGCATGTCCCTGTCCTCCTTCAGCGTGAACCGCCCCTTCCTCTTCTTCATCTTC GAGGACACCACAGGCCTTCCCCTCTTCGTGGGCAGCGTGAGGAACCCCAACCCCAGTGCACC GCGGGAGCTCAAGGAACAGCAGGATTCCCCGGGCAACAAGGACTTCCTCCAGAGCCTGAAAG GCTTCCCCCGCGGAGACAAGCTTTTCGGCCCTGACTTAAAACTTGTGCCCCCCATGGAGGAG GATTACCCCCAGTTTGGCAGCCCCAAGTGAGGGGCCGTGGCTGTGGCATCCAGAGTCCCTGCCTGGACCAGCCTCTCCACTCATGTGACTCTTTCCAACCGGCTTTGTGGCACTGGGGCAGGGG CCGGGGGCAGTCTGAGAGAGGCCATTCTTTCCCAACACCTCTTGGGGAGTTTAGGGTGGGGG GGGGGCGCGGCTGGGAGGAGGGCAGGCATCGGGGAGCCGGGAGCCTGACCCTCATCTTTCTT CCAAACAGGCTCAGAGGGTGTCCTGCACCGGGGCCTGGGCAGGAGGGAGGTGCTTCTAGTTC TGCCAGGAGACAGGTTAGCTGCTCCCCACGTCAGCTGGGACACCCCGACTTTTGTTTACCAG AGAAAAAGGGAGGGGGAGAGGGCTGCCTTTGGACTTGTCCCGGGACACCTAGGCTAGGGTGG GGAGAGACGGGCCCTGGTGGTGGCTCGGGAGGCGAAGCGTTGTCCTCAGCCCCGCGTGGAAC TCGTGTCTGGCACAGCCTGGCTGTGGCCTAACCTGCCGAGAGTCCATCAGCCTCCATCCTAC CCCCTGTGCCTTGTCACGCCAGACTTCCCACGGCTCCTCGAGATCCCAACACTGCCAGCATT TCCCTTCCTTCCTCTCCTGTCTCCCTCCTCTGCCCGGGAGCTCAGGAACCGAGGCAGGGAAG GATCCCATGAGCTCCTTAAGGCTCTTTTGTAAGGTTTTTGTAGTGATTTTTATGCCACCTGA ATAAAGAATGAATGGGC (SEQ ID NO: 245)

[0063] Homo sapiens serpin family F member 2 (SERPINF2), transcript variant 2 (GenBank accession number NM_001165920.1) GGGACTTGAAAAACTGGAGCCTGTTCTTGGCAAGAAGATTCTAATGCCCAGGAACATGGCGC TGCTCTGGGGGCTCCTGGTGCTCAGCTGGTCCTGCCTGCAAGGCCCCTGCTCCGTGTTCTCC CCTGTGAGCGCCATGGAGCCCTTGGGCCGGCAGCTAACTAGCGGGCCGAACCAGGAGCAGGT GTCCCCACTTACCCTCCTCAAGTTGGGCAACCAGGAGCCTGGTGGCCAGACTGCCCTGAAGA GTCCCCCAGGAGTCTGCAGCAGAGACCCCACCCCAGAGCAGACCCACAGGCTGGCCCGGGCC ATGATGGCCTTCACTGCCGACCTGTTCTCCCTGGTGGCTCAAACGTCCACCTGCCCCAACCT CATCCTGTCACCCCTGAGTGTGGCCCTGGCGCTGTCTCACCTGGCACTAGGTGCTCAGAACC ACACGTTGCAGAGGCTGCAACAGGTGCTGCACGCAGGCTCAGGGCCCTGCCTCCCCCATCTG CTGAGCCGCCTCTGCCAGGACCTGGGCCCCGGCGCGTTCCGACTGGCTGCCAGGATGTACCT GCAGAAAGGATTTCCCATCAAAGAAGATTTCCTGGAACAATCCGAACAGCTATTTGGGGCAA AGCCCGTGAGCCTGACGGGAAAGCAGGAAGATGACCTGGCAAACATCAACCAATGGGTGAAG GAGGCCACGGAGGGGAAGATTCAGGAATTCCTCTCTGGGCTGCCGGAAGACACCGTGTTGCT TCTCCTCAACGCCATCCACTTCCAGGGTTTCTGGAGGAACAAGTTTGACCCGAGCCTTACCC AGAGAGACTCCTTCCACCTGGACGAGCAGTTCACGGTGCCCGTGGAAATGATGCAGGCCCGC ACGTACCCGCTGCGCTGGTTCTTGCTGGAGCAGCCTGAGATCCAGGTGGCTCATTTCCCCTT TAAGAACAACATGAGCTTTGTGGTCCTTGTACCCACCCACTTTGAATGGAACGTGTCCCAGG TACTGGCCAACCTGAGTTGGGACACCCTGCACCCACCTCTGGTGTGGGAGAGGCCCACCAAG GTCCGGCTGCCTAAGCTGTATCTGAAACACCAAATGGACCTGGTGGCCACCCTCAGCCAGCT GGGCCTGCAGGAGTTGTTCCAGGCCCCAGACCTGCGTGGGATCTCCGAGCAGAGCCTGGTGGTGTCCGGCGTGCAGCATCAGTCCACCCTGGAGCTCAGCGAGGTCGGCGTGGAGGCGGCGGCG GCCACCAGCATTGCCATGTCCCGCATGTCCCTGTCCTCCTTCAGCGTGAACCGCCCCTTCCT CTTCTTCATCTTCGAGGACACCACAGGCCTTCCCCTCTTCGTGGGCAGCGTGAGGAACCCCA ACCCCAGTGCACCGCGGGAGCTCAAGGAACAGCAGGATTCCCCGGGCAACAAGGACTTCCTC CAGAGCCTGAAAGGCTTCCCCCGCGGAGACAAGCTTTTCGGCCCTGACTTAAAACTTGTGCC CCCCATGGAGGAGGATTACCCCCAGTTTGGCAGCCCCAAGTGAGGGGCCGTGGCTGTGGCAT CCAGAGTCCCTGCCTGGACCAGCCTCTCCACTCATGTGACTCTTTCCAACCGGCTTTGTGGC ACTGGGGCAGGGGCCGGGGGCAGTCTGAGAGAGGCCATTCTTTCCCAACACCTCTTGGGGAG TTTAGGGTGGGGGGGGGGCGCGGCTGGGAGGAGGGCAGGCATCGGGGAGCCGGGAGCCTGAC CCTCATCTTTCTTCCAAACAGGCTCAGAGGGTGTCCTGCACCGGGGCCTGGGCAGGAGGGAG GTGCTTCTAGTTCTGCCAGGAGACAGGTTAGCTGCTCCCCACGTCAGCTGGGACACCCCGAC TTTTGTTTACCAGAGAAAAAGGGAGGGGGAGAGGGCTGCCTTTGGACTTGTCCCGGGACACC TAGGCTAGGGTGGGGAGAGACGGGCCCTGGTGGTGGCTCGGGAGGCGAAGCGTTGTCCTCAG CCCCGCGTGGAACTCGTGTCTGGCACAGCCTGGCTGTGGCCTAACCTGCCGAGAGTCCATCA GCCTCCATCCTACCCCCTGTGCCTTGTCACGCCAGACTTCCCACGGCTCCTCGAGATCCCAA CACTGCCAGCATTTCCCTTCCTTCCTCTCCTGTCTCCCTCCTCTGCCCGGGAGCTCAGGAAC CGAGGCAGGGAAGGATCCCATGAGCTCCTTAAGGCTCTTTTGTAAGGTTTTTGTAGTGATTT TTATGCCACCTGAATAAAGAATGAATGGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AA (SEQ ID NO: 246)

[0064] Homo sapiens serpin family F member 2 (SERPINF2), transcript variant 3 (GenBank accession number NM_001165921.2) AGAGGAACGTTGTGTGTGGCAGCAAGGAGCCCGCAGAGGAACATGGCGCTGCTCTGGGGGCT CCTGGTGCTCAGCTGGTCCTGCCTGCAAGGCCCCTGCTCCGTGTTCTCCCCTGTGAGCGCCA TGGAGCCCTTGGGCCGGCAGCTAACTAGCGGGCCGAACCAGGAGCAGGTGTCCCCACTTACC CTCCTCAAGTTGGGCAACCAGGTACAACCAGGTGCTCAGAACCACACGTTGCAGAGGCTGCA ACAGGTGCTGCACGCAGGCTCAGGGCCCTGCCTCCCCCATCTGCTGAGCCGCCTCTGCCAGG ACCTGGGCCCCGGCGCGTTCCGACTGGCTGCCAGGATGTACCTGCAGAAAGGATTTCCCATC AAAGAAGATTTCCTGGAACAATCCGAACAGCTATTTGGGGCAAAGCCCGTGAGCCTGACGGG AAAGCAGGAAGATGACCTGGCAAACATCAACCAATGGGTGAAGGAGGCCACGGAGGGGAAGA TTCAGGAATTCCTCTCTGGGCTGCCGGAAGACACCGTGTTGCTTCTCCTCAACGCCATCCAC TTCCAGGGTTTCTGGAGGAACAAGTTTGACCCGAGCCTTACCCAGAGAGACTCCTTCCACCT GGACGAGCAGTTCACGGTGCCCGTGGAAATGATGCAGGCCCGCACGTACCCGCTGCGCTGGT TCTTGCTGGAGCAGCCTGAGATCCAGGTGGCTCATTTCCCCTTTAAGAACAACATGAGCTTTGTGGTCCTTGTACCCACCCACTTTGAATGGAACGTGTCCCAGGTACTGGCCAACCTGAGTTG GGACACCCTGCACCCACCTCTGGTGTGGGAGAGGCCCACCAAGGTCCGGCTGCCTAAGCTGT ATCTGAAACACCAAATGGACCTGGTGGCCACCCTCAGCCAGCTGGGCCTGCAGGAGTTGTTC CAGGCCCCAGACCTGCGTGGGATCTCCGAGCAGAGCCTGGTGGTGTCCGGCGTGCAGCATCA GTCCACCCTGGAGCTCAGCGAGGTCGGCGTGGAGGCGGCGGCGGCCACCAGCATTGCCATGT CCCGCATGTCCCTGTCCTCCTTCAGCGTGAACCGCCCCTTCCTCTTCTTCATCTTCGAGGAC ACCACAGGCCTTCCCCTCTTCGTGGGCAGCGTGAGGAACCCCAACCCCAGTGCACCGCGGGA GCTCAAGGAACAGCAGGATTCCCCGGGCAACAAGGACTTCCTCCAGAGCCTGAAAGGCTTCC CCCGCGGAGACAAGCTTTTCGGCCCTGACTTAAAACTTGTGCCCCCCATGGAGGAGGATTAC CCCCAGTTTGGCAGCCCCAAGTGAGGGGCCGTGGCTGTGGCATCCAGAGTCCCTGCCTGGAC CAGCCTCTCCACTCATGTGACTCTTTCCAACCGGCTTTGTGGCACTGGGGCAGGGGCCGGGG GCAGTCTGAGAGAGGCCATTCTTTCCCAACACCTCTTGGGGAGTTTAGGGTGGGGGGGGGGC GCGGCTGGGAGGAGGGCAGGCATCGGGGAGCCGGGAGCCTGACCCTCATCTTTCTTCCAAAC AGGCTCAGAGGGTGTCCTGCACCGGGGCCTGGGCAGGAGGGAGGTGCTTCTAGTTCTGCCAG GAGACAGGTTAGCTGCTCCCCACGTCAGCTGGGACACCCCGACTTTTGTTTACCAGAGAAAA AGGGAGGGGGAGAGGGCTGCCTTTGGACTTGTCCCGGGACACCTAGGCTAGGGTGGGGAGAG ACGGGCCCTGGTGGTGGCTCGGGAGGCGAAGCGTTGTCCTCAGCCCCGCGTGGAACTCGTGT CTGGCACAGCCTGGCTGTGGCCTAACCTGCCGAGAGTCCATCAGCCTCCATCCTACCCCCTG TGCCTTGTCACGCCAGACTTCCCACGGCTCCTCGAGATCCCAACACTGCCAGCATTTCCCTT CCTTCCTCTCCTGTCTCCCTCCTCTGCCCGGGAGCTCAGGAACCGAGGCAGGGAAGGATCCC ATGAGCTCCTTAAGGCTCTTTTGTAAGGTTTTTGTAGTGATTTTTATGCCACCTGAATAAAG AATGAATGGGC (SEQ ID NO: 247)

[0065] Table 1 provides non-limiting examples of nucleotides (including modified nucleotides) and modifications that may be used in dsRNA agents disclosed herein.

[0066] Tables 2 and 5 provide the nucleotide sequences of sense and anti-sense strands of non-limiting examples of contemplated dsRNA agents.

[0067] In some aspects, the dsRNA agents comprise at least one modified nucleotide in the sense strand or anti-sense strand; in some aspects, both the sense and anti-sense strands each comprise at least one modified nucleotide. In some aspects, the modified nucleotide comprises a chemical modification, e.g., as described herein. In some aspects, at least one of the sense strand and the antisense strand comprises at least one intemucleoside linkage, e.g., as described herein. For example, contemplated dsRNA agents include those for whom the primary nucleotide sequences of the sense and anti-sense strands are shown in Table 1, but which alsocomprise one or more modified nucleotides (e.g., chemical modifications to nucleotides) and / or internucleoside linkages.

[0068] Tables 3 and 6 provide sequences (including chemical modifications) of sense and anti-sense strands of non-limiting examples of contemplated dsRNA agents.

