Cosmetic composition for improving skin condition, comprising 15-HEPE, 5,15-HETE, or combination thereof

WO2026177483A1PCT designated stage Publication Date: 2026-08-27ICBIO CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2026/002580
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2026-01-27
Filing Date
2026-02-11
Publication Date
2026-08-27

Smart Images

  • Figure KR2026002580_27082026_PF_FP_ABST
    Figure KR2026002580_27082026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for improving skin condition, the composition comprising 15-HEPE, 5,15-HETE, or a combination thereof. The composition comprising 15-HEPE, 5,15-HETE, or a combination thereof according to one aspect alleviates skin inflammation or irritation, and exhibits skin barrier-strengthening, wrinkle-reducing, moisturizing, and skin cell-regenerating effects, and thus may be used as a cosmetic or a skin external preparation and the like for improving skin condition.
Need to check novelty before this filing date? Find Prior Art

Description

A cosmetic composition for improving skin condition comprising 15-HEPE, 5,15-HETE, or a combination thereof.

[0001] This relates to a composition for improving skin condition containing oxylipin.

[0002] Oxylipins are derivatives produced from polyunsaturated fatty acids such as DHA, EPA, and ARA through enzymatic reactions, and are known to play important physiological roles in the human body. They act as autacoids in the human body and can regulate various physiological and pathological processes.

[0003] Oxylipin is primarily produced by reacting with enzymes such as lipoxygenase, cyclooxygenase, and cytochrome P450. Although these enzymes can be produced using biotechnological techniques utilizing microorganisms, commercialization has been somewhat difficult because the cosmetics industry often avoids genetically modified organisms (LMOs) due to their nature. Additionally, while there have been cases of manufacturing oxylipin using enzyme overexpression methods with E. coli, this process involves the use of expensive raw materials such as IPTG, resulting in high manufacturing costs, and concerns regarding safety have been raised due to the use of antibiotic resistance genes.

[0004] Against this backdrop, the inventors intended to solve the above-mentioned problems by preparing compounds such as EPA-derived oxylipins, such as 15-HEPE (15(S)-hydroxy-eicosapentaenoic acid; 15(S)-hydroxy EPA) and 5,15-HETE (5(S)15(S)-DiHETE, 5S,15S-dihydroxy-6E,8Z,10Z,13E-eicosatetraenoic acid), in an economical and safe manner, and utilizing them as cosmetic compositions effective for improving skin condition. It was confirmed that a composition comprising 15-HEPE, 5,15-HETE, or a combination thereof according to one aspect alleviates skin inflammation or irritation and exhibits skin barrier strengthening, wrinkle improvement, moisturizing, and skin cell regeneration effects, and can be utilized as a cosmetic or topical skin agent for improving skin condition.

[0005] One aspect provides a cosmetic composition for improving skin condition comprising 15-HEPE (15(S)-hydroxy-eicosapentaenoic acid), 5,15-HETE (5(S)15(S)-DiHETE), or a combination thereof.

[0006] Another aspect provides a topical skin composition for improving skin condition comprising 15-HEPE, 5,15-HETE, or a combination thereof.

[0007] One aspect provides a cosmetic composition for improving skin condition comprising 15-HEPE (15(S)-hydroxy-eicosapentaenoic acid), 5,15-HETE (5(S)15(S)-DiHETE), or a combination thereof.

[0008] 15-HEPE (15(S)-hydroxy-eicosapentaenoic acid; 15(S)-hydroxy EPA), a type of oxylipin, is a monohydroxy fatty acid produced through the enzymatic reaction of lipid oxygenase with EPA (eicosapentaenoic acid), and is known to regulate the production of inflammatory lipid mediators and promote anti-inflammatory responses. The structure of 5-HEPE may be represented by the following chemical formula 1.

[0009]

[0010] 5,15-HETE (5(S)15(S)-DiHETE; 5S,15S-dihydroxy-6E,8Z,10Z,13E-eicosatetraenoic acid), a type of oxylipin, is a dihydroxy fatty acid produced through the enzymatic reaction of lipid oxygenase with EPA and is known to inhibit platelet aggregation and enhance the biosynthetic rate of LXA4 (lipoxin A4) or LXB4 (lipoxin B4). The structure of 5,15-HETE may be represented by Chemical Formula 2 below.

[0011]

[0012] In one embodiment, the improvement of skin condition may include alleviating skin inflammation or skin irritation.

[0013] Inflammation refers to an in vivo response by immune cells to damage or infection of specific tissues, and the term "inflammation relief" may refer to any action that suppresses the occurrence of skin inflammatory responses or alleviates or suppresses existing inflammation.

[0014] The term "irritation relief" may refer to any action that suppresses or eliminates factors causing itching, stinging, erythema, etc., on the skin, or alleviates or soothes irritation such as itching, stinging, or erythema induced on the skin.

[0015] In one embodiment, the improvement of skin condition may include one or more selected from strengthening the skin barrier, improving skin wrinkles, moisturizing the skin, and regenerating skin cells.

[0016] The term "skin barrier strengthening