[0069] In some aspects, dsRNA agents further comprise a GalNAc structure, e.g. as described herein. In some aspects, the GalNAc structure is attached to the sense strand, e.g., at the 3' end or at the 5' end. Tables 4 and 7 provide full sequences including any chemical modifications and / or GalNAc structures of sense and anti-strands of non-limiting examples of contemplated dsRNA agents.Table 1. Exemplary nucleotides and modifications used in dsRNA agents disclosed hereinSymbol Nucleotides / Modificationsa 2'-O-methyladenosine-3'-phosphateas 2'-O-methyladenosine-3'-phosphorothioateAf 2'-fluoroadenosine-3 '-phosphateAfs 2'-fluoroadenosine-3'-phosphorothioateAm 2'-O-(2-methoxyethyl)adenosine-3'-phosphateAms 2'-O-(2-methoxyethyl)adenosine-3'-phosphorothioate (GNA-A) Adenosine-glycol nucleic acids (GNA) s-isomerc 2'-O-methylcytidine-3'-phosphatecs 2'-O-methylcytidine-3'-phosphorothioateCf 2'-fluorocytidine-3 '-phosphateCfs 2'-fluorocytidine-3'-phosphorothioate(GNA-C) Cytidine-glycol nucleic acids (GNA) s-isomerg 2'-O-methylguanosine-3'-phosphategs 2'-O-methylguanosine-3'-phosphorothioateGf 2'-fluoroguanosine-3 '-phosphateGfs 2'-fluoroguanosine-3'-phosphorothioateu 2'-O-methyluridine-3 '-phosphateSymbol Nucleotides / Modificationsus 2'-O-methyluridine-3'-phosphorothioateUf 2'-fluorouridine-3 '-phosphateUfs 2'-fluorouridine-3'-phosphorothioate(GNA-T) Thymidine-glycol nucleic acids (GNA) s-isomer5'-(E-(dihydroxy)phosphinylmethylidene)-5'-deoxy-2'-O- (vinu)methyluridine-3 '-phosphate5'-(E-(dihydroxy)phosphinylmethylidene)-5'-deoxy-2'-<9- (vinu)smethyluridine-3'-phosphorothioates Phosphorothioate linkageGalNAc cluster having the structure of Formula III (GalNAc-TEG) (see Table 8 below; see also GahC2 triantennary cluster- phosphate, Bioconj. Chem. 2018, 29, 2478) (MonoGalNAc-TEG) Monomeric GalNAc-TEG-phosphate unit (MonoGalNAc- GalNAc cluster having the structure of Formula IV TEG)s(MonoGalNAc- (see Table 8 below; see also GahC2 triantennary cluster- TEG)s(MonoGalNAc-TEG)s phosphorothioate, Bioconj. Chem. 2018, 29, 2478) (MonoGalNAc-TEG)s Monomeric GalNAc-TEG-phosphorothioate unit GalNAc cluster having the structure of Formula II (see Table 8 (GalNAc3)(NHC6)below)(NHC6) Aminohexyl-linker; 6-aminohexyl-phosphateGalNAc cluster having the structure of Formula I (see Table 8 (L96)below)A adenosine-3 '-phosphateC cytidine-3 '-phosphateG guanosine-3 '-phosphateU uridine-3 '-phosphatedA 2'-deoxy adenosine-3 '-phosphatedC 2'-deoxy cytidine-3 '-phosphatedG 2'-deoxy guanosine-3 '-phosphateDl IDpeuxSymbol Nucleotides / ModificationsSttar dT 2'-deoxythymidine-3 '-phosphateiit posondU 2'-deoxyuridine-3 '-phosphateTable 2. Nucleotide sequences of exemplary dsRNA agentsNucleotide SequenceSEQ SEQ ID Sense strand ID Anti-sense strand NO (5’ to 3’) NO (5’ to 3’)1-1 547 1 C AGAAAGGAUUUC C CAUCAAA 2 UUUGAUGGGAAAUCCUUUCUGCA 1-2 547 3 GAAAGGAUUUC C CAUCAAA 4 UUUGAUGGGAAAUC CUUUCUG 1-3 714 5 GGAAGACACCGUGUUGCUUCA 6 UGAAGCAACACGGUGUCUUCCGG 1-4 714 7 AAGACACCGUGUUGCUUCA 8 UGAAGCAACACGGUGUCUUCC 1-5 721 9 AC CGUGUUGCUUCUC CUC AAA 10 UUUGAGGAGAAGCAACACGGUGU 1-6 721 11 CGUGUUGCUUCUCCUCAAA 12 UUUGAGGAGAAGCAACACGGU 1-7 723 13 CGUGUUGCUUCUCCUCAACGA 14 UCGUUGAGGAGAAGCAACACGGU 1-8 725 15 UGUUGCUUCUCCUCAACGCCA 16 UGGCGUUGAGGAGAAGCAACACG 1-9 725 15 UGUUGCUUCUCCUCAACGCCA 238 UGGCGUTGAGGAGAAGCAACACG 1-10 725 15 UGUUGCUUCUCCUCAACGCCA 239 UGGCGTUGAGGAGAAGCAACACG 1-11 725 17 UUGCUUCUCCUCAACGCCA 18 UGGCGUUGAGGAGAAGCAACA 1-12 1263 19 CUC CUUC AGCGUGAAC CGC C A 20 UGGCGGUUCACGCUGAAGGAGGA 1-13 1263 19 CUC CUUC AGCGUGAAC CGC C A 240 UGGCGGTUCACGCUGAAGGAGGA 1-14 1629 21 AGAGGC C AUUCUUUC C CAAC A 22 UGUUGGGAAAGAAUGGCCUCUCU 1-15 2073 23 C C C ACGGCUC CUCGAGAUC C A 24 UGGAUCUCGAGGAGCCGUGGGAA 1-16 2073 23 C C C ACGGCUC CUCGAGAUC C A 241 UGGAUCTCGAGGAGCCGUGGGAA 1-17 2181 25 GCUCCUUAAGGCUCUUUUGUA 26 UACAAAAGAGCCUUAAGGAGCUC 1-18 2181 27 UCCUUAAGGCUCUUUUGUA 28 UACAAAAGAGCCUUAAGGAGC 1-19 2197 29 UUGUAAGGUUUUUGUAGUGAA 30 UUC ACUACAAAAAC CUUAC AAAA 1-20 2197 29 UUGUAAGGUUUUUGUAGUGAA 242 UUCACTACAAAAACCUUACAAAA 1-21 2197 31 GUAAGGUUUUUGUAGUGAA 32 UUC ACUACAAAAAC CUUAC AA 1-22 2199 33 GUAAGGUUUUUGUAGUGAUUA 34 UAAUC ACUACAAAAAC CUUACAA 1-23 2199 35 AAGGUUUUUGUAGUGAUUA 36 UAAUC ACUACAAAAAC CUUACDl IDpeuxNucleotide SequenceSttar SEQ SEQiit poson ID Sense strand ID Anti-sense strand NO (5’ to 3’) NO (5’ to 3’) 1-24 2207 37 UUUGUAGUGAUUUUUAUGCCA 38 UGGCAUAAAAAUCACUACAAAAA 1-25 37 2432207 UUUGUAGUGAUUUUUAUGCCA UGGCATAAAAAUCACUACAAAAA 1-26 2207 39 UGUAGUGAUUUUUAUGCCA 40 UGGCAUAAAAAUCACUACAAA 1-27 2208 41 UUGUAGUGAUUUUUAUGCCAA 42 UUGGCAUAAAAAUCACUACAAAA 1-28 2208 41 UUGUAGUGAUUUUUAUGCCAA 244 UUGGCATAAAAAUCACUACAAAA 1-29 2208 43 GUAGUGAUUUUUAUGCCAA 44 UUGGCAUAAAAAUCACUACAA 1-30 2210 45 GUAGUG AUUUUUAUG C GAG GA 46 UGGUGG CAUAAAAAUCACUACAA 1-31 2210 47 AGUG AUUUUUAUG C GAG GA 48 UGGUGG CAUAAAAAUCACUACTable 3. Sequences of exemplary dsRNA agents (UMS* = Unmodified Sequence)SequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)547 familyUMS* 1 C AGAAAGGAUUUC C CAUCAAA 2 UUUGAUGGGAAAUCCUUUCUGCA (vinu) sUf sugaUfgggaaauCf c 2-1 49 csasgaaaGfgAfUfUf ucccaucaaa 50 UfuucugscsacsasgaAf aggAf UfUf ucccaucAf a (vinu) sUf sugaugggaaauCf cu 2-2 51 a 52 uucugscsacsasgaAf aggAf UfUf ucccaucAf a (vinu) sUf sugaUfgggaaauCf c 2-3 51 a 54 uuucugscsa(vinu) sUf sugaUfgggaaauCf c 2-4 53 csasgaAf aggAf UfdTucccaucaaa 54 uuucugscsa(vinu) sUf sugaUfgggaaauCf c 2-5 55 csasgaAf aggAf dTUf ucccaucaaa 54 uuucugscsa(vinu) sUf sugaUfgggaaauCf c 2-6 56 csasgaAf aggdAUf Uf ucccaucaaa 54 uuucugscsa(vinu) sUf sugaUfgggaaauCf c 2-7 57 csasgaAf aggAf UfAf ucccaucaaa 54 uuucugscsaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) (vinu) sUf sugaUf gggaaauCf c 2-8 58 csasgaAf aggAfUfUf acccaucaaa 54 uuucugscsa(vinu) sUf sugaUf gggaaauCf c 2-9 59 csasgaAf aggAf Uf Uf ugccaucaaa 54 uuucugscsacsasgaAf aggAfUfUf ucccaucaaA (vinu) sUf sugaUf gggaaauCf c 2-10 60 m 61 uuucugsCmsAmusUf sugaUf gggaaauCf cUfuuc 2-11 49 csasgaaaGfgAfUfUfucccaucaaa 62 ugscsaUMS* 3 GAAAGGAUUUC C CAUCAAA 4 UUUGAUGGGAAAUC CUUUCUG (vinu) sUf sugaUfgggaaauCf c 2-12 63 gsasaaGfgAfUfUfucccaucaaa 64 Ufuucsusg714 familyUMS* 5 GGAAGACACCGUGUUGCUUCA 6 UGAAGCAACACGGUGUCUUCCGG (vinu) sGf saagCf aacacggUfg 2-13 65 gsgsaagaCf aCf Cf Gf uguugcuuca 66 Uf cuuccsgsggsgsaaGf acaCf CfGf uguugcuUf c (vinu) sGf saagcaacacggUf gu 2-14 67 a 68 cuuccsgsggsgsaaGf acaCf CfGf uguugcuUf c (vinu) sGf saagCf aacacggUfg 2-15 67 a 69 ucuuccsgsg(vinu) sGf saagCf aacacggUfg 2-16 70 gsgsaaGf acaCf CfdGuguugcuuca 69 ucuuccsgsg(vinu) sGf saagCf aacacggUfg 2-17 71 gsgsaaGf acaCf dCGf uguugcuuca 69 ucuuccsgsg(vinu) sGf saagCf aacacggUfg 2-18 72 gsgsaaGf acadCCf Gf uguugcuuca 69 ucuuccsgsg(vinu) sGf saagCf aacacggUfg 2-19 73 gsgsaaGf acaCf CfCf uguugcuuca 69 ucuuccsgsg(vinu) sGf saagCf aacacggUfg 2-20 74 gsgsaaGf acaCf CfGf aguugcuuca 69 ucuuccsgsg(vinu) sGf saagCf aacacggUfg 2-21 75 gsgsaaGf acaCf CfGf ucuugcuuca 69 ucuuccsgsggsgsaaGf acaCf CfGf uguugcuucA (vinu) sGf saagCf aacacggUfg 2-22 76 m 77 ucuuccsGmsGmgsgsaaGf acaCf CfGf uguugcuUf c (vinu) sGf saagCf (GNA- 2-23 67 a 78 A) acacggUf gucuuccsgsg gsgsaaGf acaCf CfGf uguugcuUf c (vinu) sGf saag (GNA- 2-24 67 a 79 C) aacacggUf gucuuccsgsg UMS* 7 AAGACACCGUGUUGCUUCA 8 UGAAGCAACACGGUGUCUUCC (vinu) sGf saagCf aacacggUfg 2-25 80 asasgaCfaCf CfGf uguugcuuca 81 Uf cuuscscSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)721 familyUMS* 9 AC CGUGUUGCUUCUC CUC AAA 10 UUUGAGGAGAAGCAACACGGUGU (vinu) sUf sugaGf gagaagcAf a 2-26 82 as cscgugUfuGf CfUfucuccucaaa 83 Cf acggusgsu ascscgUfguuGf CfUfucuccucAf a (vinu) sUf sugaggagaagcAf ac 2-27 84 a 85 acggusgsu ascscgUfguuGf CfUfucuccucAf a (vinu) sUf sugaGf gagaagcAf a 2-28 84 a 86 cacggusgsu(vinu) sUf sugaGf gagaagcAf a 2-29 87 ascscgUfguuGf CfdTucuccucaaa 86 cacggusgsu(vinu) sUf sugaGf gagaagcAf a 2-30 88 ascscgUfguuGf dCUf ucuccucaaa 86 cacggusgsu(vinu) sUf sugaGf gagaagcAf a 2-31 89 ascscgUfguudGCfUfucuccucaaa 86 cacggusgsu(vinu) sUf sugaGf gagaagcAf a 2-32 90 ascscgUfguuGf CfAf ucuccucaaa 86 cacggusgsu(vinu) sUf sugaGf gagaagcAf a 2-33 91 ascscgUfguuGf CfUfacuccucaaa 86 cacggusgsu(vinu) sUf sugaGf gagaagcAf a 2-34 92 ascscgUfguuGf CfUfuguccucaaa 86 cacggusgsu ascscgUfguuGf CfUfucuccucaaA (vinu) sUf sugaGf gagaagcAf a 2-35 93 m 94 cacggusGmsTmUMS* 11 CGUGUUGCUUCUCCUCAAA 12 UUUGAGGAGAAGCAACACGGU (vinu) sUf sugaGf gagaagcAf a 2-36 95 csgsugUfuGf CfUfucuccucaaa 96 Cf acgsgsu723 familyUMS* 13 CGUGUUGCUUCUCCUCAACGA 14 UCGUUGAGGAGAAGCAACACGGU (vinu) sCf sguuGf aggagaaGf c 2-37 97 csgsuguuGf cUfUf Cfuccucaacga 98 Af acacgsgsu csgsugUfugcUfUf CfuccucaaCfg (vinu) sCf sguuGf (GNA- 2-38 99 a 100 A) ggagaaGf caacacgsgsu csgsugUfugcUfUf CfuccucaaCfg (vinu) sCf sguuGf aggagaaGf c 2-39 99 a 101 aacacgsgsu725 familyUGGCGUUGAGGAGAAGCAACACG UMS* 15 UGUUGCUUCUCCUCAACGCCA 16 (See also SEQ ID NOs: 238 and 239, in which one of the uracils in SEQ ID NO: 16 is modified to a thymine) (vinu) sGf sgcgUf ugaggagAf a 2-40 102 usgsuugcUfuCfUf Cf cucaacgcca 103 Gf caacascsgSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) usgsuuGf cuuCfUf Cf cucaacgCf c (vinu) sGf sgcguugaggagAf ag 2-41 104 a 105 caacascsgusgsuuGf cuuCfUf Cf cucaacgCf c (vinu) sGf sgcgUf ugaggagAf a 2-42 104 a 106 gcaacascsg(vinu) sGf sgcgUf ugaggagAf a 2-43 107 usgsuuGf cuuCfUf dCcucaacgcca 106 gcaacascsg(vinu) sGf sgcgUf ugaggagAf a 2-44 108 usgsuuGf cuuCf dTCf cucaacgcca 106 gcaacascsg(vinu) sGf sgcgUf ugaggagAf a 2-45 109 usgsuuGf cuudCUfCf cucaacgcca 106 gcaacascsg(vinu) sGf sgcgUf ugaggagAf a 2-46 110 usgsuuGf cuuCf UfGf cucaacgcca 106 gcaacascsg(vinu) sGf sgcgUf ugaggagAf a 2-47 111 usgsuuGf cuuCfUf Cfgucaacgcca 106 gcaacascsg(vinu) sGf sgcgUf ugaggagAf a 2-48 112 usgsuuGf cuuCfUf Cf cacaacgcca 106 gcaacascsgusgsuuGf cuuCfUf Cf cucaacgccA (vinu) sGf sgcgUf ugaggagAf a 2-49 113 m 114 gcaacasCmsGmusgsuuGf cuuCfUf Cf cucaacgCf c (vinu) sGf sgcgUf (GNA- 2-50 104 a 115 T) gaggagAf agcaacascsg usgsuuGf cuuCfUf Cf cucaacgCf c (vinu) sGf sgcg (GNA- 2-51 104 a 116 T) ugaggagAf agcaacascsg UMS* 17 UUGCUUCUCCUCAACGCCA 18 UGGCGUUGAGGAGAAGCAACA (vinu) sGf sgcgUf ugaggagAf a 2-52 117 ususgcUfuCfUf Cf cucaacgcca 118 Gf caascsa1263 familyUGGCGGUUCACGCUGAAGGAGG A UMS* 19 CUC CUUC AGCGUGAAC CGC C A 20 (See also SEQ ID NO: 240, in which one of the uracils in SEQ ID NO: 20 is modified to a thymine)(vinu) sGf sgcgGfuucacgc 2-53 119 csusccuuCf aGf CfGfugaaccgcca 120 UfgAf aggagsgsa csusccUfucaGf Cf Gf ugaaccgCf c (vinu) sGf sgcgGfuucacgcUfg 2-54 121 a 122 aaggagsgsa csusccUfucaGf CfGf ugaaccgCf c (vinu) sGf sgcgGf (GNA- 2-55 121 a 123 T) ucacgcUf gaaggagsgsa 1629 familyUMS* 21 AGAGGC C AUUCUUUC C CAACA 22 UGUUGGGAAAGAAUGGCCUCUCUSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) (vinu) sGf suugGf gaaagaaUf g 2-56 124 asgsaggcCf aUfUf Cfuuucccaaca 125 Gf ccucuscsuasgsagGf ccaUfUf CfuuucccaAf c (vinu) sGf suugGf gaaagaaUf g 2-57 126 a 127 gccucuscsu2073 familyUGGAUCUCGAGGAGCCGUGGGAA UMS* 23 C C C ACGGCUC CUCGAGAUC GA 24 (See also SEQ ID NO: 241, in which one of the uracils in SEQ ID NO: 24 is modified to a thymine) (vinu) sGf sgauCf ucgaggaGf c 2-58 128 cscscacgGf cUf Cf Cfucgagaucca 129 Cf gugggsasa cscscaCfggcUf Cf CfucgagauCf c (vinu) sGf sgau (GNA- 2-59 130 a 131 C) ucgaggaGf ccgugggsasa cscscaCfggcUf Cf CfucgagauCf c (vinu) sGf sgauCf ucgaggaGf c 2-60 130 a 132 cgugggsasa cscscaCfggcUf Cf CfucgagauCf c (vinu) sGf sgauCf (GNA- 2-61 130 a 133 T) cgaggaGf ccgugggsasa 2181 familyUMS* 25 GCUCCUUAAGGCUCUUUUGUA 26 UACAAAAGAGCCUUAAGGAGCUC (vinu) sAf scaaAf agagccuUf a 2-62 134 gscsuccuUfaAfGfGf cucuuuugua 135 Afggagcsusc gscsucCfuuaAfGfGf cucuuuuGfu (vinu) sAf scaaaagagccuUf aa 2-63 136 a 137 ggagcsusc gscsucCfuuaAfGfGf cucuuuuGfu (vinu) sAf scaaAf agagccuUf a 2-64 138 a 139 aggagcsusc(vinu) sAf scaaAf agagccuUf a 2-65 140 gscsucCf uuaAf Gf dGcucuuuugua 139 aggagcsusc(vinu) sAf scaaAf agagccuUf a 2-66 141 gscsucCf uuaAf dGGf cucuuuugua 139 aggagcsusc(vinu) sAf scaaAf agagccuUf a 2-67 142 gscsucCfuuadAGfGf cucuuuugua 139 aggagcsusc(vinu) sAf scaaAf agagccuUf a 2-68 143 gscsucCf uuaAf Gf C f cucuuuugua 139 aggagcsusc(vinu) sAf scaaAf agagccuUf a 2-69 144 gscsucCf uuaAf Gf Gf gucuuuugua 139 aggagcsusc(vinu) sAf scaaAf agagccuUf a 2-70 145 gscsucCf uuaAf Gf Gf cacuuuugua 139 aggagcsusc gscsucCfuuaAfGfGf cucuuuuguA (vinu) sAf scaaAf agagccuUf a 2-71 146 m 147 aggagcsTmsCmUMS* 27 UCCUUAAGGCUCUUUUGUA 28 UACAAAAGAGCCUUAAGGAGCSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) (vinu) sAf scaaAf agagccuUf a 2-72 148 uscscuUf aAfGfGf cucuuuugua 149 Afggasgsc2197 FamilyUUC ACUAC AAAAAC CUUAC AAAA UMS* 29 UUGUAAGGUUUUUGUAGUGAA 30 (See also SEQ ID NO: 242, in which one of the uracils in SEQ ID NO: 30 is modified to a thymine) (vinu) sUf scacUf acaaaaaCf c 2-73 150 ususguaaGfgUf UfUf uuguagugaa 151 Uf uacaasasaususguAf aggUf Uf Uf uuguaguGf a (vinu) sUf scacuacaaaaaCf cu 2-74 152 a 153 uacaasasaususguAf aggUf Uf Uf uuguaguGf a (vinu) sUf scacUf acaaaaaCf c 2-75 152 a 154 uuacaasasa(vinu) sUf scacUf acaaaaaCf c 2-76 155 ususguAf aggUf UfdTuuguagugaa 154 uuacaasasa(vinu) sUf scacUf acaaaaaCf c 2-77 156 ususguAf aggUf dTUf uuguagugaa 154 uuacaasasa(vinu) sUf scacUf acaaaaaCf c 2-78 157 ususguAf aggdTUf Uf uuguagugaa 154 uuacaasasa(vinu) sUf scacUf acaaaaaCf c 2-79 158 ususguAf aggUf UfAf uuguagugaa 154 uuacaasasa(vinu) sUf scacUf acaaaaaCf c 2-80 159 ususguAf aggUf UfUfauguagugaa 154 uuacaasasa(vinu) sUf scacUf acaaaaaCf c 2-81 160 ususguAf aggUf UfUfuaguagugaa 154 uuacaasasaususguAf aggUf Uf Uf uuguagugaA (vinu) sUf scacUf acaaaaaCf c 2-82 161 m 162 uuacaasAmsAmususguAf aggUf UfUf uuguaguGf a (vinu) sUf scacUf (GNA- 2-83 152 a 163 A) caaaaaCf cuuacaasasa ususguAf aggUf UfUf uuguaguGf a (vinu) sUf scac (GNA- 2-84 152 a 164 T) acaaaaaCf cuuacaasasa UMS* 31 GUAAGGUUUUUGUAGUGAA 32 UUC ACUACAAAAAC CUUAC AA (vinu) sUf scacUf acaaaaaCf c 2-85 165 gsusaaGf gUf UfUf uuguagugaa 166 Ufuacsasa2199 familyUMS* 33 GUAAGGUUUUUGUAGUGAUUA 34 UAAUC ACUACAAAAAC CUUACAA (vinu) sAf saucAf cuacaaaAf a 2-86 167 gsusaaggUf uUf Uf Uf guagugauua 168 Cf cuuacsasagsusaaGf guuUf UfUf guagugaUfu (vinu) sAf saucacuacaaaAf ac 2-87 169 a 170 cuuacsasaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gsusaaGf guuUf Uf Uf guagugaUf u (vinu) sAf saucAf cuacaaaAf a 2-88 169 a 171 ccuuacsasa(vinu) sAf saucAf cuacaaaAf a 2-89 172 gsusaaGfguuUfUfdTguagugauua 171 ccuuacsasa(vinu) sAf saucAf cuacaaaAf a 2-90 173 gsusaaGf guuU f dTUf guagugauua 171 ccuuacsasa(vinu) sAf saucAf cuacaaaAf a 2-91 174 gsusaaGf guudTUf Uf guagugauua 171 ccuuacsasa(vinu) sAf saucAf cuacaaaAf a 2-92 175 gsusaaGf guuUf Uf Af guagugauua 171 ccuuacsasa(vinu) sAf saucAf cuacaaaAf a 2-93 176 gsusaaGf guuUf Uf Uf Guagugauua 171 ccuuacsasa(vinu) sAf saucAf cuacaaaAf a 2-94 177 gsusaaGf guuUf UfUfgaagugauua 171 ccuuacsasagsusaaGf guuUf Uf Uf guagugauuA (vinu) sAf saucAf cuacaaaAf a 2-95 178 m 179 ccuuacsAmsAmgsusaaGf guuUf UfUf guagugaUf u (vinu) sAf saucAf (GNA- 2-96 169 a 180 C) uacaaaAf accuuacsasa gsusaaGf guuUf UfUf guagugaUf u (vinu) sAf sauc (GNA- 2-97 169 a 181 A) cuacaaaAf accuuacsasa UMS* 35 AAGGUUUUUGUAGUGAUUA 36 UAAUC ACUAC AAAAAC CUUAC (vinu) sAf saucAf cuacaaaAf a 2-98 182 asasggUfuUf UfUf guagugauua 183 Cf cuusasc2207 familyUGGCAUAAAAAUCACUACAAAAA UMS* 37 UUUGUAGUGAUUUUUAUGCCA 38 (See also SEQ ID NO: 243, in which one of the uracils in SEQ ID NO: 38 is modified to a thymine) (vinu) sGf sgcaUf aaaaaucAf c 2-99 184 ususuguaGf uGf Af Uf uuuuaugcca 185 Uf acaaasasa sususuguaGfuGf AfUf uuuuaugcs (vinu) sGf sgcaUf aaaaaucAf c 2-100 186 csa 185 Uf acaaasasa ususuguaGf uGfAfUf uuuuaugcs c (vinu) sGf sgcaUf aaaaaucAf c 2-101 187 sa 185 Uf acaaasasaususugUf aguGf Af Uf uuuuaugCf c (vinu) sGf sgcauaaaaaucAf cu 2-102 188 a 189 acaaasasaususugUf aguGf AfUf uuuuaugCf c (vinu) sGf sgcaUf aaaaaucAf c 2-103 188 a 190 uacaaasasa(vinu) sGf sgcaUf aaaaaucAf c 2-104 191 ususugUf aguGf AfdTuuuuaugcca 190 uacaaasasaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) (vinu) sGf sgcaUf aaaaaucAf c 2-105 192 ususugUf aguG f dAU f uuuuaug cca 190 uacaaasasa(vinu) sGf sgcaUf aaaaaucAf c 2-106 193 ususugUf agudGAf U f uuuuaug cca 190 uacaaasasa(vinu) sGf sgcaUf aaaaaucAf c 2-107 194 ususugUf aguGf AfAf uuuuaugcca 190 uacaaasasa(vinu) sGf sgcaUf aaaaaucAf ususugUf aguGf Af Uf auuuaugcca c 2-108 195 190 uacaaasasa(vinu) sGf sgcaUf aaaaaucAf c 2-109 196 ususugUf aguGf Af Uf uauuaugcca 190 uacaaasasaususugUf aguGf Af Uf uuuuaugccA (vinu) sGf sgcaUf aaaaaucAf c 2-110 197 m 198 uacaaasAmsAmusGf sgcaUf aaaaaucAf cUfaca 2-111 184 ususuguaGf uGf Af Uf uuuuaugcca 199 aasasaususugUf aguGf Af Uf uuuuaugccA (vinu) sGf sgcaUf (GNA- 2-112 197 m 200 A) aaaaucAf cuacaaasAmsAm ususugUf aguGf Af Uf uuuuaugccA (vinu) sGf sgca (GNA- 2-113 197 m 201 T) aaaaaucAf cuacaaasAmsAm UMS* 39 UGUAGUGAUUUUUAUGCCA 40 UGGCAUAAAAAUCACUACAAA (vinu) sGf sgcaUf aaaaaucAf c 2-114 202 usgsuaGf uGf Af Uf uuuuaugcca 203 Uf acasasa2208 familyUUGGCAUAAAAAUCACUACAAAA UMS* 41 UUGUAGUGAUUUUUAUGCCAA 42 (See also SEQ ID NO: 244, in which one of the uracils in SEQ ID NO: 42 is modified to a thymine) (vinu) sUf sggcAf uaaaaauCf a 2-115 204 ususguagUf gAf Uf Uf uuuaugccaa 205 Cf uacaasasa ususguAfgugAfUfUfuuuaugcCf a (vinu) sUf sggcauaaaaauCf ac 2-116 206 a 207 uacaasasa ususguAfgugAfUfUfuuuaugcCf a (vinu) sUf sggcAf uaaaaauCf a 2-117 206 a 208 cuacaasasa(vinu) sUf sggcAf uaaaaauCf a 2-118 209 ususguAf gugAf Uf dTuuuaugccaa 208 cuacaasasa(vinu) sUf sggcAf uaaaaauCf a 2-119 210 ususguAf gugAf dTUf uuuaugccaa 208 cuacaasasa(vinu) sUf sggcAf uaaaaauCf a 2-120 211 ususguAf gugdAUf Uf uuuaugccaa 208 cuacaasasaususguAf gugAf Uf Af uuuaugccaa (vinu) sUf sggcAf uaaaaauCf a 2-121 212 208 cuacaasasaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) (vinu) sUf sggcAf uaaaaauCf a 2-122 213 ususguAf gugAf Uf Uf auuaugccaa 208 cuacaasasa(vinu) sUf sggcAf uaaaaauCf a 2-123 214 ususguAf gugAf Uf Uf uauaugccaa 208 cuacaasasaususguAf gugAf Uf Uf uuuaugccaA (vinu) sUf sggcAf uaaaaauCf a 2-124 215 m 216 cuacaasAmsAmususguAf gugAf UfUf uuuaugcCf a (vinu) sUf sggcAf (GNA- 2-125 206 a 217 T) aaaaauCf acuacaasasa ususguAf gugAf UfUf uuuaugcCf a (vinu) sUf sggc (GNA- 2-126 206 a 218 A) uaaaaauCf acuacaasasa UMS* 43 GUAGUGAUUUUUAUGCCAA 44 UUGGCAUAAAAAUCACUACAA (vinu) sUf sggcAf uaaaaauCf a 2-127 219 gsusagUf gAf Uf Uf uuuaugccaa 220 Cfuacsasa2210 familyUMS* 45 GUAGUG AUUUUUAUG C GAG GA 46 UGGUGG CAUAAAAAUCACUACAA (vinu) sGf sgugGf cauaaaaAfu 2-128 221 gsusagugAfuUfUfUf uaugccacca 222 Cf acuacsasagsusagUf gauUfUfUfuaugccaCfc (vinu) sGf sguggcauaaaaAf uc 2-129 224 a 225 acuacsasagsusagUf gauUfUfUfuaugccaCfc (vinu) sGf sgugGf cauaaaaAfu 2-130 224 a 226 cacuacsasa(vinu) sGf sgugGf cauaaaaAfu 2-131 227 gsusagUfgauUfUf dTuaugccacca 226 cacuacsasa(vinu) sGf sgugGf cauaaaaAfu 2-132 228 gsusagUfgauUf dTUf uaugccacca 226 cacuacsasa(vinu) sGf sgugGf cauaaaaAfu 2-133 229 gsusagUfgaudTUfUf uaugccacca 226 cacuacsasa(vinu) sGf sgugGf cauaaaaAfu 2-134 230 gsusagUf gauUf Uf Af uaugccacca 226 cacuacsasa(vinu) sGf sgugGf cauaaaaAfu 2-135 231 gsusagUf gauUfUfUfaaugccacca 226 cacuacsasa(vinu) sGf sgugGf cauaaaaAfu 2-136 232 gsusagUf gauUf UfUfuuugccacca 226 cacuacsasagsusagUf gauUf UfUfuaugccaccA (vinu) sGf sgugGf cauaaaaAfu 2-137 233 m 234 cacuacsAmsAmgsusagUf gauUfUfUfuaugccaCfc (vinu) sGf sgugGf (GNA- 2-138 224 a 235 C) auaaaaAf ucacuacsasa UMS* 47 AGUG AUUUUUAUG C GAG GA 48 UGGUGG CAUAAAAAUCACUAC (vinu) sGf sgugGf cauaaaaAfu 2-139 236 asgsugAfuUfUfUf uaugccacca 237 Cf acusascTable 4. Sequences of exemplary dsRNA agents shown with GalNAc clusters (UMS* = Unmodified Sequence)SequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)547 familyUMS* 1 C AGAAAGGAUUUC C CAUCAAA 2 UUUGAUGGGAAAUCCUUUCUGCA csasgaaaGfgAfUfUfucccau (vinu) sUf sugaUfgggaaauCf cUf 3-1 49 caaa (L96 ) 50 uucugscsacsasgaAf aggAf UfUf ucccau (vinu) sUf sugaugggaaauCf cuuu 3-2 51 cAf aa (L96 ) 52 cugscsacsasgaAf aggAf UfUf ucccau (vinu) sUf sugaUfgggaaauCf cuu 3-3 51 cAf aa (L96 ) 54 ucugscsacsasgaAf aggAf UfdTucccau (vinu) sUf sugaUfgggaaauCf cuu 3-4 53 caaa (L96 ) 54 ucugscsacsasgaAf aggAf dTUf ucccau (vinu) sUf sugaUfgggaaauCf cuu 3-5 55 caaa (L96 ) 54 ucugscsacsasgaAf aggdAUfUf ucccau (vinu) sUf sugaUfgggaaauCf cuu 3-6 56 caaa (L96 ) 54 ucugscsacsasgaAf aggAf UfAf ucccau (vinu) sUf sugaUfgggaaauCf cuu 3-7 57 caaa (L96 ) 54 ucugscsacsasgaAf aggAf UfUf acccau (vinu) sUf sugaUfgggaaauCf cuu 3-8 58 caaa (L96 ) 54 ucugscsacsasgaAf aggAf UfUf ugccau (vinu) sUf sugaUfgggaaauCf cuu 3-9 59 caaa (L96 ) 54 ucugscsacsasgaAf aggAf UfUf ucccau (vinu) sUf sugaUfgggaaauCf cuu 3-10 60 caaAm (L96 ) 61 ucugsCmsAm csasgaaaGfgAfUfUfucccau usUf sugaUfgggaaauCf cUfuucug 3-11 49 caaa (L96 ) 62 scsaUMS* 3 GAAAGGAUUUC C C AUCAAA 4 UUUGAUGGGAAAUC CUUUCUG gsasaaGfgAfUfUfucccauca (vinu) sUf sugaUfgggaaauCf cUf 3-12 63 aa (L96 ) 64 uucsusg714 familyUMS* 5 GGAAGACACCGUGUUGCUUCA 6 UGAAGCAACACGGUGUCUUCCGG gsgsaagaCf aCf CfGfuguugc (vinu) sGf saagCf aacacggUfgUf 3-13 65 uuca (L96 ) 66 cuuccsgsggsgsaaGf acaCf CfGfuguugc (vinu) sGf saagcaacacggUf gucu 3-14 67 uUfca (L96) 68 uccsgsggsgsaaGf acaCf CfGfuguugc (vinu) sGf saagCf aacacggUfguc 3-15 67 uUfca (L96) 69 uuccsgsgSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gsgsaaGf acaCf CfdGuguugc (vinu) sGf saagCf aacacggUf guc 3-16 70 uuca (L96 ) 69 uuccsgsggsgsaaGf acaCf dCGf uguugc (vinu) sGf saagCf aacacggUf guc 3-17 71 uuca (L96 ) 69 uuccsgsggsgsaaGf acadCCf Gf uguugc (vinu) sGf saagCf aacacggUf guc 3-18 72 uuca (L96 ) 69 uuccsgsggsgsaaGf acaCf CfCf uguugc (vinu) sGf saagCf aacacggUf guc 3-19 73 uuca (L96 ) 69 uuccsgsggsgsaaGf acaCf CfGf aguugc (vinu) sGf saagCf aacacggUf guc 3-20 74 uuca (L96 ) 69 uuccsgsggsgsaaGf acaCf CfGf ucuugc (vinu) sGf saagCf aacacggUf guc 3-21 75 uuca (L96 ) 69 uuccsgsggsgsaaGf acaCf CfGf uguugc (vinu) sGf saagCf aacacggUfguc 3-22 76 uucAm (L96 ) 77 uuccsGmsGmgsgsaaGf acaCf CfGf uguugc (vinu) sGf saagCf (GNA- 3-23 67 uUfca (L96) 78 A) acacggUf gucuuccsgsg gsgsaaGf acaCf CfGf uguugc (vinu) sGf saag (GNA- 3-24 67 uUfca (L96) 79 C) aacacggUf gucuuccsgsg UMS* 7 AAGACACCGUGUUGCUUCA 8 UGAAGCAACACGGUGUCUUCC asasgaCf aCf CfGfuguugcuu (vinu) sGf saagCf aacacggUfgUf 3-25 80 ca (L96 ) 81 cuuscsc721 familyUMS* 9 AC CGUGUUGCUUCUC CUC AAA 10 UUUGAGGAGAAGCAACACGGUGU as cscgugUfuGf CfUfucuccu (vinu) sUf sugaGfgagaagcAf aCf 3-26 82 caaa (L96 ) 83 acggusgsuas cscgUfguuGf CfUfucuccu (vinu) sUf sugaggagaagcAf acac 3-27 84 cAf aa (L96 ) 85 ggusgsuas cscgUfguuGf CfUfucuccu (vinu) sUf sugaGfgagaagcAf aca 3-28 84 cAf aa (L96 ) 86 cggusgsuas cscgUfguuGf Cf dTucuccu (vinu) sUf sugaGfgagaagcAf aca 3-29 87 caaa (L96 ) 86 cggusgsuas cscgUfguuGf dCUfucuccu (vinu) sUf sugaGfgagaagcAf aca 3-30 88 caaa (L96 ) 86 cggusgsu ascscgUfguudGCfUfucuccu (vinu) sUf sugaGfgagaagcAf aca 3-31 89 caaa (L96 ) 86 cggusgsuas cscgUfguuGf Cf Afucuccu (vinu) sUf sugaGfgagaagcAf aca 3-32 90 caaa (L96 ) 86 cggusgsuas cscgUfguuGf CfUf acuccu (vinu) sUf sugaGfgagaagcAf aca 3-33 91 caaa (L96 ) 86 cggusgsuas cscgUfguuGf CfUfuguccu (vinu) sUf sugaGfgagaagcAf aca 3-34 92 caaa (L96 ) 86 cggusgsuSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) ascscgUfguuGf CfUfucuccu (vinu) sUf sugaGf gagaagcAf aca 3-35 93 caaAm (L96 ) 94 cggusGmsTm11 CGUGUUGCUUCUCCUCAAA 12 UUUGAGGAGAAGCAACACGGU csgsugUfuGf CfUfucuccuca (vinu) sUf sugaGfgagaagcAf aCf 3-36 95 aa (L96 ) 96 acgsgsu723 familyUMS* 13 CGUGUUGCUUCUCCUCAACGA 14 UCGUUGAGGAGAAGCAACACGGU csgsuguuGf cUfUf Cfuccuca (vinu) sCf sguuGf aggagaaGf cAf 3-37 97 acga (L96 ) 98 acacgsgsu csgsugUfugcUfUf Cfuccuca (vinu) sCf sguuGf (GNA- 3-38 99 aCf ga (L96 ) 100 A) ggagaaGf caacacgsgsu csgsugUfugcUfUf Cfuccuca (vinu) sCf sguuGf aggagaaGf caa 3-39 99 aCf ga (L96 ) 101 cacgsgsu725 familyUGGCGUUGAGGAGAAGCAACACG UMS* 15 UGUUGCUUCUCCUCAACGCCA 16 (See also SEQ ID NOs: 238 and 239, in which one of the uracils in SEQ ID NO: 16 is modified to a thymine) usgsuugcUfuCfUf Cf cucaac (vinu) sGf sgcgUfugaggagAf aGf 3-40 102 gcca (L96 ) 103 caacascsgusgsuuGf cuuCfUf Cf cucaac (vinu) sGf sgcguugaggagAf agca 3-41 104 gCf ca (L96 ) 105 acascsgusgsuuGf cuuCfUf Cf cucaac (vinu) sGf sgcgUfugaggagAf age 3-42 104 gCf ca (L96 ) 106 aacascsgusgsuuGf cuuCfUf dCcucaac (vinu) sGf sgcgUfugaggagAf age 3-43 107 gcca (L96 ) 106 aacascsgusgsuuGf cuuCfdTCf cucaac (vinu) sGf sgcgUfugaggagAf age 3-44 108 gcca (L96 ) 106 aacascsgusgsuuGf cuudCUfCf cucaac (vinu) sGf sgcgUfugaggagAf age 3-45 109 gcca (L96 ) 106 aacascsgusgsuuGf cuuCfUf Gf cucaac (vinu) sGf sgcgUfugaggagAf age 3-46 110 gcca (L96 ) 106 aacascsgusgsuuGf cuuCfUf Cfgucaac (vinu) sGf sgcgUfugaggagAf age 3-47 111 gcca (L96 ) 106 aacascsgusgsuuGf cuuCfUf Cfcacaac (vinu) sGf sgcgUfugaggagAf age 3-48 112 gcca (L96 ) 106 aacascsgusgsuuGf cuuCfUf Cf cucaac (vinu) sGf sgcgUfugaggagAf age 3-49 113 gccAm (L96 ) 114 aacasCmsGmusgsuuGf cuuCfUf Cf cucaac (vinu) sGf sgcgUf (GNA- 3-50 104 gCf ca (L96 ) 115 T) gaggagAf agcaacascsgSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) usgsuuGf cuuCfUf Cf cucaac (vinu) sGf sgcg (GNA- 3-51 104 gCf ca (L96 ) 116 T) ugaggagAf agcaacascsg UMS* 17 UUGCUUCUCCUCAACGCCA 18 UGGCGUUGAGGAGAAGCAACA ususgcUfuCfUf Cf cucaacgc (vinu) sGf sgcgUfugaggagAf aGf 3-52 117 ca (L96 ) 118 caascsa1263 familyUGGCGGUUCACGCUGAAGGAGGA UMS* 19 CUC CUUC AGCGUGAAC CGC C A 20 (See also SEQ ID NO: 240, in which one of the uracils in SEQ ID NO: 20 is modified to a thymine) csusccuuCf aGf CfGfugaacc (vinu) sGf sgcgGfuucacgcUfgAf 3-53 119 gcca (L96 ) 120 aggagsgsac sus ccUfucaGf CfGfugaacc (vinu) sGf sgcgGf uucacgcUf gaa 3-54 121 gCf ca (L96 ) 122 ggagsgsac sus ccUfucaGf CfGfugaacc (vinu) sGf sgcgGf (GNA- 3-55 121 gCf ca (L96 ) 123 T) ucacgcUf gaaggagsgsa 1629 familyUMS* 21 AGAGGC C AUUCUUUC C CAACA 22 UGUUGGGAAAGAAUGGCCUCUCU asgsaggcCf aUfUf Cfuuuccc (vinu) sGf suugGf gaaagaaUf gGf 3-56 124 aaca (L96 ) 125 ccucuscsuasgsagGf ccaUfUf Cfuuuccc (vinu) sGf suugGf gaaagaaUf ggc 3-57 126 aAf ca (L96 ) 127 cucuscsu2073 familyUGGAUCUCGAGGAGCCGUGGGAA UMS* 23 C C C ACGGCUC CUCGAGAUC C A 24 (See also SEQ ID NO: 241, in which one of the uracils in SEQ ID NO: 24 is modified to a thymine) cscscacgGf cUf Cf Cfucgaga (vinu) sGf sgauCfucgaggaGf cCf 3-58 128 ucca (L96 ) 129 gugggsasa cscscaCfggcUfCf Cfucgaga (vinu) sGf sgau (GNA- 3-59 130 uCf ca (L96 ) 131 C) ucgaggaGf ccgugggsasa cscscaCfggcUfCf Cfucgaga (vinu) sGf sgauCfucgaggaGf ccg 3-60 130 uCf ca (L96 ) 132 ugggsasa cscscaCfggcUfCf Cfucgaga (vinu) sGf sgauCf (GNA- 3-61 130 uCf ca (L96 ) 133 T) cgaggaGf ccgugggsasa 2181 familyUMS* 25 GCUCCUUAAGGCUCUUUUGUA 26 UACAAAAGAGCCUUAAGGAGCUC gscsuccuUf aAfGfGf cucuuu (vinu) sAf scaaAf agagccuUf aAf 3-62 134 ugua (L96 ) 135 ggagcsuscSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gscsucCfuuaAfGfGf cucuuu (vinu) sAf scaaaagagccuUf aagg 3-63 136 uGf ua (L96 ) 137 agcsusc gscsucCfuuaAfGfGf cucuuu (vinu) sAf scaaAf agagccuUf aag 3-64 138 uGf ua (L96 ) 139 gagcsusc gscsucCfuuaAfGf dGcucuuu (vinu) sAf scaaAf agagccuUf aag 3-65 140 ugua (L96 ) 139 gagcsuscgscsucCf uuaAf dGGf cucuuu (vinu) sAf scaaAf agagccuUf aag 3-66 141 ugua (L96 ) 139 gagcsusc gscsucCfuuadAGfGf cucuuu (vinu) sAf scaaAf agagccuUf aag 3-67 142 ugua (L96 ) 139 gagcsusc gscsucCfuuaAfGf Cf cucuuu (vinu) sAf scaaAf agagccuUf aag 3-68 143 ugua (L96 ) 139 gagcsuscgscsucCf uuaAf GfGfgucuuu (vinu) sAf scaaAf agagccuUf aag 3-69 144 ugua (L96 ) 139 gagcsusc gscsucCfuuaAfGfGf cacuuu (vinu) sAf scaaAf agagccuUf aag 3-70 145 ugua (L96 ) 139 gagcsusc gscsucCfuuaAfGfGf cucuuu (vinu) sAf scaaAf agagccuUf aag 3-71 146 uguAm ( L 96 ) 147 gagcsTmsCmUMS* 27 UCCUUAAGGCUCUUUUGUA 28 UACAAAAGAGCCUUAAGGAGC uscscuUf aAfGfGf cucuuuug (vinu) sAf scaaAf agagccuUf aAf 3-72 148 ua (L96 ) 149 ggasgsc2197 FamilyUUC ACUAC AAAAAC CUUAC AAAA UMS* 29 UUGUAAGGUUUUUGUAGUGAA 30 (See also SEQ ID NO: 242, in which one of the uracils in SEQ ID NO: 30 is modified to a thymine) ususguaaGf gUf Uf Uf uuguag (vinu) sUf scacUf acaaaaaCf cUf 3-73 150 ugaa (L96 ) 151 uacaasasaususguAf aggUf UfUf uuguag (vinu) sUf scacuacaaaaaCf cuua 3-74 152 uGf aa (L96 ) 153 caasasaususguAf aggUf UfUf uuguag (vinu) sUf scacUf acaaaaaCf cuu 3-75 152 uGf aa (L96 ) 154 acaasasaususguAf aggUf UfdTuuguag (vinu) sUf scacUf acaaaaaCf cuu 3-76 155 ugaa (L96 ) 154 acaasasaususguAf aggUf dTUf uuguag (vinu) sUf scacUf acaaaaaCf cuu 3-77 156 ugaa (L96 ) 154 acaasasaususguAf aggdTUfUf uuguag (vinu) sUf scacUf acaaaaaCf cuu 3-78 157 ugaa (L96 ) 154 acaasasaususguAf aggUf UfAf uuguag (vinu) sUf scacUf acaaaaaCf cuu 3-79 158 ugaa (L96 ) 154 acaasasaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) ususguAf aggUf Uf Uf auguag (vinu) sUf scacUf acaaaaaCf cuu 3-80 159 ugaa (L96 ) 154 acaasasaususguAf aggUf UfUf uaguag (vinu) sUf scacUf acaaaaaCf cuu 3-81 160 ugaa (L96 ) 154 acaasasaususguAf aggUf Uf Uf uuguag (vinu) sUf scacUf acaaaaaCf cuu 3-82 161 ugaAm (L96 ) 162 acaasAmsAmususguAf aggUf UfUf uuguag (vinu) sUf scacUf (GNA- 3-83 152 uGf aa (L96 ) 163 A) caaaaaCf cuuacaasasa ususguAf aggUf UfUf uuguag (vinu) sUf scac (GNA- 3-84 152 uGf aa (L96 ) 164 T) acaaaaaCf cuuacaasasa UMS* 31 GUAAGGUUUUUGUAGUGAA 32 UUC ACUAC AAAAAC CUUAC AA gsusaaGf gUf Uf Uf uuguagug (vinu) sUf scacUf acaaaaaCf cUf 3-85 165 aa (L96 ) 166 uacsasa2199 familyUMS* 33 GUAAGGUUUUUGUAGUGAUUA 34 UAAUC ACUAC AAAAAC CUUAC AA gsusaaggUf uUf Uf Uf guagug (vinu) sAf saucAf cuacaaaAf aCf 3-86 167 auua (L96 ) 168 cuuacsasagsusaaGf guuUf UfUf guagug (vinu) sAf saucacuacaaaAf accu 3-87 169 aUf ua (L96 ) 170 uacsasagsusaaGf guuUf UfUf guagug (vinu) sAf saucAf cuacaaaAf acc 3-88 169 aUf ua (L96 ) 171 uuacsasa gsusaaGfguuUfUf dTguagug (vinu) sAf saucAf cuacaaaAf acc 3-89 172 auua (L96 ) 171 uuacsasagsusaaGfguuUf dTUf guagug (vinu) sAf saucAf cuacaaaAf acc 3-90 173 auua (L96 ) 171 uuacsasa gsusaaGfguudTUfUf guagug (vinu) sAf saucAf cuacaaaAf acc 3-91 174 auua (L96 ) 171 uuacsasagsusaaGf guuUf UfAf guagug (vinu) sAf saucAf cuacaaaAf acc 3-92 175 auua (L96 ) 171 uuacsasagsusaaGf guuUf UfUf cuagug (vinu) sAf saucAf cuacaaaAf acc 3-93 176 auua (L96 ) 171 uuacsasagsusaaGf guuUf UfUf gaagug (vinu) sAf saucAf cuacaaaAf acc 3-94 177 auua (L96 ) 171 uuacsasagsusaaGf guuUf UfUf guagug (vinu) sAf saucAf cuacaaaAf acc 3-95 178 auuAm ( L 96 ) 179 uuacsAmsAmgsusaaGf guuUf UfUf guagug (vinu) sAf saucAf (GNA- 3-96 169 aUf ua (L96 ) 180 C) uacaaaAf accuuacsasa gsusaaGf guuUf UfUf guagug (vinu) sAf sauc (GNA- 3-97 169 aUf ua (L96 ) 181 A) cuacaaaAf accuuacsasa UMS* 35 AAGGUUUUUGUAGUGAUUA 36 UAAUC ACUAC AAAAAC CUUACSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) asasggUf uUf Uf Uf guagugau (vinu) sAf saucAf cuacaaaAf aCf 3-98 182 ua (L96 ) 183 cuusasc2207 familyUGGCAUAAAAAUCACUACAAAAA UMS* 37 UUUGUAGUGAUUUUUAUGCCA 38 (See also SEQ ID NO: 243, in which one of the uracils in SEQ ID NO: 38 is modified to a thymine) ususuguaGfuGfAfUfuuuuau (vinu) sGf sgcaUf aaaaaucAf cUf 3-99 184 gcca (L96) 185 acaaasasaususuguaGf uGf Af Uf uuuuau (vinu) sGf sgcaUf aaaaaucAf cUf 3-100 184 gcca (NHC6 ) (GalNAc3 ) 185 acaaasasa(GalNAc3 ) (NHC6 ) sususugu (vinu) sGf sgcaUf aaaaaucAf cUf 3-101 186 aGfuGf AfUfuuuuaugcscsa 185 acaaasasaususuguaGf uGfAfUf uuuuau (vinu) sGf sgcaUf aaaaaucAf cUf 3-102 184 gcca (GalNAc-TEG) 185 acaaasasa(GalNAc- (vinu) sGf sgcaUf aaaaaucAf cUf 3-103 187 TEG) sususuguaGfuGf AfUfu 185 acaaasasauuuaugcscsa(MonoGalNAc- TEG) s (MonoGalNAc- (vinu) sGf sgcaUf aaaaaucAf cUf 3-104 187 TEG) s (MonoGalNAc- 185 acaaasasaTEG) sususuguaGfuGf AfUfuuuuaugcscsaususuguaGf uGfAfUf uuuuaugccas (MonoGalNAc- (vinu) sGf sgcaUf aaaaaucAf cUf 3-105 184 TEG) s (MonoGalNAc- 185 acaaasasaTEG) s (MonoGalNAc-TEG)u s u s ugUf aguG f Af Uf uuuuau (vinu) sGf sgcauaaaaaucAf cuac 3-106 188 gCf ca (L96 ) 189 aaasasau s u s ugUf aguG f Af Uf uuuuau (vinu) sGf sgcaUf aaaaaucAf cua 3-107 188 gCf ca (L96 ) 190 caaasasaususugUf aguGf Af dTuuuuau (vinu) sGf sgcaUf aaaaaucAf cua 3-108 191 gcca (L96 ) 190 caaasasaususugUf aguG f dAU f uuuuau (vinu) sGf sgcaUf aaaaaucAf cua 3-109 192 gcca (L96 ) 190 caaasasaususugUf agudGAf Uf uuuuau (vinu) sGf sgcaUf aaaaaucAf cua 3-110 193 gcca (L96 ) 190 caaasasaususugUf aguG f Af Af uuuuau (vinu) sGf sgcaUf aaaaaucAf cua 3-111 194 gcca (L96 ) 190 caaasasaususugUf aguGf AfUfauuuau (vinu) sGf sgcaUf aaaaaucAf cua 3-112 195 gcca (L96 ) 190 caaasasaususugUf aguGf AfUfuauuau (vinu) sGf sgcaUf aaaaaucAf cua 3-113 196 gcca (L96 ) 190 caaasasaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) u s u s ugUf aguG f Af Uf uuuuau (vinu) sGf sgcaUf aaaaaucAf cua 3-114 197 gccAm (L96 ) 198 caaasAmsAm ususuguaGfuGfAfUfuuuuau usGf sgcaUf aaaaaucAf cUfacaaa 3-115 184 gcca (L96) 199 sasau s u s ugUf aguG f Af Uf uuuuau (vinu) sGf sgcaUf (GNA- 3-116 197 gccAm (L96 ) 200 A) aaaaucAf cuacaaasAmsAm u s u s ugUf aguG f Af Uf uuuuau (vinu) sGf sgca (GNA- 3-117 197 gccAm (L96 ) 201 T) aaaaaucAf cuacaaasAmsAm UMS* 39 UGUAGUGAUUUUUAUGCCA 40 UGGCAUAAAAAUCACUACAAA usgsuaGfuGf AfUfuuuuaugc (vinu) sGf sgcaUf aaaaaucAf cUf 3-118 202 ca (L96 ) 203 acasasa2208 familyUMS* 41 UUGUAGUGAUUUUUAUGCCAA 42 UUGGCAUAAAAAUCACUACAAAA ususguagUf gAf Uf Uf uuuaug (vinu) sUf sggcAfuaaaaauCf aCf 3-119 204 ccaa (L96 ) 205 uacaasasaususguAf gugAf Uf Uf uuuaug (vinu) sUf sggcauaaaaauCf acua 3-120 206 cCfaa (L96) 207 caasasaususguAf gugAf UfUf uuuaug (vinu) sUf sggcAfuaaaaauCf acu 3-121 206 cCfaa (L96) 208 acaasasaususguAf gugAf UfdTuuuaug (vinu) sUf sggcAfuaaaaauCf acu 3-122 209 ccaa (L96 ) 208 acaasasaususguAf gugAf dTUf uuuaug (vinu) sUf sggcAfuaaaaauCf acu 3-123 210 ccaa (L96 ) 208 acaasasau s u s guAf gugdAU f Uf uuuaug (vinu) sUf sggcAfuaaaaauCf acu 3-124 211 ccaa (L96 ) 208 acaasasaususguAf gugAf Uf Af uuuaug (vinu) sUf sggcAfuaaaaauCf acu 3-125 212 ccaa (L96 ) 208 acaasasaususguAf gugAf UfUfauuaug (vinu) sUf sggcAfuaaaaauCf acu 3-126 213 ccaa (L96 ) 208 acaasasaususguAf gugAf UfUfuauaug (vinu) sUf sggcAfuaaaaauCf acu 3-127 214 ccaa (L96 ) 208 acaasasaususguAf gugAf UfUf uuuaug (vinu) sUf sggcAfuaaaaauCf acu 3-128 215 ccaAm (L96 ) 216 acaasAmsAmususguAf gugAf UfUf uuuaug (vinu) sUf sggcAf (GNA- 3-129 206 cCfaa (L96) 217 T) aaaaauCf acuacaasasa ususguAf gugAf UfUf uuuaug (vinu) sUf sggc (GNA- 3-130 206 cCfaa (L96) 218 A) uaaaaauCf acuacaasasa UMS* 43 GUAGUGAUUUUUAUGCCAA 44 UUGGCAUAAAAAUCACUACAA gsusagUfgAfUfUfuuuaugcc (vinu) sUf sggcAfuaaaaauCf aCf 3-131 219 aa (L96 ) 220 uacsasaDl IDpeux SequenceDuplex SEQ SEQID Sttar ID Sense strand ID Antisense strand Niit posonO: (5’ to 3’) NO: (5’ to 3’)2210 familyUMS* 45 GUAGUG AUUUUUAUG C GAG GA 46 UGGUGG CAUAAAAAUCACUACAA gsusagugAfuUfUfUfuaugcc (vinu) sGf sgugGf cauaaaaAfuCf 3-132 221 acca (L96) 222 acuacsasa gsusagUfgauUfUfUfuaugcc (vinu) sGf sguggcauaaaaAf ucac 3-133 224 aCfca (L96) 225 uacsasa gsusagUfgauUfUfUfuaugcc (vinu) sGf sgugGf cauaaaaAfuca 3-134 224 aCfca (L96) 226 cuacsasa gsusagUfgauUfUf dTuaugcc (vinu) sGf sgugGf cauaaaaAfuca 3-135 227 acca (L96 ) 226 cuacsasagsusagUfgauUf dTUfuaugcc (vinu) sGf sgugGf cauaaaaAfuca 3-136 228 acca (L96 ) 226 cuacsasa gsusagUfgaudTUfUfuaugcc (vinu) sGf sgugGf cauaaaaAfuca 3-137 229 acca (L96 ) 226 cuacsasa gsusagUfgauUfUf Afuaugcc (vinu) sGf sgugGf cauaaaaAfuca 3-138 230 acca (L96 ) 226 cuacsasa gsusagUfgauUfUfUf aaugcc (vinu) sGf sgugGf cauaaaaAfuca 3-139 231 acca (L96 ) 226 cuacsasa gsusagUfgauUfUfUfuaugcc (vinu) sGf sgugGf cauaaaaAfuca 3-140 232 acca (L96 ) 226 cuacsasa gsusagUfgauUfUfUfuaugcc (vinu) sGf sgugGf cauaaaaAfuca 3-141 233 accAm (L96 ) 234 cuacsAmsAm gsusagUfgauUfUfUfuaugcc (vinu) sGf sgugGf (GNA- 3-142 224 aCfca (L96) 235 C) auaaaaAf ucacuacsasa UMS* 47 AGUG AUUUUUAUG C C AC C A 48 UGGUGG CAUAAAAAUCACUAC asgsugAfuUfUfUfuaugccac (vinu) sGf sgugGf cauaaaaAfuCf 3-143 236 ca (L96 ) 237 acusascTable 5. Nucleotide sequences of exemplary dsRNA agentsNucleotide SequenceSEQ ID Sense strand SEQ Anti-sense strand (5’ to 3’) ID NONO (5’ to 3’)4-1 57 248 GGGGCUCCUGGUGCUCAGCUA 249 UAGCUGAGCACCAGGAGCCCCCA 4-2 62 250 UCCUGGUGCUCAGCUGGUCCA 251 UGGACCAGCUGAGCACCAGGAGC 4-3 63 252 CCUGGUGCUCAGCUGGUCCUA 253 UAGGACCAGCUGAGCACCAGGAG 4-4 64 254 CUGGUGCUCAGCUGGUCCUGA 255 UCAGGACCAGCUGAGCACCAGGADl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit posonN (5’ to 3’) ID NOO (5’ to 3’)4-5 67 256 GUGCUCAGCUGGUCCUGCCUA 257 UAGGCAGGACCAGCUGAGCACCA 4-6 68 258 UGCUCAGCUGGUCCUGCCUGA 259 UCAGGCAGGACCAGCUGAGCACC 4-7 71 260 UCAGCUGGUCCUGCCUGCAAA 261 UUUGCAGGCAGGACCAGCUGAGC 4-8 105 262 GUUCUC C C CUGUGAGCGC CAA 263 UUGGCGCUCACAGGGGAGAACAC 4-9 108 264 CUC C C CUGUGAGCGC CAUGGA 265 UCCAUGGCGCUCACAGGGGAGAA -10 111 266 CCCUGUGAGCGCCAUGGAGCA 267 UGCUCCAUGGCGCUCACAGGGGA -11 113 268 CUGUGAGCGCCAUGGAGCCCA 269 UGGGCUCCAUGGCGCUCACAGGG -12 114 270 UGUGAGCGCCAUGGAGCCCUA 271 UAGGGCUCCAUGGCGCUCACAGG -13 117 272 GAGCGCCAUGGAGCCCUUGGA 273 UCCAAGGGCUCCAUGGCGCUCAC -14 186 274 C CUC CUCAAGUUGGGCAAC C A 275 UGGUUGC C CAACUUGAGGAGGGU -15 187 276 CUC CUCAAGUUGGGCAAC CAA 277 UUGGUUGC C CAACUUGAGGAGGG -16 188 278 UC CUCAAGUUGGGCAAC C AGA 279 UCUGGUUGC C CAACUUGAGGAGG -17 429 280 GCAGAGGCUGCAACAGGUGCA 281 UGCACCUGUUGCAGCCUCUGCAA -18 437 282 UGCAACAGGUGCUGCACGCAA 283 UUGCGUGCAGCACCUGUUGCAGC -19 438 284 GCAACAGGUGCUGCACGCAGA 285 UCUGCGUGCAGCACCUGUUGCAG -20 445 286 GUGCUGCACGCAGGCUCAGGA 287 UCCUGAGCCUGCGUGCAGCACCU -21 520 288 UUCCGACUGGCUGCCAGGAUA 289 UAUCCUGGCAGCCAGUCGGAACG -22 521 290 UCCGACUGGCUGCCAGGAUGA 291 UCAUCCUGGCAGCCAGUCGGAAC -23 522 292 CCGACUGGCUGCCAGGAUGUA 293 UACAUCCUGGCAGCCAGUCGGAA -24 523 294 CGACUGGCUGCCAGGAUGUAA 295 UUACAUCCUGGCAGCCAGUCGGA -25 528 296 GGCUGCCAGGAUGUACCUGCA 297 UGCAGGUACAUCCUGGCAGCCAG -26 529 298 GCUGCCAGGAUGUACCUGCAA 299 UUGCAGGUACAUCCUGGCAGCCA -27 531 300 UGCCAGGAUGUACCUGCAGAA 301 UUCUGCAGGUACAUCCUGGCAGC -28 533 302 C C AGGAUGUAC CUGC AGAAAA 303 UUUUCUGCAGGUACAUCCUGGCA -29 534 304 CAGGAUGUACCUGCAGAAAGA 305 UCUUUCUGCAGGUACAUCCUGGC -30 535 306 AGGAUGUACCUGCAGAAAGGA 307 UC CUUUCUGC AGGUAC AUG CUGG -31 539 308 UGUACCUGCAGAAAGGAUUUA 309 UAAAUCCUUUCUGCAGGUACAUC -32 549 310 GAAAGGAUUUC C C AUCAAAGA 311 UCUUUGAUGGGAAAUC CUUUCUG -33 550 312 AAAGGAUUUC C C AUCAAAGAA 313 UUCUUUGAUGGGAAAUC CUUUCUDl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit posonN (5’ to 3’) ID NOO (5’ to 3’)-34 551 314 AAGG AUUUC C CAUCAAAGAAA 315 UUUCUUUGAUGGGAAAUC CUUUC -35 553 316 GGAUUUC C C AUCAAAGAAGAA 317 UUCUUCUUUGAUGGGAAAUC CUU -36 554 318 GAUUUC C C AUCAAAGAAGAUA 319 UAUCUUCUUUGAUGGGAAAUC CU -37 555 320 AUUUC C C AUCAAAGAAGAUUA 321 UAAUCUUCUUUGAUGGGAAAUC C -38 556 322 UUUC C C AUCAAAGAAGAUUUA 323 UAAAUCUUCUUUGAUGGGAAAUC -39 558 324 UGG C AUCAAAGAAGAUUUC GA 325 UGGAAAUCUUCUUUGAUGGGAAA -40 563 326 UCAAAGAAG AUUUC CUGGAAA 327 UUUC C AGGAAAUCUUCUUUGAUG -41 565 328 AAAGAAG AUUUC CUGGAAC AA 329 UUGUUC C AGGAAAUCUUCUUUGA -42 601 330 GGGGCAAAGCCCGUGAGCCUA 331 UAGGCUCACGGGCUUUGCCCCAA -43 603 332 GGCAAAGCCCGUGAGCCUGAA 333 UUCAGGCUCACGGGCUUUGCCCC -44 608 334 AGC C CGUGAGC CUGACGGGAA 335 UUCCCGUCAGGCUCACGGGCUUU -45 610 336 C C CGUGAGC CUGACGGGAAAA 337 UUUUCCCGUCAGGCUCACGGGCU -46 611 338 C CGUGAGC CUGACGGGAAAGA 339 UCUUUCCCGUCAGGCUCACGGGC -47 612 340 CGUGAGCCUGACGGGAAAGCA 341 UGCUUUCCCGUCAGGCUCACGGG -48 613 342 GUGAGCCUGACGGGAAAGCAA 343 UUGCUUUCCCGUCAGGCUCACGG -49 614 344 UGAGCCUGACGGGAAAGCAGA 345 UCUGCUUUCCCGUCAGGCUCACG -50 616 346 AGCCUGACGGGAAAGCAGGAA 347 UUC CUGCUUUC C CGUC AGGCUC A -51 617 348 GCCUGACGGGAAAGCAGGAAA 349 UUUC CUGCUUUC C CGUC AGGCUC -52 618 350 CCUGACGGGAAAGCAGGAAGA 351 UCUUC CUGCUUUC C CGUC AGGCU -53 619 352 CUGACGGGAAAGCAGGAAGAA 353 UUCUUC CUGCUUUC C CGUC AGGC -54 620 354 UGACGGGAAAGCAGGAAGAUA 355 UAUCUUC CUGCUUUC C CGUC AGG -55 622 356 ACGGGAAAGCAGGAAGAUGAA 357 UUC AUCUUC CUGCUUUC C CGUC A -56 624 358 GGGAAAGCAGGAAGAUGACCA 359 UGGUC AUCUUC CUGCUUUC C CGU -57 631 360 CAGGAAGAUGACCUGGCAAAA 361 UUUUGCCAGGUCAUCUUCCUGCU -58 633 362 GGAAGAUGACCUGGCAAACAA 363 UUGUUUGC CAGGUC AUCUUC CUG -59 634 364 GAAGAUGACCUGGCAAACAUA 365 UAUGUUUGC CAGGUC AUCUUC CU -60 637 366 GAUGACCUGGCAAACAUCAAA 367 UUUGAUGUUUGCCAGGUCAUCUU -61 640 368 GAG CUGGC AAAC AUG AAC C AA 369 UUGGUUGAUGUUUGCCAGGUCAU -62 647 370 CAAAC AUCAAC CAAUGGGUGA 371 UC AC C C AUUGGUUGAUGUUUGC CDl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit posonN (5’ to 3’) ID NOO (5’ to 3’)-63 652 372 AUCAAC C AAUGGGUGAAGGAA 373 UUC CUUC AC C C AUUGGUUGAUGU -64 653 374 UCAAC CAAUGGGUGAAGGAGA 375 UCUCCUUCACC C AUUGGUUGAUG -65 654 376 C AAC C AAUGGGUGAAGGAGGA 377 UCCUCCUUCACC C AUUGGUUGAU -66 655 378 AACCAAUGGGUGAAGGAGGCA 379 UGC CUC CUUC AC C C AUUGGUUGA -67 656 380 AC C AAUGGGUG AAGG AGG CCA 381 UGGC CUC CUUC AC C C AUUGGUUG -68 657 382 C C AAUGGGUG AAGG AGG C C AA 383 UUGGC CUC CUUC AC C C AUUGGUU -69 661 384 UGGGUGAAGGAGGCCACGGAA 385 UUC CGUGGC CUC CUUC AC C C AUU -70 668 386 AGGAGGCCACGGAGGGGAAGA 387 UCUUCCCCUCCGUGGCCUCCUUC -71 669 388 GGAGGCCACGGAGGGGAAGAA 389 UUCUUCCCCUC CGUGGC CUC CUU -72 670 390 GAGGCCACGGAGGGGAAGAUA 391 UAUCUUCCCCUCCGUGGCCUCCU -73 672 392 GGCCACGGAGGGGAAGAUUCA 393 UGAAUCUUC C C CUC CGUGGC CUC -74 711 394 GCCGGAAGACACCGUGUUGCA 395 UGCAACACGGUGUCUUCCGGCAG -75 712 396 C CGGAAGAC AC CGUGUUGCUA 397 UAGCAACACGGUGUCUUCCGGCA -76 716 398 AAGACACCGUGUUGCUUCUCA 399 UGAGAAGCAACACGGUGUCUUCC -77 717 400 AGAC AC CGUGUUGCUUCUC C A 401 UGGAGAAGCAACACGGUGUCUUC -78 718 402 GAC AC CGUGUUGCUUCUC CUA 403 UAGGAGAAGCAACACGGUGUCUU -79 731 404 UUCUC CUCAACGC C AUG C AC A 405 UGUGGAUGGCGUUGAGGAGAAGC -80 732 406 UCUCCUCAACGCCAUCCACUA 407 UAGUGGAUGGCGUUGAGGAGAAG -81 733 408 CUC CUC AACGC C AUC C ACUUA 409 UAAGUGGAUGGCGUUGAGGAGAA -82 734 410 UC CUCAACGC C AUC C ACUUC A 411 UGAAGUGGAUGGCGUUGAGGAGA -83 735 412 C CUCAACGC C AUC C ACUUC C A 413 UGGAAGUGGAUGGCGUUGAGGAG -84 738 414 C AACGC C AUC C ACUUC C AGGA 415 UCCUGGAAGUGGAUGGCGUUGAG -85 739 416 AACGC C AUC C ACUUC C AGGGA 417 UC C CUGGAAGUGGAUGGCGUUGA -86 742 418 GC C AUC C ACUUC C AGGGUUUA 419 UAAAC C CUGGAAGUGGAUGGCGU -87 745 420 AUC C ACUUC C AGGGUUUCUGA 421 UC AGAAAC C CUGGAAGUGGAUGG -88 747 422 C C ACUUC C AGGGUUUCUGGAA 423 UUC C AGAAAC C CUGGAAGUGGAU -89 748 424 C ACUUC C AGGGUUUCUGGAGA 425 UCUC C AGAAAC C CUGGAAGUGGA -90 750 426 CUUC C AGGGUUUCUGGAGGAA 427 UUC CUC C AGAAAC C CUGGAAGUG -91 790 428 ACC C AGAGAGACUC CUUC C AA 429 UUGGAAGGAGUCUCUCUGGGUAADl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit posonN (5’ to 3’) ID NOO (5’ to 3’)-92 811 430 CUGGACGAGCAGUUCACGGUA 431 UAC CGUGAACUGCUCGUC C AGGU -93 812 432 UGGACGAGCAGUUCACGGUGA 433 UC AC CGUGAACUGCUCGUC C AGG -94 892 434 GAGAUCCAGGUGGCUCAUUUA 435 UAAAUGAGC C AC CUGGAUCUC AG -95 912 436 C C C CUUUAAGAAC AAC AUGAA 437 UUCAUGUUGUUCUUAAAGGGGAA -96 913 438 C C CUUUAAGAACAAC AUGAGA 439 UCUCAUGUUGUUCUUAAAGGGGA -97 915 440 CUUUAAGAACAACAUGAGCUA 441 UAGCUCAUGUUGUUCUUAAAGGG -98 919 442 AAGAACAACAUGAGCUUUGUA 443 UACAAAGCUCAUGUUGUUCUUAA -99 920 444 AGAACAACAUGAGCUUUGUGA 445 UCACAAAGCUCAUGUUGUUCUUA -100 921 446 GAACAACAUGAGCUUUGUGGA 447 UCCACAAAGCUCAUGUUGUUCUU -101 924 448 CAACAUGAGCUUUGUGGUCCA 449 UGGACCACAAAGCUCAUGUUGUU -102 946 450 GUAC C C AC C CACUUUGAAUGA 451 UCAUUCAAAGUGGGUGGGUACAA -103 948 452 AC C C AC C C ACUUUGAAUGGAA 453 UUC C AUUCAAAGUGGGUGGGUAC -104 949 454 C C C AC C C ACUUUGAAUGGAAA 455 UUUC C AUUCAAAGUGGGUGGGUA -105 950 456 C C AC C C ACUUUGAAUGGAA C A 457 UGUUC C AUUCAAAGUGGGUGGGU -106 952 458 ACC C ACUUUGAAUGGAACGUA 459 UACGUUC C AUUCAAAGUGGGUGG -107 955 460 CACUUUGAAUGGAACGUGUCA 461 UGAC ACGUUC C AUUCAAAGUGGG -108 958 462 UUUGAAUGGAACGUGUC C CAA 463 UUGGGAC ACGUUC C AUUCAAAGU -109 960 464 UGAAUGGAACGUGUC C C AGGA 465 UC CUGGGAC ACGUUC C AUUCAAA -110 967 466 AACGUGUC C C AGGUACUGGC A 467 UGC C AGUAC CUGGGAC ACGUUC C -111 969 468 CGUGUC C C AGGUACUGGC CAA 469 UUGGC C AGUAC CUGGGAC ACGUU -112 970 470 GUGUC C C AGGUACUGGC CAAA 471 UUUGGC C AGUAC CUGGGAC ACGU -113 974 472 C C C AGGUACUGGC CAAC CUGA 473 UCAGGUUGGC C AGUAC CUGGGAC -114 976 474 C AGGUACUGGC CAAC CUGAGA 475 UCUCAGGUUGGC C AGUAC CUGGG -115 981 476 ACUGGC CAAC CUGAGUUGGGA 477 UC C CAACUCAGGUUGGC C AGUAC -116 982 478 CUGGC CAAC CUGAGUUGGGAA 479 UUC C CAACUC AGGUUGGC C AGUA -117 984 480 GGC CAAC CUGAGUUGGGACAA 481 UUGUC C CAACUC AGGUUGGC C AG -118 988 482 AAC CUGAGUUGGGAC AC C CUA 483 UAGGGUGUC C CAACUC AGGUUGG -119 989 484 AC CUGAGUUGGGAC AC C CUGA 485 UC AGGGUGUC C CAACUC AGGUUG -120 1020 486 GGUGUGGG AG AGG C C C AC CAA 487 UUGGUGGGC CUCUC C C AC AC C AGDl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit posonN (5’ to 3’) ID NOO (5’ to 3’) -121 1022 488 UGUGGG AG AGG C C C AC C AAG A 489 UCUUGGUGGGC CUCUC C C AC AC C -122 1026 490 GGAGAGGC C C AC CAAGGUC C A 491 UGGAC CUUGGUGGGC CUCUC C C A -123 1029 492 GAGGC C C AC CAAGGUC CGGC A 493 UGG CGGAC CUUGGUGGGC CUCUC -124 1030 494 AGGC C C AC CAAGGUC CGGCUA 495 UAGC CGGAC CUUGGUGGGC CUCU -125 1031 496 GGC C C AC CAAGGUC CGGCUGA 497 UC AGC CGGAC CUUGGUGGGC CUC -126 1032 498 GCCCACCAAGGUCCGGCUGCA 499 UGCAGCCGGACCUUGGUGGGCCU -127 1034 500 C C AC CAAGGUC CGGCUGC CUA 501 UAGGCAGCCGGACCUUGGUGGGC -128 1035 502 C AC CAAGGUC CGGCUGC CUAA 503 UUAGGCAGCCGGACCUUGGUGGG -129 1040 504 AGGUCCGGCUGCCUAAGCUGA 505 UCAGCUUAGGCAGCCGGACCUUG -130 1043 506 UCCGGCUGCCUAAGCUGUAUA 507 UAUACAGCUUAGGCAGCCGGACC -131 1047 508 GCUGCCUAAGCUGUAUCUGAA 509 UUCAGAUACAGCUUAGGCAGCCG -132 1052 510 CUAAGCUGUAUCUGAAACACA 511 UGUGUUUCAGAUACAGCUUAGGC -133 1055 512 AGCUGUAUCUGAAACACCAAA 513 UUUGGUGUUUCAGAUACAGCUUA -134 1056 514 GCUGUAUCUGAAACACCAAAA 515 UUUUGGUGUUUCAGAUACAGCUU -135 1057 516 CUGUAUCUGAAAC AC C AAAUA 517 UAUUUGGUGUUUCAGAUACAGCU -136 1059 518 GUAUCUGAAAC AC CAAAUGGA 519 UC C AUUUGGUGUUUC AGAUAC AG -137 1061 520 AUCUGAAAC AC CAAAUGGA C A 521 UGUC C AUUUGGUGUUUC AGAUAC -138 1062 522 UCUGAAAC AC CAAAUGGA C C A 523 UGGUC C AUUUGGUGUUUC AGAUA -139 1149 524 CGAGCAGAGCCUGGUGGUGUA 525 UACACCACCAGGCUCUGCUCGGA -140 1155 526 GAGCCUGGUGGUGUCCGGCGA 527 UCGCCGGACACCACCAGGCUCUG -141 1156 528 AGCCUGGUGGUGUCCGGCGUA 529 UACGCCGGACACCACCAGGCUCU -142 1158 530 CCUGGUGGUGUCCGGCGUGCA 531 UGCACGCCGGACACCACCAGGCU -143 1159 532 CUGGUGGUGUCCGGCGUGCAA 533 UUGCACGCCGGACACCACCAGGC -144 1161 534 GGUGGUGUCCGGCGUGCAGCA 535 UGCUGCACGCCGGACACCACCAG -145 1172 536 GCGUGCAGCAUCAGUCCACCA 537 UGGUGGACUGAUGCUGCACGCCG -146 1177 538 C AGC AUG AGUC C AC C CUGGAA 539 UUCCAGGGUGGACUGAUGCUGCA -147 1178 540 AGC AUC AGUC C AC C CUGGAGA 541 UCUCCAGGGUGGACUGAUGCUGC -148 1181 542 AUG AGUC C AC C CUGGAGCUC A 543 UGAGCUCCAGGGUGGACUGAUGC -149 1183 544 C AGUC C AC C CUGGAGCUC AGA 545 UCUGAGCUCCAGGGUGGACUGAUDl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit posonN (5’ to 3’) ID NOO (5’ to 3’) -150 1186 546 UC C AC C CUGGAGCUC AGCGAA 547 UUCGCUGAGCUCCAGGGUGGACU -151 1190 548 CCCUGGAGCUCAGCGAGGUCA 549 UGACCUCGCUGAGCUCCAGGGUG -152 1192 550 CUGGAGCUCAGCGAGGUCGGA 551 UC CGAC CUCGCUGAGCUC C AGGG -153 1194 552 GGAGCUCAGCGAGGUCGGCGA 553 UCGCCGACCUCGCUGAGCUCCAG -154 1195 554 GAGCUCAGCGAGGUCGGCGUA 555 UACGCCGACCUCGCUGAGCUCCA -155 1200 556 CAGCGAGGUCGGCGUGGAGGA 557 UCCUCCACGCCGACCUCGCUGAG -156 1203 558 CGAGGUCGGCGUGGAGGCGGA 559 UCCGCCUCCACGCCGACCUCGCU -157 1204 560 GAGGUCGGCGUGGAGGCGGCA 561 UGCCGCCUCCACGCCGACCUCGC -158 1242 562 C AUGUC C CGC AUGUC C CUGUA 563 UACAGGGACAUGCGGGACAUGGC -159 1243 564 AUGUC C CGC AUGUC C CUGUC A 565 UGACAGGGACAUGCGGGACAUGG -160 1245 566 GUC C CGC AUGUC C CUGUC CUA 567 UAGGACAGGGACAUGCGGGACAU -161 1246 568 UC C CGC AUGUC C CUGUC CUC A 569 UGAGGACAGGGACAUGCGGGACA -162 1249 570 CGC AUGUC C CUGUC CUC CUUA 571 UAAGGAGGACAGGGACAUGCGGG -163 1251 572 C AUGUC C CUGUC CUC CUUC AA 573 UUGAAGGAGGACAGGGACAUGCG -164 1256 574 C C CUGUC CUC CUUC AGCGUGA 575 UCACGCUGAAGGAGGACAGGGAC -165 1258 576 CUGUC CUC CUUC AGCGUGAAA 577 UUUCACGCUGAAGGAGGACAGGG -166 1260 578 GUC CUC CUUC AGCGUGAAC C A 579 UGGUUCACGCUGAAGGAGGACAG -167 1272 580 CGUGAACCGCCCCUUCCUCUA 581 UAGAGGAAGGGGCGGUUCACGCU -168 1273 582 GUGAAC CGCCCCUUC CUCUUA 583 UAAGAGGAAGGGGCGGUUCACGC -169 1274 584 UGAAC CGCCCCUUCCUCUUCA 585 UGAAGAGGAAGGGGCGGUUCACG -170 1276 586 AACCGCCCCUUCCUCUUCUUA 587 UAAGAAGAGGAAGGGGCGGUUCA -171 1277 588 ACCGCCCCUUCCUCUUCUUCA 589 UGAAGAAGAGGAAGGGGCGGUUC -172 1302 590 CGAGGAC AC C AC AGGC CUUC A 591 UGAAGGC CUGUGGUGUC CUCGAA -173 1304 592 AGGAC AC C AC AGGC CUUC C C A 593 UGGGAAGGC CUGUGGUGUC CUCG -174 1306 594 GAC AC C AC AGGC CUUC C C CUA 595 UAGGGGAAGGC CUGUGGUGUC CU -175 1309 596 AC C AC AGGC CUUC C C CUCUUA 597 UAAGAGGGGAAGGCCUGUGGUGU -176 1527 598 GGCUGUGGCAUCCAGAGUCCA 599 UGGACUCUGGAUGCCACAGCCAC -177 1529 600 CUGUGGC AUG C AGAGUC C CUA 601 UAGGGACUCUGGAUGCCACAGCC -178 1536 602 AUC C AGAGUC C CUGC CUGGAA 603 UUCCAGGCAGGGACUCUGGAUGCDl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit posonN (5’ to 3’) ID NOO (5’ to 3’) -179 1539 604 C AGAGUC C CUGC CUGGAC CAA 605 UUGGUCCAGGCAGGGACUCUGGA -180 1545 606 CCCUGCCUGGACCAGCCUCUA 607 UAGAGGCUGGUCCAGGCAGGGAC -181 1549 608 GC CUGGAC C AGC CUCUC C AC A 609 UGUGGAGAGGCUGGUCCAGGCAG -182 1551 610 CUGGAC C AGC CUCUC C ACUC A 611 UGAGUGGAGAGGCUGGUCCAGGC -183 1553 612 GGAC C AGC CUCUC C ACUC AUA 613 UAUGAGUGGAGAGGCUGGUCCAG -184 1555 614 AC C AGC CUCUC C ACUC AUGUA 615 UACAUGAGUGGAGAGGCUGGUCC -185 1556 616 C C AGC CUCUC C ACUC AUGUGA 617 UCACAUGAGUGGAGAGGCUGGUC -186 1558 618 AGC CUCUC C ACUC AUGUGAC A 619 UGUCACAUGAGUGGAGAGGCUGG -187 1560 620 C CUCUC C ACUC AUGUGACUC A 621 UGAGUCACAUGAGUGGAGAGGCU -188 1561 622 CUCUC C ACUC AUGUGACUCUA 623 UAGAGUCACAUGAGUGGAGAGGC -189 1562 624 UCUC C ACUC AUGUGACUCUUA 625 UAAGAGUCACAUGAGUGGAGAGG -190 1563 626 CUC C ACUC AUGUGACUCUUUA 627 UAAAGAGUCACAUGAGUGGAGAG -191 1564 628 UC C ACUC AUGUGACUCUUUC A 629 UGAAAGAGUCACAUGAGUGGAGA -192 1565 630 C C ACUC AUGUGACUCUUUC C A 631 UGGAAAGAGUCACAUGAGUGGAG -193 1566 632 C ACUC AUGUGACUCUUUC CAA 633 UUGGAAAGAGUCACAUGAGUGGA -194 1567 634 ACUC AUGUGACUCUUUC C AAA 635 UUUGGAAAGAGUCACAUGAGUGG -195 1621 636 AGUCUGAGAGAGGCCAUUCUA 637 UAGAAUGGCCUCUCUCAGACUGC -196 1624 638 CUGAGAGAGGCCAUUCUUUCA 639 UGAAAGAAUGGCCUCUCUCAGAC -197 1625 640 UGAGAGAGGC C AUUCUUUC C A 641 UGGAAAGAAUGGCCUCUCUCAGA -198 1627 642 AGAGAGGC C AUUCUUUC C CAA 643 UUGGGAAAGAAUGGCCUCUCUCA -199 1691 644 GGAGGGCAGGCAUCGGGGAGA 645 UCUCCCCGAUGCCUGCCCUCCUC -200 1694 646 GGGCAGGCAUCGGGGAGCCGA 647 UCGGCUCCCCGAUGCCUGCCCUC -201 1695 648 GGCAGGCAUCGGGGAGCCGGA 649 UCCGGCUCCCCGAUGCCUGCCCU -202 1772 650 UGGGCAGGAGGGAGGUGCUUA 651 UAAGC AC CUCCCUCCUGCC C AGG -203 1775 652 GCAGGAGGGAGGUGCUUCUAA 653 UUAGAAGC AC CUCCCUCCUGCCC -204 1779 654 GAGGGAGGUGCUUCUAGUUCA 655 UGAACUAGAAGC AC CUCCCUCCU -205 1783 656 GAGGUGCUUCUAGUUCUGCCA 657 UGGC AGAACUAGAAGC AC CUC C C -206 1785 658 GGUGCUUCUAGUUCUGCCAGA 659 UCUGGCAGAACUAGAAGCACCUC -207 1788 660 GCUUCUAGUUCUGCCAGGAGA 661 UCUCCUGGCAGAACUAGAAGCACDl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit posonN (5’ to 3’) ID NOO (5’ to 3’) -208 1789 662 CUUCUAGUUCUGCCAGGAGAA 663 UUCUCCUGGCAGAACUAGAAGCA -209 1792 664 CUAGUUCUGCCAGGAGACAGA 665 UCUGUCUCCUGGCAGAACUAGAA -210 1793 666 UAGUUCUGCCAGGAGACAGGA 667 UC CUGUCUC CUGGC AGAACUAGA -211 1798 668 CUGCCAGGAGACAGGUUAGCA 669 UGCUAACCUGUCUCCUGGCAGAA -212 1801 670 CCAGGAGACAGGUUAGCUGCA 671 UGCAGCUAACCUGUCUCCUGGCA -213 1804 672 GGAGACAGGUUAGCUGCUCCA 673 UGGAGCAGCUAACCUGUCUCCUG -214 1805 674 GAGACAGGUUAGCUGCUCCCA 675 UGGGAGCAGCUAACCUGUCUCCU -215 1806 676 AGACAGGUUAGCUGCUCCCCA 677 UGGGGAGCAGCUAACCUGUCUCC -216 1810 678 AGGUUAGCUGCUCCCCACGUA 679 UACGUGGGGAGCAGCUAACCUGU -217 1885 680 GC CUUUGGACUUGUC C CGGGA 681 UC C CGGGACAAGUC CAAAGGC AG -218 1889 682 UUGGACUUGUC C CGGGAC AC A 683 UGUGUC C CGGGACAAGUC CAAAG -219 1921 684 GGGGAGAGACGGGC C CUGGUA 685 UACCAGGGCCCGUCUCUCCCCAC -220 1923 686 GGAGAGACGGGC C CUGGUGGA 687 UCCACCAGGGCCCGUCUCUCCCC -221 1924 688 GAGAGACGGGC C CUGGUGGUA 689 UACCACCAGGGCCCGUCUCUCCC -222 1964 690 GUCCUCAGCCCCGCGUGGAAA 691 UUUCCACGCGGGGCUGAGGACAA -223 1965 692 UC CUC AGC C C CGCGUGGAAC A 693 UGUUCCACGCGGGGCUGAGGACA -224 2070 694 CUUC C C ACGGCUC CUCGAGAA 695 UUCUCGAGGAGCCGUGGGAAGUC -225 2072 696 UCCCACGGCUC CUCGAGAUC A 697 UGAUCUCGAGGAGCCGUGGGAAG -226 2074 698 C C ACGGCUC CUCGAGAUC C C A 699 UGGGAUCUCGAGGAGCCGUGGGA -227 2077 700 CGGCUC CUCGAGAUC C C AAC A 701 UGUUGGGAUCUCGAGGAGCCGUG -228 2078 702 GGCUC CUCGAGAUC C C AAC AA 703 UUGUUGGGAUCUCGAGGAGCCGU -229 2081 704 UC CUCGAGAUC C C AAC ACUGA 705 UCAGUGUUGGGAUCUCGAGGAGC -230 2084 706 UCGAGAUC C C AAC ACUGC C AA 707 UUGGCAGUGUUGGGAUCUCGAGG -231 2085 708 CGAGAUC C CAAC ACUGC C AGA 709 UCUGGCAGUGUUGGGAUCUCGAG -232 2087 710 AGAUC C CAAC ACUGC CAGCAA 711 UUGCUGGCAGUGUUGGGAUCUCG -233 2088 712 GAUC C CAAC ACUGC C AGC AUA 713 UAUGCUGGCAGUGUUGGGAUCUC -234 2130 714 UCCCUCCUCUGCCCGGGAGCA 715 UGCUCCCGGGCAGAGGAGGGAGA -235 2131 716 CCCUCCUCUGCCCGGGAGCUA 717 UAGCUCCCGGGCAGAGGAGGGAG -236 2133 718 CUCCUCUGCCCGGGAGCUCAA 719 UUGAGCUCCCGGGCAGAGGAGGGDl IDpeux Nucleotide SequenceSEQSttar Sense strand SEQID Anti-sense strand iit poson (5’ to 3’) ID NONO (5’ to 3’)4-237 2180 720 AGCUCCUUAAGGCUCUUUUGA 721 UCAAAAGAGCCUUAAGGAGCUCA 4-238 2184 722 CCUUAAGGCUCUUUUGUAAGA 723 UCUUACAAAAGAGCCUUAAGGAG 4-239 2185 724 CUUAAGGCUCUUUUGUAAGGA 725 UC CUUACAAAAGAGC CUUAAGGA 4-240 2186 726 UUAAGGCUCUUUUGUAAGGUA 727 UAC CUUACAAAAGAGC CUUAAGG 4-241 2187 728 UAAGGCUCUUUUGUAAGGUUA 729 UAAC CUUACAAAAGAGC CUUAAG 4-242 2188 730 AAGGCUCUUUUGUAAGGUUUA 731 UAAAC CUUACAAAAGAGC CUUAA 4-243 2194 732 CUUUUGUAAGGUUUUUGUAGA 733 UCUACAAAAAC CUUACAAAAGAG 4-244 2195 734 UUUUGUAAGGUUUUUGUAGUA 735 UACUACAAAAAC CUUACAAAAGA 4-245 2196 736 UUUGUAAGGUUUUUGUAGUGA 737 UC ACUAC AAAAAC CUUAC AAAAG 4-246 2202 738 AGGUUUUUGUAGUGAUUUUUA 739 UAAAAAUC ACUACAAAAAC CUUA 4-247 2203 740 GGUUUUUGUAGUGAUUUUUAA 741 UUAAAAAUC ACUACAAAAAC CUU 4-248 2213 742 GUGAUUUUUAUGC C AC CUGAA 743 UUCAGGUGGCAUAAAAAUCACUA 4-249 2214 744 UGAUUUUUAUGC C AC CUGAAA 745 UUUCAGGUGGCAUAAAAAUCACU 4-250 2216 746 AUUUUUAUGC C AC CUGAAUAA 747 UUAUUCAGGUGGCAUAAAAAUCATable 6. Sequences of exemplary dsRNA agents (UMS*= Unmodified Sequences)SequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)57 familyUMS* 248 GGGGCUCCUGGUGCUCAGCUA 249 UAGCUGAGCACCAGGAGCCCCCA gsgsggCfuccUfGfGfugcucagC (vinu) sAf sgcuGf agcaccaGf gage 5-1 748 f ua 749 cccscsa62 familyUMS* 250 UCCUGGUGCUCAGCUGGUCCA 251 UGGACCAGCUGAGCACCAGGAGC uscscuGfgugCfUf Cf agcugguC (vinu) sGf sgacCf agcugagCf acca 5-2 750 f ca 751 ggasgsc63 familyUMS* 252 CCUGGUGCUCAGCUGGUCCUA 253 UAGGACCAGCUGAGCACCAGGAGSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) cscsugGfugcUf Cf AfgcuggucC (vinu) sAf sggaCf cagcugaGf cacc 5-3 752 f ua 753 aggsasg64 familyUMS* 254 CUGGUGCUCAGCUGGUCCUGA 255 UCAGGACCAGCUGAGCACCAGGA csusggUfgcuCf AfGf cugguccU (vinu) sCf saggAf ccagcugAf gcac 5-4 754 f ga 755 cagsgsa67 familyUMS* 256 GUGCUCAGCUGGUCCUGCCUA 257 UAGGCAGGACCAGCUGAGCACCA gsusgcUf cagCf Uf Gf guccugcC (vinu) sAf sggcAf ggaccagCf ugag 5-5 756 f ua 757 cacscsa68 familyUMS* 258 UGCUCAGCUGGUCCUGCCUGA 259 UCAGGCAGGACCAGCUGAGCACC usgscuCf agcUfGfGfuccugccU (vinu) sCf saggCf aggaccaGf cuga 5-6 758 f ga 759 gcascsc71 familyUMS* 260 UCAGCUGGUCCUGCCUGCAAA 261 UUUGCAGGCAGGACCAGCUGAGC uscsagCfuggUf Cf CfugccugcA (vinu) sUf sugcAf ggcaggaCf cage 5-7 760 f aa 761 ugasgsc105 familyUMS* 262 GUUCUC C C CUGUGAGCGC CAA 263 UUGGCGCUCACAGGGGAGAACAC gsusucUf cccCfUfGfugagcgcC (vinu) sUf sggcGf cucacagGf ggag 5-8 762 f aa 763 aacsasc108 familyUMS* 264 CUC C C CUGUGAGCGC CAUGGA 265 UCCAUGGCGCUCACAGGGGAGAA csusccCf cugUfGf AfgcgccauG (vinu) sCf scauGf gcgcucaCf aggg 5-9 764 f ga 765 gagsasa111 familyUMS* 266 CCCUGUGAGCGCCAUGGAGCA 267 UGCUCCAUGGCGCUCACAGGGGA cscscuGfugaGf CfGf ccauggaG (vinu) sGf scucCf auggegeUf caca 5-10 766 f ca 767 gggsgsa113 familyUMS* 268 CUGUGAGCGCCAUGGAGCCCA 269 UGGGCUCCAUGGCGCUCACAGGG csusguGf agcGf Cf Cf auggagcC (vinu) sGf sggcUf ccauggcGf cuca 5-11 768 f ca 769 cagsgsgSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)114 familyUMS* 270 UGUGAGCGCCAUGGAGCCCUA 271 UAGGGCUCCAUGGCGCUCACAGG usgsugAfgcgCf Cf AfuggagccC (vinu) sAf sgggCf uccauggCf gcuc 5-12 770 f ua 771 acasgsg117 familyUMS* 272 GAGCGCCAUGGAGCCCUUGGA 273 UCCAAGGGCUCCAUGGCGCUCAC gsasgcGf ccaUfGfGf agcccuuG (vinu) sCf scaaGf ggcuccaUf ggcg 5-13 772 f ga 773 cucsasc186 familyUMS* 274 C CUC CUCAAGUUGGGCAAC C A 275 UGGUUGC C CAACUUGAGGAGGGU cscsucCfucaAfGfUfugggcaaC (vinu) sGf sguuGf cccaacuUf gagg 5-14 774 f ca 775 aggsgsu187 familyUMS* 276 CUC CUCAAGUUGGGCAAC CAA 277 UUGGUUGC C CAACUUGAGGAGGG csusccUf caaGfUfUfgggcaacC (vinu) sUf sgguUf gcccaacUf ugag 5-15 776 f aa 777 gagsgsg188 familyUMS* 278 UC CUCAAGUUGGGCAAC C AGA 279 UCUGGUUGC C CAACUUGAGGAGG uscscuCf aagUfUfGfggcaaccA (vinu) sCf suggUf ugcccaaCf uuga 5-16 778 f ga 779 ggasgsg429 familyUMS* 280 GCAGAGGCUGCAACAGGUGCA 281 UGCACCUGUUGCAGCCUCUGCAA gscsagAfggcUfGf Cf aacagguG (vinu) sGf scacCfuguugcaGf ccuc 5-17 780 f ca 781 ugesasa437 familyUMS* 282 UGCAACAGGUGCUGCACGCAA 283 UUGCGUGCAGCACCUGUUGCAGC usgscaAf cagGfUfGf cugcacgC (vinu) sUf sgcgUf gcagcacCf uguu 5-18 782 f aa 783 gcasgsc438 familyUMS* 284 GCAACAGGUGCUGCACGCAGA 285 UCUGCGUGCAGCACCUGUUGCAG gscsaaCf aggUfGf CfugcacgcA (vinu) sCf sugcGf ugcagcaCf cugu 5-19 784 f ga 785 ugcsasg445 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 286 GUGCUGCACGCAGGCUCAGGA 287 UCCUGAGCCUGCGUGCAGCACCU gsusgcUfgcaCfGf Cf aggcucaG (vinu) sCf scugAf gccugcgUf gcag 5-20 786 f ga 787 cacscsu520 familyUMS* 288 UUCCGACUGGCUGCCAGGAUA 289 UAUCCUGGCAGCCAGUCGGAACG ususccGf acuGfGf CfugccaggA (vinu) sAf succUfggcagccAfgucg 5-21 788 f ua 789 gaascsg521 familyUMS* 290 UCCGACUGGCUGCCAGGAUGA 291 UCAUCCUGGCAGCCAGUCGGAAC uscscgAf cugGf CfUfgccaggaU (vinu) sCf saucCf uggcagcCf ague 5-22 790 f ga 791 ggasasc522 familyUMS* 292 CCGACUGGCUGCCAGGAUGUA 293 UACAUCCUGGCAGCCAGUCGGAA cscsgaCfuggCfUfGf ccaggauG (vinu) sAf scauCf cuggcagCf cagu 5-23 792 f ua 793 cggsgsa523 familyUMS* 294 CGACUGGCUGCCAGGAUGUAA 295 UUACAUCCUGGCAGCCAGUCGGA csgsacUfggcUfGf Cf caggaugU (vinu) sUf sacaUf ccuggcaGf ccag 5-24 794 f aa 795 ucgsgsa528 familyUMS* 296 GGCUGCCAGGAUGUACCUGCA 297 UGCAGGUACAUCCUGGCAGCCAG gsgscuGf ccaGfGf AfuguaccuG (vinu) sGf scagGf uacauccUf ggca 5-25 796 f ca 797 gccsasg529 familyUMS* 298 GCUGCCAGGAUGUACCUGCAA 299 UUGCAGGUACAUCCUGGCAGCCA gscsugCf cagGf AfUfguaccugC (vinu) sUf sgcaGf guacaucCf uggc 5-26 798 f aa 799 agcscsa531 familyUMS* 300 UGCCAGGAUGUACCUGCAGAA 301 UUCUGCAGGUACAUCCUGGCAGC usgsccAfggaUfGfUf accugcaG (vinu) sUf scugCf agguacaUf ccug 5-27 800 f aa 801 gcasgsc533 fami yUMS* 302 C C AGGAUGUAC CUGCAGAAAA 303 UUUUCUGCAGGUACAUCCUGGCASequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) cscsagGf augUf Af Cf cugcagaA (vinu) sUf suucUf gcagguaCf aucc 5-28 802 f aa 803 uggscsa534 fami yUMS* 304 CAGGAUGUACCUGCAGAAAGA 305 UCUUUCUGCAGGUACAUCCUGGC csasggAfuguAf Cf CfugcagaaA (vinu) sCf suuuCf ugcagguAf cauc 5-29 804 f ga 805 cugsgsc535 fami yUMS* 306 AGGAUGUACCUGCAGAAAGGA 307 UC CUUUCUGC AGGUAC AUG CUGG asgsgaUf guaCf Cf Uf gcagaaaG (vinu) sCf scuuUf cugcaggUf acau 5-30 806 f ga 807 ccusgsg539 fami yUMS* 308 UGUACCUGCAGAAAGGAUUUA 309 UAAAUCCUUUCUGCAGGUACAUC usgsuaCf cugCf AfGf aaaggauU (vinu) sAf saauCf cuuucugCf aggu 5-31 808 f ua 809 acasusc549 fami yUMS* 310 GAAAGGAUUUC C C AUCAAAGA 311 UCUUUGAUGGGAAAUC CUUUCUG gsasaaGfgauUfUf Cf ccaucaaA (vinu) sCf suuuGf augggaaAf uccu 5-32 810 f ga 811 uucsusg550 fami yUMS* 312 AAAGGAUUUC C C AUCAAAGAA 313 UUCUUUGAUGGGAAAUC CUUUCU asasagGf auuUf Cf Cf caucaaaG (vinu) sUf scuuUf gaugggaAf aucc 5-33 812 f aa 813 uuuscsu551 fami yUMS* 314 AAGGAUUUC C C AUCAAAGAAA 315 UUUCUUUGAUGGGAAAUC CUUUC asasggAfuuuCfCfCf aucaaagA (vinu) sUf sucuUf ugaugggAf aauc 5-34 814 f aa 815 cuususc553 fami yUMS* 316 GGAUUUC C C AUCAAAGAAGAA 317 UUCUUCUUUGAUGGGAAAUC CUU gsgsauUfuccCf AfUf caaagaaG (vinu) sUf scuuCf uuugaugGf gaaa 5-35 816 f aa 817 uccsusu554 fami yUMS* 318 GAUUUC C C AUCAAAGAAGAUA 319 UAUCUUCUUUGAUGGGAAAUC CU gsasuuUf cccAfUf Cf aaagaagA (vinu) sAf sucuUf cuuugauGf ggaa 5-36 818 f ua 819 aucscsuSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)555 fami yUMS* 320 AUUUC C CAUCAAAGAAGAUUA 321 UAAUCUUCUUUGAUGGGAAAUC C asusuuCf ccaUf Cf Af aagaagaU (vinu) sAf saucUf ucuuugaUf ggga 5-37 820 f ua 821 aauscsc556 fami yUMS* 322 UUUC C CAUCAAAGAAGAUUUA 323 UAAAUCUUCUUUGAUGGGAAAUC ususucCf cauCf Af Af agaagauU (vinu) sAf saauCf uucuuugAf uggg 5-38 822 f ua 823 aaasusc558 fami yUMS* 324 UC C CAUCAAAGAAGAUUUC C A 325 UGGAAAUCUUCUUUGAUGGGAAA uscsccAfucaAf AfGf aagauuuC (vinu) sGf sgaaAf ucuucuuUf gang 5-39 824 f ca 825 ggasasa563 fami yUMS* 326 UCAAAG AAGAUUUC CUGGAAA 327 UUUC C AGGAAAUCUUCUUUGAUG uscsaaAfgaaGf AfUfuuccuggA (vinu) sUf succAf ggaaaucUf ucuu 5-40 826 f aa 827 ugasusg565 fami yUMS* 328 AAAG AAGAUUUC CUGGAAC AA 329 UUGUUC C AGGAAAUCUUCUUUGA asasagAf agaUfUfUf ccuggaaC (vinu) sUf sguuCf caggaaaUf cuuc 5-41 828 f aa 829 uuusgsa601 fami yUMS* 330 GGGGCAAAGCCCGUGAGCCUA 331 UAGGCUCACGGGCUUUGCCCCAA gsgsggCf aaaGf Cf Cf cgugagcC (vinu) sAf sggcUf cacgggcUf uugc 5-42 830 f ua 831 cccsasa603 fami yUMS* 332 GGCAAAGCCCGUGAGCCUGAA 333 UUCAGGCUCACGGGCUUUGCCCC gsgscaAf agcCf CfGfugagccuG (vinu) sUf scagGf cucacggGf cuuu 5-43 832 f aa 833 gccscsc608 fami yUMS* 334 AGC C CGUGAGC CUGACGGGAA 335 UUCCCGUCAGGCUCACGGGCUUU asgsccCfgugAfGf Cf cugacggG (vinu) sUf scccGfucaggcuCf acgg 5-44 834 f aa 835 gcususu610 fami ySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 336 C C CGUGAGC CUGACGGGAAAA 337 UUUUCCCGUCAGGCUCACGGGCU cscscgUfgagCf CfUfgacgggaA (vinu) sUf suucCf cgucaggCf ucac 5-45 836 f aa 837 gggscsu611 fami yUMS* 338 C CGUGAGC CUGACGGGAAAGA 339 UCUUUCCCGUCAGGCUCACGGGC cscsguGf agcCfUfGf acgggaaA (vinu) sCf suuuCf ccgucagGf cuca 5-46 838 f ga 839 cggsgsc612 fami yUMS* 340 CGUGAGCCUGACGGGAAAGCA 341 UGCUUUCCCGUCAGGCUCACGGG csgsugAfgccUfGf Af cgggaaaG (vinu) sGf scuuUf cccgucaGf gcuc 5-47 840 f ca 841 acgsgsg613 fami yUMS* 342 GUGAGCCUGACGGGAAAGCAA 343 UUGCUUUCCCGUCAGGCUCACGG gsusgaGf ccuGf Af CfgggaaagC (vinu) sUf sgcuUfucccgucAfggcu 5-48 842 f aa 843 cacsgsg614 fami yUMS* 344 UGAGCCUGACGGGAAAGCAGA 345 UCUGCUUUCCCGUCAGGCUCACG usgsagCf cugAf CfGfggaaagcA (vinu) sCf sugcUf uucccguCf aggc 5-49 844 f ga 845 ucascsg616 fami yUMS* 346 AGCCUGACGGGAAAGCAGGAA 347 UUC CUGCUUUC C CGUC AGGCUC A asgsccUfgacGfGfGf aaagcagG (vinu) sUf sccuGf cuuucccGf ucag 5-50 846 f aa 847 gcuscsa617 fami yUMS* 348 GCCUGACGGGAAAGCAGGAAA 349 UUUC CUGCUUUC C CGUC AGGCUC gscscuGf acgGfGf Af aagcaggA (vinu) sUf succUfgcuuuccCfguca 5-51 848 f aa 849 ggcsusc618 fami yUMS* 350 CCUGACGGGAAAGCAGGAAGA 351 UCUUC CUGCUUUC C CGUC AGGCU cscsugAf cggGf Af Af agcaggaA (vinu) sCf suucCf ugcuuucCf cguc 5-52 850 f ga 851 aggscsu619 fami yUMS* 352 CUGACGGGAAAGCAGGAAGAA 353 UUCUUC CUGCUUUC C CGUC AGGCSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) csusgaCfgggAf Af AfgcaggaaG (vinu) sUf scuuCf cugcuuuCf ccgu 5-53 852 f aa 853 cagsgsc620 fami yUMS* 354 UGACGGGAAAGCAGGAAGAUA 355 UAUCUUC CUGCUUUC C CGUC AGG usgsacGfggaAf AfGf caggaagA (vinu) sAf sucuUf ccugcuuUf cccg 5-54 854 f ua 855 ucasgsg622 fami yUMS* 356 ACGGGAAAGCAGGAAGAUGAA 357 UUC AUCUUC CUGCUUUC C CGUC A ascsggGf aaaGf Cf Af ggaagauG (vinu) sUf scauCfuuccugcUfuucc 5-55 856 f aa 857 cguscsa624 fami yUMS* 358 GGGAAAGCAGGAAGAUGACCA 359 UGGUC AUCUUC CUGCUUUC CCGU gsgsgaAf agcAf Gf Gf aagaugaC (vinu) sGf sgucAf ucuuccuGf cuuu 5-56 858 f ca 859 cccsgsu631 fami yUMS* 360 CAGGAAGAUGACCUGGCAAAA 361 UUUUGCCAGGUCAUCUUCCUGCU csasggAf agaUfGf Af ccuggcaA (vinu) sUf suugCf caggucaUf cuuc 5-57 860 f aa 861 cugscsu633 fami yUMS* 362 GGAAGAUGACCUGGCAAACAA 363 UUGUUUGC CAGGUC AUCUUC CUG gsgsaaGf augAf Cf Cf uggcaaaC (vinu) sUf sguuUf gccagguCf aucu 5-58 862 f aa 863 uccsusg634 fami yUMS* 364 GAAGAUGACCUGGCAAACAUA 365 UAUGUUUGC CAGGUC AUCUUC CU gsasagAfugaCf CfUfggcaaacA (vinu) sAf suguUf ugccaggUf cauc 5-59 864 f ua 865 uucscsu637 fami yUMS* 366 GAUGACCUGGCAAACAUCAAA 367 UUUGAUGUUUGCCAGGUCAUCUU gsasugAf ccuGfGf Cf aaacaucA (vinu) sUf sugaUf guuugccAf gguc 5-60 866 f aa 867 aucsusu640 fami yUMS* 368 GAC CUGGC AAAC AUC AAC C AA 369 UUGGUUGAUGUUUGCCAGGUCAU gsasccUfggcAf Af Af caucaacC (vinu) sUf sgguUf gauguuuGf ccag 5-61 868 f aa 869 gucsasuSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)647 fami yUMS* 370 CAAAC AUCAAC CAAUGGGUGA 371 UC AC C C AUUGGUUGAUGUUUGC C csasaaCf aucAf Af Cf caaugggU (vinu) sCf saccCf auugguuGf augu 5-62 870 f ga 871 uugscsc652 fami yUMS* 372 AUCAAC C AAUGGGUGAAGGAA 373 UUC CUUC AC C C AUUGGUUGAUGU asuscaAf ccaAf Uf Gf ggugaagG (vinu) sUf sccuUf cacccauUf gguu 5-63 872 f aa 873 gausgsu653 fami yUMS* 374 UCAAC CAAUGGGUGAAGGAGA 375 UCUCCUUCACC C AUUGGUUGAUG uscsaaCf caaUf Gf Gf gugaaggA (vinu) sCf succUf ucacccaUf uggu 5-64 874 f ga 875 ugasusg654 fami yUMS* 376 C AAC C AAUGGGUGAAGGAGGA 377 UCCUCCUUCACC C AUUGGUUGAU csasacCf aauGf Gf Gf ugaaggaG (vinu) sCf scucCf uucacccAf uugg 5-65 876 f ga 877 uugsasu655 fami yUMS* 378 AACCAAUGGGUGAAGGAGGCA 379 UGC CUC CUUC AC C C AUUGGUUGA asasccAf augGf Gf Uf gaaggagG (vinu) sGf sccuCf cuucaccCf auug 5-66 878 f ca (L96 ) 879 guusgsa656 fami yUMS* 380 AC C AAUGGGUG AAGG AGG CCA 381 UGGC CUC CUUC AC C C AUUGGUUG ascscaAfuggGfUfGf aaggaggC (vinu) sGf sgccUf ccuucacCf cauu 5-67 880 f ca 881 ggususg657 fami yUMS* 382 C C AAUGGGUG AAGG AGG C C AA 383 UUGGC CUC CUUC AC C C AUUGGUU cscsaaUfgggUfGf Af aggaggcC (vinu) sUf sggcCfuccuucaCf ccau 5-68 882 f aa 883 uggsusu661 fami yUMS* 384 UGGGUGAAGGAGGCCACGGAA 385 UUC CGUGGC CUC CUUC AC C CAUU usgsggUfgaaGfGf AfggccacgG (vinu) sUf sccgUfggccuccUfucac 5-69 884 f aa 885 ccasusu668 fami ySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 386 AGGAGGCCACGGAGGGGAAGA 387 UCUUCCCCUCCGUGGCCUCCUUC asgsgaGfgccAf CfGfgaggggaA (vinu) sGf suucCf ccuccguGf gccu 5-70 886 f ga 887 ccususc669 fami yUMS* 388 GGAGGCCACGGAGGGGAAGAA 389 UUCUUCCCCUC CGUGGC CUC CUU gsgsagGf ccaCfGfGf aggggaaG (vinu) sUf scuuCf cccuccgUf ggcc 5-71 888 f aa 889 uccsusu670 fami yUMS* 390 GAGGCCACGGAGGGGAAGAUA 391 UAUCUUCCCCUCCGUGGCCUCCU gsasggCf cacGfGf AfggggaagA (vinu) sAf sucuUf ccccuccGf uggc 5-72 890 f ua 891 cucscsu672 fami yUMS* 392 GGCCACGGAGGGGAAGAUUCA 393 UGAAUCUUC C C CUC CGUGGC CUC gsgsccAf cggAf Gf Gf ggaagauU (vinu) sGf saauCf uuccccuCf cgug 5-73 892 f ca 893 gccsusc711 fami yUMS* 394 GCCGGAAGACACCGUGUUGCA 395 UGCAACACGGUGUCUUCCGGCAG gscscgGf aagAf Cf Af ccguguuG (vinu) sGf scaaCf acgguguCf uucc 5-74 894 f ca 895 ggcsasg712 fami yUMS* 396 C CGGAAGAC AC CGUGUUGCUA 397 UAGCAACACGGUGUCUUCCGGCA cscsggAf agaCf Af Cf cguguugC (vinu) sAf sgcaAf cacggugUf cuuc 5-75 896 f ua 897 cggscsa716 fami yUMS* 398 AAGACACCGUGUUGCUUCUCA 399 UGAGAAGCAACACGGUGUCUUCC asasgaCf accGf Uf Gf uugcuucU (vinu) sGf sagaAf gcaacacGf gugu 5-76 898 f ca 899 cuuscsc717 fami yUMS* 400 AGAC AC CGUGUUGCUUCUC C A 401 UGGAGAAGCAACACGGUGUCUUC asgsacAf ccgUf Gf Uf ugcuucuC (vinu) sGf sgagAf agcaacaCf ggug 5-77 900 f ca 901 ucususc718 fami yUMS* 402 GAC AC CGUGUUGCUUCUC CUA 403 UAGGAGAAGCAACACGGUGUCUUSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gsascaCf cguGf Uf Uf gcuucucC (vinu) sAf sggaGf aagcaacAf cggu 5-78 902 f ua 903 gucsusu731 fami yUMS* 404 UUCUC CUCAACGC C AUC C AC A 405 UGUGGAUGGCGUUGAGGAGAAGC ususcuCf cucAf Af CfgccauccA (vinu) sGf suggAf uggcguuGf agga 5-79 904 f ca 905 gaasgsc732 fami yUMS* 406 UCUCCUCAACGCCAUCCACUA 407 UAGUGGAUGGCGUUGAGGAGAAG uscsucCfucaAf CfGf ccauccaC (vinu) sAf sgugGf auggcguUf gagg 5-80 906 f ua 907 agasasg733 fami yUMS* 408 CUCCUCAACGCCAUCCACUUA 409 UAAGUGGAUGGCGUUGAGGAGAA csusccUf caaCfGf Cf cauccacU (vinu) sAf saguGf gauggcgUf ugag 5-81 908 f ua 909 gagsasa734 fami yUMS* 410 UC CUCAACGC C AUC C ACUUC A 411 UGAAGUGGAUGGCGUUGAGGAGA uscscuCf aacGf Cf Cf auccacuU (vinu) sGf saagUf ggauggcGf uuga 5-82 910 f ca 911 ggasgsa735 fami yUMS* 412 C CUCAACGC C AUC C ACUUC C A 413 UGGAAGUGGAUGGCGUUGAGGAG cscsucAf acgCf Cf AfuccacuuC (vinu) sGf sgaaGf uggauggCf guug 5-83 912 f ca 913 aggsasg738 fami yUMS* 414 C AACGC C AUC C ACUUC C AGGA 415 UCCUGGAAGUGGAUGGCGUUGAG csasacGf ccaUf Cf Cf acuuccaG (vinu) sGf scugGf aaguggaUf ggcg 5-84 914 f ga 915 uugsasg739 fami yUMS* 416 AACGC C AUC C ACUUC C AGGGA 417 UC C CUGGAAGUGGAUGGCGUUGA asascgCf cauCf Cf Af cuuccagG (vinu) sGf sccuGf gaaguggAf uggc 5-85 916 f ga 917 guusgsa742 fami yUMS* 418 GC C AUC C ACUUC C AGGGUUUA 419 UAAAC C CUGGAAGUGGAUGGCGU gscscaUf ccaCfUfUf ccaggguU (vinu) sAf saacCf cuggaagUf ggau 5-86 918 f ua 919 ggcsgsuSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)745 fami yUMS* 420 AUG C ACUUC C AGGGUUUCUGA 421 UC AGAAAC C CUGGAAGUGGAUGG asusccAf cuuCf Cf AfggguuucU (vinu) sCf sagaAf acccuggAf agug 5-87 920 f ga 921 gausgsg747 fami yUMS* 422 C C ACUUC C AGGGUUUCUGGAA 423 UUC C AGAAAC C CUGGAAGUGGAU cscsacUfuccAfGfGfguuucugG (vinu) sUf sccaGf aaacccuGf gaag 5-88 922 f aa 923 uggsasu748 fami yUMS* 424 C ACUUC C AGGGUUUCUGGAGA 425 UCUC C AGAAAC C CUGGAAGUGGA csascuUf ccaGfGfGfuuucuggA (vinu) sCf succAf gaaacccUf ggaa 5-89 924 f ga 925 gugsgsa750 fami yUMS* 426 CUUC C AGGGUUUCUGGAGGAA 427 UUC CUC C AGAAAC C CUGGAAGUG csusucCf aggGfUfUfucuggagG (vinu) sUf sccuCf cagaaacCf cugg 5-90 926 f aa 927 aagsusg790 fami yUMS* 428 ACC C AGAGAGACUC CUUC C AA 429 UUGGAAGGAGUCUCUCUGGGUAA ascsccAfgagAfGf Af cuccuucC (vinu) sUf sggaAf ggagucuCf ucug 5-91 928 f aa 929 ggusasa811 fami yUMS* 430 CUGGACGAGCAGUUCACGGUA 431 UAC CGUGAACUGCUCGUC C AGGU csusggAf cgaGf Cf AfguucacgG (vinu) sAf sccgUf gaacugcUf cguc 5-92 930 f ua 931 cagsgsu812 fami yUMS* 432 UGGACGAGCAGUUCACGGUGA 433 UC AC CGUGAACUGCUCGUC C AGG usgsgaCfgagCf AfGfuucacggU (vinu) sCf saccGf ugaacugCf ucgu 5-93 932 f ga 933 ccasgsg892 fami yUMS* 434 GAGAUCCAGGUGGCUCAUUUA 435 UAAAUGAGC C AC CUGGAUCUC AG gsasgaUf ccaGf Gf Uf ggcucauU (vinu) sAf saauGf agccaccUf ggau 5-94 934 f ua 935 cucsasg912 fami ySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 436 C C C CUUUAAGAACAAC AUGAA 437 UUCAUGUUGUUCUUAAAGGGGAA cscsccUfuuaAfGf Af acaacauG (vinu) sUf scauGf uuguucuUf aaag 5-95 936 f aa 937 gggsasa913 fami yUMS* 438 C C CUUUAAGAACAAC AUGAGA 439 UCUCAUGUUGUUCUUAAAGGGGA cscscuUfuaaGf Af Af caacaugA (vinu) sCf sucaUf guuguucUf uaaa 5-96 938 f ga 939 gggsgsa915 fami yUMS* 440 CUUUAAGAACAACAUGAGCUA 441 UAGCUCAUGUUGUUCUUAAAGGG csusuuAf agaAf Cf Af acaugagC (vinu) sAf sgcuCf auguuguUf cuua 5-97 940 f ua 941 aagsgsg919 fami yUMS* 442 AAGAACAACAUGAGCUUUGUA 443 UACAAAGCUCAUGUUGUUCUUAA asasgaAf caaCf AfUfgagcuuuG (vinu) sAf scaaAf gcucaugUf uguu 5-98 942 f ua 943 cuusasa920 fami yUMS* 444 AGAACAACAUGAGCUUUGUGA 445 UCACAAAGCUCAUGUUGUUCUUA asgsaaCf aacAfUfGf agcuuugU (vinu) sCf sacaAf agcucauGf uugu 5-99 944 f ga 945 ucususa921 fami yUMS* 446 GAACAACAUGAGCUUUGUGGA 447 UCCACAAAGCUCAUGUUGUUCUU gsasacAf acaUfGf AfgcuuuguG (vinu) sCf scacAf aagcucaUf guug 5-100 946 f ga 947 uucsusu924 fami yUMS* 448 CAACAUGAGCUUUGUGGUCCA 449 UGGACCACAAAGCUCAUGUUGUU csasacAfugaGf CfUfuugugguC (vinu) sGf sgacCf acaaagcUf caug 5-101 948 f ca 949 uugsusu946 fami yUMS* 450 GUAC C C AC C C ACUUUGAAUGA 451 UCAUUCAAAGUGGGUGGGUACAA gsusacCf cacCf Cf Af cuuugaaU (vinu) sCf sauuCf aaaguggGf uggg 5-102 950 f ga 951 uacsasa948 fami yUMS* 452 AC C C AC C C ACUUUGAAUGGAA 453 UUC C AUUCAAAGUGGGUGGGUACSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) ascsccAf cccAf CfUfuugaaugG (vinu) sUf sccaUf ucaaaguGf ggug 5-103 952 f aa 953 ggusasc949 fami yUMS* 454 C C C AC C C ACUUUGAAUGGAAA 455 UUUC C AUUCAAAGUGGGUGGGUA cscscaCf ccaCfUfUfugaauggA (vinu) sUf succAf uucaaagUf gggu 5-104 954 f aa 955 gggsusa950 fami yUMS* 456 C C AC C C ACUUUGAAUGGAAC A 457 UGUUC C AUUCAAAGUGGGUGGGU cscsacCf cacUfUfUfgaauggaA (vinu) sGf suucCf auucaaaGf uggg 5-105 956 f ca 957 uggsgsu952 fami yUMS* 458 ACC C ACUUUGAAUGGAACGUA 459 UACGUUC C AUUCAAAGUGGGUGG ascsccAf cuuUfGf Af auggaacG (vinu) sAf scguUf ccauucaAf agug 5-106 958 f ua 959 ggusgsg955 fami yUMS* 460 CACUUUGAAUGGAACGUGUCA 461 UGAC ACGUUC C AUUCAAAGUGGG csascuUfugaAfUfGfgaacgugU (vinu) sGf sacaCf guuccauUf caaa 5-107 960 f ca 961 gugsgsg958 fami yUMS* 462 UUUGAAUGGAACGUGUC C CAA 463 UUGGGAC ACGUUC C AUUCAAAGU ususugAf augGf Af Af cguguccC (vinu) sUf sgggAf cacguucCf auuc 5-108 962 f aa 963 aaasgsu960 fami yUMS* 464 UGAAUGGAACGUGUC C C AGGA 465 UC CUGGGAC ACGUUC C AUUCAAA usgsaaUfggaAf CfGfugucccaG (vinu) sGf scugGf gacacguUf ccau 5-109 964 f ga 965 ucasasa967 fami yUMS* 466 AACGUGUC C C AGGUACUGGC A 467 UGC C AGUAC CUGGGAC ACGUUC C asascgUfgucCf Cf AfgguacugG (vinu) sGf sccaGfuaccuggGf acac 5-110 966 f ca 967 guuscsc969 fami yUMS* 468 CGUGUC C C AGGUACUGGC CAA 469 UUGGC C AGUAC CUGGGAC ACGUU csgsugUf cccAf GfGfuacuggcC (vinu) sUf sggcCf aguaccuGf ggac 5-111 968 f aa 969 acgsusuSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)970 fami yUMS* 470 GUGUC C CAGGUACUGGC CAAA 471 UUUGGC C AGUAC CUGGGAC ACGU gsusguCf ccaGfGfUf acuggccA (vinu) sUf suggCf caguaccUf ggga 5-112 970 f aa 971 cacsgsu974 fami yUMS* 472 C C CAGGUACUGGC CAAC CUGA 473 UCAGGUUGGC C AGUAC CUGGGAC cscscaGfguaCfUfGfgccaaccU (vinu) sCf saggUf uggccagUf accu 5-113 972 f ga 973 gggsasc976 fami yUMS* 474 CAGGUACUGGC CAAC CUGAGA 475 UCUCAGGUUGGC C AGUAC CUGGG csasggUf acuGfGf Cf caaccugA (vinu) sCf sucaGf guuggccAf guac 5-114 974 f ga 975 cugsgsg981 fami yUMS* 476 ACUGGC CAAC CUGAGUUGGGA 477 UC C CAACUCAGGUUGGC C AGUAC ascsugGfccaAfCfCf ugaguugG (vinu) sCf sccaAf cucagguUf ggcc 5-115 976 f ga 977 agusasc982 fami yUMS* 478 CUGGC CAAC CUGAGUUGGGAA 479 UUC C CAACUC AGGUUGGC C AGUA csusggCf caaCf CfUfgaguuggG (vinu) sUf scccAf acucaggUf uggc 5-116 978 f aa 979 cagsusa984 fami yUMS* 480 GGC CAAC CUGAGUUGGGACAA 481 UUGUC C CAACUC AGGUUGGC C AG gsgsccAf accUfGf AfguugggaC (vinu) sUf sgucCf caacucaGf guug 5-117 980 f aa 981 gccsasg988 fami yUMS* 482 AAC CUGAGUUGGGAC AC C CUA 483 UAGGGUGUC C CAACUC AGGUUGG asasccUfgagUfUfGfggacaccC (vinu) sAf sgggUf gucccaaCf ucag 5-118 982 f ua 983 guusgsg989 fami yUMS* 484 AC CUGAGUUGGGAC AC C CUGA 485 UC AGGGUGUC C CAACUC AGGUUG ascscuGf aguUfGfGfgacacccU (vinu) sCf saggGf ugucccaAf cuca 5-119 984 f ga 985 ggususg1020 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 486 GGUGUGGG AG AGG C C C AC C AA 487 UUGGUGGGC CUCUC C C AC AC C AG gsgsugUfgggAfGf AfggcccacC (vinu) sUf sgguGfggccucuCf ccac 5-120 986 f aa 987 accsasg1022 familyUMS* 488 UGUGGG AG AGG C C C AC C AAG A 489 UCUUGGUGGGC CUCUC C C AC AC C usgsugGfgagAfGfGf cccaccaA (vinu) sCf suugGf ugggccuCf uccc 5-121 988 f ga 989 acascsc1026 familyUMS* 490 GGAGAGGC C C AC CAAGGUC C A 491 UGGAC CUUGGUGGGC CUCUC C C A gsgsagAfggcCf Cf Af ccaagguC (vinu) sGf sgacCf uugguggGf ccuc 5-122 990 f ca 991 uccscsa1029 familyUMS* 492 GAGGC C C AC CAAGGUC CGGC A 493 UGC CGGAC CUUGGUGGGC CUCUC gsasggCf ccaCf Cf Af agguccgG (vinu) sGf sccgGf accuuggUf gggc 5-123 992 f ca 993 cucsusc1030 familyUMS* 494 AGGC C C AC CAAGGUC CGGCUA 495 UAGC CGGAC CUUGGUGGGC CUCU asgsgcCf cacCf Af AfgguccggC (vinu) sAf sgccGf gaccuugGf uggg 5-124 994 f ua 995 ccuscsu1031 familyUMS* 496 GGC C C AC CAAGGUC CGGCUGA 497 UCAGC CGGAC CUUGGUGGGC CUC gsgsccCf accAf AfGfguccggcU (vinu) sCf sagcCf ggaccuuGf gugg 5-125 996 f ga 997 gccsusc1032 familyUMS* 498 GCCCACCAAGGUCCGGCUGCA 499 UGCAGCCGGACCUUGGUGGGCCU gscsccAf ccaAfGfGfuccggcuG (vinu) sGf scagCf cggaccuUf ggug 5-126 998 f ca 999 ggcscsu1034 familyUMS* 500 C C AC CAAGGUC CGGCUGC CUA 501 UAGGCAGCCGGACCUUGGUGGGC cscsacCf aagGfUf Cf cggcugcC (vinu) sAf sggcAf gccggacCf uugg 5-127 1000 f ua 1001 uggsgsc1035 familyUMS* 502 C AC CAAGGUC CGGCUGC CUAA 503 UUAGGCAGCCGGACCUUGGUGGGSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) csasccAf aggUf Cf CfggcugccU (vinu) sUf saggCf agccggaCf cuug 5-128 1002 f aa 1003 gugsgsg1040 familyUMS* 504 AGGUCCGGCUGCCUAAGCUGA 505 UCAGCUUAGGCAGCCGGACCUUG asgsguCf cggCfUfGf ccuaagcU (vinu) sCf sagcUf uaggcagCf cgga 5-129 1004 f ga 1005 ccususg1043 familyUMS* 506 UCCGGCUGCCUAAGCUGUAUA 507 UAUACAGCUUAGGCAGCCGGACC uscscgGf cugCf CfUf aagcuguA (vinu) sAf suacAf gcuuaggCf agcc 5-130 1006 f ua 1007 ggascsc1047 familyUMS* 508 GCUGCCUAAGCUGUAUCUGAA 509 UUCAGAUACAGCUUAGGCAGCCG gscsugCf cuaAfGf CfuguaucuG (vinu) sUf scagAf uacagcuUf aggc 5-131 1008 f aa 1009 agcscsg1052 familyUMS* 510 CUAAGCUGUAUCUGAAACACA 511 UGUGUUUCAGAUACAGCUUAGGC csusaaGf cugUf AfUf cugaaacA (vinu) sGf suguUf ucagauaCf agcu 5-132 1010 f ca 1011 uagsgsc1055 familyUMS* 512 AGCUGUAUCUGAAACACCAAA 513 UUUGGUGUUUCAGAUACAGCUUA asgscuGfuauCfUfGf aaacaccA (vinu) sUf suggUf guuucagAf uaca 5-133 1012 f aa 1013 gcususa1056 familyUMS* 514 GCUGUAUCUGAAACACCAAAA 515 UUUUGGUGUUUCAGAUACAGCUU gscsugUf aucUfGf Af aacaccaA (vinu) sUf suugGf uguuucaGf auac 5-134 1014 f aa 1015 agcsusu1057 familyUMS* 516 CUGUAUCUGAAAC AC C AAAUA 517 UAUUUGGUGUUUCAGAUACAGCU csusguAfucuGf Af Af acaccaaA (vinu) sAf suuuGf guguuucAf gaua 5-135 1016 f ua 1017 cagscsu1059 familyUMS* 518 GUAUCUGAAAC AC CAAAUGGA 519 UC C AUUUGGUGUUUC AGAUAC AG gsusauCfugaAf Af Cf accaaauG (vinu) sCf scauUf ugguguuUf caga 5-136 1018 f ga 1019 uacsasgSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)1061 familyUMS* 520 AUCUGAAAC AC CAAAUGGAC A 521 UGUC C AUUUGGUGUUUC AGAUAC asuscuGf aaaCf Af Cf caaauggA (vinu) sGf succAf uuuggugUf uuca 5-137 1020 f ca 1021 gausasc1062 familyUMS* 522 UCUGAAAC AC CAAAUGGAC C A 523 UGGUC C AUUUGGUGUUUC AGAUA uscsugAf aacAf Cf Cf aaauggaC (vinu) sGf sgucCf auuugguGf uuuc 5-138 1022 f ca 1023 agasusa1149 familyUMS* 524 CGAGCAGAGCCUGGUGGUGUA 525 UACACCACCAGGCUCUGCUCGGA csgsagCf agaGf Cf Cf uggugguG (vinu) sAf scacCf accaggcUf cugc 5-139 1024 f ua 1025 ucgsgsa1155 familyUMS* 526 GAGCCUGGUGGUGUCCGGCGA 527 UCGCCGGACACCACCAGGCUCUG gsasgcCfuggUfGfGfuguccggC (vinu) sCf sgccGf gacaccaCf cagg 5-140 1026 f ga 1027 cucsusg1156 familyUMS* 528 AGCCUGGUGGUGUCCGGCGUA 529 UACGCCGGACACCACCAGGCUCU asgsccUfgguGfGfUfguccggcG (vinu) sAf scgcCf ggacaccAf ccag 5-141 1028 f ua 1029 gcuscsu1158 familyUMS* 530 CCUGGUGGUGUCCGGCGUGCA 531 UGCACGCCGGACACCACCAGGCU cscsugGfuggUfGfUf ccggcguG (vinu) sGf scacGf ccggacaCf cacc 5-142 1030 f ca 1031 aggscsu1159 familyUMS* 532 CUGGUGGUGUCCGGCGUGCAA 533 UUGCACGCCGGACACCACCAGGC csusggUfgguGfUf Cf cggcgugC (vinu) sUf sgcaCfgccggacAf ccac 5-143 1032 f aa 1033 cagsgsc1161 familyUMS* 534 GGUGGUGUCCGGCGUGCAGCA 535 UGCUGCACGCCGGACACCACCAG gsgsugGfuguCf CfGfgcgugcaG (vinu) sGf scugCf acgccggAf cacc 5-144 1034 f ca 1035 accsasg1172 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 536 GCGUGCAGCAUCAGUCCACCA 537 UGGUGGACUGAUGCUGCACGCCG gscsguGf cagCf AfUf caguccaC (vinu) sGf sgugGf acugaugCf ugca 5-145 1036 f ca 1037 cgcscsg1177 familyUMS* 538 C AGC AUG AGUC C AC C CUGGAA 539 UUCCAGGGUGGACUGAUGCUGCA csasgcAfucaGfUf Cf cacccugG (vinu) sUf sccaGf gguggacUf gacu 5-146 1038 f aa 1039 cugscsa1178 familyUMS* 540 AGC AUG AGUC C AC C CUGGAGA 541 UCUCCAGGGUGGACUGAUGCUGC asgscaUf cagUf Cf Cf acccuggA (vinu) sCf succAf ggguggaCf ugau 5-147 1040 f ga 1041 gcusgsc1181 familyUMS* 542 AUC AGUC C AC C CUGGAGCUC A 543 UGAGCUCCAGGGUGGACUGAUGC asuscaGfuccAf Cf Cf cuggagcU (vinu) sGf sagcUf ccaggguGf gacu 5-148 1042 f ca 1043 gausgsc1183 familyUMS* 544 C AGUC C AC C CUGGAGCUC AGA 545 UCUGAGCUCCAGGGUGGACUGAU csasguCf cacCf CfUfggagcucA (vinu) sCf sugaGf cuccaggGf ugga 5-149 1044 f ga 1045 cugsasu1186 familyUMS* 546 UC GAG C CUGGAGCUC AGCGAA 547 UUCGCUGAGCUCCAGGGUGGACU uscscaCf ccuGfGf AfgcucagcG (vinu) sUf scgcUf gagcuccAf gggu 5-150 1046 f aa 1047 ggascsu1190 familyUMS* 548 CCCUGGAGCUCAGCGAGGUCA 549 UGACCUCGCUGAGCUCCAGGGUG cscscuGfgagCfUf Cf agcgaggU (vinu) sGf saccUf cgcugagCf ucca 5-151 1048 f ca 1049 gggsusg1192 familyUMS* 550 CUGGAGCUCAGCGAGGUCGGA 551 UC CGAC CUCGCUGAGCUC C AGGG csusggAfgcuCf AfGf cgaggucG (vinu) sCf scgaCf cucgcugAf gcuc 5-152 1050 f ga 1051 cagsgsg1194 familyUMS* 552 GGAGCUCAGCGAGGUCGGCGA 553 UCGCCGACCUCGCUGAGCUCCAGSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gsgsagCfucaGf CfGf aggucggC (vinu) sCf sgccGf accucgcUf gagc 5-153 1052 f ga 1053 uccsasg1195 familyUMS* 554 GAGCUCAGCGAGGUCGGCGUA 555 UACGCCGACCUCGCUGAGCUCCA gsasgcUf cagCfGf AfggucggcG (vinu) sAf scgcCf gaccucgCf ugag 5-154 1054 f ua 1055 cucscsa1200 familyUMS* 556 CAGCGAGGUCGGCGUGGAGGA 557 UCCUCCACGCCGACCUCGCUGAG csasgcGf aggUf CfGfgcguggaG (vinu) sCf scucCf acgccgaCf cucg 5-155 1056 f ga 1057 cugsasg1203 familyUMS* 558 CGAGGUCGGCGUGGAGGCGGA 559 UCCGCCUCCACGCCGACCUCGCU csgsagGfucgGf CfGfuggaggcG (vinu) sCf scgcCf uccacgcCfgacc 5-156 1058 f ga 1059 ucgscsu1204 familyUMS* 560 GAGGUCGGCGUGGAGGCGGCA 561 UGCCGCCUCCACGCCGACCUCGC gsasggUf cggCf Gf Uf ggaggcgG (vinu) sGf sccgCf cuccacgCf cgac 5-157 1060 f ca 1061 cucsgsc1242 familyUMS* 562 C AUGUC C CGC AUGUC C CUGUA 563 UACAGGGACAUGCGGGACAUGGC csasugUf cccGf Cf AfugucccuG (vinu) sAf scagGf gacaugcGf ggac 5-158 1062 f ua 1063 augsgsc1243 familyUMS* 564 AUGUC C CGC AUGUC C CUGUC A 565 UGACAGGGACAUGCGGGACAUGG asusguCf ccgCf AfUfgucccugU (vinu) sGf sacaGf ggacaugCf ggga 5-159 1064 f ca 1065 causgsg1245 familyUMS* 566 GUC C CGC AUGUC C CUGUC CUA 567 UAGGACAGGGACAUGCGGGACAU gsusccCfgcaUfGfUf cccugucC (vinu) sAf sggaCf agggacaUf gegg 5-160 1066 f ua 1067 gacsasu1246 familyUMS* 568 UC C CGC AUGUC C CUGUC CUC A 569 UGAGGACAGGGACAUGCGGGACA uscsccGf cauGfUf Cf ccuguccU (vinu) sGf saggAf cagggacAf ugcg 5-161 1068 f ca 1069 ggascsaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)1249 familyUMS* 570 CGC AUGUC C CUGUC CUC CUUA 571 UAAGGAGGACAGGGACAUGCGGG csgscaUfgucCf CfUfguccuccU (vinu) sAf saggAf ggacaggGf acau 5-162 1070 f ua (L96 ) 1071gcgsgsg1251 familyUMS* 572 C AUGUC C CUGUC CUC CUUC AA 573 UUGAAGGAGGACAGGGACAUGCG csasugUf cccUfGfUf ccuccuuC (vinu) sUf sgaaGf gaggacaGf ggac 5-163 1072 f aa 1073 augscsg1256 familyUMS* 574 C C CUGUC CUC CUUC AGCGUGA 575 UCACGCUGAAGGAGGACAGGGAC cscscuGfuccUf Cf CfuucagcgU (vinu) sCf sacgCf ugaaggaGf gaca 5-164 1074 f ga 1075 gggsasc1258 familyUMS* 576 CUGUC CUC CUUC AGCGUGAAA 577 UUUCACGCUGAAGGAGGACAGGG csusguCf cucCfUfUf cagcgugA (vinu) sUf sucaCf gcugaagGf agga 5-165 1076 f aa 1077 cagsgsg1260 familyUMS* 578 GUC CUC CUUC AGCGUGAAC C A 579 UGGUUCACGCUGAAGGAGGACAG gsusccUf ccuUf Cf AfgcgugaaC (vinu) sGf sguuCf acgcugaAf ggag 5-166 1078 f ca 1079 gacsasg1272 familyUMS* 580 CGUGAACCGCCCCUUCCUCUA 581 UAGAGGAAGGGGCGGUUCACGCU csgsugAf accGf Cf Cf ccuuccuC (vinu) sAf sgagGf aaggggcGf guuc 5-167 1080 f ua 1081 acgscsu1273 familyUMS* 582 GUGAAC CGCCCCUUC CUCUUA 583 UAAGAGGAAGGGGCGGUUCACGC gsusgaAf ccgCf Cf Cf cuuccucU (vinu) sAf sagaGf gaaggggCf gguu 5-168 1082 f ua 1083 cacsgsc1274 familyUMS* 584 UGAAC CGCCCCUUCCUCUUCA 585 UGAAGAGGAAGGGGCGGUUCACG usgsaaCf cgcCf Cf CfuuccucuU (vinu) sGf saagAf ggaagggGf cggu 5-169 1084 f ca 1085 ucascsg1276 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 586 AACCGCCCCUUCCUCUUCUUA 587 UAAGAAGAGGAAGGGGCGGUUCA asasccGf cccCfUfUf ccucuucU (vinu) sAf sagaAf gaggaagGf ggcg 5-170 1086 f ua 1087 guuscsa1277 familyUMS* 588 ACCGCCCCUUCCUCUUCUUCA 589 UGAAGAAGAGGAAGGGGCGGUUC ascscgCf cccUfUf Cf cucuucuU (vinu) sGf saagAf agaggaaGf gggc 5-171 1088 f ca 1089 ggususc1302 familyUMS* 590 CGAGGAC AC C AC AGGC CUUC A 591 UGAAGGC CUGUGGUGUC CUCGAA csgsagGf acaCf Cf Af caggccuU (vinu) sGf saagGf ccuguggUf gucc 5-172 1090 f ca 1091 ucgsasa1304 familyUMS* 592 AGGAC AC C AC AGGC CUUC C C A 593 UGGGAAGGC CUGUGGUGUC CUCG asgsgaCf accAf Cf AfggccuucC (vinu) sGf sggaAf ggccuguGf gugu 5-173 1092 f ca 1093 ccuscsg1306 familyUMS* 594 GAC AC C AC AGGC CUUC C C CUA 595 UAGGGGAAGGC CUGUGGUGUC CU gsascaCf cacAfGfGf ccuucccC (vinu) sAf sgggGf aaggccuGf uggu 5-174 1094 f ua 1095 gucscsu1309 familyUMS* 596 AC C AC AGGC CUUC C C CUCUUA 597 UAAGAGGGGAAGGCCUGUGGUGU ascscaCf aggCf CfUfuccccucU (vinu) sAf sagaGf gggaaggCf cugu 5-175 1096 f ua 1097 ggusgsu1527 familyUMS* 598 GGCUGUGGCAUCCAGAGUCCA 599 UGGACUCUGGAUGCCACAGCCAC gsgscuGfuggCf AfUf ccagaguC (vinu) sGf sgacUf cuggaugCf caca 5-176 1098 f ca 1099 gccsasc1529 familyUMS* 600 CUGUGGC AUG C AGAGUC C CUA 601 UAGGGACUCUGGAUGCCACAGCC csusguGfgcaUf Cf Cf agaguccC (vinu) sAf sgggAf cucuggaUf gcca 5-177 1100 f ua 1101 cagscsc1536 familyUMS* 602 AUC C AGAGUC C CUGC CUGGAA 603 UUCCAGGCAGGGACUCUGGAUGCSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) asusccAfgagUf Cf Cf cugccugG (vinu) sUf sccaGf gcagggaCf ucug 5-178 1102 f aa 1103 gausgsc1539 familyUMS* 604 C AGAGUC C CUGC CUGGAC CAA 605 UUGGUCCAGGCAGGGACUCUGGA csasgaGfuccCfUfGf ccuggacC (vinu) sUf sgguCf caggcagGf gacu 5-179 1104 f aa 1105 cugsgsa1545 familyUMS* 606 CCCUGCCUGGACCAGCCUCUA 607 UAGAGGCUGGUCCAGGCAGGGAC cscscuGf ccuGfGf Af ccagccuC (vinu) sAf sgagGf cugguccAf ggca 5-180 1106 f ua 1107 gggsasc1549 familyUMS* 608 GC CUGGAC C AGC CUCUC C AC A 609 UGUGGAGAGGCUGGUCCAGGCAG gscscuGfgacCf AfGf ccucuccA (vinu) sGf suggAf gaggcugGf ucca 5-181 1108 f ca 1109 ggcsasg1551 familyUMS* 610 CUGGAC C AGC CUCUC C ACUC A 611 UGAGUGGAGAGGCUGGUCCAGGC csusggAf ccaGf Cf CfucuccacU (vinu) sGf saguGf gagaggcUf gguc 5-182 1110 f ca 1111 cagsgsc1553 familyUMS* 612 GGAC C AGC CUCUC C ACUC AUA 613 UAUGAGUGGAGAGGCUGGUCCAG gsgsacCf agcCfUf CfuccacucA (vinu) sAf sugaGf uggagagGf cugg 5-183 1112 f ua 1113 uccsasg1555 familyUMS* 614 AC C AGC CUCUC C ACUC AUGUA 615 UACAUGAGUGGAGAGGCUGGUCC ascscaGf ccuCfUf Cf cacucauG (vinu) sAf scauGf aguggagAf ggcu 5-184 1114 f ua 1115 gguscsc1556 familyUMS* 616 C C AGC CUCUC C ACUC AUGUGA 617 UCACAUGAGUGGAGAGGCUGGUC cscsagCf cucUf Cf Cf acucaugU (vinu) sGf sacaUf gaguggaGf aggc 5-185 1116 f ga 1117 uggsusc1558 familyUMS* 618 AGC CUCUC C ACUC AUGUGAC A 619 UGUCACAUGAGUGGAGAGGCUGG asgsccUf cucCf Af CfucaugugA (vinu) sGf sucaCf augagugGf agag 5-186 1118 f ca 1119 gcusgsgSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)1560 familyUMS* 620 C CUCUC C ACUC AUGUGACUC A 621 UGAGUCACAUGAGUGGAGAGGCU cscsucUf ccaCfUf Cf augugacU (vinu) sGf saguCf acaugagUf ggag 5-187 1120 f ca 1121 aggscsu1561 familyUMS* 622 CUCUC C ACUC AUGUGACUCUA 623 UAGAGUCACAUGAGUGGAGAGGC csuscuCf cacUf Cf AfugugacuC (vinu) sAf sgagUf cacaugaGf ugga 5-188 1122 f ua 1123 gagsgsc1562 familyUMS* 624 UCUC C ACUC AUGUGACUCUUA 625 UAAGAGUCACAUGAGUGGAGAGG uscsucCf acuCf AfUfgugacucU (vinu) sAf sagaGf ucacaugAf gugg 5-189 1124 f ua 1125 agasgsg1563 familyUMS* 626 CUC C ACUC AUGUGACUCUUUA 627 UAAAGAGUCACAUGAGUGGAGAG csusccAf cucAfUfGfugacucuU (vinu) sAf saagAf gucacauGf agug 5-190 1126 f ua 1127 gagsasg1564 familyUMS* 628 UC C ACUC AUGUGACUCUUUC A 629 UGAAAGAGUCACAUGAGUGGAGA uscscaCfucaUfGfUfgacucuuU (vinu) sGf saaaGf agucacaUf gagu 5-191 1128 f ca 1129 ggasgsa1565 familyUMS* 630 C C ACUC AUGUGACUCUUUC C A 631 UGGAAAGAGUCACAUGAGUGGAG cscsacUf cauGfUfGf acucuuuC (vinu) sGf sgaaAf gagucacAf ugag 5-192 1130 f ca 1131 uggsasg1566 familyUMS* 632 C ACUC AUGUGACUCUUUC C AA 633 UUGGAAAGAGUCACAUGAGUGGA csascuCf augUfGf Af cucuuucC (vinu) sUf sggaAf agagucaCf auga 5-193 1132 f aa 1133 gugsgsa1567 familyUMS* 634 ACUC AUGUGACUCUUUC C AAA 635 UUUGGAAAGAGUCACAUGAGUGG ascsucAfuguGf Af CfucuuuccA (vinu) sUf suggAf aagagucAf caug 5-194 1134 f aa 1135 agusgsg1621 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 636 AGUCUGAGAGAGGCCAUUCUA 637 UAGAAUGGCCUCUCUCAGACUGC asgsucUfgagAfGf AfggccauuC (vinu) sAf sgaaUf ggccucuCf ucag 5-195 1136 f ua 1137 acusgsc1624 familyUMS* 638 CUGAGAGAGGCCAUUCUUUCA 639 UGAAAGAAUGGCCUCUCUCAGAC csusgaGf agaGfGf Cf cauucuuU (vinu) sGf saaaGf aauggccUf cucu 5-196 1138 f ca 1139 cagsasc1625 familyUMS* 640 UGAGAGAGGC CAUUCUUU C C A 641 UGGAAAGAAUGGCCUCUCUCAGA usgsagAfgagGfCfCf auucuuuC (vinu) sGf sgaaAf gaauggcCf ucuc 5-197 1140 f ca 1141 ucasgsa1627 familyUMS* 642 AGAGAGGC C AUUCUUUC C CAA 643 UUGGGAAAGAAUGGCCUCUCUCA asgsagAfggcCf AfUfucuuuccC (vinu) sUf sgggAf aagaaugGf ccuc 5-198 1142 f aa 1143 ucuscsa1691 familyUMS* 644 GGAGGGCAGGCAUCGGGGAGA 645 UCUCCCCGAUGCCUGCCCUCCUC gsgsagGfgcaGfGf Cf aucggggA (vinu) sCf succCf cgaugccUf gccc 5-199 1144 f ga 1145 uccsusc1694 familyUMS* 646 GGGCAGGCAUCGGGGAGCCGA 647 UCGGCUCCCCGAUGCCUGCCCUC gsgsgcAfggcAfUf CfggggagcC (vinu) sCf sggcUf ccccgauGf ccug 5-200 1146 f ga 1147 cccsusc1695 familyUMS* 648 GGCAGGCAUCGGGGAGCCGGA 649 UCCGGCUCCCCGAUGCCUGCCCU gsgscaGfgcaUf CfGfgggagccG (vinu) sCf scggCf uccccgaUf gccu 5-201 1148 f ga 1149 gccscsu1772 familyUMS* 650 UGGGCAGGAGGGAGGUGCUUA 651 UAAGC AC CUCCCUCCUGCC C AGG usgsggCf aggAf Gf Gf gaggugcU (vinu) sAf sagcAf ccucccuCf cugc 5-202 1150 f ua 1151 ccasgsg1775 familyUMS* 652 GCAGGAGGGAGGUGCUUCUAA 653 UUAGAAGC AC CUCCCUCCUGCCCSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gscsagGf aggGf AfGfgugcuucU (vinu) sUf sagaAfgcaccucCf cucc 5-203 1152 f aa 1153 ugcscsc1779 familyUMS* 654 GAGGGAGGUGCUUCUAGUUCA 655 UGAACUAGAAGC AC CUCCCUCCU gsasggGf aggUfGf CfuucuaguU (vinu) sGf saacUf agaagcaCf cucc 5-204 1154 f ca 1155 cucscsu1783 familyUMS* 656 GAGGUGCUUCUAGUUCUGCCA 657 UGGC AGAACUAGAAGC AC CUC C C gsasggUfgcuUf CfUf aguucugC (vinu) sGf sgcaGf aacuagaAf gcac 5-205 1156 f ca 1157 cucscsc1785 familyUMS* 658 GGUGCUUCUAGUUCUGCCAGA 659 UCUGGCAGAACUAGAAGCACCUC gsgsugCfuucUf AfGfuucugccA (vinu) sCf suggCf agaacuaGf aagc 5-206 1158 f ga 1159 accsusc1788 familyUMS* 660 GCUUCUAGUUCUGCCAGGAGA 661 UCUCCUGGCAGAACUAGAAGCAC gscsuuCfuagUfUf CfugccaggA (vinu) sCf succUf ggcagaaCf uaga 5-207 1160 f ga 1161 agcsasc1789 familyUMS* 662 CUUCUAGUUCUGCCAGGAGAA 663 UUCUCCUGGCAGAACUAGAAGCA csusucUf aguUf CfUfgccaggaG (vinu) sUf scucCf uggcagaAf cuag 5-208 1162 f aa 1163 aagscsa1792 familyUMS* 664 CUAGUUCUGCCAGGAGACAGA 665 UCUGUCUCCUGGCAGAACUAGAA csusagUfucuGf Cf Cf aggagacA (vinu) sCf suguCf uccuggcAf gaac 5-209 1164 f ga 1165 uagsasa1793 familyUMS* 666 UAGUUCUGCCAGGAGACAGGA 667 UC CUGUCUC CUGGC AGAACUAGA usasguUf cugCf Cf AfggagacaG (vinu) sCf scugUf cuccuggCf agaa 5-210 1166 f ga 1167 cuasgsa1798 familyUMS* 668 CUGCCAGGAGACAGGUUAGCA 669 UGCUAACCUGUCUCCUGGCAGAA csusgcCf aggAfGf Af cagguuaG (vinu) sGf scuaAf ccugucuCf cugg 5-211 1168 f ca 1169 cagsasaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)1801 familyUMS* 670 CCAGGAGACAGGUUAGCUGCA 671 UGCAGCUAACCUGUCUCCUGGCA cscsagGf agaCf AfGfguuagcuG (vinu) sGf scagCfuaaccugUf cucc 5-212 1170 f ca 1171 uggscsa1804 familyUMS* 672 GGAGACAGGUUAGCUGCUCCA 673 UGGAGCAGCUAACCUGUCUCCUG gsgsagAf cagGfUfUf agcugcuC (vinu) sGf sgagCf agcuaacCf uguc 5-213 1172 f ca 1173 uccsusg1805 familyUMS* 674 GAGACAGGUUAGCUGCUCCCA 675 UGGGAGCAGCUAACCUGUCUCCU gsasgaCf aggUfUf AfgcugcucC (vinu) sGf sggaGf cagcuaaCf cugu 5-214 1174 f ca 1175 cucscsu1806 familyUMS* 676 AGACAGGUUAGCUGCUCCCCA 677 UGGGGAGCAGCUAACCUGUCUCC asgsacAfgguUf AfGf cugcuccC (vinu) sGf sgggAf gcagcuaAf ccug 5-215 1176 f ca 1177 ucuscsc1810 familyUMS* 678 AGGUUAGCUGCUCCCCACGUA 679 UACGUGGGGAGCAGCUAACCUGU asgsguUf agcUfGf CfuccccacG (vinu) sAf scguGf gggagcaGf cuaa 5-216 1178 f ua 1179 ccusgsu1885 familyUMS* 680 GC CUUUGGACUUGUC C CGGGA 681 UC C CGGGACAAGUC CAAAGGC AG gscscuUfuggAf CfUfugucccgG (vinu) sCf sccgGf gacaaguCf caaa 5-217 1180 f ga 1181 ggcsasg1889 familyUMS* 682 UUGGACUUGUC C CGGGAC AC A 683 UGUGUC C CGGGACAAGUC CAAAG ususggAf cuuGfUf Cf ccgggacA (vinu) sGf suguCf ccgggacAf ague 5-218 1182 f ca 1183 caasasg1921 familyUMS* 684 GGGGAGAGACGGGC C CUGGUA 685 UACCAGGGCCCGUCUCUCCCCAC gsgsggAfgagAf CfGfggcccugG (vinu) sAf sccaGf ggcccguCf ucuc 5-219 1184 f ua 1185 cccsasc1923 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 686 GGAGAGACGGGC C CUGGUGGA 687 UCCACCAGGGCCCGUCUCUCCCC gsgsagAfgacGfGfGf cccugguG (vinu) sGf scacCf agggcccGf ucuc 5-220 1186 f ga 1187 uccscsc1924 familyUMS* 688 GAGAGACGGGC C CUGGUGGUA 689 UACCACCAGGGCCCGUCUCUCCC gsasgaGf acgGfGf Cf ccuggugG (vinu) sAf sccaCf cagggccCf gucu 5-221 1188 f ua 1189 cucscsc1964 familyUMS* 690 GUCCUCAGCCCCGCGUGGAAA 691 UUUCCACGCGGGGCUGAGGACAA gsusccUf cagCf Cf Cf cgcguggA (vinu) sUf succAf cgcggggCf ugag 5-222 1190 f aa 1191 gacsasa1965 familyUMS* 692 UC CUC AGC C C CGCGUGGAAC A 693 UGUUCCACGCGGGGCUGAGGACA uscscuCf agcCf Cf CfgcguggaA (vinu) sGf suucCf acgcgggGf cuga 5-223 1192 f ca 1193 ggascsa2070 familyUMS* 694 CUUC C C ACGGCUC CUCGAGAA 695 UUCUCGAGGAGCCGUGGGAAGUC csusucCf cacGfGf CfuccucgaG (vinu) sUf scucGf aggagccGf uggg 5-224 1194 f aa 1195 aagsusc2072 familyUMS* 696 UCCCACGGCUC CUCGAGAUC A 697 UGAUCUCGAGGAGCCGUGGGAAG uscsccAf cggCfUf Cf cucgagaU (vinu) sGf saucUf cgaggagCf cgug 5-225 1196 f ca 1197 ggasasg2074 familyUMS* 698 C C ACGGCUC CUCGAGAUC C C A 699 UGGGAUCUCGAGGAGCCGUGGGA cscsacGfgcuCf CfUf cgagaucC (vinu) sGf sggaUf cucgaggAf gceg 5-226 1198 f ca 1199 uggsgsa2077 familyUMS* 700 CGGCUC CUCGAGAUC C C AAC A 701 UGUUGGGAUCUCGAGGAGCCGUG csgsgcUf ccuCfGf AfgaucccaA (vinu) sGf suugGf gaucucgAf ggag 5-227 1200 f ca 1201 ccgsusg2078 familyUMS* 702 GGCUC CUCGAGAUC C C AAC AA 703 UUGUUGGGAUCUCGAGGAGCCGUSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gsgscuCf cucGf AfGf aucccaaC (vinu) sUf sguuGf ggaucucGf agga 5-228 1202 f aa 1203 gccsgsu2081 familyUMS* 704 UC CUCGAGAUC C C AAC ACUGA 705 UCAGUGUUGGGAUCUCGAGGAGC uscscuCfgagAfUf Cf ccaacacU (vinu) sCf saguGf uugggauCf ucga 5-229 1204 f ga 1205 ggasgsc2084 familyUMS* 706 UCGAGAUC C CAAC ACUGC CAA 707 UUGGCAGUGUUGGGAUCUCGAGG uscsgaGf aucCf Cf Af acacugcC (vinu) sUf sggcAf guguuggGf aucu 5-230 1206 f aa 1207 cgasgsg2085 familyUMS* 708 CGAGAUC C C AAC ACUGC C AGA 709 UCUGGCAGUGUUGGGAUCUCGAG csgsagAfuccCf Af Af cacugccA (vinu) sCf suggCf aguguugGf gauc 5-231 1208 f ga 1209 ucgsasg2087 familyUMS* 710 AGAUC C CAAC ACUGC C AG CAA 711 UUGCUGGCAGUGUUGGGAUCUCG asgsauCf ccaAf Cf Af cugccagC (vinu) sUf sgcuGf gcaguguUfggga 5-232 1210 f aa 1211 ucuscsg2088 familyUMS* 712 GAUC C CAAC ACUGC CAGCAUA 713 UAUGCUGGCAGUGUUGGGAUCUC gsasucCf caaCf Af CfugccagcA (vinu) sAf sugcUf ggcagugUf uggg 5-233 1212 f ua 1213 aucsusc2130 familyUMS* 714 UCCCUCCUCUGCCCGGGAGCA 715 UGCUCCCGGGCAGAGGAGGGAGA uscsccUf ccuCfUfGf cccgggaG (vinu) sGf scucCf cgggcagAf ggag 5-234 1214 f ca 1215 ggasgsa2131 familyUMS* 716 CCCUCCUCUGCCCGGGAGCUA 717 UAGCUCCCGGGCAGAGGAGGGAG cscscuCf cucUfGf Cf ccgggagC (vinu) sAf sgcuGf ccgggcaGf agga 5-235 1216 f ua 1217 gggsasg2133 familyUMS* 718 CUCCUCUGCCCGGGAGCUCAA 719 UUGAGCUCCCGGGCAGAGGAGGG csusccUf cugCf Cf CfgggagcuC (vinu) sUf sgagCf ucccgggCf agag 5-236 1218 f aa 1219 gagsgsgSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)2180 familyUMS* 720 AGCUCCUUAAGGCUCUUUUGA 721 UCAAAAGAGCCUUAAGGAGCUCA asgscuCf cuuAf AfGfgcucuuuU (vinu) sCf saaaAf gagccuuAf agga 5-237 1220 f ga 1221 gcuscsa2184 familyUMS* 722 CCUUAAGGCUCUUUUGUAAGA 723 UCUUACAAAAGAGCCUUAAGGAG cscs uuAf aggCfUfCf uuuugua A (vinu) sCf suuaCf aaaagagCf cuua 5-238 1222 f ga 1223 aggsasg2185 familyUMS* 724 CUUAAGGCUCUUUUGUAAGGA 725 UC CUUAC AAAAGAGC CUUAAGGA csusuaAfggcUf CfUfuuuguaaG (vinu) sCf scuuAf caaaagaGf ccuu 5-239 1224 f ga 1225 aagsgsa2186 familyUMS* 726 UUAAGGCUCUUUUGUAAGGUA 727 UAC CUUACAAAAGAGC CUUAAGG ususaaGfgcuCfUfUfuuguaagG (vinu) sAf sccuUf acaaaagAf gccu 5-240 1226 f ua 1227 uaasgsg2187 familyUMS* 728 UAAGGCUCUUUUGUAAGGUUA 729 UAAC CUUACAAAAGAGC CUUAAG usasagGf cucUf Uf Uf uguaaggU (vinu) sAf saccUf uacaaaaGf agcc 5-241 1228 f ua 1229 uuasasg2188 familyUMS* 730 AAGGCUCUUUUGUAAGGUUUA 731 UAAAC CUUACAAAAGAGC CUUAA asasggCfucuUfUfUfguaagguU (vinu) sAf saacCf uuacaaaAf gage 5-242 1230 f ua 1231 cuusasa2194 familyUMS* 732 CUUUUGUAAGGUUUUUGUAGA 733 UCUACAAAAAC CUUACAAAAGAG csus uuU fguaAfGfGf uuuuuguA (vinu) sCf suacAf aaaaccuUf acaa 5-243 1232 f ga 1233 aagsasg2195 familyUMS* 734 UUUUGUAAGGUUUUUGUAGUA 735 UACUACAAAAAC CUUACAAAAGA ususuuGf uaaGf Gf Uf uuuuguaG (vinu) sAf scuaCf aaaaaccUf uaca 5-244 1234 f ua 1235 aaasgsa2196 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 736 UUUGUAAGGUUUUUGUAGUGA 737 UC ACUACAAAAAC CUUAC AAAAG ususugUf aagGf Uf Uf uuuguagU (vinu) sCf sacuAf caaaaacCf uuac 5-245 1236 f ga 1237 aaasasg2202 familyUMS* 738 AGGUUUUUGUAGUGAUUUUUA 739 UAAAAAUC ACUACAAAAAC CUUA a s g s guU f uuuG f U f Af gugauuuU (vinu) sAf saaaAf ucacuacAf aaaa 5-246 1238 f ua 1239 ccususa2203 familyUMS* 740 GGUUUUUGUAGUGAUUUUUAA 741 UUAAAAAUC ACUACAAAAAC CUU g s g s uuU f uugU f A f G f ug auuuuU (vinu) sUf saaaAf aucacuaCf aaaa 5-247 1240 f aa 1241 accsusu2213 familyUMS* 742 GUGAUUUUUAUGC C AC CUGAA 743 UUCAGGUGGCAUAAAAAUCACUA gsusgaUfuuuUf AfUfgccaccuG (vinu) sUf scagGf uggcauaAf aaau 5-248 1242 f aa 1243 cacsusa2214 familyUMS* 744 UGAUUUUUAUGC C AC CUGAAA 745 UUUCAGGUGGCAUAAAAAUCACU usgsauUfuuuAfUfGf ccaccugA (vinu) sUf sucaGf guggcauAf aaaa 5-249 1244 f aa 1245 ucascsu2216 familyUMS* 746 AUUUUUAUGC C AC CUGAAUAA 747 UUAUUCAGGUGGCAUAAAAAUCA asusuuUfuauGf Cf Cf accugaaU (vinu) sUf sauuCf agguggcAf uaaa 5-250 1246 f aa 1247 aauscsaTable 7. Sequence of exemplary dsRNA agents shown with GalNAc clusters (UMS* = Unmodified Sequence)SequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)57 familyUMS* 248 GGGGCUCCUGGUGCUCAGCUA 249 UAGCUGAGCACCAGGAGCCCCCASequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gsgsggCfuccUfGfGfugcucagC (vinu) sAf sgcuGf agcaccaGf gage 6-1 748 f ua (L96 ) 749 cccscsa62 familyUMS* 250 UCCUGGUGCUCAGCUGGUCCA 251 UGGACCAGCUGAGCACCAGGAGC uscscuGfgugCfUf Cf agcugguC (vinu) sGf sgacCf agcugagCf acca 6-2 750 f ca (L96 ) 751 ggasgsc63 familyUMS* 252 CCUGGUGCUCAGCUGGUCCUA 253 UAGGACCAGCUGAGCACCAGGAG cscsugGfugcUf Cf AfgcuggucC (vinu) sAf sggaCf cagcugaGf cacc 6-3 752 f ua (L96 ) 753 aggsasg64 familyUMS* 254 CUGGUGCUCAGCUGGUCCUGA 255 UCAGGACCAGCUGAGCACCAGGA csusggUfgcuCf AfGf cugguccU (vinu) sGf saggAf ccagcugAf gcac 6-4 754 f ga (L96 ) 755 cagsgsa67 familyUMS* 256 GUGCUCAGCUGGUCCUGCCUA 257 UAGGCAGGACCAGCUGAGCACCA gsusgcUf cagCf Uf Gf guccugcC (vinu) sAf sggcAf ggaccagCf ugag 6-5 756 f ua (L96 ) 757 cacscsa68 familyUMS* 258 UGCUCAGCUGGUCCUGCCUGA 259 UCAGGCAGGACCAGCUGAGCACC usgscuCf agcUfGfGfuccugccU (vinu) sGf saggCf aggaccaGf cuga 6-6 758 f ga (L96 ) 759 gcascsc71 familyUMS* 260 UCAGCUGGUCCUGCCUGCAAA 261 UUUGCAGGCAGGACCAGCUGAGC uscsagCfuggUf Cf CfugccugcA (vinu) sUf sugcAf ggcaggaCf cage 6-7 760 f aa (L96 ) 761 ugasgsc105 familyUMS* 262 GUUCUC C C CUGUGAGCGC CAA 263 UUGGCGCUCACAGGGGAGAACAC gsusucUf cccCfUfGfugagcgcC (vinu) sUf sggcGf cucacagGf ggag 6-8 762 f aa (L96 ) 763 aacsasc108 familyUMS* 264 CUC C C CUGUGAGCGC CAUGGA 265 UCCAUGGCGCUCACAGGGGAGAA csusccCf cugUfGf AfgcgccauG (vinu) sGf scauGf gcgcucaCf aggg 6-9 764 f ga (L96 ) 765 gagsasa111 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 266 CCCUGUGAGCGCCAUGGAGCA 267 UGCUCCAUGGCGCUCACAGGGGA cscscuGfugaGf CfGf ccauggaG (vinu) sGf scucCf auggcgcUf caca 6-10 766 f ca (L96 ) 767 gggsgsa113 familyUMS* 268 CUGUGAGCGCCAUGGAGCCCA 269 UGGGCUCCAUGGCGCUCACAGGG csusguGf agcGf Cf Cf auggagcC (vinu) sGf sggcUf ccauggcGf cuca 6-11 768 f ca (L96 ) 769 cagsgsg114 familyUMS* 270 UGUGAGCGCCAUGGAGCCCUA 271 UAGGGCUCCAUGGCGCUCACAGG usgsugAfgcgCf Cf AfuggagccC (vinu) sAf sgggCf uccauggCf gcuc 6-12 770 f ua (L96 ) 771 acasgsg117 familyUMS* 272 GAGCGCCAUGGAGCCCUUGGA 273 UCCAAGGGCUCCAUGGCGCUCAC gsasgcGf ccaUfGfGf agcccuuG (vinu) sCf scaaGf ggcuccaUf ggcg 6-13 772 f ga (L96 ) 773 cucsasc186 familyUMS* 274 C CUC CUCAAGUUGGGCAAC C A 275 UGGUUGC C CAACUUGAGGAGGGU cscsucCfucaAfGfUfugggcaaC (vinu) sGf sguuGf cccaacuUf gagg 6-14 774 f ca (L96 ) 775 aggsgsu187 familyUMS* 276 CUC CUCAAGUUGGGCAAC CAA 277 UUGGUUGC C CAACUUGAGGAGGG csusccUf caaGfUfUfgggcaacC (vinu) sUf sgguUf gcccaacUf ugag 6-15 776 f aa (L96 ) 777 gagsgsg188 familyUMS* 278 UC CUCAAGUUGGGCAAC C AGA 279 UCUGGUUGC C CAACUUGAGGAGG uscscuCf aagUfUfGfggcaaccA (vinu) sCf suggUf ugcccaaCf uuga 6-16 778 f ga (L96 ) 779 ggasgsg429 familyUMS* 280 GCAGAGGCUGCAACAGGUGCA 281 UGCACCUGUUGCAGCCUCUGCAA gscsagAfggcUfGf Cf aacagguG (vinu) sGf scacCfuguugcaGf ccuc 6-17 780 f ca (L96 ) 781 ugesasa437 familyUMS* 282 UGCAACAGGUGCUGCACGCAA 283 UUGCGUGCAGCACCUGUUGCAGC usgscaAf cagGfUfGf cugcacgC (vinu) sUf sgcgUf gcagcacCf uguu 6-18 782 f aa (L96 ) 783 gcasgscSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)438 familyUMS* 284 GCAACAGGUGCUGCACGCAGA 285 UCUGCGUGCAGCACCUGUUGCAG gscsaaCf aggUfGf CfugcacgcA (vinu) sCf sugcGf ugcagcaCf cugu 6-19 784 f ga (L96 ) 785 ugcsasg445 familyUMS* 286 GUGCUGCACGCAGGCUCAGGA 287 UCCUGAGCCUGCGUGCAGCACCU gsusgcUfgcaCfGf Cf aggcucaG (vinu) sCf scugAf gccugcgUf gcag 6-20 786 f ga (L96 ) 787 cacscsu520 familyUMS* 288 UUCCGACUGGCUGCCAGGAUA 289 UAUCCUGGCAGCCAGUCGGAACG ususccGf acuGfGf CfugccaggA (vinu) sAf succUf ggcagccAf gucg 6-21 788 f ua (L96 ) 789 gaascsg521 familyUMS* 290 UCCGACUGGCUGCCAGGAUGA 291 UCAUCCUGGCAGCCAGUCGGAAC uscscgAf cugGf CfUfgccaggaU (vinu) sCf saucCf uggcagcCf ague 6-22 790 f ga (L96 ) 791 ggasasc522 familyUMS* 292 CCGACUGGCUGCCAGGAUGUA 293 UACAUCCUGGCAGCCAGUCGGAA cscsgaCfuggCfUfGf ccaggauG (vinu) sAf scauCf cuggcagCf cagu 6-23 792 f ua (L96 ) 793 cggsgsa523 familyUMS* 294 CGACUGGCUGCCAGGAUGUAA 295 UUACAUCCUGGCAGCCAGUCGGA csgsacUfggcUfGf Cf caggaugU (vinu) sUf sacaUf ccuggcaGf ccag 6-24 794 f aa (L96 ) 795 ucgsgsa528 familyUMS* 296 GGCUGCCAGGAUGUACCUGCA 297 UGCAGGUACAUCCUGGCAGCCAG gsgscuGf ccaGfGf AfuguaccuG (vinu) sGf scagGf uacauccUf ggca 6-25 796 f ca (L96 ) 797 gccsasg529 familyUMS* 298 GCUGCCAGGAUGUACCUGCAA 299 UUGCAGGUACAUCCUGGCAGCCA gscsugCf cagGf AfUfguaccugC (vinu) sUf sgcaGf guacaucCf uggc 6-26 798 f aa (L96 ) 799 agcscsa531 familyUMS* 300 UGCCAGGAUGUACCUGCAGAA 301 UUCUGCAGGUACAUCCUGGCAGCSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) usgsccAfggaUfGfUf accugcaG (vinu) sUf scugCf agguacaUf ccug 6-27 800 f aa (L96 ) 801 gcasgsc533 fami yUMS* 302 C C AGGAUGUAC CUGCAGAAAA 303 UUUUCUGCAGGUACAUCCUGGCA cscsagGf augUf Af Cf cugcagaA (vinu) sUf suucUf gcagguaCf aucc 6-28 802 f aa (L96 ) 803 uggscsa534 fami yUMS* 304 CAGGAUGUACCUGCAGAAAGA 305 UCUUUCUGCAGGUACAUCCUGGC csasggAfuguAf Cf CfugcagaaA (vinu) sCf suuuCf ugcagguAf cauc 6-29 804 f ga (L96 ) 805 cugsgsc535 fami yUMS* 306 AGGAUGUACCUGCAGAAAGGA 307 UC CUUUCUGC AGGUAC AUG CUGG asgsgaUf guaCf Cf Uf gcagaaaG (vinu) sCf scuuUf cugcaggUf acau 6-30 806 f ga (L96 ) 807 ccusgsg539 fami yUMS* 308 UGUACCUGCAGAAAGGAUUUA 309 UAAAUCCUUUCUGCAGGUACAUC usgsuaCf cugCf AfGf aaaggauU (vinu) sAf saauCf cuuucugCf aggu 6-31 808 f ua (L96 ) 809 acasusc549 fami yUMS* 310 GAAAGGAUUUC C C AUCAAAGA 311 UCUUUGAUGGGAAAUC CUUUCUG gsasaaGfgauUfUf Cf ccaucaaA (vinu) sCf suuuGf augggaaAf uccu 6-32 810 f ga (L96 ) 811 uucsusg550 fami yUMS* 312 AAAGGAUUUC C C AUCAAAGAA 313 UUCUUUGAUGGGAAAUC CUUUCU asasagGf auuUf Cf Cf caucaaaG (vinu) sUf scuuUf gaugggaAf aucc 6-33 812 f aa (L96 ) 813 uuuscsu551 fami yUMS* 314 AAGGAUUUC C C AUCAAAGAAA 315 UUUCUUUGAUGGGAAAUC CUUUC asasggAfuuuCfCfCf aucaaagA (vinu) sUf sucuUf ugaugggAf aauc 6-34 814 f aa (L96 ) 815 cuususc553 fami yUMS* 316 GGAUUUC C C AUCAAAGAAGAA 317 UUCUUCUUUGAUGGGAAAUC CUU gsgsauUfuccCf AfUf caaagaaG (vinu) sUf scuuCf uuugaugGf gaaa 6-35 816 f aa (L96 ) 817 uccsusu554 fami ySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 318 GAUUUC C CAUCAAAGAAGAUA 319 UAUCUUCUUUGAUGGGAAAUC CU gsasuuUf cccAfUf Cf aaagaagA (vinu) sAf sucuUf cuuugauGf ggaa 6-36 818 f ua (L96 ) 819 aucscsu555 fami yUMS* 320 AUUUC C CAUCAAAGAAGAUUA 321 UAAUCUUCUUUGAUGGGAAAUC C asusuuCf ccaUf Cf Af aagaagaU (vinu) sAf saucUf ucuuugaUf ggga 6-37 820 f ua (L96 ) 821 aauscsc556 fami yUMS* 322 UUUC C C AUCAAAGAAGAUUUA 323 UAAAUCUUCUUUGAUGGGAAAUC ususucCf cauCf Af Af agaagauU (vinu) sAf saauCf uucuuugAf uggg 6-38 822 f ua (L96 ) 823 aaasusc558 fami yUMS* 324 UC C C AUCAAAGAAGAUUUC C A 325 UGGAAAUCUUCUUUGAUGGGAAA uscsccAfucaAf AfGf aagauuuC (vinu) sGf sgaaAf ucuucuuUf gang 6-39 824 f ca (L96 ) 825 ggasasa563 fami yUMS* 326 UCAAAG AAGAUUUC CUGGAAA 327 UUUC C AGGAAAUCUUCUUUGAUG uscsaaAfgaaGf AfUfuuccuggA (vinu) sUf succAf ggaaaucUf ucuu 6-40 826 f aa (L96 ) 827 ugasusg565 fami yUMS* 328 AAAG AAGAUUUC CUGGAAC AA 329 UUGUUC C AGGAAAUCUUCUUUGA asasagAf agaUfUfUf ccuggaaC (vinu) sUf sguuCf caggaaaUf cuuc 6-41 828 f aa (L96 ) 829 uuusgsa601 fami yUMS* 330 GGGGCAAAGCCCGUGAGCCUA 331 UAGGCUCACGGGCUUUGCCCCAA gsgsggCf aaaGf Cf Cf cgugagcC (vinu) sAf sggcUf cacgggcUf uugc 6-42 830 f ua (L96 ) 831 cccsasa603 fami yUMS* 332 GGCAAAGCCCGUGAGCCUGAA 333 UUCAGGCUCACGGGCUUUGCCCC gsgscaAf agcCf CfGfugagccuG (vinu) sUf scagGf cucacggGf cuuu 6-43 832 f aa (L96 ) 833 gccscsc608 fami yUMS* 334 AGC C CGUGAGC CUGACGGGAA 335 UUCCCGUCAGGCUCACGGGCUUU asgsccCfgugAfGf Cf cugacggG (vinu) sUf scccGfucaggcuCf acgg 6-44 834 f aa (L96 ) 835 gcususuSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)610 fami yUMS* 336 C C CGUGAGC CUGACGGGAAAA 337 UUUUCCCGUCAGGCUCACGGGCU cscscgUfgagCf CfUfgacgggaA (vinu) sUf suucCf cgucaggCf ucac 6-45 836 f aa (L96 ) 837 gggscsu611 fami yUMS* 338 C CGUGAGC CUGACGGGAAAGA 339 UCUUUCCCGUCAGGCUCACGGGC cscsguGf agcCfUfGf acgggaaA (vinu) sCf suuuCf ccgucagGf cuca 6-46 838 f ga (L96 ) 839 cggsgsc612 fami yUMS* 340 CGUGAGCCUGACGGGAAAGCA 341 UGCUUUCCCGUCAGGCUCACGGG csgsugAfgccUfGf Af cgggaaaG (vinu) sGf scuuUf cccgucaGf gcuc 6-47 840 f ca (L96 ) 841 acgsgsg613 fami yUMS* 342 GUGAGCCUGACGGGAAAGCAA 343 UUGCUUUCCCGUCAGGCUCACGG gsusgaGf ccuGf Af CfgggaaagC (vinu) sUf sgcuUfucccgucAfggcu 6-48 842 f aa (L96 ) 843 cacsgsg614 fami yUMS* 344 UGAGCCUGACGGGAAAGCAGA 345 UCUGCUUUCCCGUCAGGCUCACG usgsagCf cugAf CfGfggaaagcA (vinu) sCf sugcUf uucccguCf aggc 6-49 844 f ga (L96 ) 845 ucascsg616 fami yUMS* 346 AGCCUGACGGGAAAGCAGGAA 347 UUC CUGCUUUC C CGUC AGGCUC A asgsccUfgacGfGfGf aaagcagG (vinu) sUf sccuGf cuuucccGf ucag 6-50 846 f aa (L96 ) 847 gcuscsa617 fami yUMS* 348 GCCUGACGGGAAAGCAGGAAA 349 UUUC CUGCUUUC C CGUC AGGCUC gscscuGf acgGfGf Af aagcaggA (vinu) sUf succUfgcuuuccCfguca 6-51 848 f aa (L96 ) 849 ggcsusc618 fami yUMS* 350 CCUGACGGGAAAGCAGGAAGA 351 UCUUC CUGCUUUC C CGUC AGGCU cscsugAf cggGf Af Af agcaggaA (vinu) sCf suucCf ugcuuucCf cguc 6-52 850 f ga (L96 ) 851 aggscsu619 fami yUMS* 352 CUGACGGGAAAGCAGGAAGAA 353 UUCUUC CUGCUUUC C CGUC AGGCSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) csusgaCfgggAf Af AfgcaggaaG (vinu) sUf scuuCf cugcuuuCf ccgu 6-53 852 f aa (L96 ) 853 cagsgsc620 fami yUMS* 354 UGACGGGAAAGCAGGAAGAUA 355 UAUCUUC CUGCUUUC C CGUC AGG usgsacGfggaAf AfGf caggaagA (vinu) sAf sucuUf ccugcuuUf cccg 6-54 854 f ua (L96 ) 855 ucasgsg622 fami yUMS* 356 ACGGGAAAGCAGGAAGAUGAA 357 UUC AUCUUC CUGCUUUC C CGUC A ascsggGf aaaGf Cf Af ggaagauG (vinu) sUf scauCfuuccugcUfuucc 6-55 856 f aa (L96 ) 857 cguscsa624 fami yUMS* 358 GGGAAAGCAGGAAGAUGACCA 359 UGGUC AUCUUC CUGCUUUC CCGU gsgsgaAf agcAf Gf Gf aagaugaC (vinu) sGf sgucAf ucuuccuGf cuuu 6-56 858 f ca (L96 ) 859 cccsgsu631 fami yUMS* 360 CAGGAAGAUGACCUGGCAAAA 361 UUUUGCCAGGUCAUCUUCCUGCU csasggAf agaUfGf Af ccuggcaA (vinu) sUf suugCf caggucaUf cuuc 6-57 860 f aa (L96 ) 861 cugscsu633 fami yUMS* 362 GGAAGAUGACCUGGCAAACAA 363 UUGUUUGC CAGGUC AUCUUC CUG gsgsaaGf augAf Cf Cf uggcaaaC (vinu) sUf sguuUf gccagguCf aucu 6-58 862 f aa (L96 ) 863 uccsusg634 fami yUMS* 364 GAAGAUGACCUGGCAAACAUA 365 UAUGUUUGC CAGGUC AUCUUC CU gsasagAfugaCf CfUfggcaaacA (vinu) sAf suguUf ugccaggUf cauc 6-59 864 f ua (L96 ) 865 uucscsu637 fami yUMS* 366 GAUGACCUGGCAAACAUCAAA 367 UUUGAUGUUUGCCAGGUCAUCUU gsasugAf ccuGfGf Cf aaacaucA (vinu) sUf sugaUf guuugccAf gguc 6-60 866 f aa (L96 ) 867 aucsusu640 fami yUMS* 368 GAC CUGGC AAAC AUC AAC C AA 369 UUGGUUGAUGUUUGCCAGGUCAU gsasccUfggcAf Af Af caucaacC (vinu) sUf sgguUf gauguuuGf ccag 6-61 868 f aa (L96 ) 869 gucsasu647 fami ySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 370 CAAAC AUCAAC CAAUGGGUGA 371 UC AC C C AUUGGUUGAUGUUUGC C csasaaCf aucAf Af Cf caaugggU (vinu) sCf saccCf auugguuGf augu 6-62 870 f ga (L96 ) 871 uugscsc652 fami yUMS* 372 AUCAAC C AAUGGGUGAAGGAA 373 UUC CUUC AC C C AUUGGUUGAUGU asuscaAf ccaAf Uf Gf ggugaagG (vinu) sUf sccuUf cacccauUf gguu 6-63 872 f aa (L96 ) 873 gausgsu653 fami yUMS* 374 UCAAC CAAUGGGUGAAGGAGA 375 UCUCCUUCACC C AUUGGUUGAUG uscsaaCf caaUf Gf Gf gugaaggA (vinu) sCf succUf ucacccaUf uggu 6-64 874 f ga (L96 ) 875 ugasusg654 fami yUMS* 376 C AAC C AAUGGGUGAAGGAGGA 377 UCCUCCUUCACC C AUUGGUUGAU csasacCf aauGf Gf Gf ugaaggaG (vinu) sCf scucCf uucacccAf uugg 6-65 876 f ga (L96 ) 877 uugsasu655 fami yUMS* 378 AACCAAUGGGUGAAGGAGGCA 379 UGC CUC CUUC AC C C AUUGGUUGA asasccAf augGf Gf Uf gaaggagG (vinu) sGf sccuCf cuucaccCf auug 6-66 878 f ca (L96 ) 879 guusgsa656 fami yUMS* 380 AC C AAUGGGUG AAGG AGG CCA 381 UGGC CUC CUUC AC C C AUUGGUUG ascscaAfuggGfUfGf aaggaggC (vinu) sGf sgccUf ccuucacCf cauu 6-67 880 f ca (L96 ) 881 ggususg657 fami yUMS* 382 C C AAUGGGUG AAGG AGG C C AA 383 UUGGC CUC CUUC AC C C AUUGGUU cscsaaUfgggUfGf Af aggaggcC (vinu) sUf sggcCfuccuucaCf ccau 6-68 882 f aa (L96 ) 883 uggsusu661 fami yUMS* 384 UGGGUGAAGGAGGCCACGGAA 385 UUC CGUGGC CUC CUUC AC C CAUU usgsggUfgaaGfGf AfggccacgG (vinu) sUf sccgUfggccuccUfucac 6-69 884 f aa (L96 ) 885 ccasusu668 fami yUMS* 386 AGGAGGCCACGGAGGGGAAGA 387 UCUUCCCCUCCGUGGCCUCCUUC asgsgaGfgccAf CfGfgaggggaA (vinu) sCf suucCf ccuccguGf gccu 6-70 886 f ga (L96 ) 887 ccususcSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)669 fami yUMS* 388 GGAGGCCACGGAGGGGAAGAA 389 UUCUUCCCCUC CGUGGC CUC CUU gsgsagGf ccaCfGfGf aggggaaG (vinu) sUf scuuCf cccuccgUf ggcc 6-71 888 f aa (L96 ) 889 uccsusu670 fami yUMS* 390 GAGGCCACGGAGGGGAAGAUA 391 UAUCUUCCCCUCCGUGGCCUCCU gsasggCf cacGfGf AfggggaagA (vinu) sAf sucuUf ccccuccGf uggc 6-72 890 f ua (L96 ) 891 cucscsu672 fami yUMS* 392 GGCCACGGAGGGGAAGAUUCA 393 UGAAUCUUC C C CUC CGUGGC CUC gsgsccAf cggAf Gf Gf ggaagauU (vinu) sGf saauCf uuccccuCf cgug 6-73 892 f ca (L96 ) 893 gccsusc711 fami yUMS* 394 GCCGGAAGACACCGUGUUGCA 395 UGCAACACGGUGUCUUCCGGCAG gscscgGf aagAf Cf Af ccguguuG (vinu) sGf scaaCf acgguguCf uucc 6-74 894 f ca (L96 ) 895 ggcsasg712 fami yUMS* 396 C CGGAAGAC AC CGUGUUGCUA 397 UAGCAACACGGUGUCUUCCGGCA cscsggAf agaCf Af Cf cguguugC (vinu) sAf sgcaAf cacggugUf cuuc 6-75 896 f ua (L96 ) 897 cggscsa716 fami yUMS* 398 AAGACACCGUGUUGCUUCUCA 399 UGAGAAGCAACACGGUGUCUUCC asasgaCf accGf Uf Gf uugcuucU (vinu) sGf sagaAf gcaacacGf gugu 6-76 898 f ca (L96 ) 899 cuuscsc717 fami yUMS* 400 AGAC AC CGUGUUGCUUCUC C A 401 UGGAGAAGCAACACGGUGUCUUC asgsacAf ccgUf Gf Uf ugcuucuC (vinu) sGf sgagAf agcaacaCf ggug 6-77 900 f ca (L96 ) 901 ucususc718 fami yUMS* 402 GAC AC CGUGUUGCUUCUC CUA 403 UAGGAGAAGCAACACGGUGUCUU gsascaCf cguGf Uf Uf gcuucucC (vinu) sAf sggaGf aagcaacAf cggu 6-78 902 f ua (L96 ) 903 gucsusu731 fami yUMS* 404 UUCUC CUCAACGC C AUG C AC A 405 UGUGGAUGGCGUUGAGGAGAAGCSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) ususcuCf cucAf Af CfgccauccA (vinu) sGf suggAf uggcguuGf agga 6-79 904 f ca (L96 ) 905 gaasgsc732 fami yUMS* 406 UCUCCUCAACGCCAUCCACUA 407 UAGUGGAUGGCGUUGAGGAGAAG uscsucCfucaAf CfGf ccauccaC (vinu) sAf sgugGf auggcguUf gagg 6-80 906 f ua (L96 ) 907 agasasg733 fami yUMS* 408 CUCCUCAACGCCAUCCACUUA 409 UAAGUGGAUGGCGUUGAGGAGAA csusccUf caaCfGf Cf cauccacU (vinu) sAf saguGf gauggcgUf ugag 6-81 908 f ua (L96 ) 909 gagsasa734 fami yUMS* 410 UC CUCAACGC C AUG C ACUUC A 411 UGAAGUGGAUGGCGUUGAGGAGA uscscuCf aacGf Cf Cf auccacuU (vinu) sGf saagUf ggauggcGf uuga 6-82 910 f ca (L96 ) 911 ggasgsa735 fami yUMS* 412 C CUCAACGC C AUC C ACUUC C A 413 UGGAAGUGGAUGGCGUUGAGGAG cscsucAf acgCf Cf AfuccacuuC (vinu) sGf sgaaGf uggauggCf guug 6-83 912 f ca (L96 ) 913 aggsasg738 fami yUMS* 414 CAACGC C AUC C ACUUC C AGGA 415 UCCUGGAAGUGGAUGGCGUUGAG csasacGf ccaUf Cf Cf acuuccaG (vinu) sCf scugGf aaguggaUf ggcg 6-84 914 f ga (L96 ) 915 uugsasg739 fami yUMS* 416 AACGC C AUC C ACUUC C AGGGA 417 UC C CUGGAAGUGGAUGGCGUUGA asascgCf cauCf Cf Af cuuccagG (vinu) sCf sccuGf gaaguggAf uggc 6-85 916 f ga (L96 ) 917 guusgsa742 fami yUMS* 418 GC C AUC C ACUUC C AGGGUUUA 419 UAAAC C CUGGAAGUGGAUGGCGU gscscaUf ccaCfUfUf ccaggguU (vinu) sAf saacCf cuggaagUf ggau 6-86 918 f ua (L96 ) 919 ggcsgsu745 fami yUMS* 420 AUC C ACUUC C AGGGUUUCUGA 421 UC AGAAAC C CUGGAAGUGGAUGG asusccAf cuuCf Cf AfggguuucU (vinu) sCf sagaAf acccuggAf agug 6-87 920 f ga (L96 ) 921 gausgsg747 fami ySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 422 C C ACUUC CAGGGUUUCUGGAA 423 UUC C AGAAAC C CUGGAAGUGGAU cscsacUfuccAfGfGfguuucugG (vinu) sUf sccaGf aaacccuGf gaag 6-88 922 f aa (L96 ) 923 uggsasu748 fami yUMS* 424 C ACUUC C AGGGUUUCUGGAGA 425 UCUC C AGAAAC C CUGGAAGUGGA csascuUf ccaGfGfGfuuucuggA (vinu) sCf succAf gaaacccUf ggaa 6-89 924 f ga (L96 ) 925 gugsgsa750 fami yUMS* 426 CUUC C AGGGUUUCUGGAGGAA 427 UUC CUC C AGAAAC C CUGGAAGUG csusucCf aggGfUfUfucuggagG (vinu) sUf sccuCf cagaaacCf cugg 6-90 926 f aa (L96 ) 927 aagsusg790 fami yUMS* 428 ACC C AGAGAGACUC CUUC C AA 429 UUGGAAGGAGUCUCUCUGGGUAA ascsccAfgagAfGf Af cuccuucC (vinu) sUf sggaAf ggagucuCf ucug 6-91 928 f aa (L96 ) 929 ggusasa811 fami yUMS* 430 CUGGACGAGCAGUUCACGGUA 431 UAC CGUGAACUGCUCGUC C AGGU csusggAf cgaGf Cf AfguucacgG (vinu) sAf sccgUfgaacugcUf egue 6-92 930 f ua (L96 ) 931 cagsgsu812 fami yUMS* 432 UGGACGAGCAGUUCACGGUGA 433 UC AC CGUGAACUGCUCGUC C AGG usgsgaCfgagCf AfGfuucacggU (vinu) sCf saccGf ugaacugCf ucgu 6-93 932 f ga (L96 ) 933 ccasgsg892 fami yUMS* 434 GAGAUCCAGGUGGCUCAUUUA 435 UAAAUGAGC C AC CUGGAUCUC AG gsasgaUf ccaGf Gf Uf ggcucauU (vinu) sAf saauGf agccaccUf ggau 6-94 934 f ua (L96 ) 935 cucsasg912 fami yUMS* 436 C C C CUUUAAGAAC AAC AUGAA 437 UUCAUGUUGUUCUUAAAGGGGAA cscsccUfuuaAfGf Af acaacauG (vinu) sUf scauGf uuguucuUf aaag 6-95 936 f aa (L96 ) 937 gggsasa913 fami yUMS* 438 C C CUUUAAGAACAAC AUGAGA 439 UCUCAUGUUGUUCUUAAAGGGGA cscscuUfuaaGf Af Af caacaugA (vinu) sCf sucaUf guuguucUf uaaa 6-96 938 f ga (L96 ) 939 gggsgsaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)915 fami yUMS* 440 CUUUAAGAACAACAUGAGCUA 441 UAGCUCAUGUUGUUCUUAAAGGG csusuuAf agaAf Cf Af acaugagC (vinu) sAf sgcuCf auguuguUf cuua 6-97 940 f ua (L96 ) 941 aagsgsg919 fami yUMS* 442 AAGAACAACAUGAGCUUUGUA 443 UACAAAGCUCAUGUUGUUCUUAA asasgaAf caaCf AfUfgagcuuuG (vinu) sAf scaaAf gcucaugUf uguu 6-98 942 f ua (L96 ) 943 cuusasa920 fami yUMS* 444 AGAACAACAUGAGCUUUGUGA 445 UCACAAAGCUCAUGUUGUUCUUA asgsaaCf aacAfUfGf agcuuugU (vinu) sCf sacaAf agcucauGf uugu 6-99 944 f ga (L96 ) 945 ucususa921 fami yUMS* 446 GAACAACAUGAGCUUUGUGGA 447 UCCACAAAGCUCAUGUUGUUCUU gsasacAf acaUfGf AfgcuuuguG (vinu) sCf scacAf aagcucaUf guug 6-100 946 f ga (L96 ) 947 uucsusu924 fami yUMS* 448 CAACAUGAGCUUUGUGGUCCA 449 UGGACCACAAAGCUCAUGUUGUU csasacAfugaGf CfUfuugugguC (vinu) sGf sgacCf acaaagcUf caug 6-101 948 f ca (L96 ) 949 uugsusu946 fami yUMS* 450 GUAC C C AC C CACUUUGAAUGA 451 UCAUUCAAAGUGGGUGGGUACAA gsusacCf cacCf Cf Af cuuugaaU (vinu) sCf sauuCf aaaguggGf uggg 6-102 950 f ga (L96 ) 951 uacsasa948 fami yUMS* 452 AC C C AC C C ACUUUGAAUGGAA 453 UUC C AUUCAAAGUGGGUGGGUAC ascsccAf cccAf CfUfuugaaugG (vinu) sUf sccaUf ucaaaguGf ggug 6-103 952 f aa (L96 ) 953 ggusasc949 fami yUMS* 454 C C C AC C C ACUUUGAAUGGAAA 455 UUUC C AUUCAAAGUGGGUGGGUA cscscaCf ccaCfUfUfugaauggA (vinu) sUf succAf uucaaagUf gggu 6-104 954 f aa (L96 ) 955 gggsusa950 fami yUMS* 456 C C AC C C ACUUUGAAUGGAA C A 457 UGUUC C AUUCAAAGUGGGUGGGUSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) cscsacCf cacUfUfUfgaauggaA (vinu) sGf suucCf auucaaaGf uggg 6-105 956 f ca (L96 ) 957 uggsgsu952 fami yUMS* 458 ACC C ACUUUGAAUGGAACGUA 459 UACGUUC C AUUCAAAGUGGGUGG ascsccAf cuuUfGf Af auggaacG (vinu) sAf scguUf ccauucaAf agug 6-106 958 f ua (L96 ) 959 ggusgsg955 fami yUMS* 460 CACUUUGAAUGGAACGUGUCA 461 UGAC ACGUUC C AUUCAAAGUGGG csascuUfugaAfUfGfgaacgugU (vinu) sGf sacaCf guuccauUf caaa 6-107 960 f ca (L96 ) 961 gugsgsg958 fami yUMS* 462 UUUGAAUGGAACGUGUC C CAA 463 UUGGGAC ACGUUC C AUUCAAAGU ususugAf augGf Af Af cguguccC (vinu) sUf sgggAf cacguucCf auuc 6-108 962 f aa (L96 ) 963 aaasgsu960 fami yUMS* 464 UGAAUGGAACGUGUC C C AGGA 465 UC CUGGGAC ACGUUC C AUUCAAA usgsaaUfggaAf CfGfugucccaG (vinu) sCf scugGf gacacguUf ccau 6-109 964 f ga (L96 ) 965 ucasasa967 fami yUMS* 466 AACGUGUC C C AGGUACUGGC A 467 UGC C AGUAC CUGGGAC ACGUUC C asascgUfgucCf Cf AfgguacugG (vinu) sGf sccaGfuaccuggGf acac 6-110 966 f ca (L96 ) 967 guuscsc969 fami yUMS* 468 CGUGUC C C AGGUACUGGC CAA 469 UUGGC C AGUAC CUGGGAC ACGUU csgsugUf cccAf Gf Gf uacuggcC (vinu) sUf sggcCf aguaccuGf ggac 6-111 968 f aa (L96 ) 969 acgsusu970 fami yUMS* 470 GUGUC C C AGGUACUGGC CAAA 471 UUUGGC C AGUAC CUGGGAC ACGU gsusguCf ccaGfGfUf acuggccA (vinu) sUf suggCf caguaccUf ggga 6-112 970 f aa (L96 ) 971 cacsgsu974 fami yUMS* 472 C C C AGGUACUGGC CAAC CUGA 473 UCAGGUUGGC C AGUAC CUGGGAC cscscaGfguaCfUfGfgccaaccU (vinu) sCf saggUf uggccagUf accu 6-113 972 f ga (L96 ) 973 gggsasc976 fami ySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 474 C AGGUACUGGC CAAC CUGAGA 475 UCUC AGGUUGGC C AGUAC CUGGG csasggUf acuGfGf Cf caaccugA (vinu) sCf sucaGf guuggccAf guac 6-114 974 f ga (L96 ) 975 cugsgsg981 fami yUMS* 476 ACUGGC CAAC CUGAGUUGGGA 477 UC C CAACUC AGGUUGGC C AGUAC ascsugGfccaAfCfCf ugaguugG (vinu) sCf sccaAf cucagguUf ggcc 6-115 976 f ga (L96 ) 977 agusasc982 fami yUMS* 478 CUGGC CAAC CUGAGUUGGGAA 479 UUC C CAACUC AGGUUGGC C AGUA csusggCf caaCf CfUfgaguuggG (vinu) sUf scccAf acucaggUf uggc 6-116 978 f aa (L96 ) 979 cagsusa984 fami yUMS* 480 GGC CAAC CUGAGUUGGGACAA 481 UUGUC C CAACUC AGGUUGGC C AG gsgsccAf accUfGf AfguugggaC (vinu) sUf sgucCf caacucaGf guug 6-117 980 f aa (L96 ) 981 gccsasg988 fami yUMS* 482 AAC CUGAGUUGGGAC AC C CUA 483 UAGGGUGUC C CAACUC AGGUUGG asasccUfgagUfUfGfggacaccC (vinu) sAf sgggUf gucccaaCf ucag 6-118 982 f ua (L96 ) 983 guusgsg989 fami yUMS* 484 AC CUGAGUUGGGAC AC C CUGA 485 UC AGGGUGUC C CAACUC AGGUUG ascscuGf aguUfGfGfgacacccU (vinu) sCf saggGf ugucccaAf cuca 6-119 984 f ga (L96 ) 985 ggususg1020 familyUMS* 486 GGUGUGGG AG AGG C C C AC C AA 487 UUGGUGGGC CUCUC C C AC AC C AG gsgsugUfgggAfGf AfggcccacC (vinu) sUf sgguGfggccucuCf ccac 6-120 986 f aa (L96 ) 987 accsasg1022 familyUMS* 488 UGUGGG AG AGG C C C AC C AAG A 489 UCUUGGUGGGC CUCUC C C AC AC C usgsugGfgagAfGfGf cccaccaA (vinu) sCf suugGf ugggccuCf uccc 6-121 988 f ga (L96 ) 989 acascsc1026 familyUMS* 490 GGAGAGGC C C AC C AAGGUC C A 491 UGGAC CUUGGUGGGC CUCUC C C A gsgsagAfggcCf Cf Af ccaagguC (vinu) sGf sgacCf uugguggGf ccuc 6-122 990 f ca (L96 ) 991 uccscsaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)1029 familyUMS* 492 GAGGC C C AC CAAGGUC CGGC A 493 UGC CGGAC CUUGGUGGGC CUCUC gsasggCf ccaCf Cf Af agguccgG (vinu) sGf sccgGf accuuggUf gggc 6-123 992 f ca (L96 ) 993 cucsusc1030 familyUMS* 494 AGGC C C AC CAAGGUC CGGCUA 495 UAGC CGGAC CUUGGUGGGC CUCU asgsgcCf cacCf Af AfgguccggC (vinu) sAf sgccGf gaccuugGf uggg 6-124 994 f ua (L96 ) 995 ccuscsu1031 familyUMS* 496 GGC C C AC CAAGGUC CGGCUGA 497 UCAGC CGGAC CUUGGUGGGC CUC gsgsccCf accAf AfGfguccggcU (vinu) sGf sagcCf ggaccuuGf gugg 6-125 996 f ga (L96 ) 997 gccsusc1032 familyUMS* 498 GCCCACCAAGGUCCGGCUGCA 499 UGCAGCCGGACCUUGGUGGGCCU gscsccAf ccaAfGfGfuccggcuG (vinu) sGf scagCf cggaccuUf ggug 6-126 998 f ca (L96 ) 999 ggcscsu1034 familyUMS* 500 C C AC CAAGGUC CGGCUGC CUA 501 UAGGCAGCCGGACCUUGGUGGGC cscsacCf aagGfUf Cf cggcugcC (vinu) sAf sggcAf gccggacCf uugg 6-127 1000 f ua (L96 ) 1001 uggsgsc1035 familyUMS* 502 C AC CAAGGUC CGGCUGC CUAA 503 UUAGGCAGCCGGACCUUGGUGGG csasccAf aggUf Cf CfggcugccU (vinu) sUf saggCf agccggaCf cuug 6-128 1002 f aa (L96 ) 1003 gugsgsg1040 familyUMS* 504 AGGUCCGGCUGCCUAAGCUGA 505 UCAGCUUAGGCAGCCGGACCUUG asgsguCf cggCfUfGf ccuaagcU (vinu) sGf sagcUf uaggcagCf cgga 6-129 1004 f ga (L96 ) 1005 ccususg1043 familyUMS* 506 UCCGGCUGCCUAAGCUGUAUA 507 UAUACAGCUUAGGCAGCCGGACC uscscgGf cugCf CfUf aagcuguA (vinu) sAf suacAf gcuuaggCf agcc 6-130 1006 f ua (L96 ) 1007 ggascsc1047 familyUMS* 508 GCUGCCUAAGCUGUAUCUGAA 509 UUCAGAUACAGCUUAGGCAGCCGSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gscsugCf cuaAfGf CfuguaucuG (vinu) sUf scagAf uacagcuUf aggc 6-131 1008 f aa (L96 ) 1009 agcscsg1052 familyUMS* 510 CUAAGCUGUAUCUGAAACACA 511 UGUGUUUCAGAUACAGCUUAGGC csusaaGf cugUf AfUf cugaaacA (vinu) sGf suguUf ucagauaCf agcu 6-132 1010 f ca (L96 ) 1011 uagsgsc1055 familyUMS* 512 AGCUGUAUCUGAAACACCAAA 513 UUUGGUGUUUCAGAUACAGCUUA asgscuGfuauCfUfGf aaacaccA (vinu) sUf suggUf guuucagAf uaca 6-133 1012 f aa (L96 ) 1013 gcususa1056 familyUMS* 514 GCUGUAUCUGAAACACCAAAA 515 UUUUGGUGUUUCAGAUACAGCUU gscsugUf aucUfGf Af aacaccaA (vinu) sUf suugGf uguuucaGf auac 6-134 1014 f aa (L96 ) 1015 agcsusu1057 familyUMS* 516 CUGUAUCUGAAAC AC C AAAUA 517 UAUUUGGUGUUUCAGAUACAGCU csusguAfucuGf Af Af acaccaaA (vinu) sAf suuuGf guguuucAf gaua 6-135 1016 f ua (L96 ) 1017 cagscsu1059 familyUMS* 518 GUAUCUGAAAC AC CAAAUGGA 519 UC C AUUUGGUGUUUC AGAUAC AG gsusauCfugaAf Af Cf accaaauG (vinu) sCf scauUf ugguguuUf caga 6-136 1018 f ga (L96 ) 1019 uacsasg1061 familyUMS* 520 AUCUGAAAC AC CAAAUGGA C A 521 UGUC C AUUUGGUGUUUC AGAUAC asuscuGf aaaCf Af Cf caaauggA (vinu) sGf succAf uuuggugUf uuca 6-137 1020 f ca (L96 ) 1021 gausasc1062 familyUMS* 522 UCUGAAAC AC CAAAUGGA C C A 523 UGGUC C AUUUGGUGUUUC AGAUA uscsugAf aacAf Cf Cf aaauggaC (vinu) sGf sgucCf auuugguGf uuuc 6-138 1022 f ca (L96 ) 1023 agasusa1149 familyUMS* 524 CGAGCAGAGCCUGGUGGUGUA 525 UACACCACCAGGCUCUGCUCGGA csgsagCf agaGf Cf Cf uggugguG (vinu) sAf scacCf accaggcUf cugc 6-139 1024 f ua (L96 ) 1025 ucgsgsa1155 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 526 GAGCCUGGUGGUGUCCGGCGA 527 UCGCCGGACACCACCAGGCUCUG gsasgcCfuggUfGfGfuguccggC (vinu) sCf sgccGf gacaccaCf cagg 6-140 1026 f ga (L96 ) 1027 cucsusg1156 familyUMS* 528 AGCCUGGUGGUGUCCGGCGUA 529 UACGCCGGACACCACCAGGCUCU asgsccUfgguGfGfUfguccggcG (vinu) sAf scgcCfggacaccAf ccag 6-141 1028 f ua (L96 ) 1029 gcuscsu1158 familyUMS* 530 CCUGGUGGUGUCCGGCGUGCA 531 UGCACGCCGGACACCACCAGGCU cscsugGfuggUfGfUf ccggcguG (vinu) sGf scacGf ccggacaCf cacc 6-142 1030 f ca (L96 ) 1031 aggscsu1159 familyUMS* 532 CUGGUGGUGUCCGGCGUGCAA 533 UUGCACGCCGGACACCACCAGGC csusggUfgguGfUf Cf cggcgugC (vinu) sUf sgcaCfgccggacAf ccac 6-143 1032 f aa (L96 ) 1033 cagsgsc1161 familyUMS* 534 GGUGGUGUCCGGCGUGCAGCA 535 UGCUGCACGCCGGACACCACCAG gsgsugGfuguCf CfGfgcgugcaG (vinu) sGf scugCf acgccggAf cacc 6-144 1034 f ca (L96 ) 1035 accsasg1172 familyUMS* 536 GCGUGCAGCAUCAGUCCACCA 537 UGGUGGACUGAUGCUGCACGCCG gscsguGf cagCf AfUf caguccaC (vinu) sGf sgugGf acugaugCf ugca 6-145 1036 f ca (L96 ) 1037 cgcscsg1177 familyUMS* 538 C AGC AUC AGUC C AC C CUGGAA 539 UUCCAGGGUGGACUGAUGCUGCA csasgcAfucaGfUf Cf cacccugG (vinu) sUf sccaGf gguggacUf gacu 6-146 1038 f aa (L96 ) 1039 cugscsa1178 familyUMS* 540 AGC AUG AGUC C AC C CUGGAGA 541 UCUCCAGGGUGGACUGAUGCUGC asgscaUf cagUf Cf Cf acccuggA (vinu) sCf succAf ggguggaCf ugau 6-147 1040 f ga (L96 ) 1041 gcusgsc1181 familyUMS* 542 AUC AGUC C AC C CUGGAGCUC A 543 UGAGCUCCAGGGUGGACUGAUGC asuscaGfuccAf Cf Cf cuggagcU (vinu) sGf sagcUf ccaggguGf gacu 6-148 1042 f ca (L96 ) 1043 gausgscSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)1183 familyUMS* 544 C AGUC C AC C CUGGAGCUC AGA 545 UCUGAGCUCCAGGGUGGACUGAU csasguCf cacCf CfUfggagcucA (vinu) sCf sugaGf cuccaggGf ugga 6-149 1044 f ga (L96 ) 1045 cugsasu1186 familyUMS* 546 UC C AC C CUGGAGCUC AGCGAA 547 UUCGCUGAGCUCCAGGGUGGACU uscscaCf ccuGfGf AfgcucagcG (vinu) sUf scgcUf gagcuccAf gggu 6-150 1046 f aa (L96 ) 1047 ggascsu1190 familyUMS* 548 CCCUGGAGCUCAGCGAGGUCA 549 UGACCUCGCUGAGCUCCAGGGUG cscscuGfgagCfUf Cf agcgaggU (vinu) sGf saccUf cgcugagCf ucca 6-151 1048 f ca (L96 ) 1049 gggsusg1192 familyUMS* 550 CUGGAGCUCAGCGAGGUCGGA 551 UC CGAC CUCGCUGAGCUC C AGGG csusggAfgcuCf AfGf cgaggucG (vinu) sCf scgaCf cucgcugAf gcuc 6-152 1050 f ga (L96 ) 1051 cagsgsg1194 familyUMS* 552 GGAGCUCAGCGAGGUCGGCGA 553 UCGCCGACCUCGCUGAGCUCCAG gsgsagCfucaGf CfGf aggucggC (vinu) sCf sgccGf accucgcUf gagc 6-153 1052 f ga (L96 ) 1053 uccsasg1195 familyUMS* 554 GAGCUCAGCGAGGUCGGCGUA 555 UACGCCGACCUCGCUGAGCUCCA gsasgcUf cagCfGf AfggucggcG (vinu) sAf scgcCf gaccucgCf ugag 6-154 1054 f ua (L96 ) 1055 cucscsa1200 familyUMS* 556 CAGCGAGGUCGGCGUGGAGGA 557 UCCUCCACGCCGACCUCGCUGAG csasgcGf aggUf CfGfgcguggaG (vinu) sCf scucCf acgccgaCf cucg 6-155 1056 f ga (L96 ) 1057 cugsasg1203 familyUMS* 558 CGAGGUCGGCGUGGAGGCGGA 559 UCCGCCUCCACGCCGACCUCGCU csgsagGfucgGf CfGfuggaggcG (vinu) sCf scgcCf uccacgcCfgacc 6-156 1058 f ga (L96 ) 1059 ucgscsu1204 familyUMS* 560 GAGGUCGGCGUGGAGGCGGCA 561 UGCCGCCUCCACGCCGACCUCGCSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gsasggUf cggCf Gf Uf ggaggcgG (vinu) sGf sccgCf cuccacgCf cgac 6-157 1060 f ca (L96 ) 1061 cucsgsc1242 familyUMS* 562 C AUGUC C CGC AUGUC C CUGUA 563 UACAGGGACAUGCGGGACAUGGC csasugUf cccGfCfAfugucccuG (vinu) sAf scagGf gacaugcGf ggac 6-158 1062 f ua (L96 ) 1063 augsgsc1243 familyUMS* 564 AUGUC C CGC AUGUC C CUGUC A 565 UGACAGGGACAUGCGGGACAUGG asusguCf ccgCf AfUfgucccugU (vinu) sGf sacaGf ggacaugCf ggga 6-159 1064 f ca (L96 ) 1065 causgsg1245 familyUMS* 566 GUC C CGC AUGUC C CUGUC CUA 567 UAGGACAGGGACAUGCGGGACAU gsusccCfgcaUfGfUf cccugucC (vinu) sAf sggaCf agggacaUf gcgg 6-160 1066 f ua (L96 ) 1067 gacsasu1246 familyUMS* 568 UC C CGC AUGUC C CUGUC CUC A 569 UGAGGACAGGGACAUGCGGGACA uscsccGf cauGfUf Cf ccuguccU (vinu) sGf saggAf cagggacAf ugcg 6-161 1068 f ca (L96 ) 1069 ggascsa1249 familyUMS* 570 CGC AUGUC C CUGUC CUC CUUA 571 UAAGGAGGACAGGGACAUGCGGG csgscaUfgucCf CfUfguccuccU (vinu) sAf saggAf ggacaggGf acau 6-162 1070 f ua (L96 ) 1071gcgsgsg1251 familyUMS* 572 C AUGUC C CUGUC CUC CUUC AA 573 UUGAAGGAGGACAGGGACAUGCG csasugUf cccUf Gf Uf ccuccuuC (vinu) sUf sgaaGf gaggacaGf ggac 6-163 1072 f aa (L96 ) 1073 augscsg1256 familyUMS* 574 C C CUGUC CUC CUUC AGCGUGA 575 UCACGCUGAAGGAGGACAGGGAC cscscuGfuccUf Cf CfuucagcgU (vinu) sCf sacgCf ugaaggaGf gaca 6-164 1074 f ga (L96 ) 1075 gggsasc1258 familyUMS* 576 CUGUC CUC CUUC AGCGUGAAA 577 UUUCACGCUGAAGGAGGACAGGG csusguCf cucCfUfUf cagcgugA (vinu) sUf sucaCf gcugaagGf agga 6-165 1076 f aa (L96 ) 1077 cagsgsg1260 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 578 GUC CUC CUUC AGCGUGAAC C A 579 UGGUUCACGCUGAAGGAGGACAG gsusccUf ccuUf Cf AfgcgugaaC (vinu) sGf sguuCf acgcugaAf ggag 6-166 1078 f ca (L96 ) 1079 gacsasg1272 familyUMS* 580 CGUGAACCGCCCCUUCCUCUA 581 UAGAGGAAGGGGCGGUUCACGCU csgsugAf accGf Cf Cf ccuuccuC (vinu) sAf sgagGf aaggggcGf guuc 6-167 1080 f ua (L96 ) 1081 acgscsu1273 familyUMS* 582 GUGAAC CGCCCCUUC CUCUUA 583 UAAGAGGAAGGGGCGGUUCACGC gsusgaAf ccgCf Cf Cf cuuccucU (vinu) sAf sagaGf gaaggggCf gguu 6-168 1082 f ua (L96 ) 1083 cacsgsc1274 familyUMS* 584 UGAAC CGCCCCUUCCUCUUCA 585 UGAAGAGGAAGGGGCGGUUCACG usgsaaCf cgcCf Cf CfuuccucuU (vinu) sGf saagAf ggaagggGf cggu 6-169 1084 f ca (L96 ) 1085 ucascsg1276 familyUMS* 586 AACCGCCCCUUCCUCUUCUUA 587 UAAGAAGAGGAAGGGGCGGUUCA asasccGf cccCfUfUf ccucuucU (vinu) sAf sagaAf gaggaagGf ggcg 6-170 1086 f ua (L96 ) 1087 guuscsa1277 familyUMS* 588 ACCGCCCCUUCCUCUUCUUCA 589 UGAAGAAGAGGAAGGGGCGGUUC ascscgCf cccUfUf Cf cucuucuU (vinu) sGf saagAf agaggaaGf gggc 6-171 1088 f ca (L96 ) 1089 ggususc1302 familyUMS* 590 CGAGGAC AC C AC AGGC CUUC A 591 UGAAGGC CUGUGGUGUC CUCGAA csgsagGf acaCf Cf Af caggccuU (vinu) sGf saagGf ccuguggUf gucc 6-172 1090 f ca (L96 ) 1091 ucgsasa1304 familyUMS* 592 AGGAC AC C AC AGGC CUUC C C A 593 UGGGAAGGC CUGUGGUGUC CUCG asgsgaCf accAf Cf AfggccuucC (vinu) sGf sggaAf ggccuguGf gugu 6-173 1092 f ca (L96 ) 1093 ccuscsg1306 familyUMS* 594 GAC AC C AC AGGC CUUC C C CUA 595 UAGGGGAAGGC CUGUGGUGUC CU gsascaCf cacAfGfGf ccuucccC (vinu) sAf sgggGf aaggccuGf uggu 6-174 1094 f ua (L96 ) 1095 gucscsuSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)1309 familyUMS* 596 AC C AC AGGC CUUC C C CUCUUA 597 UAAGAGGGGAAGGCCUGUGGUGU ascscaCf aggCf CfUfuccccucU (vinu) sAf sagaGf gggaaggCf cugu 6-175 1096 f ua (L96 ) 1097 ggusgsu1527 familyUMS* 598 GGCUGUGGCAUCCAGAGUCCA 599 UGGACUCUGGAUGCCACAGCCAC gsgscuGfuggCf AfUf ccagaguC (vinu) sGf sgacUf cuggaugCf caca 6-176 1098 f ca (L96 ) 1099 gccsasc1529 familyUMS* 600 CUGUGGC AUC C AGAGUC C CUA 601 UAGGGACUCUGGAUGCCACAGCC csusguGfgcaUf Cf Cf agaguccC (vinu) sAf sgggAf cucuggaUf gcca 6-177 1100 f ua (L96 ) 1101 cagscsc1536 familyUMS* 602 AUC C AGAGUC C CUGC CUGGAA 603 UUCCAGGCAGGGACUCUGGAUGC asusccAfgagUf Cf Cf cugccugG (vinu) sUf sccaGf gcagggaCf ucug 6-178 1102 f aa (L96 ) 1103 gausgsc1539 familyUMS* 604 C AGAGUC C CUGC CUGGAC CAA 605 UUGGUCCAGGCAGGGACUCUGGA csasgaGfuccCfUfGf ccuggacC (vinu) sUf sgguCf caggcagGf gacu 6-179 1104 f aa (L96 ) 1105 cugsgsa1545 familyUMS* 606 CCCUGCCUGGACCAGCCUCUA 607 UAGAGGCUGGUCCAGGCAGGGAC cscscuGf ccuGfGf Af ccagccuC (vinu) sAf sgagGf cugguccAf ggca 6-180 1106 f ua (L96 ) 1107 gggsasc1549 familyUMS* 608 GC CUGGAC C AGC CUCUC C AC A 609 UGUGGAGAGGCUGGUCCAGGCAG gscscuGfgacCf AfGf ccucuccA (vinu) sGf suggAf gaggcugGf ucca 6-181 1108 f ca (L96 ) 1109 ggcsasg1551 familyUMS* 610 CUGGAC C AGC CUCUC C ACUC A 611 UGAGUGGAGAGGCUGGUCCAGGC csusggAf ccaGf Cf CfucuccacU (vinu) sGf saguGf gagaggcUf gguc 6-182 1110 f ca (L96 ) 1111 cagsgsc1553 familyUMS* 612 GGAC C AGC CUCUC C ACUC AUA 613 UAUGAGUGGAGAGGCUGGUCCAGSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) gsgsacCf agcCfUf CfuccacucA (vinu) sAf sugaGf uggagagGf cugg 6-183 1112 f ua (L96 ) 1113 uccsasg1555 familyUMS* 614 AC C AGC CUCUC C ACUC AUGUA 615 UACAUGAGUGGAGAGGCUGGUCC ascscaGf ccuCfUf Cf cacucauG (vinu) sAf scauGf aguggagAf ggcu 6-184 1114 f ua (L96 ) 1115 gguscsu1556 familyUMS* 616 C C AGC CUCUC C ACUC AUGUGA 617 UCACAUGAGUGGAGAGGCUGGUC cscsagCf cucUf Cf Cf acucaugU (vinu) sCf sacaUf gaguggaGf aggc 6-185 1116 f ga (L96 ) 1117 uggsusc1558 familyUMS* 618 AGC CUCUC C ACUC AUGUGAC A 619 UGUCACAUGAGUGGAGAGGCUGG asgsccUf cucCf Af CfucaugugA (vinu) sGf sucaCf augagugGf agag 6-186 1118 f ca (L96 ) 1119 gcusgsg1560 familyUMS* 620 C CUCUC C ACUC AUGUGACUC A 621 UGAGUCACAUGAGUGGAGAGGCU cscsucUf ccaCfUf Cf augugacU (vinu) sGf saguCf acaugagUf ggag 6-187 1120 f ca (L96 ) 1121 aggscsu1561 familyUMS* 622 CUCUC C ACUC AUGUGACUCUA 623 UAGAGUCACAUGAGUGGAGAGGC csuscuCf cacUf Cf AfugugacuC (vinu) sAf sgagUf cacaugaGf ugga 6-188 1122 f ua (L96 ) 1123 gagsgsc1562 familyUMS* 624 UCUC C ACUC AUGUGACUCUUA 625 UAAGAGUCACAUGAGUGGAGAGG uscsucCf acuCf AfUfgugacucU (vinu) sAf sagaGf ucacaugAf gugg 6-189 1124 f ua (L96 ) 1125 agasgsg1563 familyUMS* 626 CUC C ACUC AUGUGACUCUUUA 627 UAAAGAGUCACAUGAGUGGAGAG csusccAf cucAfUfGfugacucuU (vinu) sAf saagAf gucacauGf agug 6-190 1126 f ua (L96 ) 1127 gagsasg1564 familyUMS* 628 UC C ACUC AUGUGACUCUUUC A 629 UGAAAGAGUCACAUGAGUGGAGA uscscaCfucaUfGfUfgacucuuU (vinu) sGf saaaGf agucacaUf gagu 6-191 1128 f ca (L96 ) 1129 ggasgsa1565 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 630 C C ACUC AUGUGACUCUUUC GA 631 UGGAAAGAGUCACAUGAGUGGAG cscsacUf cauGfUfGf acucuuuC (vinu) sGf sgaaAf gagucacAf ugag 6-192 1130 f ca (L96 ) 1131 uggsasg1566 familyUMS* 632 C ACUC AUGUGACUCUUUC C AA 633 UUGGAAAGAGUCACAUGAGUGGA csascuCf augUfGf Af cucuuucC (vinu) sUf sggaAf agagucaCf auga 6-193 1132 f aa (L96 ) 1133 gugsgsa1567 familyUMS* 634 ACUC AUGUGACUCUUUC C AAA 635 UUUGGAAAGAGUCACAUGAGUGG ascsucAfuguGf Af CfucuuuccA (vinu) sUf suggAf aagagucAf caug 6-194 1134 f aa (L96 ) 1135 agusgsg1621 familyUMS* 636 AGUCUGAGAGAGGCCAUUCUA 637 UAGAAUGGCCUCUCUCAGACUGC asgsucUfgagAfGf AfggccauuC (vinu) sAf sgaaUf ggccucuCf ucag 6-195 1136 f ua (L96 ) 1137 acusgsc1624 familyUMS* 638 CUGAGAGAGGCCAUUCUUUCA 639 UGAAAGAAUGGCCUCUCUCAGAC csusgaGf agaGfGf Cf cauucuuU (vinu) sGf saaaGf aauggccUf cucu 6-196 1138 f ca (L96 ) 1139 cagsasc1625 familyUMS* 640 UGAGAGAGGC C AUUCUUUC C A 641 UGGAAAGAAUGGCCUCUCUCAGA usgsagAfgagGfCfCf auucuuuC (vinu) sGf sgaaAf gaauggcCf ucuc 6-197 1140 f ca (L96 ) 1141 ucasgsa1627 familyUMS* 642 AGAGAGGC C AUUCUUUC C CAA 643 UUGGGAAAGAAUGGCCUCUCUCA asgsagAfggcCf AfUfucuuuccC (vinu) sUf sgggAf aagaaugGf ccuc 6-198 1142 f aa (L96 ) 1143 ucuscsa1691 familyUMS* 644 GGAGGGCAGGCAUCGGGGAGA 645 UCUCCCCGAUGCCUGCCCUCCUC gsgsagGfgcaGfGf Cf aucggggA (vinu) sCf succCf cgaugccUf gccc 6-199 1144 f ga (L96 ) 1145 uccsusc1694 familyUMS* 646 GGGCAGGCAUCGGGGAGCCGA 647 UCGGCUCCCCGAUGCCUGCCCUC gsgsgcAfggcAfUf CfggggagcC (vinu) sCf sggcUf ccccgauGf ccug 6-200 1146 f ga (L96 ) 1147 cccsusc- Ill -SequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)1695 familyUMS* 648 GGCAGGCAUCGGGGAGCCGGA 649 UCCGGCUCCCCGAUGCCUGCCCU gsgscaGfgcaUf CfGfgggagccG (vinu) sCf scggCf uccccgaUf gccu 6-201 1148 f ga (L96 ) 1149 gccscsu1772 familyUMS* 650 UGGGCAGGAGGGAGGUGCUUA 651 UAAGC AC CUC C CUC CUGC C C AGG usgsggCf aggAf Gf Gf gaggugcU (vinu) sAf sagcAf ccucccuCf cugc 6-202 1150 f ua (L96 ) 1151 ccasgsg1775 familyUMS* 652 GCAGGAGGGAGGUGCUUCUAA 653 UUAGAAGC AC CUC C CUC CUGC C C gscsagGf aggGf AfGfgugcuucU (vinu) sUf sagaAfgcaccucCf cucc 6-203 1152 f aa (L96 ) 1153 ugcscsc1779 familyUMS* 654 GAGGGAGGUGCUUCUAGUUCA 655 UGAACUAGAAGC AC CUC C CUC CU gsasggGf aggUfGf CfuucuaguU (vinu) sGf saacUf agaagcaCf cucc 6-204 1154 f ca (L96 ) 1155 cucscsu1783 familyUMS* 656 GAGGUGCUUCUAGUUCUGCCA 657 UGGC AGAACUAGAAGC AC CUC C C gsasggUfgcuUf CfUf aguucugC (vinu) sGf sgcaGf aacuagaAf gcac 6-205 1156 f ca (L96 ) 1157 cucscsc1785 familyUMS* 658 GGUGCUUCUAGUUCUGCCAGA 659 UCUGGCAGAACUAGAAGCACCUC gsgsugCfuucUf AfGfuucugccA (vinu) sCf suggCf agaacuaGf aagc 6-206 1158 f ga (L96 ) 1159 accsusc1788 familyUMS* 660 GCUUCUAGUUCUGCCAGGAGA 661 UCUCCUGGCAGAACUAGAAGCAC gscsuuCfuagUfUf CfugccaggA (vinu) sCf succUf ggcagaaCf uaga 6-207 1160 f ga (L96 ) 1161 agcsasc1789 familyUMS* 662 CUUCUAGUUCUGCCAGGAGAA 663 UUCUCCUGGCAGAACUAGAAGCA csusucUf aguUf CfUfgccaggaG (vinu) sUf scucCf uggcagaAf cuag 6-208 1162 f aa (L96 ) 1163 aagscsa1792 familyUMS* 664 CUAGUUCUGCCAGGAGACAGA 665 UCUGUCUCCUGGCAGAACUAGAASequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) csusagUfucuGf Cf Cf aggagacA (vinu) sCf suguCf uccuggcAf gaac 6-209 1164 f ga (L96 ) 1165 uagsasa1793 familyUMS* 666 UAGUUCUGCCAGGAGACAGGA 667 UC CUGUCUC CUGGC AGAACUAGA usasguUf cugCf Cf AfggagacaG (vinu) sCf scugUf cuccuggCf agaa 6-210 1166 f ga (L96 ) 1167 cuasgsa1798 familyUMS* 668 CUGCCAGGAGACAGGUUAGCA 669 UGCUAACCUGUCUCCUGGCAGAA csusgcCf aggAfGf Af cagguuaG (vinu) sGf scuaAf ccugucuCf cugg 6-211 1168 f ca (L96 ) 1169 cagsasa1801 familyUMS* 670 CCAGGAGACAGGUUAGCUGCA 671 UGCAGCUAACCUGUCUCCUGGCA cscsagGf agaCf AfGfguuagcuG (vinu) sGf scagCfuaaccugUf cucc 6-212 1170 f ca (L96 ) 1171 uggscsa1804 familyUMS* 672 GGAGACAGGUUAGCUGCUCCA 673 UGGAGCAGCUAACCUGUCUCCUG gsgsagAf cagGfUfUf agcugcuC (vinu) sGf sgagCf agcuaacCf uguc 6-213 1172 f ca (L96 ) 1173 uccsusg1805 familyUMS* 674 GAGACAGGUUAGCUGCUCCCA 675 UGGGAGCAGCUAACCUGUCUCCU gsasgaCf aggUfUf AfgcugcucC (vinu) sGf sggaGf cagcuaaCf cugu 6-214 1174 f ca (L96 ) 1175 cucscsu1806 familyUMS* 676 AGACAGGUUAGCUGCUCCCCA 677 UGGGGAGCAGCUAACCUGUCUCC asgsacAfgguUf AfGf cugcuccC (vinu) sGf sgggAf gcagcuaAf ccug 6-215 1176 f ca (L96 ) 1177 ucuscsc1810 familyUMS* 678 AGGUUAGCUGCUCCCCACGUA 679 UACGUGGGGAGCAGCUAACCUGU asgsguUf agcUfGf CfuccccacG (vinu) sAf scguGf gggagcaGf cuaa 6-216 1178 f ua (L96 ) 1179 ccusgsu1885 familyUMS* 680 GC CUUUGGACUUGUC C CGGGA 681 UC C CGGGACAAGUC CAAAGGC AG gscscuUfuggAf CfUfugucccgG (vinu) sCf sccgGf gacaaguCf caaa 6-217 1180 f ga (L96 ) 1181 ggcsasg1889 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) UMS* 682 UUGGACUUGUC C CGGGAC AC A 683 UGUGUC C CGGGACAAGUC CAAAG ususggAf cuuGfUf Cf ccgggacA (vinu) sGf suguCf ccgggacAf ague 6-218 1182 f ca (L96 ) 1183 caasasg1921 familyUMS* 684 GGGGAGAGACGGGC C CUGGUA 685 UACCAGGGCCCGUCUCUCCCCAC gsgsggAfgagAf CfGfggcccugG (vinu) sAf sccaGf ggcccguCf ucuc 6-219 1184 f ua (L96 ) 1185 cccsasc1923 familyUMS* 686 GGAGAGACGGGC C CUGGUGGA 687 UCCACCAGGGCCCGUCUCUCCCC gsgsagAfgacGfGfGf cccugguG (vinu) sCf scacCf agggcccGf ucuc 6-220 1186 f ga (L96 ) 1187 uccscsc1924 familyUMS* 688 GAGAGACGGGC C CUGGUGGUA 689 UACCACCAGGGCCCGUCUCUCCC gsasgaGf acgGfGf Cf ccuggugG (vinu) sAf sccaCf cagggccCf gucu 6-221 1188 f ua (L96 ) 1189 cucscsc1964 familyUMS* 690 GUCCUCAGCCCCGCGUGGAAA 691 UUUCCACGCGGGGCUGAGGACAA gsusccUf cagCf Cf Cf cgcguggA (vinu) sUf succAf cgcggggCf ugag 6-222 1190 f aa (L96 ) 1191 gacsasa1965 familyUMS* 692 UC CUC AGC C C CGCGUGGAAC A 693 UGUUCCACGCGGGGCUGAGGACA uscscuCf agcCf Cf CfgcguggaA (vinu) sGf suucCf acgcgggGf cuga 6-223 1192 f ca (L96 ) 1193 ggascsa2070 familyUMS* 694 CUUC C C ACGGCUC CUCGAGAA 695 UUCUCGAGGAGCCGUGGGAAGUC csusucCf cacGfGf CfuccucgaG (vinu) sUf scucGf aggagccGf uggg 6-224 1194 f aa (L96 ) 1195 aagsusc2072 familyUMS* 696 UCCCACGGCUC CUCGAGAUC A 697 UGAUCUCGAGGAGCCGUGGGAAG uscsccAf cggCfUf Cf cucgagaU (vinu) sGf saucUf cgaggagCf cgug 6-225 1196 f ca (L96 ) 1197 ggasasg2074 familyUMS* 698 C C ACGGCUC CUCGAGAUC C C A 699 UGGGAUCUCGAGGAGCCGUGGGA cscsacGfgcuCf CfUf cgagaucC (vinu) sGf sggaUf cucgaggAf gceg 6-226 1198 f ca (L96 ) 1199 uggsgsaSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)2077 familyUMS* 700 CGGCUC CUCGAGAUC C C AAC A 701 UGUUGGGAUCUCGAGGAGCCGUG csgsgcUf ccuCfGf AfgaucccaA (vinu) sGf suugGf gaucucgAf ggag 6-227 1200 f ca (L96 ) 1201 ccgsusg2078 familyUMS* 702 GGCUC CUCGAGAUC C C AAC AA 703 UUGUUGGGAUCUCGAGGAGCCGU gsgscuCf cucGf AfGf aucccaaC (vinu) sUf sguuGf ggaucucGf agga 6-228 1202 f aa (L96 ) 1203 gccsgsu2081 familyUMS* 704 UC CUCGAGAUC C C AAC ACUGA 705 UCAGUGUUGGGAUCUCGAGGAGC uscscuCfgagAfUf Cf ccaacacU (vinu) sCf saguGf uugggauCf ucga 6-229 1204 f ga (L96 ) 1205 ggasgsc2084 familyUMS* 706 UCGAGAUC C C AAC ACUGC C AA 707 UUGGCAGUGUUGGGAUCUCGAGG uscsgaGf aucCf Cf Af acacugcC (vinu) sUf sggcAf guguuggGf aucu 6-230 1206 f aa (L96 ) 1207 cgasgsg2085 familyUMS* 708 CGAGAUC C CAAC ACUGC C AGA 709 UCUGGCAGUGUUGGGAUCUCGAG csgsagAfuccCf Af Af cacugccA (vinu) sCf suggCf aguguugGf gauc 6-231 1208 f ga (L96 ) 1209 ucgsasg2087 familyUMS* 710 AGAUC C CAAC ACUGC CAGCAA 711 UUGCUGGCAGUGUUGGGAUCUCG asgsauCf ccaAf Cf Af cugccagC (vinu) sUf sgcuGf gcaguguUf ggga 6-232 1210 f aa (L96 ) 1211 ucuscsg2088 familyUMS* 712 GAUC C CAAC ACUGC CAGCAUA 713 UAUGCUGGCAGUGUUGGGAUCUC gsasucCf caaCf Af CfugccagcA (vinu) sAf sugcUf ggcagugUf uggg 6-233 1212 f ua (L96 ) 1213 aucsusc2130 familyUMS* 714 UCCCUCCUCUGCCCGGGAGCA 715 UGCUCCCGGGCAGAGGAGGGAGA uscsccUf ccuCfUfGf cccgggaG (vinu) sGf scucCf cgggcagAf ggag 6-234 1214 f ca (L96 ) 1215 ggasgsa2131 familyUMS* 716 CCCUCCUCUGCCCGGGAGCUA 717 UAGCUCCCGGGCAGAGGAGGGAGSequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’) cscscuCf cucUfGf Cf ccgggagC (vinu) sAf sgcuCf ccgggcaGf agga 6-235 1216 f ua (L96 ) 1217 gggsasg2133 familyUMS* 718 CUCCUCUGCCCGGGAGCUCAA 719 UUGAGCUCCCGGGCAGAGGAGGG csusccUf cugCf Cf CfgggagcuC (vinu) sUf sgagCf ucccgggCf agag 6-236 1218 f aa (L96 ) 1219 gagsgsg2180 familyUMS* 720 AGCUCCUUAAGGCUCUUUUGA 721 UCAAAAGAGCCUUAAGGAGCUCA asgscuCf cuuAf AfGfgcucuuuU (vinu) sCf saaaAf gagccuuAf agga 6-237 1220 f ga (L96 ) 1221 gcuscsa2184 familyUMS* 722 CCUUAAGGCUCUUUUGUAAGA 723 UCUUACAAAAGAGCCUUAAGGAG cscs uuAf aggCfUfCf uuuugua A (vinu) sCf suuaCf aaaagagCf cuua 6-238 1222 f ga (L96 ) 1223 aggsasg2185 familyUMS* 724 CUUAAGGCUCUUUUGUAAGGA 725 UC CUUACAAAAGAGC CUUAAGGA csusuaAfggcUf CfUfuuuguaaG (vinu) sCf scuuAf caaaagaGf ccuu 6-239 1224 f ga (L96 ) 1225 aagsgsa2186 familyUMS* 726 UUAAGGCUCUUUUGUAAGGUA 727 UAC CUUACAAAAGAGC CUUAAGG ususaaGfgcuCfUfUfuuguaagG (vinu) sAf sccuUf acaaaagAf gccu 6-240 1226 f ua (L96 ) 1227 uaasgsg2187 familyUMS* 728 UAAGGCUCUUUUGUAAGGUUA 729 UAAC CUUACAAAAGAGC CUUAAG usasagGf cucUf Uf Uf uguaaggU (vinu) sAf saccUf uacaaaaGf agcc 6-241 1228 f ua (L96 ) 1229 uuasasg2188 familyUMS* 730 AAGGCUCUUUUGUAAGGUUUA 731 UAAAC CUUACAAAAGAGC CUUAA asasggCfucuUfUfUfguaagguU (vinu) sAf saacCf uuacaaaAf gage 6-242 1230 f ua (L96 ) 1231 cuusasa2194 familyUMS* 732 CUUUUGUAAGGUUUUUGUAGA 733 UCUACAAAAAC CUUACAAAAGAG csus uuU fguaAfGfGf uuuuuguA (vinu) sCf suacAf aaaaccuUf acaa 6-243 1232 f ga (L96 ) 1233 aagsasg2195 familySequenceDuplex SEQ SEQID ID Sense strand ID Antisense strand NO: (5’ to 3’) NO: (5’ to 3’)UMS* 734 UUUUGUAAGGUUUUUGUAGUA 735 UACUACAAAAAC CUUACAAAAGA ususuuGf uaaGf Gf Uf uuuuguaG (vinu) sAf scuaCf aaaaaccUf uaca 6-244 1234 f ua (L96 ) 1235 aaasgsa2196 familyUMS* 736 UUUGUAAGGUUUUUGUAGUGA 737 UC ACUAC AAAAAC CUUAC AAAAG ususugUf aagGf Uf Uf uuuguagU (vinu) sCf sacuAf caaaaacCf uuac 6-245 1236 f ga (L96 ) 1237 aaasasg2202 familyUMS* 738 AGGUUUUUGUAGUGAUUUUUA 739 UAAAAAUC ACUACAAAAAC CUUAa s g s guU f uuuG f U f Af gugauuuU (vinu) sAf saaaAf ucacuacAf aaaa 6-246 1238 f ua (L96 ) 1239 ccususa2203 familyUMS* 740 GGUUUUUGUAGUGAUUUUUAA 741 UUAAAAAUC ACUACAAAAAC CUU gsgsuuUfuugUfAfGfugauuuuU (vinu) sUf saaaAf aucacuaCf aaaa 6-247 1240 f aa (L96 ) 1241 accsusu2213 familyUMS* 742 GUGAUUUUUAUGC C AC CUGAA 743 UUCAGGUGGCAUAAAAAUCACUA gsusgaUfuuuUf AfUfgccaccuG (vinu) sUf scagGf uggcauaAf aaau 6-248 1242 f aa (L96 ) 1243 cacsusa2214 familyUMS* 744 UGAUUUUUAUGC C AC CUGAAA 745 UUUCAGGUGGCAUAAAAAUCACU usgsauUfuuuAfUfGf ccaccugA (vinu) sUf sucaGf guggcauAf aaaa 6-249 1244 f aa (L96 ) 1245 ucascsu2216 familyUMS* 746 AUUUUUAUGC C AC CUGAAUAA 747 UUAUUCAGGUGGCAUAAAAAUCA asusuuUfuauGf Cf Cf accugaaU (vinu) sUf sauuCf agguggcAf uaaa 6-250 1246 f aa (L96 ) 1247 aauscsa

[0070] In some aspects, at least one end of the dsRNA has a single-stranded nucleotide overhang of one to four, e.g., two, nucleotides. In some aspects, the dsRNA comprises a singlestranded overhang at the 3'-terminal end of the antisense strand. In some aspects, the dsRNA comprises a blunt end, for example, at the 5 '-end of the antisense strand. In some aspects, one or more of the nucleotides in the overhang (if present) is replaced with a nucleoside thiophosphate.Chemical modifications

[0071] In some aspects, the dsRNA agents are chemically modified, e.g., to enhance stability. Chemical modifications may include, but are not limited to 2' modifications, modifications at other sites of the sugar or base of an oligonucleotide, introduction of nonnatural bases into the oligonucleotide chain, covalent attachment to a ligand or chemical moiety, and replacement of internucleotide phosphate linkages with alternate linkages such as thiophosphates. More than one such modification may be employed.

[0072] In some aspects, the 5 '-end of the antisense strand and the 3 '-end of the sense strand are chemically linked via a hexaethylene glycol linker.

[0073] In some embodiment, at least one nucleotide of the dsRNA agent comprises a phosphorothioate or phosphorodi thioate groups.

[0074] In some aspects, one or more nucleotides in the sense strand and / or the anti-sense strand is a deoxyribonucleotide.

[0075] In some aspects, the nucleotides at one or both of the strands of a dsRNA agent are modified to prevent or inhibit the degradation activities of cellular enzymes, such as nucleases. Examples of modifications which may inhibit degradation by cellular enzymes including, but are not limited to, 2'-amino modifications, 2'-amino sugar modifications, 2'-F (2'-fluoro) sugar modifications, 2'-F (2'-fluoro) modifications, 2'-alkyl sugar modifications, uncharged backbone modifications, morpholino modifications, 2'-O-methyl modifications, and phosphoramidate. In some aspects, at least one 2'-hydroxyl group of the nucleotides on a dsRNA is replaced by a chemical group, for example, by a 2'-amino, a 2'-methyl group, or a 2'-O-Methoxyethyl (2'-M0E) group.

[0076] In some aspects, the dsRNA agent is modified by the addition of a vinyl-phosphonate 2'O-Methyl group, e.g., at one end of one of the strands. For example, in some aspects, the 5' end of the anti-sense strand is modified by the addition of a vinyl-phosphonate 2'O-Methyl group.

[0077] In some aspects, the dsRNA agent is modified by the addition of a vinyl-phosphonate group, e.g., at one end of one of the strands. For example, in some aspects, the 5' end of the anti-sense strand is modified by the addition of a vinyl-phosphonate group.

[0078] In some aspects, at least one nucleotide is modified to form a locked nucleotide. For example, a locked nucleotide may contain a methylene bridge that connects the 2'-oxygen of ribose with the 4'-carbon of ribose. Oligonucleotides containing the locked nucleotide aredescribed in Koshkin, A. A., et al., Tetrahedron (1998), 54: 3607-3630) and Obika, S. et al., Tetrahedron Lett. (1998), 39: 5401-5404).

[0079] In some aspects, at least one nucleotide is modified to be a glycol nucleic acid.Modified internucleoside linkages

[0080] Examples of modified internucleoside linkages or backbones include, for example, phosphorothioates (including chiral phosphorothioates), phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates and chiral phosphonates, alkenylene phosphonates such as vinyl phosphonate, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5' to 5 '-3' or 2'-5' to 5 '-2'. Various salts, mixed salts and free-acid forms are also included.

[0081] Representative United States patents relating to the preparation of the above phosphorus-atom-containing linkages include, but are not limited to, U. S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; and 5,697,248.

[0082] Non-limiting examples of modified internucleoside linkages or backbones that do not include a phosphorus atom therein include short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, and short chain heteroatomic or heterocyclic intersugar linkages. For example, morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CEE component parts, may be used.

[0083] Representative United States patents relating to the preparation of the above oligonucleosides include, but are not limited to, U. S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257;5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439.GalNAc structures

[0084] GalNAc (N-acetylgalactosamine) has a high affinity for the asialoglycoprotein receptor (ASGPR), a component of liver specific lipoprotein (LSP), a macromolecular complex expressed on hepatocyte membranes. ASGPR is mainly expressed on the surface of liver parenchyma cells in the hepatic sinusoid space and exhibits calcium-dependent ligand binding.

[0085] In some aspects, the dsRNA agents comprises a GalNAc structure (e.g., GalNAc, a GalNAc derivative, a compound based on GalNAc, or a GalNAc cluster), which facilitates targeted delivery of the dsRNA to the liver and entry of the dsRNA into the cell via ASGPR-mediated cellular endocytosis. A GalNAc structure may comprise any number of GalNAc moieties. In some aspects, the GalNAc structure comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more GalNAc moieties. In some aspects, the GalNAc structure comprises 3 GalNAc moiety. In some aspects, the GalNAc structure is attached (e.g., conjugated) to the antisense strand of the dsRNA agent. In some aspects, the GalNAc structure is attached (e.g., conjugated) to the antisense strand of the dsRNA agent, e.g., at the 3' end or the 5' end of the antisense strand. In some aspects, the GalNAc structure is attached (e.g., conjugated) to the sense strand of the dsRNA agent. In some aspects, the GalNAc structure is attached (e.g., conjugated) to the sense strand, e.g., at the 3' end or the 5' end. In some aspects, the GalNAc structure is attached as shown in FIGs. 4A-4D.

[0086] Any of a variety of GalNAc structures can be used in accordance with the present disclosure. Table 8 depicts the chemical structures of non-limiting examples of GalNAc structures which may be included in dsRNA agents disclosed herein.Table 8. Exemplary structures of GalNAc clustersDepicted structures may show linkers / scaffolds used to attach GalNAc structures to oligonucleotides and / or attachment point on GalNAc structures to oligonucleotides

[0087] In some aspeects, the dsRNA agent comprises a GalNAc cluster, wherein the GalNAc cluster comprises a structure of Formula I, Formula II, Formula III, and / or Formula IV. In some aspeects, the dsRNA agent comprises a GalNAc cluster, wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III. In some aspeects, the dsRNA agent comprises a GalNAc cluster, wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV. In some aspeects, the dsRNA agent comprises a GalNAc cluster, wherein the GalNAc cluster comprises a structure of Formula I. In some aspeects, the dsRNA agent comprises a GalNAc cluster, wherein the GalNAc cluster comprises a structure of Formula II. In some aspeects, the dsRNA agent comprises a GalNAc cluster, wherein the GalNAc cluster comprises a structure of Formula III. In some aspeects, the dsRNA agent comprises a GalNAc cluster, wherein the GalNAc cluster comprises a structure of Formula IV.Pharmaceutical Compositions

[0088] Provided pharmaceutical compositions generally comprise a dsRNA agent as disclosed herein and a pharmaceutically acceptable carrier. As used herein, the terms “pharmaceutically acceptable carrier,” “pharmaceutically acceptable adjuvant,” “pharmaceutically acceptable excipient,” and “pharmaceutically acceptable vehicle” are used interchangeably and refer to a non-toxic carrier, excipient, adjuvant, or vehicle that does not destroy the pharmacological activity of the compound(s) with which it is formulated and facilitates delivery of the agent (e.g., dsRNA agent) to tissues and cells within a subject. Suitable carriers can be liquid or solid and are generally selected with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Such agents are well known in the art.

[0089] Typical pharmaceutically acceptable carriers include, by way of non-limiting example: water, saline solution, binding agents (e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose);, fillers (e.g., lactose and other sugars, gelatin, or calcium sulfate); lubricants (e.g., starch, polyethylene glycol, or sodium acetate), disintegrants (e.g., starch or sodium starch glycolate), and wetting agents (e.g., sodium lauryl sulfate).

[0090] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and otherdiseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for dsRNA agents of the disclosure can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model.

[0091] In certain aspects, pharmaceutical compositions disclosed herein comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing pharmaceutical compositions including those comprising hydrophobic compounds. In certain aspects, certain organic solvents such as dimethylsulfoxide are used.

[0092] In some aspects, the dsRNA agent is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, the dsRNA agent complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain aspects, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.

[0093] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.Methods of Treatment

[0094] Methods disclosed herein can be used to treat any of a variety of disorders that may benefit from upregulating fibrinolytic activity and / or down-regulating A2AP. By “benefit,” it is meant the disorder and / or its attendant symptoms is alleviated or abrogated.

[0095] Methods disclosed herein can be used to treat any of a variety of A2AP-associated disorders. By “A2AP-associated disorder,” it is meant any disorder for which increased risk of the disorder is associated with increased levels of A2AP. The increased levels of A2AP may be, but need not be, associated with a genetic mutation in a gene (e.g., A2AP or a gene encoding a polypeptide involved in regulation of plasminogen).

[0096] Non-limiting examples of disorders that may be treated using methods disclosed herein include plasminogen deficiency, venous thrombosis, venous thromboembolism, deep vein thrombosis, pulmonary embolism, prosthetic valve thrombosis, post-thrombotic syndrome, atherothrombosis, heart attack, stroke, fibrinolytic disorders, hypofibrinolysis,disfibrinolysis, ischemic stroke, atrial fibrillation, myocardial infarction, peripheral arterial disease, dynamic thrombosis, coronary artery disease, microvascular thrombosis, ischemic brain injury, brain swelling, brain hemorrhage and death after thromboembolic stroke. In some aspects, the disorder is plasminogen deficiency. In some aspects, the disorder is thrombosis.Routes of Administration

[0097] In some aspects, peptides or pharmaceutical compositions of the present disclosure are administered systemically. Systemic routes of administration include parenteral routes and enteral routes. In some aspects, peptides or pharmaceutical compositions thereof are administered by a parenteral route, for example, intravenously, intraarterially, intraperitoneally, subcutaneously, or intradermally. In some aspects, peptides or pharmaceutical compositions thereof are administered intravenously. In some aspects, peptides or pharmaceutical compositions thereof are administered subcutaneously. In some aspects, peptides or pharmaceutical compositions thereof are administered by an enteral route of administration, for example, trans-gastrointestinal, or orally.

[0098] In some aspects, peptides or pharmaceutical compositions thereof are administered locally, e.g., to the site of a wound.Methods of Making

[0099] dsRNA agents disclosed here may be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry”, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N. Y., USA.

[0100] For example, dsRNA agents may be produced by solid phase synthesis, optionally incorporating certain chemical modifications as disclosed herein. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

[0101] Teachings regarding the synthesis of particular modified oligonucleotides may be found in the following U. S. patents: U. S. Pat. Nos. 5,138,045 and 5,218,105, drawn to polyamine conjugated oligonucleotides; U. S. Pat. No. 5,212,295, drawn to monomers for the preparation of oligonucleotides having chiral phosphorus linkages; U. S. Pat. Nos. 5,378,825 and 5,541,307, drawn to oligonucleotides having modified backbones; U. S. Pat. No. 5,386,023,drawn to backbone-modified oligonucleotides and the preparation thereof through reductive coupling; U. S. Pat. No. 5,457,191, drawn to modified nucleobases based on the 3-deazapurine ring system and methods of synthesis thereof; U. S. Pat. No. 5,459,255, drawn to modified nucleobases based on N-2 substituted purines; U. S. Pat. No. 5,521,302, drawn to processes for preparing oligonucleotides having chiral phosphorus linkages; U. S. Pat. No. 5,539,082, drawn to peptide nucleic acids; U. S. Pat. No. 5,554,746, drawn to oligonucleotides having P-lactam backbones; U. S. Pat. No. 5,571,902, drawn to methods and materials for the synthesis of oligonucleotides; U. S. Pat. No. 5,578,718, drawn to nucleosides having alkylthio groups, wherein such groups may be used as linkers to other moieties attached at any of a variety of positions of the nucleoside; U. S. Pat. Nos. 5,587,361 and 5,599,797, drawn to oligonucleotides having phosphorothioate linkages of high chiral purity; U. S. Pat. No. 5,506,351, drawn to processes for the preparation of 2'-O-alkyl guanosine and related compounds, including 2,6-diaminopurine compounds; U. S. Pat. No. 5,587,469, drawn to oligonucleotides having N-2 substituted purines; U. S. Pat. No. 5,587,470, drawn to oligonucleotides having 3 -deazapurines; U. S. Pat. Nos. 5,223,168, and 5,608,046, both drawn to conjugated 4'-desmethyl nucleoside analogs; U. S. Pat. Nos. 5,602,240, and 5,610,289, drawn to backbone-modified oligonucleotide analogs; U. S. Pat. Nos. 6,262,241, and 5,459,255, drawn to, inter alia, methods of synthesizing 2'-fluoro-oligonucleotides.

[0102] To synthesize dsRNA agents which are conjugated to ligands, oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or using nucleotide or nucleoside conjugate precursors that already bear a linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear a ligand molecule, or non-nucleoside ligand-bearing building blocks.

[0103] When using nucleotide-conjugate precursors that already bear a linking moiety, synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. Oligonucleotide conjugates bearing a variety of molecules such as steroids, vitamins, lipids and reporter molecules, has previously been described. In some aspects, oligonucleotides or linked nucleosides are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0104] To synthesize dsRNA agents which incorporate certain chemical groups (e.g., 2'-O-methyl, 2'-O-ethyl, 2'-O-propyl, 2'-O-allyl, 2'-O-aminoalkyl or 2 '-deoxy -2 '-fluoro groups), functionalized nucleoside sequences possessing an amino group at the 5 '-terminus may be prepared using a DNA synthesizer, and then reacted with an active ester derivative of a selected ligand. Active ester derivatives are well known to those skilled in the art. Representative active esters include N-hydrosuccinimide esters, tetrafluorophenolic esters, pentafluorophenolic esters and pentachlorophenolic esters. Reaction of the amino group and the active ester produces an oligonucleotide in which the selected ligand is attached to the 5 '-position through a linking group. The amino group at the 5 '-terminus can be prepared utilizing a 5 '-AminoModifier C6 reagent. In some aspects, ligand molecules are conjugated to oligonucleotides at the 5 '-position by the use of a ligand-nucleoside phosphoramidite, wherein the ligand is linked to the 5 '-hydroxy group directly or indirectly via a linker. Such ligand-nucleoside phosphoramidites are typically used at the end of an automated synthesis procedure to provide a ligand-conjugated oligonucleotide bearing the ligand at the 5 '-terminus.EXAMPLES EXAMPLE 1: Design and synthesis of dsRNA agents

[0105] Candidate dsRNA agents were designed in silico based on match across human A2AP transcripts and predicted minimal off-target binding. Designed candidates varied in target region and included various chemical modifications, intemucleoside linkages, and a GalNAc cluster on the sense strand (either at the 5' end or the 3' end). Tables 4 and 7 list the sequences of the sense and anti-sense strands of the dsRNA agents, including chemical modifications and any GalNAc structures. In Table 3 and Table 6, dsRNA agents sequences are grouped by start positions within A2AP transcripts. Chemical synthesis was performed as follows:2,-modified oligoribonucleotide synthesis

[0106] Single stranded oligoribonucleotides were synthesized according to the conventional solid-phase oligonucleotide synthesis technology using the standard phosphoramidite-based oligomerization chemistry, whereby the oligonucleotides were assembled on solid support, employing a Mermade 96E synthesizer (LGC Bioautomation) in a 96 well format, controlled by the Poseidon software package.

[0107] Syntheses were performed on a solid support made of controlled pore glass (CPG). Specifically, guide strands were assembled on a 500 A universal solid support available fromBiocomma (#DSO5OO, porosity of 500 A). For passenger strands modified with a tri-antennary GalNAc-cluster based ligand on the 3'-end (L96-tri-N-acetylgalactosamine (GalNAc)-cluster (J. Am. Chem. Soc. 2014, 136, 16958)), synthesis was performed on the L96-GalNAc-cluster immobilised CPG solid support sourced from Primetech, Belarus (#0088-1000, porosity of 500 A, 41 pmol / g loading) or an immobilised CPG solid support sourced as follows: GalNAc-TEG CPG (or Gal3C2-cluster (Bioconj. Chem. 2018, 29, 2478)) from LGC Biosearch Technologies (#BG7-999-B, porosity of 500 A, 42 pmol / g loading) or mono-GalNAc-TEG CPG from Hongene, Hamburg (#ON-431, porosity of 500 A, 49 pmol / g loading)

[0108] All 2'-modified RNA phosphoramidites as well as majority of the ancillary reagents were purchased from SAFC, Proligo, Sigma Aldrich (now Merck, Hamburg, Germany). Specifically, the following 2'-O-Methyl phosphoramidites were used: (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5'-O-dimethoxytrityl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidites, the 2’-deoxy phosphoramidites [for DNA units 2'-deoxythymidine (instead of uridine) was used], the 2'-O-(2-methoxyethyl) phosphoramidites [for MOE units thymidine (instead of uridine) and N4-(benzoyl)-5-methylcytidine (instead of cytidine) derivatives were used], and the ( )-glycol nucleic acid (GNA) phosphoramidites (procured from Hongene, Hamburg) carried the same protecting groups as the 2'-O-methyl RNA amidites, if not otherwise mentioned. In addition to these, the 5'-(E)-vinyl phosphonate-2'-OMe-U (POM protected) phosphoramidite was purchased from Hongene, Hamburg.

[0109] To synthesize passenger strands modified with GalNAc ligand on the 5'-end, the terminal GalNAc-modifications were incorporated using their respective phosphoramidites as follows: GalNAc-TEG from Gal3C2 phosphoramidite sourced from Hongene, Hamburg (#OP-199), mono-GalNAc-TEG (as a trimer) from TEG-GalNAc Cluster amidite sourced from Hongene, Hamburg (#OP-123). Amidite solutions (50 mM) used were prepared from the respective amidites, as commercially sourced, in anhydrous acetonitrile and molecular sieves (3 A, 8-12 mesh, Car Roth, #N893.1) were added.

[0110] 5-Ethyl thiotetrazole (ETT, 500 mM in acetonitrile, 99.8%, Biosolve #0022112402BS) was used as activator solution. Coupling times were 5 minutes. In order to introduce phosphorothioate linkages a 100 mM solution of 3-Amino-l,2,4-dithiazole-5-thione (obtained from TCI Chemicals, Germany, (Purity: > 96.0%(HPLC) cas: 6846-35-1)) dissolved in ACN-pyridine (2:3 v / v) was employed as sulfurizing agent. The other ancillary reagents used were as follows: lodine-Oxidizer (50 mM 12 (in Pyridine-H2O (9:1 v / v))), DCA (3% in toluene) for deblocking, Cap A (Acetic anhydride in THF (9.1:90.9 v / v)) and Cap B (THF, N-Methylimidazole and Pyridine (8:1:1 v / v / v) as capping agents. Oligonucleotides were all synthesized with the removal of the final DMT protecting group (“DMT-Off ’).[OHl] For the sense strands conjugated with triantennary GalNAc3 -cluster at 3'- or 5'-end, the precursor strands comprising respective aminohexyl-linker (NH2C6) were synthesized. The (NH2C6)-linker was incorporated at the 5'-end using the TFA-aminohexyl-linker phosphoramidite sourced from ChemGenes (MA, USA, #CLP-1553); whereas at the 3'-end it was incorporated by using the pthalamidyl protected aminohexyl-linker immobilized 500 A CPG solid support available from LGC Biosearch Technologies (#BG7-1048, 86 pmol / g loading).Cleavage and deprotection of support bound oligomer

[0112] After finalization of the solid phase synthesis, oligonucleotides were cleaved from the solid support by addition of AMA (1: 1 (v / v) mixture of concentrated aqueous ammonia and 40% aqueous methylamine, both available from Sigma Aldrich) and collected in 96 well plates. To achieve quantitative removal of all the protecting groups, the solutions were incubated with shaking at 33 °C. For 2'-O-MOE-5Me-C comprising oligos, AMA was replaced by ammoniaethanol (3: 1 (v / v), both available from Sigma Aldrich). The sample solutions were then dried under reduced pressure (SpeedVac concentrator (ThermoFisher)) and solid residues were thereafter reconstituted in 250 mM Tris(hydroxymethyl)aminomethane (TRIS) (pH 7.0) to yield crude sample solutions for subsequent purification.Purification of oligoribonucleotides

[0113] Crude preparations were purified by Anion Exchange (AEX) HPLC Chromatography using a Dionex DNA PaclOO (9 x 250 mm)-column (ThermoFisher, Dreieich, Germany) on an AKTA Purifier system (GE Healthcare, Freiburg, Germany) equipped with an auto-sampler (A905) and a fraction collector (Frac-950). Buffer A was 20 mM TRIS pH 7.4and contained 20% acetonitrile and buffer B contained 500 mM sodium perchlorate in buffer A. A flow rate of 5 mL / min and a gradient starting from 10% to 100% buffer B within 15 column volumes (CV) was employed. UV traces at 260 and 280 nm were recorded to monitor product elution. Appropriate fractions were pooled and precipitated overnight in the freezer using 3M NaOAc, pH 5.2 in ethanol (1:32 v / v). Pellets were collected by centrifugation and reconstituted in purified water. The purified sense and antisense strands were quantified by measuring the UV absorption at 260 nm. Subsequently, the materials were analysed for identity (+ / -0.05% of calculated molecular weight (by ESI-MS)) and purity (single strand purity > 85%, as per integration of the UV signal of the analytical AEX trace).GalNAc3-Coniugation onto the sense strands

[0114] The per-acetylated free-acid derivative of the triantennary GalNAc cluster (GalNAc3-free acid) was prepared pursuing disclosures from Hadwiger et al., Patent number US 9,796,756 B2. For GalNAc3-conjugations to the free (NH2C6)-linker on the 5'- or 3'-terminal of the sense strands, the free acid derivative was activated by conversion to the NHS-ester (GalNAc3-NHS) followed by conjugation onto (NH2C6)-modified sense strands following published protocol (Nucleic Acid Ther. 2019, 29, 231).Annealing of oligoribonucleotides to generate siRNA

[0115] The purified complementary strands were then mixed in an equimolar ratio and dried in a SpeedVac concentrator. Subsequently, they were formulated in annealing buffer (40 mM NaH2PO4 H2O + Na2HPO4 buffer, pH 6.8, 0.2 M NaCl) and annealed (duplex solutions were placed into a water bath at 70 °C, which was subsequently cooled to room temperature within 3 h) to yield desired amount of the siRNAs required for follow-up experiments. The resultant siRNA-duplexes were characterized by size-exclusion chromatography (SEC) for purity (duplex purity > 90%, as per integration of the UV signal of the analytical SEC trace).EXAMPLE 2: In vitro screening of dsRNA agents in Hep3B and Primary Human Hepatocytes

[0116] dsRNA agents were screened for ability to reduce human A2AP (SERPINF2) mRNA levels in Hep3B cells. In the Hep3B cells, dsRNA agents were tested at two different doses. Further characterization of dsRNA agents was performed by direct incubation in primary human hepatocytes (PHH) at ten different doses.Characterization of dsRNA agents in Hep3B cells:

[0117] After testing a panel of 43 human cell lines on a sufficient (at least 15-20 fold above background relative luminescence units (RLUs)) expression level for human A2AP (SERPINF2), Hep3B cells were identified as being a good in vitro model for the initial characterization of dsRNA agents.

[0118] Hep3B cells were obtained from ATCC (ATCC in partnership with LGC Standards, Wesel, Germany, cat.# ATCC-HB-8064) and cultured in MEM Eagle (PAN #P04-08050) supplemented to contain 10% fetal calf serum (#1248D, Biochrom GmbH, Berlin, Germany), 100 U / ml Penicillin / 100 pg / ml Streptomycin (#A2213, Biochrom GmbH, Berlin, Germany) and 2 mM L-Glu (K0283, Biochrom GmbH, Berlin, Germany), at 37 °C in an atmosphere with 5% CO2 in a humidified incubator. For transfection of Hep3B cells with siRNAs, cells were seeded at a density of 15,000 cells / well into 96-well tissue culture plates (#655180, GBO, Germany).

[0119] Transfection of dsRNA agents was carried out with Lipofectamine RNAiMax (Invitrogen / Life Technologies, Karlsruhe, Germany) according to manufacturer’s instructions for reverse transfection. The dual dose screen was performed with dsRNA agents in quadruplicates at 10 nM and 0.1 nM, with siRNAs targeting AHSA1, Firefly-Luciferase and Renilla-Luciferase as unspecific controls and a mock transfection. After 24h of incubation with dsRNA agents, medium was removed and cells were lysed in 150 pl Medium-Lysis Mixture (1 volume lysis mixture, 2 volumes cell culture medium) and then incubated at 53 °C for 30 minutes. Quantigene Singleplex (bDNA; ThermoFisher Scientific) assay was performed according to manufacturer’s instructions with a probeset directed to human SERPINF2 (accession-# NM_000934), which had been designed by ThermoFisher Scientific and synthesized by Metabion International AG, Planegg, Germany. Luminescence was read using 1420 Luminescence Counter (WALL AC VICTOR Light, Perkin Elmer, Rodgau-Jugesheim, Germany) following 30 minutes incubation at room temperature in the dark.

[0120] The AHSA1 siRNA served as an unspecific control for SERPINF2 target mRNA expression and as positive control for transfection efficiency with regards to AHSA1 mRNA level. By hybridization with an AHSA1 probeset, mock transfected cells served as controls for AHSA1 mRNA level. Transfection efficiency for each 96-well plate and both doses in the dual dose screen was calculated by relating the AHS Al -levels in cells treated with AHSA1 siRNA (normalized to GAPDH) to AHSA1 levels in mock-transfected cells.

[0121] For each well, the target mRNA level was normalized to the respective GAPDH mRNA level also determined using the Quantigene Singleplex assay. The activity of a given dsRNA agent was expressed as percent of mRNA concentration of the respective target (normalized to GAPDH mRNA) in treated cells, relative to the target mRNA concentration (normalized to GAPDH mRNA) averaged across control wells. The results from dual-dose titration of dsRNA agents at 10 and 0.1 nM in Hep3B cells are shown in Table 9. The results from dual-dose titration of dsRNA agents at 1 and 0.01 nM in Hep3B cells are shown in Table 10.Characterization of dsRNA agents in cryopreserved human primary hepatocytes:

[0122] Human cryopreserved primary hepatocytes were purchased from Primacyt (Schwerin, Germany, Lot# CHM2221). Directly before treatment, cells were thawed, transferred to a tube with Thawing medium (Primacyt, cat#HTM), centrifuged and washed with Washing Medium (Primacyt, cat#HWM). Cells were seeded at a density of 80,000 cells per well in Plating medium (Primacyt, cat#MPM-cryo) on collagen coated 96-well plates (Greiner-Bio-One, #655150). Directly after seeding, cells were treated with the dsRNA agents as they adhered as a monolayer in plating medium. Each dsRNA agent was applied to the cells as dose response curve with sequential 4-fold dilution steps. Each concentration was applied in quadruplicate. After 5 hours, the medium was changed to maintenance medium (Primacyt cat#HHMM). The medium was changed every 24 hours and the cells were harvested for analysis by the Quantigene Singleplex assay 48 hours after seeding.

[0123] For each well, the A2AP (SERPINF2) mRNA level was normalized to the respective GAPDH mRNA level. The activity of a given A2AP dsRNA agent was expressed as percent A2AP (SERPINF2) mRNA concentration (normalized to GAPDH mRNA) in treated cells, relative to the A2AP (SERPINF2) mRNA concentration (normalized to GAPDH mRNA) averaged across control wells.

[0124] The half maximal inhibitory concentration (ICso) was determined using a 4 parameter logistic model with the formula Y=bottom+(top-bottom) / (l+(IC50 / X)AHillslope) and with Top constrained to a value of 100%. ICso (80% inhibitory concentration) was calculated from ICso using the formula IC_F=[(F / (100-F))A(l / H)]xIC50, where F is the percentage inhibition and H is the hill slope. The ICso values and maximum knockdown percentages from full-titration of dsRNA agents in primary human hepatocytes (PHH) are shown in Table 9.Table 9. Residual level of SERPINF2 / GAPDH in Hep3B cells at indicated concentrations of dsRNA agent (value indicates % of message remaining)Hep3B Hep3B Hep3B Hep3B Duplex IDXOnM (mean) XOnM (SD) O.lnM (mean) O.lnM (SD) 3-1 6.90 2.30 21.30 0.70 3-3 17.24 4.15 21.35 2.66 3-5 19.48 1.79 25.00 2.39 3-4 44.69 4.07 30.76 3.58 3-6 42.25 4.06 30.85 3.91 3-7 24.12 1.66 25.24 4.90 3-8 33.15 9.10 40.83 7.31 3-9 13.43 1.38 19.92 4.02 3-10 12.39 1.10 22.13 2.99 3-2 39.70 1.46 32.32 4.03 3-12 17.97 1.26 24.19 7.11 3-13 6.50 1.20 33.50 4.30 3-15 11.07 1.31 21.29 0.85 3-17 11.33 0.54 17.38 1.49 3-16 11.75 1.64 20.40 2.04 3-18 13.24 1.35 18.86 3.47 3-19 20.60 2.27 26.80 1.59 3-20 16.04 3.02 26.26 5.64 3-21 9.52 0.77 19.11 3.36 3-22 14.40 2.65 32.20 5.81 3-14 13.51 0.71 19.82 3.32 3-25 11.95 0.80 18.63 6.99 3-26 7.10 1.10 15.60 1.80 3-28 12.56 1.58 16.16 2.27 3-30 13.09 0.46 17.10 1.95 3-29 12.24 1.08 16.17 2.26 3-31 14.28 0.84 16.11 1.07 3-32 9.53 1.45 16.42 1.49 3-33 11.59 2.14 14.85 1.50 3-34 10.00 0.75 15.62 1.77Hep3B Hep3B Hep3B Hep3B Duplex IDXOnM (mean) XOnM (SD) O.lnM (mean) O.lnM (SD) 3-35 20.06 3.15 19.97 2.50 3-27 14.07 0.79 14.04 1.91 3-36 17.64 1.06 18.74 1.70 3-37 12.70 2.10 38.60 2.90 3-40 16.80 5.40 15.40 1.80 3-42 21.76 2.27 21.39 1.04 3-44 25.00 2.12 20.47 2.95 3-43 20.73 2.14 22.02 2.17 3-45 23.68 3.87 20.64 2.11 3-46 18.91 1.43 19.29 1.79 3-47 42.90 7.73 49.66 7.58 3-48 17.99 2.65 23.16 2.50 3-49 21.54 3.92 36.12 5.48 3-41 22.14 0.95 21.48 3.14 3-52 23.07 0.81 17.29 1.17 3-53 10.30 2.20 26.00 1.60 3-56 11.30 6.00 23.10 5.80 3-58 9.90 0.80 42.60 7.50 3-62 6.30 0.60 22.20 7.20 3-64 12.92 1.07 17.44 1.18 3-66 13.78 1.23 18.14 1.10 3-65 13.50 0.90 19.40 3.72 3-67 14.98 1.28 18.35 2.06 3-68 11.63 1.02 18.06 1.71 3-69 11.40 1.81 15.38 3.52 3-70 10.31 1.39 17.13 1.92 3-71 17.25 3.72 54.26 6.55 3-63 16.55 1.50 21.26 1.46 3-72 16.03 1.31 16.95 2.50 3-73 6.50 1.70 13.70 5.70 3-75 13.91 1.37 14.70 1.05 3-77 13.53 1.44 17.38 1.16Hep3B Hep3B Hep3B Hep3B Duplex IDXOnM (mean) XOnM (SD) O.lnM (mean) O.lnM (SD) 3-76 13.51 2.21 18.06 3.18 3-78 14.49 0.71 18.71 1.43 3-79 9.50 1.14 20.63 1.90 3-80 13.26 2.30 22.09 2.90 3-81 13.29 1.07 23.89 2.25 3-82 12.07 2.18 15.77 1.70 3-74 15.80 1.44 14.27 0.76 3-85 17.15 0.62 14.50 0.60 3-86 3.10 0.40 13.90 4.30 3-88 7.71 0.80 12.21 1.46 3-90 7.23 1.11 13.12 0.67 3-89 8.61 0.93 14.65 2.44 3-91 9.26 0.52 13.36 0.43 3-92 8.63 0.80 13.30 1.06 3-93 10.61 1.95 14.45 1.26 3-94 9.42 1.05 13.07 1.03 3-95 7.31 1.43 12.90 0.73 3-87 9.35 0.25 12.70 1.04 3-98 10.22 1.73 11.42 0.64 3-99 7.10 2.30 11.50 3.50 3-107 17.87 2.75 16.38 0.85 3-109 15.19 0.38 16.47 1.02 3-108 16.57 0.74 16.90 1.91 3-110 16.43 0.49 14.87 2.03 3-111 14.67 2.46 13.47 1.66 3-112 15.23 2.54 17.04 0.41 3-113 13.70 1.40 13.56 0.93 3-114 13.27 4.06 13.05 0.79 3-106 18.00 0.97 16.78 3.36 3-118 17.23 3.74 13.88 2.89 3-119 7.70 0.80 28.20 10.50 3-121 20.59 1.51 25.05 2.66Hep3B Hep3B Hep3B Hep3B Duplex IDXOnM (mean) XOnM (SD) O.lnM (mean) O.lnM (SD) 3-123 20.84 0.91 29.07 4.98 3-122 21.55 2.20 33.74 8.83 3-124 22.58 2.18 28.16 2.32 3-125 19.51 3.57 36.48 2.97 3-126 22.57 5.62 47.55 8.55 3-127 23.37 4.16 51.75 5.33 3-128 14.74 2.57 27.13 2.07 3-120 23.17 0.56 23.21 2.32 3-131 23.47 0.64 22.54 0.92 3-132 7.30 1.20 38.00 12.30 3-134 18.21 2.13 29.97 1.49 3-136 17.53 3.04 31.89 2.71 3-135 24.99 2.03 46.16 5.58 3-137 25.80 0.43 41.20 5.65 3-138 45.68 3.80 56.77 4.94 3-139 70.18 12.03 80.51 9.15 3-140 39.57 2.33 51.68 3.73 3-141 18.39 2.13 45.38 2.79 3-133 22.34 2.93 38.59 2.54 3-143 18.27 4.93 27.62 2.71Table 10. Residual level of SERPINF2 / GAPDH in Hep3B at indicated concentrations of dsRNA agent (value indicates % of message remaining)Hep3B Hep3B Hep3B Hep3B Duplex IDInM (mean) InM (SD) O. OlnM (mean) O. OlnM (SD) 3-99 15.99 1.51 49.26 0.55 6-1 51.88 2.43 118.30 4.90 6-2 28.49 0.58 114.87 6.67 6-3 100.19 2.51 120.05 3.49 6-4 52.56 3.75 111.14 6.04 6-5 107.29 4.33 115.50 7.70 6-6 50.45 3.77 122.57 6.78Hep3B Hep3B Hep3B Hep3B Duplex IDInM (mean) InM (SD) O. OlnM (mean) O. OlnM (SD) 6-7 15.28 1.13 105.99 6.71 6-8 95.06 8.10 121.26 7.60 6-9 227.56 17.22 120.28 5.45 6-10 81.48 2.80 120.48 2.22 6-11 97.89 10.80 103.11 9.86 6-12 81.23 6.15 99.01 10.29 6-13 84.51 7.46 98.84 12.01 6-14 64.67 7.65 91.47 10.27 6-15 53.85 7.77 95.37 9.25 6-16 74.77 7.11 98.85 15.10 6-17 80.00 5.09 104.81 7.22 6-18 69.25 5.77 104.06 20.35 6-19 37.77 4.40 97.14 8.62 6-20 59.60 11.21 107.23 12.74 6-21 32.15 2.37 96.17 5.28 6-22 85.80 4.17 101.07 3.77 6-23 94.94 4.33 99.79 4.17 6-24 94.81 1.59 100.74 2.32 6-25 43.83 3.46 96.81 2.84 6-26 96.55 1.68 103.20 2.01 6-27 43.76 1.35 102.91 3.41 6-28 30.72 1.11 94.39 2.23 6-29 16.75 2.16 80.73 7.58 6-30 33.47 1.35 90.77 3.20 6-31 41.05 3.28 96.66 0.44 6-32 28.62 2.16 97.83 3.87 6-33 15.95 0.48 61.78 3.04 6-34 15.14 0.56 61.96 1.61 6-35 52.61 5.19 93.52 2.52 6-36 94.72 3.37 98.57 4.23 6-37 24.64 1.11 76.93 12.45 6-38 24.06 0.38 89.92 5.45Hep3B Hep3B Hep3B Hep3B Duplex IDInM (mean) InM (SD) O. OlnM (mean) O. OlnM (SD) 6-39 19.88 1.45 76.26 3.79 6-40 21.34 2.35 80.08 2.89 6-41 38.94 2.07 98.80 2.17 6-42 58.67 1.46 103.88 2.74 6-43 29.56 2.51 100.10 1.75 6-44 90.89 2.75 104.77 2.30 6-45 61.07 2.97 109.26 6.27 6-46 94.86 3.05 105.50 2.86 6-47 86.07 3.05 106.07 6.85 6-48 78.49 3.14 103.53 2.87 6-49 96.93 2.73 97.65 3.03 6-50 106.42 2.74 99.48 5.05 6-51 88.37 2.58 103.27 1.70 6-52 72.07 2.06 102.94 2.77 6-53 74.18 1.47 101.24 5.72 6-54 75.10 4.49 99.91 4.67 6-55 31.82 2.71 100.34 5.41 6-56 53.68 5.02 98.49 3.21 6-57 59.32 1.71 97.66 3.06 6-58 18.83 0.45 81.39 4.54 6-59 19.78 0.91 80.61 6.98 6-60 33.58 3.28 90.32 4.60 6-61 62.75 3.03 101.45 2.80 6-62 57.56 1.80 98.18 1.22 6-63 103.37 3.88 98.30 4.09 6-64 66.75 4.82 99.73 6.89 6-65 66.08 2.45 98.60 7.35 6-66 100.03 6.52 96.38 4.82 6-67 98.58 1.12 101.05 8.65 6-68 64.40 6.15 101.66 7.17 6-69 73.91 3.73 101.03 7.79 6-70 98.38 4.58 102.51 3.22Hep3B Hep3B Hep3B Hep3B Duplex IDInM (mean) InM (SD) O. OlnM (mean) O. OlnM (SD) 6-71 102.00 4.79 100.95 3.62 6-72 105.80 6.04 101.32 3.57 6-73 94.62 5.87 96.36 5.48 6-74 17.02 1.27 81.92 3.72 6-75 17.83 1.24 69.93 3.38 6-76 20.45 0.88 84.47 2.25 6-77 16.30 0.32 55.20 6.08 6-78 39.05 3.82 98.23 3.44 6-79 94.40 5.70 98.22 1.70 6-80 34.44 3.87 93.51 5.72 6-81 65.76 6.21 107.69 6.36 6-82 90.03 4.08 112.92 4.40 6-83 21.59 1.24 102.11 2.69 6-84 43.84 1.86 113.77 4.90 6-85 92.44 8.48 117.38 4.11 6-86 81.80 2.22 113.88 3.34 6-87 37.68 1.72 112.46 5.51 6-88 100.81 11.61 115.14 4.21 6-89 63.18 2.51 116.66 3.43 6-90 98.42 3.73 117.41 4.03 6-91 29.69 2.95 88.84 9.45 6-92 32.31 2.87 92.51 11.25 6-93 32.95 1.23 89.80 8.68 6-94 47.65 0.65 91.84 11.22 6-95 32.35 3.78 99.88 1.19 6-96 11.97 1.61 53.65 9.52 6-97 10.99 0.70 65.97 10.15 6-98 11.58 3.86 69.41 9.15 6-99 88.49 9.45 90.18 6.86 6-100 31.92 1.97 102.37 4.77 6-101 12.04 0.64 64.36 4.71 6-102 48.54 2.03 95.74 2.48Hep3B Hep3B Hep3B Hep3B Duplex IDInM (mean) InM (SD) O. OlnM (mean) O. OlnM (SD) 6-103 27.95 4.13 83.96 4.48 6-104 14.48 1.22 80.77 3.94 6-105 67.85 4.90 82.21 6.22 6-106 19.33 2.42 81.10 2.75 6-107 37.52 3.54 85.54 4.84 6-108 78.55 7.99 86.76 6.19 6-109 33.87 3.36 86.91 7.48 6-110 64.81 4.36 86.77 4.75 6-111 88.59 5.49 94.16 4.49 6-112 93.54 12.04 93.45 6.13 6-113 63.18 3.17 88.66 5.25 6-114 58.51 2.46 84.15 9.92 6-115 49.88 2.30 86.16 2.79 6-116 55.69 2.53 87.28 1.37 6-117 93.26 6.58 87.28 2.73 6-118 98.24 7.74 80.71 5.24 6-119 89.85 5.39 88.25 9.95 6-120 95.74 2.73 86.64 4.35 6-121 94.43 7.16 99.60 8.01 6-122 92.94 3.87 99.83 2.68 6-123 70.96 2.63 98.73 4.33 6-124 89.43 0.76 98.85 3.45 6-125 97.27 8.07 105.33 8.54 6-126 82.83 0.75 99.30 6.37 6-127 101.73 5.78 97.78 4.20 6-128 92.22 2.40 95.83 3.18 6-129 91.46 4.73 101.39 5.40 6-130 76.27 3.08 92.95 8.71 6-131 14.41 1.21 65.36 5.00 6-132 17.56 0.85 95.16 6.13 6-133 36.61 1.68 92.01 7.54 6-134 36.32 4.15 93.89 8.85Hep3B Hep3B Hep3B Hep3B Duplex IDInM (mean) InM (SD) O. OlnM (mean) O. OlnM (SD) 6-135 16.08 1.91 95.34 10.84 6-136 46.50 1.12 89.26 9.55 6-137 19.12 1.89 64.76 6.12 6-138 81.85 4.86 94.72 7.44 6-139 39.05 2.05 87.95 7.48 6-140 74.04 2.64 97.05 8.99 6-141 92.04 2.31 109.28 6.55 6-142 84.14 4.50 106.67 7.60 6-143 58.83 2.51 92.90 2.88 6-144 80.87 2.64 95.60 2.09 6-145 48.98 2.47 96.19 6.43 6-146 63.60 1.43 99.28 6.25 6-147 64.20 4.78 97.72 6.09 6-148 87.06 2.20 98.79 2.23 6-149 85.90 2.23 97.04 3.60 6-150 83.76 1.71 97.85 3.98 6-151 86.12 3.16 102.49 0.95 6-152 79.77 4.73 100.03 6.75 6-153 42.32 3.07 100.65 4.64 6-154 83.06 1.36 103.04 5.62 6-155 87.33 7.40 105.13 3.09 6-156 86.23 5.39 105.61 4.00 6-157 85.78 5.24 109.77 2.39 6-158 65.41 1.78 105.79 3.19 6-159 58.77 2.40 102.36 10.99 6-160 54.04 1.17 96.84 2.28 6-161 71.59 5.87 88.26 3.13 6-162 45.88 1.01 94.39 3.68 6-163 53.33 2.20 89.63 3.23 6-164 16.79 1.07 73.76 1.97 6-165 71.09 3.86 90.46 1.02 6-166 24.65 4.12 86.88 1.51Hep3B Hep3B Hep3B Hep3B Duplex IDInM (mean) InM (SD) O. OlnM (mean) O. OlnM (SD) 6-167 65.68 2.91 89.63 1.45 6-168 44.34 2.18 87.65 6.16 6-169 14.40 0.90 77.91 4.11 6-170 81.67 1.90 96.57 4.46 6-171 20.91 4.07 78.22 2.86 6-172 51.95 2.37 85.84 5.39 6-173 72.97 6.20 93.41 2.56 6-174 82.95 5.52 90.09 2.63 6-175 38.58 4.05 89.15 5.50 6-176 27.71 3.93 86.32 2.63 6-177 24.74 2.46 93.69 7.24 6-178 55.43 2.14 94.77 4.06 6-179 86.92 8.16 95.46 4.63 6-180 29.43 2.24 92.86 4.53 6-181 50.82 1.72 89.05 2.42 6-182 30.64 2.37 74.29 1.77 6-183 19.11 1.46 75.46 3.27 6-184 20.37 1.16 67.61 1.88 6-185 25.43 0.88 83.89 4.19 6-186 19.12 1.83 80.25 8.18 6-187 10.49 0.94 62.90 4.54 6-188 15.32 1.26 67.82 5.34 6-189 11.40 1.33 47.35 0.88 6-190 12.19 1.00 51.81 1.81 6-191 10.07 0.38 51.40 3.07 6-192 12.19 0.43 46.83 4.92 6-193 15.16 0.77 55.61 1.67 6-194 12.99 0.70 39.17 3.34 6-195 17.75 2.53 60.23 0.53 6-196 11.60 1.91 60.51 3.57 6-197 27.55 2.94 84.83 2.58 6-198 32.47 3.77 88.15 2.72Hep3B Hep3B Hep3B Hep3B Duplex ID1nM (mean) 1nM (SD) 0.01nM (mean) 0.01nM (SD) 6-199 87.28 3.30 100.60 7.66 6-200 88.14 1.20 98.09 4.26 6-201 91.52 6.32 94.65 2.94 6-202 80.99 2.04 91.26 4.38 6-203 44.84 1.94 87.29 5.94 6-204 17.47 0.77 71.22 4.46 6-205 16.81 0.33 68.53 3.53 6-206 17.43 1.50 77.51 2.14 6-207 26.08 0.76 83.11 3.40 6-208 31.50 3.59 82.23 3.06 6-209 38.64 1.73 87.57 5.39 6-210 57.57 2.60 87.67 3.14 6-211 24.27 1.22 85.70 1.71 6-212 35.71 0.78 88.83 5.13 6-213 53.01 1.85 94.36 6.63 6-214 61.89 2.61 90.18 1.67 6-215 37.48 2.32 90.51 4.40 6-216 68.36 2.12 97.10 6.20 6-217 52.96 2.88 97.30 5.48 6-218 77.78 1.47 95.79 3.95 6-219 84.43 3.21 97.80 1.82 6-220 91.29 3.62 96.62 2.34 6-221 93.31 5.04 104.61 5.36 6-222 52.08 2.57 99.01 6.21 6-223 74.69 4.98 99.74 4.60 6-224 50.29 3.98 96.90 5.45 6-225 20.92 0.98 90.39 4.52 6-226 18.16 2.08 80.23 3.21 6-227 22.93 1.35 86.47 8.99 6-228 52.97 6.62 95.52 5.27 6-229 21.81 1.89 91.34 6.31 6-230 18.65 1.40 80.56 2.24Hep3B Hep3B Hep3B Hep3B Duplex ID1nM (mean) 1nM (SD) 0.01nM (mean) 0.01nM (SD) 6-231 52.09 2.44 90.25 5.06 6-232 19.34 1.48 53.41 5.69 6-233 18.29 1.99 56.99 3.91 6-234 88.58 4.88 103.43 7.01 6-235 85.93 4.98 95.53 2.21 6-236 82.87 4.38 96.35 11.20 6-237 19.83 2.17 69.84 4.90 6-238 12.81 1.44 47.02 9.33 6-239 13.56 1.31 55.95 1.32 6-240 14.35 1.52 36.63 2.71 6-241 83.63 4.90 72.32 10.57 6-242 86.26 6.68 43.48 2.24 6-243 65.58 5.64 50.40 5.65 6-244 77.82 7.47 54.76 5.60 6-245 86.12 2.20 75.11 6.32 6-246 68.54 3.85 62.04 7.04 6-247 83.77 7.14 72.67 3.59 6-248 77.09 1.40 81.38 9.05 6-249 78.94 4.85 90.89 3.92 6-250 70.20 5.11 80.76 4.44Table 11. Parameters estimated from full titration of dsRNA agents in PHHs PHH PHHDuplex IDIC50(nM) max knockdown (%) 3-1 5.37 83.093-12 56.23 68.443-11 29.11 81.233-13 9.80 82.143-15 10.26 83.423-24 N / A 24.183-23 74.75 56.813-25 17.44 59.43PHH PHH Duplex IDIC50(nM) max knockdown (%) 3-26 1.25 89.40 3-28 14.26 77.72 3-29 18.99 66.74 3-32 6.73 70.73 3-27 15.17 75.95 3-36 11.43 76.47 3-37 23.57 76.03 3-39 189.97 57.97 3-38 42.30 3-40 17.18 78.46 3-42 15.39 73.63 3-51 N / A 18.10 3-50 N / A 24.97 3-53 25.53 72.88 3-55 730.32 55.60 3-54 99.61 62.78 3-56 3.94 74.31 3-57 15.38 75.35 3-58 27.79 71.97 3-61 N / A 46.82 3-60 802.25 52.72 3-59 N / A 26.39 3-62 10.40 85.54 3-70 22.35 79.51 3-72 11.93 83.61 3-73 4.68 86.86 3-75 5.22 85.72 3-84 77.49 70.11 3-83 N / A 42.72 3-74 5.04 83.54 3-85 7.23 86.39 3-86 2.96 84.90PHH PHH Duplex IDIC50(nM) max knockdown (%) 3-88 5.22 84.32 3-90 5.62 83.11 3-97 189.06 62.31 3-96 N / A 29.33 3-92 6.08 81.72 3-95 13.22 79.55 3-87 6.89 84.66 3-98 1.94 85.07 3-99 6.75 88.22 3-107 3.48 87.37 3-110 12.18 80.07 3-111 7.85 85.47 3-114 2.67 89.55 3-117 25.36 80.68 3-118 N / A 54.04 3-106 10.81 85.26 3-118 4.35 86.52 3-115 114.48 67.93 3-105 68.16 86.60 3-102 5.25 86.82 3-100 10.12 86.77 3-104 2.50 86.22 3-103 2.41 87.63 3-101 3.49 86.36 3-119 7.87 87.09 3-121 23.98 79.29 3-130 N / A 26.60 3-129 N / A 0.003-132 6.57 72.97 3-134 147.18 60.56 3-142 N / A 3.996-33 61.02 72.43PHH PHH Duplex IDIC50(nM) max knockdown (%) 6-34 76.38 80.56 6-75 54.24 84.93 6-77 133.85 78.50 6-96 211.53 80.88 6-97 107.26 82.78 6-101 378.17 70.88 6-131 63.96 83.45 6-187 131.76 78.92 6-189 19.55 86.85 6-190 23.42 85.30 6-191 77.85 83.13 6-192 26.85 87.55 6-193 36.58 82.08 6-196 62.98 82.95 6-205 103.79 81.24 6-232 97.30 78.85 6-238 96.54 82.76 6-239 48.89 81.65 6-240 13.85 83.83 6-242 16.61 86.50 6-243 13.54 85.78 6-244 52.18 83.50 6-246 44.96 81.43EXAMPLE 3: In vitro surrogate analysis of dsRNA agents in cryopreserved murine primary hepatocytes

[0125] The activity of dsRNA agents with predicted cross-reactivity to mouse A2AP (SERPINF2) was further characterized for their ability to reduce mouse A2AP mRNA levels in murine primary hepatocytes.

[0126] Cryopreserved murine hepatocytes were purchased from Primacyt (Schwerin, Germany; Lot# MH230403). Directly before treatment, cells were thawed, transferred to a tube with Thawing medium (Primacyt, cat#HTM), centrifuged and washed with Washing Medium(Primacyt, cat#HWM). Cells were seeded at a density of 40,000 cells per well in Plating medium (Primacyt, cat#MPM-cryo) on collagen coated 96-well plates (Greiner-Bio-One, #655150). Directly after seeding, cells were treated with the dsRNA agents as they adhered as a monolayer in plating medium. Each dsRNA agent was applied at defined concentrations to the cells in quadruplicates. After 5 hours, the medium was changed to maintenance medium (Primacyt cat#HHMM). The medium was changed every 24 hours and cells were harvested for analysis by Quantigene Singleplex 48 hours after seeding.

[0127] For each well, the SERPINF2 mRNA level was normalized to the respective GAPDH mRNA level. The activity of a given SERPINF2 dsRNA agent was expressed as percent SERPINF2 mRNA concentration (normalized to GAPDH mRNA) in treated cells, relative to the SERPINF2 mRNA concentration (normalized to GAPDH mRNA) averaged across control wells.EXAMPLE 4: Evaluation of pharmacokinetics and pharmacodynamics of dsRNA agents in mouse

[0128] The in vivo activity of an A2AP dsRNA agents with mouse cross-reactivity was evaluated in a mouse single-dose study. Doses of 3 mg / kg and 10 mg / kg of A2AP dsRNA agent (Duplex ID 3-99; SEQ ID NOs: 184 and 185) or PBS were administrated subcutaneously to C57BL / 6 mice (3 per group) at day 0. Blood samples were collected at day -1 (pre-dose), day 3 and day 7. Intermediated blood draws were done via vena facialis and final blood draw by cardiac puncture. Blood was directly transferred to Mini-Collect K2-EDTA Plasma tubes (Greiner Bio-ONE) and within 30 min after collection, tubes were spun at 1000 g for 15 min. Supernatants were transferred to new tubes and stored at -20°C until using them for ELISA assays. Levels of A2AP were measured in the plasma samples by ELISA (Innovative Research; Catalog: IMSA2APKTT). Following termination of mice at day 7, livers were isolated and A2AP mRNA measured. In short, liver pieces, approximately 50-100 mg each, were dissected, snap-frozen in liquid nitrogen, and stored at -80°C until lysis. The liver pieces were transferred to precooled 1.5 mL vials, and 1 mL of Tissue & Cell Lysis Buffer (Epicentre) containing 3.3 pL of Proteinase K (50 pg / pL, Epicentre) was added. The tissue was lysed directly by sonication (Bandelin HD2070) before thawing. Post-sonication, the lysates were incubated for 30 minutes on an Eppendorf thermomixer at 450 rpm. The lysates were vortexed and either stored at -20°C or directly applied to Quantigene plates. For measurement of both mouse A2AP and mouse GAPDH mRNA, the lysates were diluted 1:10 with a 1:3 diluted lysis mixture (partof the Quantigene kit, Thermo), and 10 pL of this dilution was applied to the Quantigene plate. The Quantigene assay was performed according to the manufacturer’s protocol. Results are shown in FIG. 1A and FIG. 1B.Evaluation of GalNAc clusters:

[0129] A series of GalNAc clusters were evaluated in the context of the 3-99 A2AP dsRNA agent yielding the following compounds: Duplex ID 3-99 (SEQ ID NO: 184 and 185), 3-100 (SEQ ID NO: 184 and 185), 3-101 (SEQ ID NO: 186 and 185), 3-102 (SEQ ID NO: 184 and 185), 3-103 (SEQ ID NO: 187 and 185), 3-104 (SEQ ID NO: 187 and 185), 3-105 (SEQ ID NO: 184 and 185). In vivo activity of the dsRNA agents was determined in C57BL / 6 mice with subcutaneous dosing of 3 mg / kg siRNA at day 0 to female C57BL / 6 mice (group size n = 4). Blood samples were taken at day -1 (pre-dose), 3, and 7. Intermediate blood draws were done via vena facialis and final blood draw by cardiac puncture. Blood was directly transferred to Mini-Collect K2-EDTA Plasma tubes (Greiner Bio-ONE) and within 30 min after collection, tubes were spun at 1000 g for 15 min. Supernatants were transferred to new tubes and stored at -20°C until further use. Levels of A2AP in the plasma samples were measured by ELISA (Innovative Research; Catalog: IMSA2APKTT). Following termination of mice at day 7, livers were isolated followed by measurement of mouse A2AP and GAPDH mRNA as described above. Results are shown in FIG. 2A and FIG. 2B.EXAMPLE 5: Effect of dsRNA agents on fibrinolytic activity in a mouse model of plasminogen deficiency

[0130] To evaluate the ability of A2AP knock-down to restore fibrinolytic activity in plasminogen deficiency, a study in mouse was conducted with initial siRNA-mediated plasminogen (PLG) knock-down to induce plasminogen deficiency followed by no further treatment (control Group 1) or administration of A2AP dsRNA agent (treatment Group 2). On day 1, control Group 1 and treatment Group 2 (15 female C57BL / 6JRj mice per group) received intravenously 0.1 mg / kg mouse PLG siRNA in LNP formulation as described by Strilchuk et al. (2024) Lipid nanoparticles and siRNA targeting plasminogen provide lasting inhibition of fibrinolysis in mouse and dog models of hemophilia A. Sci. Transl. Med. 16(735):eadh0027. On day 2, treatment Group 2 received an intravenous dose of 3 mg / kg A2AP dsRNA agent (Duplex ID 3-99; SEQ ID NO: 184 and 185). Mice in both groups were monitored for up to 9 days with daily blood collection.

[0131] Blood samples were drawn from the sublingual vein into Citrate MICRO VETTE® tubes. Terminal blood samples were collected from the heart and divided into multiple Citrate MICROVETTE® tubes. The samples were centrifuged at 3000 g for 10 minutes at 4°C to separate the plasma, which was then aliquoted into three portions and stored at -80°C until further analysis. Plasma levels of mouse PLG and A2AP were measured and the third aliquot used for measurement of fibrinolytic activity in the clot lysis assay as described below.Measurement of A2AP in mouse plasma samples:

[0132] A2AP levels in mouse plasma samples were quantified using a sandwich ELISA. The ELISA was prepared by coating of a 96-well plate with 50 pL (1 pg / mL) of a Alpha-2-antiplasmin antibody (LSBio, Catalog no. LS-C489238) diluted in DPBS (Gibco, Catalog no.14190169) over night at 4°C. Following a single wash of the plate with 300 pL Washing Buffer (PBS + 0.05% Tween20; Preparation: PBS-Tween tablet (Medicago, Catalog no. 09-9410-100) dissolved in 1-L distilled water per tablet), the plate was blocked by incubation with 80 pL blocking buffer (PBS containing 1% BSA; Preparation: 1% w / v BSA (Sigma-Aldrich, Catalog no. 7030) added to DPBS (Gibco, Catalog no. 14190169) and allowed to dissolve without agitation) for 1 hour at room temperature while shaking at 500 rpm. Before transfer of 50 pL of Standards, Blanks and Samples (standard curve: 20, 4, 2, 1, 0.5, 0.25, 0.125, 0.0625, 0.0312, 0.003 nM mouse A2AP; Innovative Research, Catalog no. IMSA2APHIS100UG) prepared in blocking buffer, the plate was washed one time with 300 pL Washing Buffer. Incubation of Standards, Blanks and Samples lasted for 1 hour at room temperature while shaking 500 rpm followed by a 1-hour incubation with 50 pL biotinylated anti-mSerpinF2 antibody for detection (2000-fold dilution in Blocking Buffer; RnD Systems, Catalog no. BAF1239). Before and after addition of detection antibody, the plate was washed 3 times with 300 pL Wash Buffer. Enhanced Streptavidin-HRP (50 pL of 15000-fold dilution in Blocking Buffer; Kementec, Catalog no. 4740N) was then added to all wells and incubated for 30 min at room temperature while shaking at 500 rpm followed by washing three times with Washing Buffer and then addition of an HRP -based chromogenic substrate (50 pL of TMB; SeraCare, Catalog no. 5120-0047). Following color development. ELISA Stop Solution (50 pL of IM H2SO4; Fisher Chemical, Catalog no. J / 8420 / PB15) was added to quench the reaction. Absorbance was measured on a SpectraMax i3x instrument at 450 nm with subtraction of the absorbance at 620 nm.Measurement of PLG in mouse plasma samples:

[0133] Plasminogen levels in mouse plasma samples were quantified using a sandwich ELISA. The ELISA was prepared by coating of a 96-well plate with 50 pL (1 pg / mL) of a Rabbit anti-mouse / rat plasminogen polyclonal affinity purified antibody (Innovative Research, Catalog no. IRBAMSPLGAPIOOUG) diluted in DPBS (Gibco, Catalog no. 14190169) over night at 4°C. Following a single wash of the plate with 300 pL Washing Buffer (PBS + 0.05% Tween20; Preparation: PBS-Tween tablet (Medicago, Catalog no. 09-9410-100) dissolved in 1-L distilled water per tablet), the plate was blocked by incubation with 80 pL blocking buffer (PBS containing 1% BSA; Preparation: 1% w / vBSA (Sigma-Aldrich, Catalog no. 7030) added to DPBS (Gibco, Catalog no. 14190169) and allowed to dissolve without agitation) for 1 hour at room temperature while shaking at 500 rpm. Before transfer of 50 pL of Standards, Blanks and Samples (standard curve: 20, 4, 2, 1, 0.5, 0.25, 0.125, 0.0625, 0.0312, 0.003 nM mouse plasminogen; Innovative Research, Catalog no. IMSPLG1MG) prepared in blocking buffer, the plate was washed one time with 300pL Washing Buffer. Incubation of Standards, Blanks and Samples lasted for 1 hour at room temperature while shaking 500 rpm followed by a 1-hour incubation with 50 pL biotinylated rabbit anti-mouse / rat plasminogen polyclonal fractionated antibody for detection (1000-fold dilution in Blocking Buffer; Innovative Research, Catalog no. IRBAMSPLGGF1MG biotinylated using Biotinylation kit; Abeam, Catalog no. ab201795). Before and after addition of detection antibody, the plate was washed 3 times with 300 pL Wash Buffer. Streptavidin-HRP (50 pL of 10000-fold dilution in Blocking Buffer; Thermo Scientific, Catalog no. N100) was then added to all wells and incubated for 30 min at room temperature while shaking at 500 rpm followed by washing three times with Washing Buffer and then addition of an HRP -based chromogenic substrate (50 pL of TMB; SeraCare, Catalog no. 5120-0047). Following color development ELISA Stop Solution (50 pL of IM H2SO4; Fisher Chemical, Catalog no. J / 8420 / PB15) was added to quench the reaction. Absorbance was measured on a SpectraMax i3x instrument at 450 nm with subtraction of the absorbance at 620 nm.Measurement of fibrinolytic activity in mouse plasma samples:

[0134] The lysis of a tissue factor (TF)-induced clot by exogenous tPA was studied by tracking turbidity changes during clot formation and subsequent lysis. Plasma (final concentration of 20%) was added to a microtiter plate and supplemented with human fibrinogen (Enzyme Research, catalog no. 1-574-288-2268; final concentration of 1.2 mg / ml). Afterincubation for 10 min at 37°C, tPA (Fitzgerald, catalog no. 30C-CP1109; final concentration of 15 nM) was added, followed by lipidated TF (final concentration of 0.2 pM) and CaCh (fincal concentration of 20 mM). After thorough mixing, turbidity was measured at 300 nm for 180 min at 37°C using a Spectramax 340 kinetic microplate reader (Molecular Devices Corporation). From the clot lysis profile, the 50% clot lysis time was calculated for each mouse plasma sample. The 50% clot lysis time was defined as the time interval between the midpoint of clear to maximum turbidity (which characterizes clot formation), to the midpoint of the maximum to clear turbidity (which characterizes the clot lysis). To ensure data quality, samples with a maximum absorbance below 0.075 absorbance units were excluded from the final dataset. This threshold was set to eliminate samples with insufficient clot formation.Results:

[0135] In control Group 1, administration of PLG siRNA resulted in a decrease in plasma levels of mouse PLG. Maximum effect was reached after day 5 with mean PLG levels around 14% of pre-dose followed by comparably reduced PLG levels from day 6 to end of study at day 9. In contrast, plasma levels of A2AP in the control Group 1 were similar from day 0 and to the end of the study. Consistent with the knock-down of mouse PLG, fibrinolytic activity started to decline at day 2 and from day 4 and until study end at day 9, no clot lysis was evident in the 180-min duration of the clot lysis assay (FIG.3A).

[0136] In treatment Group 2, mouse PLG plasma levels were comparable to control Group 1 with a mean PLG level around 25% of pre-dose at day 4, which was maintained until study end. After administration of A2AP dsRNA agent at day 2, plasma levels of A2AP declined over time and reached 35% at day 6 and 24% at the end of study on day 9. Consistent with the incomplete knock-down of A2AP at day 3 to 5 (plasma A2AP >50% of pre-dose levels), fibrinolytic activity was compromised due to the reduced levels of PLG and with no measurable clot lysis at all at day 4. From day 6 and until study-end where A2AP levels were <39% of predose levels, fibrinolytic activity was restored with clot lysis times at or close to the pre-dose range (FIG.3B)EXAMPLE 6: Evaluation of the Effect of 5'-vinylphosphonate modification on potency of A2AP knockdownEvaluation in primary human and mouse hepatocytes:

[0137] The effect of 5’-vinylphosphonate (5 ’-VP) modification on the antisense strand was evaluated by comparing the potency (IC50) of A2AP knockdown of dsRNA agents with or without this modification. Full titrations were performed in primary human (PHH) and mouse (PMH) hepatocytes as described in Example 2 and 3, respectively.

[0138] As shown in Table 12, the 5’-VP modification consistently improved the potency of A2AP knockdown in PHHs and PMHs.Table 12. Parameters estimated from full titration of dsRNA agents with or without 5’-vinylphosphonate (5’-VP) modification on the antisense strand in primary human (PHH) and mouse (PMH) hepatocytesPHH PMH PHH PMHDuplex 5’-VP max max Family ICID m50ICodification knockdown50knockdown (nM) (nM)(%) (%) 3-11 547 No 29.11 81.23 4.56 83.7 3-1 547 Yes 5.37 83.09 1.44 87.4 3-115 2207 No 114.48 67.93 1.98 86.0 3-99 2207 Yes 6.75 88.22 0.45 90.8Evaluation in C57BL / 6 mice:

[0139] The effect of the 5 ’-VP modification was also evaluated in C57BL / 6 mice following SC administration of 3 mg / kg of dsRNA agents as described in Example 4.

[0140] As shown in Table 13, the 5 ’-VP modification improved the in vivo activity of dsRNA agents seen as a greater reduction of A2AP plasma levels over time.Table 13. Plasma Levels of A2AP in percent (%) of the predose level after SC administration of 3 mg / kg dsRNA agent at day 0. Results are shown as mean ± SD (n = 3)Plasm Plasma Plasma Plasma Duplex 5’-VPFamily A2AP (%) A2AP (%) A2AP (%) A2AP (%) ID modificationPredose Day 1 Day 3 Day 7 3-11 547 No 100 ± 17 110 ± 11 84 ± 4 71 ± 7 3-1 547 Yes 100 ± 20 71 ± 30 64 ± 7 61± 7 3-115 2207 No 100 ± 20 92 ±12 84 ± 4 72 ± 9 3-99 2207 Yes 100 ± 13 50 ± 14 35 ± 6 13 ± 4EXAMPLE 7: Therapeutic Effect of A2AP knockdown in plasminogen-deficient mouse wound healing model

[0141] Impaired wound healing is a clinical phenotype of congenital plasminogen deficiency in humans, which is recapitulated in mice with genetic knockout of the plasminogen (PLG) gene (Schuster V, Hiigle B, Tefs K. Plasminogen deficiency. Journal of Thrombosis and Haemostasis. 2007;5(12):2315-2322; Romer J, Bugge TH, Pyke C, et al. Impaired wound healing in mice with a disrupted plasminogen gene. Nat Med. 1996 Mar;2(3):287-92.). In the present study, plasminogen deficiency was induced in mice using a siRNA-based knockdown approach as described in Example 5, and the efficacy of Compound 3-99 was evaluated in this model of plasminogen deficiency-induced delayed wound healing.Methods:

[0142] The siRNA used for plasminogen (PLG) knockdown was the same as used in Example 5. Female C57BL / 6J mice (7 weeks old, n=29) were randomly allocated into four groups: (1) PLG siRNA + vehicle (n=5), (2) PLG siRNA + Compound 3-99 (n=8), (3) vehicle + vehicle (n=8), and (4) vehicle + Compound 3-99 (n=8). To establish delayed wound healing, mice received PLG siRNA targeting plasminogen (PLG siRNA, 0.5 mg / kg) or vehicle (DPBS) via intravenous injection on days 0 and 7. Compound 3-99 (3 mg / kg) or vehicle was administered intravenously on days -2 and 4. Dosing schedules were designed based on prior pharmacodynamic studies showing maximal target knockdown (-95%) at 4-14 days post-administration. On day 4, two 4 mm diameter full-thickness skin punch biopsies were created on the upper dorsal area under inhalation anesthesia with appropriate analgesia. Animals were monitored daily for clinical signs and weighed three times weekly. Wound areas were measured individually on days 4, 7, 9, 11, and 14. Digital photographs were captured at these timepoints with animals positioned 15 cm from the camera under brief anesthesia, with a reference grid placed adjacent to each wound. Wound areas were quantified using ImageJ software. Plasma samples were collected on days -3 and 14 for biomarker analysis. Plasma levels of A2AP and PLG were measured as described in Example 5.Results:

[0143] As shown in FIG. 5A and FIG. 5B, knockdown of plasminogen following administration of PLG siRNA successfully established a delayed wound healing phenotype compared with vehicle-treated controls. Compound 3-99 produced significant beneficial effects on wound healing from day 11 onwards. In the plasminogen-deficient model, Compound 3-99 significantly improved wound healing compared to PLG siRNA-treated vehicle controls (p<0.05 at days 11 and 14). In animals with normal wound healing capacity, Compound 3-99 also resulted in significantly reduced wound areas and faster wound closure rates compared to vehicle controls (p<0.05 at day 11). Treatment was well-tolerated with no significant effects on body weight or treatment-related adverse effects (data not shown). At day 14, plasma PLG levels in PLG siRNA-treated animals (groups 1 and 2) were reduced to approximately 6% of normal, and plasma A2AP levels in Compound 3-99-treated animals were reduced to approximately 6% of normal, consistent with the prolonged knockdown of PLG and A2AP observed in Example 5 following dsRNA agent administration.

[0144] These findings demonstrate that dsRNA agent-mediated A2AP knockdown promotes wound healing in both plasminogen-deficient and normal conditions, supporting the utility of dsRNA agents of the disclosure as a therapeutic agent in settings where fibrinolytic activity may be compromised.EXAMPLE 8: Pharmacodynamic effects of dsRNA agents in rats

[0145] The pharmacodynamic activities of Compounds 3-114 and 6-243 were evaluated in male Sprague Dawley rats.Methods:

[0146] Male Sprague Dawley rats (7 weeks old, 125-150 g, n=18) were randomly allocated into six groups (n=3 per group). Groups 1, 2, and 6 received repeated intravenous dosing on days 0, 7, and 14, while Groups 3-5 received a single intravenous dose on day 0. The study design was as follows:• Group 1: Compound 6-243 (30 mg / kg, repeated dosing on days 0, 7, and 14)• Group 2: Compound 3-114 (30 mg / kg, repeated dosing on days 0, 7, and 14)• Group 3: Compound 3-114 (1 mg / kg, single dose on day 0)• Group 4: Compound 3-114 (3 mg / kg, single dose on day 0)• Group 5: Compound 3-114 (10 mg / kg, single dose on day 0)• Group 6: Control siRNA (30 mg / kg, repeated dosing on days 0, 7, and 14)

[0147] All test compounds were formulated in phosphate-buffered saline (PBS, pH 7.4) at concentrations appropriate to deliver 1 mL / kg administration volume. Compounds 6-243, 3-114 (for Group 2), and control siRNA were prepared at 30 mg / mL concentration, while Compound 3-114 for single-dose groups was prepared at 1, 3, and 10 mg / mL for the respective dose groups. Compounds were administered via tail vein injection. Animals were housed under standard conditions with free access to food and water throughout the study duration. Blood samples (approximately 300 pL for in-life samples, 3 mL at termination) were collected from the sublingual vein on days -1 (baseline), 3, 7, 10, 14, 17, and 21 into lithium heparin tubes. For Groups 1, 2, and 6, blood sampling on days 7 and 14 was performed immediately prior to compound administration. Plasma was separated by centrifugation (2000 × g, 5 minutes, 4°C) and stored at -80°C until analysis. Plasma A2AP levels were determined using ELISA as described in Example 5.Results:

[0148] Plasma A2AP levels were substantially reduced following administration of Compounds 6-243 and 3-114, while control siRNA had no effect on A2AP levels (FIG. 6A).All animals tolerated the dosing regimens well, with no significant changes in body weight or clinical signs throughout the study duration.

[0149] For Groups 1 and 2 (Compounds 6-243 and 3-114, repeated dosing at 30 mg / kg), reductions of A2AP plasma levels were observed with maximal knockdown achieved after the third dose on day 14. Both compounds produced comparable pharmacodynamic profiles, with sustained target suppression evident through day 21.

[0150] For Groups 3-5 (Compound 3-114, single-dose), dose-dependent reductions in plasma A2AP were observed (FIG. 6B).OTHER EMBODIMENTS

[0151] While the invention has been described in connection with specific aspects thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features set forth herein.

Claims

WHAT IS CLAIMED IS:

1. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Alpha- 2-antiplasmin (A2AP), wherein the dsRNA agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 37, 312, 396, 624, 626, 732, 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 39, 41, 43, 45, 47, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566. 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 734, 736, 738, 740, 742, 744, or 746, and an antisense strand hybridized to the sense strand.

2. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Alpha- 2-antiplasmin (A2AP), wherein the dsRNA agent comprises a sense strand hybridized to an antisense strand, wherein the sense strand and the antisense strand comprise the nucleotide sequences of (a) SEQ ID NOs: 37 and 38, respectively; (b) SEQ ID NOs: 312 and 313, respectively; (c) SEQ ID NOs: 396 and 397, respectively; (d) SEQ ID NOs: 624 and 625, respectively; (e) SEQ ID NOs: 626 and 627, respectively; (f) SEQ ID NOs: 732 and 733, respectively; (g) SEQ ID NOs: 1 and 2, respectively; (h) SEQ ID NOs: 3 and 4, respectively; (i) SEQ ID NOs: 5 and 6, respectively; (j) SEQ ID NOs: 7 and 8, respectively; (k) SEQ ID NOs: 9 and 10, respectively; (1) SEQ ID NOs: 11 and 12, respectively; (m) SEQ ID NOs: 13 and 14, respectively; (n) SEQ ID NOs: 15 and 16, respectively; (o) SEQ ID NOs: 15 and 238, respectively; (p) SEQ ID NOs: 15 and 239, respectively; (q) SEQ ID NOs: 17 and 18, respectively; (r) SEQ IDNOs: 19 and 20, respectively; (s) SEQ ID NOs: 19 and 240, respectively; (t) SEQ ID NOs: 21 and 22, respectively; (u) SEQ ID NOs: 23 and 24, respectively; (v) SEQ ID NOs: 23 and 241, respectively; (w) SEQ ID NOs: 25 and 26, respectively; (x) SEQ ID NOs: 27 and 28, respectively; (y) SEQ ID NOs: 29 and 30, respectively; (z) SEQ ID NOs: 29 and 242, respectively; (aa) SEQ ID NOs: 31 and 32, respectively; (bb) SEQ ID NOs: 33 and 34, respectively; (cc) SEQ ID NOs: 35 and 36, respectively; (dd) SEQ ID NOs: 37 and 243, respectively; (ee) SEQ ID NOs: 39 and 40, respectively; (ff) SEQ ID NOs: 41 and 42, respectively; (gg) SEQ ID NOs: 41 and 244, respectively; (hh) SEQ ID NOs: 43 and 44, respectively; (ii) SEQ ID NOs: 45 and 46, respectively; (jj) SEQ ID NOs: 47 and 48, respectively; (kk) SEQ ID NOs: 248 and 249, respectively; (11) SEQ ID NOs: 250 and 251, respectively; (mm) SEQ ID NOs: 252 and 253, respectively; (nn) SEQ ID NOs: 254 and 255, respectively; (oo) SEQ ID NOs: 256 and 257, respectively; (pp) SEQ ID NOs: 258 and 259, respectively; (qq) SEQ ID NOs: 260 and 261, respectively; (rr) SEQ ID NOs: 262 and 263, respectively; (ss) SEQ ID NOs: 264 and 265, respectively; (tt) SEQ ID NOs: 266 and 267, respectively; (uu) SEQ ID NOs: 268 and 269, respectively; (vv) SEQ ID NOs: 270 and 271, respectively; (ww) SEQ ID NOs: 272 and 273, respectively; (xx) SEQ ID NOs: 274 and 275, respectively; (yy) SEQ ID NOs: 276 and 277, respectively; (zz) SEQ ID NOs: 278 and 279, respectively; (aaa) SEQ ID NOs: 280 and 281, respectively; (bbb) SEQ ID NOs: 282 and 283, respectively; (ccc) SEQ ID NOs: 284 and 285, respectively; (ddd) SEQ ID NOs: 286 and 287, respectively; (eee) SEQ ID NOs: 288 and 289, respectively; (fff) SEQ ID NOs: 290 and 291, respectively; (ggg) SEQ ID NOs: 292 and 293, respectively; (hhh) SEQ ID NOs: 294 and 295, respectively; (iii) SEQ ID NOs: 296 and 297, respectively; (jjj) SEQ ID NOs: 298 and 299, respectively; (kkk) SEQ ID NOs: 300 and 301, respectively; (111) SEQ ID NOs: 302 and 303, respectively; (mmm) SEQ ID NOs: 304 and 305, respectively; (nnn) SEQ ID NOs: 306 and 307, respectively; (ooo) SEQ ID NOs: 308 and 309, respectively; (ppp) SEQ ID NOs: 310 and 311, respectively; (qqq) SEQ ID NOs: 314 and 315, respectively; (rrr) SEQ ID NOs: 316 and 317, respectively; (sss) SEQ ID NOs: 318 and 319, respectively; (ttt) SEQ ID NOs: 320 and 321, respectively; (uuu) SEQ ID NOs: 322 and 323, respectively; (vvv) SEQ ID NOs: 324 and 325, respectively; (www) SEQ ID NOs: 326 and 327, respectively; (xxx) SEQ ID NOs: 328 and 329, respectively; (yyy) SEQ ID NOs: 330 and 331, respectively; (zzz) SEQID NOs: 332 and 333, respectively; (aaaa) SEQ ID NOs: 334 and 335, respectively; (bbbb) SEQ ID NOs: 336 and 337, respectively; (cccc) SEQ ID NOs: 338 and 339, respectively; (dddd) SEQ ID NOs: 340 and 341, respectively; (eeee) SEQ ID NOs: 342 and 343, respectively; (ffff) SEQ ID NOs: 344 and 345, respectively; (gggg) SEQ ID NOs: 346 and 347, respectively; (hhhh) SEQ ID NOs: 348 and 349, respectively; (iiii) SEQ ID NOs: 350 and 351, respectively; (jjjj) SEQ ID NOs: 352 and 353, respectively; (kkkk) SEQ ID NOs: 354 and 355, respectively; (1111) SEQ ID NOs: 356 and 357, respectively; (mmmm) SEQ ID NOs: 358 and 359, respectively; (nnnn) SEQ ID NOs: 360 and 361, respectively; (oooo) SEQ ID NOs: 362 and 363, respectively; (pppp) SEQ ID NOs: 364 and 365, respectively; (qqqq) SEQ ID NOs: 366 and 367, respectively; (rrrr) SEQ ID NOs: 368 and 369, respectively; (ssss) SEQ ID NOs: 370 and 371, respectively; (tttt) SEQ ID NOs: 372 and 373, respectively; (uuuu) SEQ ID NOs: 374 and 375, respectively; (vvvv) SEQ ID NOs: 376 and 377, respectively; (wwww) SEQ ID NOs: 378 and 379, respectively; (xxxx) SEQ ID NOs: 380 and 381, respectively; (yyyy) SEQ ID NOs: 382 and 383, respectively; (zzzz) SEQ ID NOs: 384 and 385, respectively; (aaaaa) SEQ ID NOs: 386 and 387, respectively; (bbbbb) SEQ ID NOs: 388 and 389, respectively; (ccccc) SEQ ID NOs: 390 and 391, respectively; (ddddd) SEQ ID NOs: 392 and 393, respectively; (eeeee) SEQ ID NOs: 394 and 395, respectively; (fffff) SEQ ID NOs: 398 and 399, respectively; (ggggg) SEQ ID NOs: 400 and 401, respectively; (hhhhh) SEQ ID NOs: 402 and 403, respectively; (iiiii) SEQ ID NOs: 404 and 405, respectively; (jjjjj) SEQ ID NOs: 406 and 407, respectively; (kkkkk) SEQ ID NOs: 408 and 409, respectively; (11111) SEQ ID NOs: 410 and 411, respectively; (mmmmm) SEQ ID NOs: 412 and 413, respectively; (nnnnn) SEQ ID NOs: 414 and 415, respectively; (ooooo) SEQ ID NOs: 416 and 417, respectively; (ppppp) SEQ ID NOs: 418 and 419, respectively; (qqqqq) SEQ ID NOs: 420 and 421, respectively; (rrrrr) SEQ ID NOs: 422 and 423, respectively; (sssss) SEQ ID NOs: 424 and 425, respectively; (ttttt) SEQ ID NOs: 426 and 427, respectively; (uuuuu) SEQ ID NOs: 428 and 429, respectively; (vvvvv) SEQ ID NOs: 430 and 431, respectively; (wwwww) SEQ ID NOs: 432 and 433, respectively;(xxxxx) SEQ ID NOs: 434 and 435, respectively; (yyyyy) SEQ ID NOs: 436 and 437, respectively; (zzzzz) SEQ ID NOs: 438 and 439, respectively; (aaaaaa) SEQ ID NOs: 440 and 441, respectively; (bbbbbb) SEQ ID NOs: 442 and 443, respectively;(cccccc) SEQ ID NOs: 444 and 445, respectively; (dddddd) SEQ ID NOs: 446 and447, respectively; (eeeeee) SEQ ID NOs: 448 and 449, respectively; (ffffff) SEQ ID NOs: 450 and 451, respectively; (gggggg) SEQ ID NOs: 452 and 453, respectively; (hhhhhh) SEQ ID NOs: 454 and 455, respectively; (iiiiii) SEQ ID NOs: 456 and 457, respectively; (jjjjjj) SEQ ID NOs: 458 and 459, respectively; (kkkkkk) SEQ ID NOs: 460 and 461, respectively; (111111) SEQ ID NOs: 462 and 463, respectively;(mmmmmm) SEQ ID NOs: 464 and 465, respectively; (nnnnnn) SEQ ID NOs: 466 and 467, respectively; (oooooo) SEQ ID NOs: 468 and 469, respectively; (pppppp) SEQ ID NOs: 470 and 471, respectively; (qqqqqq) SEQ ID NOs: 472 and 473, respectively; (rrrrrr) SEQ ID NOs: 474 and 475, respectively; (ssssss) SEQ ID NOs: 476 and 477, respectively; (tttttt) SEQ ID NOs: 478 and 479, respectively; (uuuuuu) SEQ ID NOs: 480 and 481, respectively; (vvvvvv) SEQ ID NOs: 482 and 483, respectively; (wwwwww) SEQ ID NOs: 484 and 485, respectively; (xxxxxx) SEQ ID NOs: 486 and 487, respectively; (yyyyyy) SEQ ID NOs: 488 and 489, respectively; (zzzzzz) SEQ ID NOs: 490 and 491, respectively; (aaaaaaa) SEQ ID NOs: 492 and 493, respectively; (bbbbbbb) SEQ ID NOs: 494 and 495, respectively; (ccccccc) SEQ ID NOs: 496 and 497, respectively; (ddddddd) SEQ ID NOs: 498 and 499, respectively; (eeeeeee) SEQ ID NOs: 500 and 501, respectively; (fffffff) SEQ ID NOs: 502 and 503, respectively; (ggggggg) SEQ ID NOs: 504 and 505, respectively; (hhhhhhh) SEQ ID NOs: 506 and 507, respectively; (iiiiiii) SEQ ID NOs: 508 and 509, respectively; (jjjjjjj) SEQ ID NOs: 510 and 511, respectively; (kkkkkkk) SEQ ID NOs: 512 and 513, respectively; (1111111) SEQ ID NOs: 514 and 515, respectively; (mmmmmmm) SEQ ID NOs: 516 and 517, respectively; (nnnnnnn) SEQ ID NOs: 518 and 519, respectively; (ooooooo) SEQ ID NOs: 520 and 521, respectively;(ppppppp) SEQ ID NOs: 522 and 523, respectively; (qqqqqqq) SEQ ID NOs: 524 and 525, respectively; (rrrrrrr) SEQ ID NOs: 526 and 527, respectively; (sssssss) SEQ ID NOs: 528 and 529, respectively; (ttttttt) SEQ ID NOs: 530 and 531, respectively; (uuuuuuu) SEQ ID NOs: 532 and 533, respectively; (vvvvvvv) SEQ ID NOs: 534 and 535, respectively; (wwwwwww) SEQ ID NOs: 536 and 537, respectively; (xxxxxxx) SEQ ID NOs: 538 and 539, respectively; (yyyyyyy) SEQ ID NOs: 540 and 541, respectively; (zzzzzzz) SEQ ID NOs: 542 and 543, respectively; (aaaaaaaa) SEQ ID NOs: 544 and 545, respectively; (bbbbbbbb) SEQ ID NOs: 546 and 547, respectively; (cccccccc) SEQ ID NOs: 548 and 549, respectively; (dddddddd) SEQ ID NOs: 550 and 551, respectively; (eeeeeeee) SEQ ID NOs: 552 and 553, respectively; (ffffffff)SEQ ID NOs: 554 and 555, respectively; (gggggggg) SEQ ID NOs: 556 and 557, respectively; (hhhhhhhh) SEQ ID NOs: 558 and 559, respectively; (iiiiiiii) SEQ ID NOs: 560 and 561, respectively; (jjjjjjjj) SEQ ID NOs: 562 and 563, respectively; (kkkkkkkk) SEQ ID NOs: 564 and 565, respectively; (11111111) SEQ ID NOs: 566 and 567, respectively; (mmmmmmmm) SEQ ID NOs: 568 and 569, respectively;(nnnnnnnn) SEQ ID NOs: 570 and 571, respectively; (oooooooo) SEQ ID NOs: 572 and 573, respectively; (pppppppp) SEQ ID NOs: 574 and 575, respectively;(qqqqqqqq) SEQ ID NOs: 576 and 577, respectively; (rrrrrrrr) SEQ ID NOs: 578 and 579, respectively; (ssssssss) SEQ ID NOs: 580 and 581, respectively; (tttttttt) SEQ ID NOs: 582 and 583, respectively; (uuuuuuuu) SEQ ID NOs: 584 and 585, respectively; (vvvvvvvv) SEQ ID NOs: 586 and 587, respectively; (wwwwwwww) SEQ ID NOs: 588 and 589, respectively; (xxxxxxxx) SEQ ID NOs: 590 and 591, respectively; (yyyyyyyy) SEQ ID NOS: 592 and 593, respectively; (zzzzzzzz) SEQ ID NOs: 594 and 595, respectively; (aaaaaaaaa) SEQ ID NOs: 596 and 597, respectively;(bbbbbbbbb) SEQ ID NOs: 598 and 599, respectively; (ccccccccc) SEQ ID NOs: 600 and 601, respectively; (ddddddddd) SEQ ID NOs: 602 and 603, respectively;(eeeeeeeee) SEQ ID NOs: 604 and 605, respectively; (fffffffff) SEQ ID NOs: 606 and 607, respectively; (ggggggggg) SEQ ID NOs: 608 and 609, respectively; (hhhhhhhhh) SEQ ID NOs: 610 and 611, respectively; (iiiiiiiii) SEQ ID NOs: 612 and 613, respectively; (jjjjjjjjj) SEQ ID NOs: 614 and 615, respectively; (kkkkkkkkk) SEQ ID NOs: 616 and 617, respectively; (111111111) SEQ ID NOs: 618 and 619, respectively; (mmmmmmmmm) SEQ ID NOs: 620 and 621, respectively; (nnnnnnnnn) SEQ ID NOs: 622 and 623, respectively; (ooooooooo) SEQ ID NOs: 628 and 629, respectively; (ppppppppp) SEQ ID NOs: 630 and 631, respectively; (qqqqqqqqq) SEQ ID NOs: 632 and 633, respectively; (rrrrrrrrr) SEQ ID NOs: 634 and 635, respectively; (sssssssss) SEQ ID NOs: 636 and 637, respectively; (ttttttttt) SEQ ID NOs: 638 and 639, respectively; (uuuuuuuuu) SEQ ID NOs: 640 and 641, respectively; (vvvvvvvvv) SEQ ID NOs: 642 and 643, respectively; (wwwwwwwww) SEQ ID NOs: 644 and 645, respectively; (xxxxxxxxx) SEQ ID NOs: 646 and 647, respectively; (yyyyyyyyy) SEQ ID NOs: 648 and 649, respectively; (zzzzzzzzz) SEQ ID NOs: 650 and 651, respectively; (aaaaaaaaaa) SEQ ID NOs: 652 and 653, respectively; (bbbbbbbbbb) SEQ ID NOs: 654 and 655, respectively; (cccccccccc) SEQ ID NOs: 656 and 657, respectively; (dddddddddd) SEQ ID NOs: 658 and 659,respectively; (eeeeeeeeee) SEQ ID NOs: 660 and 661, respectively; (ffffffffff) SEQ ID NOs: 662 and 663, respectively; (gggggggggg) SEQ ID NOs: 664 and 665, respectively; (hhhhhhhhhh) SEQ ID NOs: 666 and 667, respectively; (iiiiiiiiii) SEQ ID NOs: 668 and 669, respectively; (jjjjjjjjjj) SEQ ID NOs: 670 and 671, respectively; (kkkkkkkkkk) SEQ ID NOs: 672 and 673, respectively; (1111111111) SEQ ID NOs: 674 and 675, respectively; (mmmmmmmmmm) SEQ ID NOs: 676 and 677, respectively; (nnnnnnnnnn) SEQ ID NOs: 678 and 679, respectively; (oooooooooo) SEQ ID NOs: 680 and 681, respectively; (pppppppppp) SEQ ID NOs: 682 and 683, respectively; (qqqqqqqqqq) SEQ ID NOs: 684 and 685, respectively; (rrrrrrrrrr) SEQ ID NOs: 686 and 687, respectively; (ssssssssss) SEQ ID NOs: 688 and 689, respectively; (tttttttttt) SEQ ID NOs: 690 and 691, respectively; (uuuuuuuuuu) SEQ ID NOs: 692 and 693, respectively; (vvvvvvvvvv) SEQ ID NOs: 694 and 695, respectively;(wwwwwwwwww) SEQ ID NOs: 696 and 697, respectively; (xxxxxxxxxx) SEQ ID NOs: 698 and 699, respectively; (yyyyyyyyyy) SEQ ID NOs: 700 and 701, respectively; (zzzzzzzzzz) SEQ ID NOs: 702 and 703, respectively; (aaaaaaaaaaa) SEQ ID NOs: 704 and 705, respectively; (bbbbbbbbbbb) SEQ ID NOs: 706 and 707, respectively; (ccccccccccc) SEQ ID NOs: 708 and 709, respectively; (ddddddddddd) SEQ ID NOs: 710 and 711, respectively; (eeeeeeeeeee) SEQ ID NOs: 712 and 713, respectively; (fffffffffff) SEQ ID NOs: 714 and 715, respectively; (ggggggggggg) SEQ ID NOs: 716 and 717, respectively; (hhhhhhhhhhh) SEQ ID NOs: 718 and 719, respectively; (iiiiiiiiiii) SEQ ID NOs: 720 and 721, respectively; (jjjjjjjjjjj) SEQ ID NOs: 722 and 723, respectively; (kkkkkkkkkkk) SEQ ID NOs: 724 and 725, respectively; (11111111111) SEQ ID NOs: 726 and 727, respectively;(mmmmmmmmmmm) SEQ ID NOs: 728 and 729, respectively; (nnnnnnnnnnn) SEQ ID NOs: 730 and 731, respectively; (ooooooooooo) SEQ ID NOs: 734 and 735, respectively; (ppppppppppp) SEQ IDNOs: 736 and 737, respectively; (qqqqqqqqqqq) SEQ ID NOs: 738 and 739, respectively; (rrrrrrrrrrr) SEQ ID NOs: 740 and 741, respectively; (sssssssssss) SEQ ID NOs: 742 and 743, respectively; (ttttttttttt) SEQ ID NOs: 744 and 745, respectively; or (uuuuuuuuuuu) SEQ ID NOs: 746 and 747, respectively.

3. The dsRNA agent of claim 1 or 2, wherein the sense strand comprises at least one chemically modified nucleotide and / or at least one modified intemucleoside linkage.

4. The dsRNA agent of claim 3, wherein the antisense strand comprises at least one chemically modified nucleotide and / or at least one modified intemucleoside linkage.

5. The dsRNA agent of claim 3 or 4, wherein the at least one chemically modified nucleotide comprises a nucleotide scomprising a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'- deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C- alkyl-modified nucleotide, 2'-hydroxyl-modified nucleotide, a 2'-methoxy ethyl modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'-phosphate, a nucleotide comprising a 5'-phosphate mimic, a thermally destabilizing nucleotide, a glycol modified nucleotide (GNA), a 2-O-(N-methylacetamide) modified nucleotide, or any combination thereof.

6. The dsRNA agent of claim 5, wherein the at least one chemically modified nucleotide comprises a 2'-deoxy-modified nucleotide.

7. The dsRNA agent of claim 6, wherein the 2'-deoxy-modified nucleotide comprises a 2'-deoxy-2'-fluoro modification.

8. The dsRNA agent of claim 5, wherein the at least one chemically modified nucleotide comprises a 2'-O-methyl modified nucleotide.

9. The dsRNA agent of claim 5, wherein the at least one chemically modified nucleotide comprises a 2'-fluoro modified nucleotide10. The dsRNA agent of claim 5, wherein the at least one chemically modified nucleotide comprises a 2'-methoxy ethyl modified nucleotide.

11. The dsRNA agent of claim 5, wherein the at least one chemically modified nucleotide comprises a phosphorothioate group.

12. The dsRNA agent of claim 5, wherein the at least one chemically modified nucleotide comprises a 5'-phosphate mimic.

13. The dsRNA agent of claim 12, wherein the 5'-phosphate mimic comprises 5'-vinyl phosphonate.

14. The dsRNA agent of any one of claims 3-13, wherein the at least one modified intemucleoside linkage comprises an internucleoside linkage of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, an alkenylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, and an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, a boranophosphate linkage, or any combination thereof.

15. The dsRNA agent of claim 14, wherein the at least one modified internucleoside linkage comprises a phosphorothioate linkage.

16. The dsRNA agent of claim 14, wherein the at least one modified internucleoside linkage comprises an alkenylene phosphonate linkage.

17. The dsRNA agent of claim 16, wherein the alkenylene phosphonate linkage comprises a vinyl phosphonate linkage.

18. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Alpha- 2-antiplasmin (A2AP), wherein the dsRNA agent comprises a sense strand hybridized to an antisense strand, wherein the sense strand and the antisense strand have the nucleotide sequences of (a) SEQ ID NOs: 197 and 198, respectively; (b) SEQ ID NOs: 812 and 813, respectively; (c) SEQ ID NOs: 896 and 897, respectively; (d) SEQ ID NOs: 1124 and 1125, respectively; (e) SEQ ID NOs: 1126 and 1127, respectively; (f) SEQ ID NOs: 1232 and 1233, respectively; (g) SEQ ID NOs: 49 and 50, respectively; (h) SEQ ID NOs: 51 and 52, respectively; (i) SEQ ID NOs: 51 and 54,respectively; (j) SEQ ID NOs: 53 and 54, respectively; (k) SEQ ID NOs: 55 and 54, respectively; (1) SEQ ID NOs: 56 and 54, respectively; (m) SEQ ID NOs: 57 and 54, respectively; (n) SEQ ID NOs: 58 and 54, respectively; (o) SEQ ID NOs: 59 and 54, respectively; (p) SEQ ID NOs: 60 and 61, respectively; (q) SEQ ID NOs: 49 and 62, respectively; (r) SEQ ID NOs: 63 and 64, respectively; (s) SEQ ID NOs: 65 and 66, respectively; (t) SEQ ID NOs: 67 and 68, respectively; (u) SEQ ID NOs: 67 and 69, respectively; (v) SEQ ID NOs: 70 and 69, respectively; (w) SEQ ID NOs: 71 and 69, respectively; (x) SEQ ID NOs: 72 and 69, respectively; (y) SEQ ID NOs: 73 and 69, respectively; (z) SEQ ID NOs: 74 and 69, respectively; (aa) SEQ ID NOs: 75 and 69, respectively; (bb) SEQ ID NOs: 76 and 77, respectively; (cc) SEQ ID NOs: 67 and 78, respectively; (dd) SEQ ID NOs: 67 and 79, respectively; (ee) SEQ ID NOs: 80 and 81, respectively; (ff) SEQ ID NOs: 82 and 83, respectively; (gg) SEQ ID NOs: 84 and 85, respectively; (hh) SEQ ID NOs: 84 and 86, respectively; (ii) SEQ ID NOs: 87 and 86, respectively; (jj) SEQ ID NOs: 88 and 86, respectively; (kk) SEQ ID NOs: 89 and 86, respectively; (11) SEQ ID NOs: 90 and 86, respectively; (mm) SEQ ID NOs: 91 and 86, respectively; (nn) SEQ ID NOs: 92 and 86, respectively; (oo) SEQ ID NOs: 93 and 94, respectively; (pp) SEQ ID NOs: 95 and 96, respectively; (qq) SEQ ID NOs: 97 and 98, respectively; (rr) SEQ ID NOs: 99 and 100, respectively; (ss) SEQ ID NOs: 99 and 101, respectively; (tt) SEQ ID NOs: 102 and 103, respectively; (uu) SEQ ID NOs: 104 and 105, respectively; (vv) SEQ ID NOs: 104 and 106, respectively; (ww) SEQ ID NOs: 107 and 106, respectively; (xx) SEQ ID NOs: 108 and 106, respectively; (yy) SEQ ID NOs: 109 and 106, respectively; (zz) SEQ ID NOs: 110 and 106, respectively; (aaa) SEQ ID NOs: 111 and 106, respectively; (bbb) SEQ ID NOs: 112 and 106, respectively; (ccc) SEQ ID NOs: 113 and 114, respectively; (ddd) SEQ ID NOs: 104 and 115, respectively; (eee) SEQ ID NOs: 104 and 116, respectively; (fff) SEQ ID NOs: 117 and 118, respectively; (ggg) SEQ ID NOs: 119 and 120, respectively; (hhh) SEQ ID NOs: 121 and 122, respectively; (iii) SEQ ID NOs: 121 and 123, respectively; (jjj) SEQ ID NOs: 124 and 125, respectively; (kkk) SEQ ID NOs: 126 and 127, respectively; (111) SEQ ID NOs: 128 and 129, respectively; (mmm) SEQ ID NOs: 130 and 131, respectively; (nnn) SEQ ID NOs: 130 and 132, respectively; (ooo) SEQ ID NOs: 130 and 133, respectively; (ppp) SEQ ID NOs: 134 and 135, respectively; (qqq) SEQ ID NOs: 136 and 137, respectively; (rrr) SEQ ID NOs: 138 and 139, respectively; (sss) SEQ ID NOs: 140and 139, respectively; (ttt) SEQ ID NOs: 141 and 139, respectively; (uuu) SEQ ID NOs: 142 and 139, respectively; (vvv) SEQ ID NOs: 143 and 139, respectively;(www) SEQ ID NOs: 144 and 139, respectively; (xxx) SEQ ID NOs: 145 and 139, respectively; (yyy) SEQ ID NOs: 146 and 147, respectively; (zzz) SEQ ID NOs: 148 and 149, respectively; (aaaa) SEQ ID NOs: 150 and 151, respectively; (bbbb) SEQ ID NOs: 152 and 153, respectively; (cccc) SEQ ID NOs: 152 and 154, respectively; (dddd) SEQ ID NOs: 155 and 154, respectively; (eeee) SEQ ID NOs: 156 and 154, respectively; (ffff) SEQ ID NOs: 157 and 154, respectively; (gggg) SEQ ID NOs: 158 and 154, respectively; (hhhh) SEQ ID NOs: 159 and 154, respectively; (iiii) SEQ ID NOs: 160 and 154, respectively; (jjjj) SEQ ID NOs: 161 and 162, respectively; (kkkk) SEQ ID NOs: 152 and 163, respectively; (1111) SEQ ID NOs: 152 and 164, respectively; (mmmm) SEQ ID NOs: 165 and 166, respectively; (nnnn) SEQ ID NOs: 167 and 168, respectively; (oooo) SEQ ID NOs: 169 and 170, respectively; (pppp) SEQ ID NOs: 169 and 171, respectively; (qqqq) SEQ ID NOs: 172 and 171, respectively; (rrrr) SEQ ID NOs: 173 and 171, respectively; (ssss) SEQ ID NOs: 174 and 171, respectively; (tttt) SEQ ID NOs: 175 and 171, respectively; (uuuu) SEQ ID NOs: 176 and 171, respectively; (vvvv) SEQ ID NOs: 177 and 171, respectively; (wwww) SEQ ID NOs: 178 and 179, respectively; (xxxx) SEQ ID NOs: 169 and 180, respectively; (yyyy) SEQ ID NOs: 169 and 181, respectively; (zzzz) SEQ ID NOs: 182 and 183, respectively; (aaaaa) SEQ ID NOs: 184 and 185, respectively; (bbbbb) SEQ ID NOs: 186 and 185, respectively; (ccccc) SEQ ID NOs: 187 and 185, respectively; (ddddd) SEQ ID NOs: 188 and 189, respectively; (eeeee) SEQ ID NOs: 188 and 190, respectively; (fffff) SEQ ID NOs: 191 and 190, respectively; (ggggg) SEQ ID NOs: 192 and 190, respectively; (hhhhh) SEQ ID NOs: 193 and 190, respectively; (iiiii) SEQ ID NOs: 194 and 190, respectively; (jjjjj) SEQ ID NOs: 195 and 190, respectively; SEQ ID NOs: 196 and 190, respectively; (kkkkk) (11111) SEQ ID NOs: 184 and 199, respectively; (mmmmm) SEQ ID NOs: 197 and 200, respectively; (nnnnn) SEQ ID NOs: 197 and 201, respectively; (ooooo) SEQ ID NOs: 202 and 203, respectively; (ppppp) SEQ ID NOs: 204 and 205, respectively; (qqqqq) SEQ ID NOs: 206 and 207, respectively; (rrrrr) SEQ ID NOs: 206 and 208, respectively; (sssss) SEQ ID NOs: 209 and 208, respectively; (ttttt) SEQ ID NOs: 210 and 208, respectively; (uuuuu) SEQ ID NOs: 211 and 208, respectively; (vvvvv) SEQ ID NOs: 212 and 208, respectively; (wwwww) SEQ ID NOs: 213 and 208,respectively; (xxxxx) SEQ ID NOs: 214 and 208, respectively; (yyyyy) SEQ ID NOs: 215 and 216, respectively; (zzzzz) SEQ ID NOs: 206 and 217, respectively; (aaaaaa) SEQ ID NOs: 206 and 218, respectively; (bbbbbb) SEQ ID NOs: 219 and 220, respectively; (cccccc) SEQ ID NOs: 221 and 222, respectively; (dddddd) SEQ ID NOs: 224 and 225, respectively; (eeeeee) SEQ ID NOs: 224 and 226, respectively; (ffffff) SEQ ID NOs: 227 and 226, respectively; (gggggg) SEQ ID NOs: 228 and 226, respectively; (hhhhhh) SEQ ID NOs: 229 and 226, respectively; (iiiiii) SEQ ID NOs: 230 and 226, respectively; (jjjjjj) SEQ ID NOs: 231 and 226, respectively; (kkkkkk) SEQ ID NOs: 232 and 226, respectively; (111111) SEQ ID NOs: 233 and 234, respectively; (mmmmmm) SEQ ID NOs: 224 and 235, respectively; (nnnnnn) SEQ ID NOs: 236 and 237, respectively; (oooooo) SEQ ID NOs: 748 and 749, respectively; (pppppp) SEQ ID NOs: 750 and 751, respectively; (qqqqqq) SEQ ID NOs: 752 and 753, respectively; (rrrrrr) SEQ ID NOs: 754 and 755, respectively; (ssssss) SEQ ID NOs: 756 and 757, respectively; (tttttt) SEQ ID NOs: 758 and 759, respectively; (uuuuuu) SEQ ID NOs: 760 and 761, respectively; (vvvvvv) SEQ ID NOs: 762 and 763, respectively; (wwwwww) SEQ ID NOs: 764 and 765, respectively; (xxxxxx) SEQ ID NOs: 766 and 767, respectively; (yyyyyy) SEQ ID NOs: 768 and 769, respectively; (zzzzzz) SEQ ID NOs: 770 and 771, respectively; (aaaaaaa) SEQ ID NOs: 772 and 773, respectively; (bbbbbbb) SEQ ID NOs: 774 and 775, respectively; (ccccccc) SEQ ID NOs: 776 and 777, respectively; (ddddddd) SEQ ID NOs: 778 and 779, respectively; (eeeeeee) SEQ ID NOs: 780 and 781, respectively; (fffffff) SEQ ID NOs: 782 and 783, respectively; (ggggggg) SEQ ID NOs: 784 and 785, respectively; (hhhhhhh) SEQ ID NOs: 786 and 787, respectively; (iiiiiii) SEQ ID NOs: 788 and 789, respectively; (jjjjjjj) SEQ ID NOs: 790 and 791, respectively; (kkkkkkk) SEQ ID NOs: 792 and 793, respectively; (1111111) SEQ ID NOs: 794 and 795, respectively; (mmmmmmm) SEQ ID NOs: 796 and 797, respectively; (nnnnnnn) SEQ ID NOs: 798 and 799, respectively; (ooooooo) SEQ ID NOs: 800 and 801, respectively; (ppppppp) SEQ ID NOs: 802 and 803, respectively; (qqqqqqq) SEQ ID NOs: 804 and 805, respectively; (rrrrrrr) SEQ ID NOs: 806 and 807, respectively; (sssssss) SEQ ID NOs: 808 and 809, respectively; (ttttttt) SEQ ID NOs: 810 and 811, respectively; (uuuuuuu) SEQ ID NOs: 814 and 815, respectively; (vvvvvvv) SEQ ID NOs: 816 and 817, respectively; (wwwwwww) SEQ ID NOs: 818 and 819, respectively; (xxxxxxx) SEQ ID NOs: 820 and 821, respectively; (yyyyyyy)SEQ ID NOs: 822 and 823, respectively; (zzzzzzz) SEQ ID NOs: 824 and 825, respectively; (aaaaaaaa) SEQ ID NOs: 826 and 827, respectively; (bbbbbbbb) SEQ ID NOs: 828 and 829, respectively; (cccccccc) SEQ ID NOs: 830 and 831, respectively; (dddddddd) SEQ ID NOs: 832 and 833, respectively; (eeeeeeee) SEQ ID NOs: 834 and 835, respectively; (ffffffff) SEQ ID NOs: 836 and 837, respectively; (gggggggg) SEQ ID NOs: 838 and 839, respectively; (hhhhhhhh) SEQ ID NOs: 840 and 841, respectively; (iiiiiiii) SEQ ID NOs: 842 and 843, respectively; (jjjjjjjj ) SEQ ID NOs: 844 and 845, respectively; (kkkkkkkk) SEQ ID NOs: 846 and 847, respectively; (llllllll) SEQ ID NOs: 848 and 849, respectively; (mmmmmmmm) SEQ ID NOs: 850 and 851, respectively; (nnnnnnnn) SEQ ID NOs: 852 and 853, respectively;(oooooooo) SEQ ID NOs: 854 and 855, respectively; (pppppppp) SEQ ID NOs: 856 and 857, respectively; (qqqqqqqq) SEQ ID NOs: 858 and 859, respectively; (rrrrrrrr) SEQ ID NOs: 860 and 861, respectively; (ssssssss) SEQ ID NOs: 862 and 863, respectively; (tttttttt) SEQ ID NOs: 864 and 865, respectively; (uuuuuuuu) SEQ ID NOs: 866 and 867, respectively; (vvvvvvvv) SEQ ID NOs: 868 and 869, respectively; (wwwwwwww) SEQ ID NOs: 870 and 871, respectively; (xxxxxxxx) SEQ ID NOs: 872 and 873, respectively; (yyyyyyyy) SEQ ID NOs: 874 and 875, respectively; (zzzzzzzz) SEQ ID NOs: 876 and 877, respectively; (aaaaaaaaa) SEQ ID NOs: 878 and 879, respectively; (bbbbbbbbb) SEQ ID NOs: 880 and 881, respectively;(ccccccccc) SEQ ID NOs: 882 and 883, respectively; (ddddddddd) SEQ ID NOs: 884 and 885, respectively; (eeeeeeeee) SEQ ID NOs: 886 and 887, respectively; (fffffffff) SEQ ID NOs: 888 and 889, respectively; (ggggggggg) SEQ ID NOs: 890 and 891, respectively; (hhhhhhhhh) SEQ ID NOs: 892 and 893, respectively; (iiiiiiiii) SEQ ID NOs: 894 and 895, respectively; (jjjjjjjjj ) SEQ ID NOs: 898 and 899, respectively; (kkkkkkkkk) SEQ ID NOs: 900 and 901, respectively; (lllllllll) SEQ ID NOs: 902 and 903, respectively; (mmmmmmmmm) SEQ ID NOs: 904 and 905, respectively;(nnnnnnnnn) SEQ ID NOs: 906 and 907, respectively; (ooooooooo) SEQ ID NOs: 908 and 909, respectively; (ppppppppp) SEQ ID NOs: 910 and 911, respectively; (qqqqqqqqq) SEQ ID NOs: 912 and 913, respectively; (rrrrrrrrr) SEQ ID NOs: 914 and 915, respectively; (sssssssss) SEQ ID NOs: 916 and 917, respectively; (ttttttttt) SEQ ID NOs: 918 and 919, respectively; (uuuuuuuuu) SEQ ID NOs: 920 and 921, respectively; (vvvvvvvvv) SEQ ID NOs: 922 and 923, respectively; (wwwwwwwww) SEQ ID NOs: 924 and 925, respectively; (xxxxxxxxx) SEQ ID NOs: 926 and 927,respectively; (yyyyyyyyy) SEQ ID NOs: 928 and 929, respectively; (zzzzzzzzz) SEQ ID NOs: 930 and 931, respectively; (aaaaaaaaaa) SEQ ID NOs: 932 and 933, respectively; (bbbbbbbbbb) SEQ ID NOs: 934 and 935, respectively; (cccccccccc) SEQ ID NOs: 936 and 937, respectively; (dddddddddd) SEQ ID NOs: 938 and 939, respectively; (eeeeeeeeee) SEQ ID NOs: 940 and 941, respectively; (ffffffffff) SEQ ID NOs: 942 and 943, respectively; (gggggggggg) SEQ ID NOs: 944 and 945, respectively; (hhhhhhhhhh) SEQ ID NOs: 946 and 947, respectively; (iiiiiiiiii) SEQ ID NOs: 948 and 949, respectively; (jjjjjjjjjj) SEQ ID NOs: 950 and 951, respectively; (kkkkkkkkkk) SEQ ID NOs: 952 and 953, respectively; (llllllllll) SEQ ID NOs: 954 and 955, respectively; (mmmmmmmmmm) SEQ ID NOs: 956 and 957, respectively; (nnnnnnnnnn) SEQ ID NOs: 958 and 959, respectively; (oooooooooo) SEQ ID NOs: 960 and 961, respectively; (pppppppppp) SEQ ID NOs: 962 and 963, respectively; (qqqqqqqqqq) SEQ ID NOs: 964 and 965, respectively; (rrrrrrrrrr) SEQ ID NOs: 966 and 967, respectively; (ssssssssss) SEQ ID NOs: 968 and 969, respectively; (tttttttttt) SEQ ID NOs: 970 and 971, respectively; (uuuuuuuuuu) SEQ ID NOs: 972 and 973, respectively; (vvvvvvvvvv) SEQ ID NOs: 974 and 975, respectively;(wwwwwwwwww) SEQ ID NOs: 976 and 977, respectively; (xxxxxxxxxx) SEQ ID NOs: 978 and 979, respectively; (yyyyyyyyyy) SEQ ID NOs: 980 and 981, respectively; (zzzzzzzzzz) SEQ ID NOs: 982 and 983, respectively; (aaaaaaaaaaa) SEQ ID NOs: 984 and 985, respectively; (bbbbbbbbbbb) SEQ ID NOs: 986 and 987, respectively; (ccccccccccc) SEQ ID NOs: 988 and 989, respectively; (ddddddddddd) SEQ ID NOs: 990 and 991, respectively; (eeeeeeeeeee) SEQ ID NOs: 992 and 993, respectively; (fffffffffff) SEQ ID NOs: 994 and 995, respectively; (ggggggggggg) SEQ ID NOs: 996 and 997, respectively; (hhhhhhhhhhh) SEQ ID NOs: 998 and 999, respectively; (iiiiiiiiiii) SEQ ID NOs: 1000 and 1001, respectively; (jjjjjjjjjjj) SEQ ID NOs: 1002 and 1003, respectively; (kkkkkkkkkkk) SEQ ID NOs: 1004 and 1005, respectively; (lllllllllll) SEQ ID NOs: 1006 and 1007, respectively;(mmmmmmmmmmm) SEQ ID NOs: 1008 and 1009, respectively; (nnnnnnnnnnn) SEQ ID NOs: 1010 and 1011, respectively; (ooooooooooo) SEQ ID NOs: 1012 and 1013, respectively; (ppppppppppp) SEQ ID NOs: 1014 and 1015, respectively;(qqqqqqqqqqq) SEQ ID NOs: 1016 and 1017, respectively; (rrrrrrrrrrr) SEQ ID NOs: 1018 and 1019, respectively; (sssssssssss) SEQ ID NOs: 1020 and 1021, respectively; (ttttttttttt) SEQ ID NOs: 1022 and 1023, respectively; (uuuuuuuuuuu) SEQ ID NOs:1024 and 1025, respectively; (vvvvvvvvvvv) SEQ ID NOs: 1026 and 1027, respectively; (wwwwwwwwwww) SEQ ID NOs: 1028 and 1029, respectively;(xxxxxxxxxxx) SEQ ID NOs: 1030 and 1031, respectively; (yyyyyyyyyyy) SEQ ID NOs: 1032 and 1033, respectively; (zzzzzzzzzzz) SEQ ID NOs: 1034 and 1035, respectively; (aaaaaaaaaaaa) SEQ ID NOs: 1036 and 1037, respectively;(bbbbbbbbbbbb) SEQ ID NOs: 1038 and 1039, respectively; (cccccccccccc) SEQ ID NOs: 1040 and 1041, respectively; (dddddddddddd) SEQ ID NOs: 1042 and 1043, respectively; (eeeeeeeeeeee) SEQ ID NOs: 1044 and 1045, respectively; (ffffffffffff) SEQ ID NOs: 1046 and 1047, respectively; (gggggggggggg) SEQ ID NOs: 1048 and 1049, respectively; (hhhhhhhhhhhh) SEQ ID NOs: 1050 and 1051, respectively; (iiiiiiiiiiii) SEQ ID NOs: 1052 and 1053, respectively; (j j j j j j j j j j j j ) SEQ ID NOs: 1054 and 1055, respectively; (kkkkkkkkkkkk) SEQ ID NOs: 1056 and 1057, respectively; (llllllllllll) SEQ ID NOs: 1058 and 1059, respectively; (mmmmmmmmmmmm) SEQ ID NOs: 1060 and 1061, respectively; (nnnnnnnnnnnn) SEQ ID NOs: 1062 and 1063, respectively; (oooooooooooo) SEQ ID NOs: 1064 and 1065, respectively;(pppppppppppp) SEQ ID NOs: 1066 and 1067, respectively; (qqqqqqqqqqqq) SEQ ID NOs: 1068 and 1069, respectively; (rrrrrrrrrrrr) SEQ ID NOs: 1070 and 1071, respectively; (ssssssssssss) SEQ ID NOs: 1072 and 1073, respectively; (tttttttttttt) SEQ ID NOs: 1074 and 1075, respectively; (uuuuuuuuuuuu) SEQ ID NOs: 1076 and 1077, respectively; (vvvvvvvvvvvv) SEQ ID NOs: 1078 and 1079, respectively; (wwwwwwwwwwww) SEQ ID NOs: 1080 and 1081, respectively; (xxxxxxxxxxxx) SEQ ID NOs: 1082 and 1083, respectively; (yyyyyyyyyyyy) SEQ ID NOs: 1084 and 1085, respectively; (zzzzzzzzzzzz) SEQ ID NOs: 1086 and 1087, respectively;(aaaaaaaaaaaaa) SEQ ID NOs: 1088 and 1089, respectively; (bbbbbbbbbbbbb) SEQ ID NOs: 1090 and 1091, respectively; (ccccccccccccc) SEQ ID NOs: 1092 and 1093, respectively; (ddddddddddddd) SEQ ID NOs: 1094 and 1095, respectively;(eeeeeeeeeeeee) SEQ ID NOs: 1096 and 1097, respectively; (ffffffffffffff) SEQ ID NOs: 1098 and 1099, respectively; (ggggggggggggg) SEQ ID NOs: 1100 and 1101, respectively; (hhhhhhhhhhhhh) SEQ ID NOs: 1102 and 1103, respectively;(iiiiiiiiiiiii) SEQ ID NOs: 1104 and 1105, respectively; (jjjjjjjjjjjjj) SEQ ID NOs: 1106 and 1107, respectively; (kkkkkkkkkkkkk) SEQ ID NOs: 1108 and 1109, respectively; (lllllllllllll) SEQ ID NOs: 1110 and 1111, respectively; (mmmmmmmmmmmmm) SEQ ID NOs: 1112 and 1113, respectively; (nnnnnnnnnnnnn) SEQ ID NOs: 1114 and1115, respectively; (ooooooooooooo) SEQ ID NOs: 1116 and 1117, respectively; (ppppppppppppp) SEQ ID NOs: 1118 and 1119, respectively; (qqqqqqqqqqqqq) SEQ ID NOs: 1120 and 1121, respectively; (rrrrrrrrrrrrr) SEQ ID NOs: 1122 and 1123, respectively; (sssssssssssss) SEQ ID NOs: 1128 and 1129, respectively; (ttttttttttttt) SEQ ID NOs: 1130 and 1131, respectively; (uuuuuuuuuuuuu) SEQ ID NOs: 1132 and 1133, respectively; (vvvvvvvvvvvvv) SEQ ID NOs: 1134 and 1135, respectively; (wwwwwwwwwwwww) SEQ ID NOs: 1136 and 1137, respectively;(xxxxxxxxxxxxx) SEQ ID NOs: 1138 and 1139, respectively; (yyyyyyyyyyyyy) SEQ ID NOs: 1140 and 1141, respectively; (zzzzzzzzzzzzz) SEQ ID NOs: 1142 and 1143, respectively; (aaaaaaaaaaaaaa) SEQ ID NOs: 1144 and 1145, respectively;(bbbbbbbbbbbbbb) SEQ ID NOs: 1146 and 1147, respectively; (cccccccccccccc) SEQ ID NOs: 1148 and 1149, respectively; (dddddddddddddd) SEQ ID NOs: 1150 and 1151, respectively; (eeeeeeeeeeeeee) SEQ ID NOs: 1152 and 1153, respectively; (ffffffffffffff) SEQ ID NOs: 1154 and 1155, respectively; (gggggggggggggg) SEQ ID NOs: 1156 and 1157, respectively; (hhhhhhhhhhhhhh) SEQ ID NOs: 1158 and 1159, respectively; (iiiiiiiiiiiiii) SEQ ID NOs: 1160 and 1161, respectively; (j j j jj j j j j j j j j j ) SEQ ID NOs: 1162 and 1163, respectively; (kkkkkkkkkkkkkk) SEQ ID NOs: 1164 and 1165, respectively; (llllllllllllll) SEQ ID NOs: 1166 and 1167, respectively;(mmmmmmmmmmmmmm) SEQ ID NOs: 1168 and 1169, respectively;(nnnnnnnnnnnnnn) SEQ ID NOs: 1170 and 1171, respectively; (oooooooooooooo) SEQ ID NOs: 1172 and 1173, respectively; (pppppppppppppp) SEQ ID NOs: 1174 and 1175, respectively; (qqqqqqqqqqqqqq) SEQ ID NOs: 1176 and 1177, respectively; (rrrrrrrrrrrrrr) SEQ ID NOs: 1178 and 1179, respectively;(ssssssssssssss) SEQ ID NOs: 1180 and 1181, respectively; (tttttttttttttt) SEQ ID NOs: 1182 and 1183, respectively; (uuuuuuuuuuuuuu) SEQ ID NOs: 1184 and 1185, respectively; (vvvvvvvvvvvvvv) SEQ ID NOs: 1186 and 1187, respectively;(wwwwwwwwwwwwww) SEQ ID NOs: 1188 and 1189, respectively;(xxxxxxxxxxxxxx) SEQ ID NOs: 1190 and 1191, respectively; (yyyyyyyyyyyyyy) SEQ ID NOs: 1192 and 1193, respectively; (zzzzzzzzzzzzzz) SEQ ID NOs: 1194 and 1195, respectively; (aaaaaaaaaaaaaaa) SEQ ID NOs: 1196 and 1197, respectively; (bbbbbbbbbbbbbbb) SEQ ID NOs: 1198 and 1199, respectively; (ccccccccccccccc) SEQ ID NOs: 1200 and 1201, respectively; (ddddddddddddddd) SEQ ID NOs: 1202 and 1203, respectively; (eeeeeeeeeeeeeee) SEQ ID NOs: 1204 and 1205, respectively;(ffffffffffffffff) SEQ ID NOs: 1206 and 1207, respectively; (ggggggggggggggg) SEQ ID NOs: 1208 and 1209, respectively; (hhhhhhhhhhhhhhh) SEQ ID NOs: 1210 and 1211, respectively; (iiiiiiiiiiiiiii) SEQ ID NOs: 1212 and 1213, respectively;(jjjjjjjjjjjjjjj) SEQ ID NOs: 1214 and 1215, respectively; (kkkkkkkkkkkkkkk) SEQ ID NOs: 1216 and 1217, respectively; (lllllllllllllll) SEQ ID NOs: 1218 and 1219, respectively; (mmmmmmmmmmmmmmm) SEQ ID NOs: 1220 and 1221, respectively; (nnnnnnnnnnnnnnn) SEQ ID NOs: 1222 and 1223, respectively;(ooooooooooooooo) SEQ ID NOs: 1224 and 1225, respectively; (ppppppppppppppp) SEQ ID NOs: 1226 and 1227, respectively; (qqqqqqqqqqqqqqq) SEQ ID NOs: 1228 and 1229, respectively; (rrrrrrrrrrrrrrr) SEQ ID NOs: 1230 and 1231, respectively; (sssssssssssssss) SEQ ID NOs: 1234 and 1235, respectively; (ttttttttttttttt) SEQ ID NOs: 1236 and 1237, respectively; (uuuuuuuuuuuuuuu) SEQ ID NOs: 1238 and 1239, respectively; (vvvvvvvvvvvvvvv) SEQ ID NOs: 1240 and 1241, respectively;(wwwwwwwwwwwwwww) SEQ ID NOs: 1242 and 1243, respectively;(xxxxxxxxxxxxxxx) SEQ ID NOs: 1244 and 1245, respectively; or (yyyyyyyyyyyyyyy) SEQ ID NOS: 1246 and 1247, respectively.

19. The dsRNA agent of any one of claims 1-18, further comprising a GalNAc cluster attached to the sense strand.

20. The dsRNA agent of claim 19, wherein the GalNAc cluster is attached at the 3' end of the sense strand.

21. The dsRNA agent of claim 19, wherein the GalNAc cluster is attached at the 5' end of the sense strand.

22. The dsRNA agent of any one of claims 19-21, wherein the GalNAc cluster comprises a structure of Formula I, Formula II, Formula III, and / or Formula IV.

23. The dsRNA agent of any one of claims 18-20 and 22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 197 and 198, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

24. The dsRNA agent of any one of claims 18-20 and 22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 812 and 813, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

25. The dsRNA agent of any one of claims 18-20 and 22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 896 and 897, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

26. The dsRNA agent of any one of claims 18-20 and 22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1124 and 1125, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

27. The dsRNA agent of any one of claims 18-20 and 22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1126 and 1127, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

28. The dsRNA agent of any one of claims 18-20 and 22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1232 and 1233, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 3' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula I, Formula II, and / or Formula III.

29. The dsRNA agent of any one of claims 18-19 and 21-22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 197 and 198, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

30. The dsRNA agent of any one of claims 18-19 and 21-22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 812 and 813, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

31. The dsRNA agent of any one of claims 18-19 and 21-22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 896 and 897, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

32. The dsRNA agent of any one of claims 18-19 and 21-22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1124 and 1125, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

33. The dsRNA agent of any one of claims 18-19 and 21-22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1126 and 1127, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

34. The dsRNA agent of any one of claims 18-19 and 21-22, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1232 and 1233, respectively, and the dsRNA agent comprises a GalNAc cluster attached at the 5' end of the sense strand, and wherein the GalNAc cluster comprises a structure of Formula II, Formula III, and / or Formula IV.

35. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Alpha- 2-antiplasmin (A2AP), wherein the dsRNA agent comprises a sense strand hybridized to an antisense strand, wherein the sense strand has a sequence and comprises a GalNAc cluster of a duplex described in Table 4 or Table 7, and the antisense strand has a nucleotide sequence of the same duplex described in Table 4 or Table 7.

36. The dsRNA agent of claim 35, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 197 and 198, respectively, wherein the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

37. The dsRNA agent of claim 35, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 812 and 813, respectively, wherein the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

38. The dsRNA agent of claim 35, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 896 and 897, respectively, wherein the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

39. The dsRNA agent of claim 35, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1124 and 1125, respectively, wherein the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

40. The dsRNA agent of claim 35, wherein the sense strand and the antisense strand have the nucleotide sequences of SEQ ID NOs: 1126 and 1127, respectively, wherein the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

41. The dsRNA agent of claim 35, wherein the sense strand and the antisense strand have the nucleotide sequences SEQ ID NOs: 1232 and 1233, respectively, wherein the sense strand comprises a GalNAc cluster attached at the 3' end, and wherein the GalNAc cluster comprises a structure of Formula I.

42. A compound comprising the structure set forth in Figure 4A.

43. A compound comprising the structure set forth in Figure 4B.

44. A compound comprising the structure set forth in Figure 4C.

45. A compound comprising the structure set forth in Figure 4D.

46. A cell comprising the dsRNA agent of any one of claims 1 to 41 or the compound of any one of claims 42 to 45.

47. A pharmaceutical composition comprising the dsRNA agent of any one of claims 1 to 41 or the compound of any one of claims 42 to 45.

48. A lipid nanoparticle comprising the dsRNA agent of any one of claims 1 to 41 or the compound of any one of claims 42 to 45.

49. A method of treating an A2AP-associated disorder in a subject in need thereof, the method comprising administering to the subject the dsRNA agent of any one of claims 1 to 41, the compound of any one of claims 41 to 45, the pharmaceutical composition of claim 47, or the lipid nanoparticle of claim 48.

50. The method of claim 49, wherein the A2AP-associated disordercomprises plasminogen deficiency, venous thrombosis, venous thromboembolism, deep vein thrombosis, pulmonary embolism, prosthetic valve thrombosis, post- thrombotic syndrome, atherothrombosis, heart attack, stroke, fibrinolytic disorders, hypofibrinolysis, disfibrinolysis, ischemic stroke, atrial fibrillation, myocardial infarction, peripheral arterial disease, dynamic thrombosis, coronary artery disease, microvascular thrombosis, ischemic brain injury, brain swelling, brain hemorrhage, death after thromboembolic stroke, or any combination thereof.

51. The method of claim 50, wherein the A2AP-associated disorder comprises plasminogen deficiency.

52. The method of any one of claims 49 to 51, wherein the subject is a human.

53. The method of any one of claims 49 to 52, wherein the administering comprises systemic administration.

54. The method of claim 53, wherein the systemic administration comprises intravenous administration.

55. The method of claim 53, wherein the systemic administration comprises subcutaneous administration56. The method of any one of claims 49 to 55, further comprising administering a second agent to the subject.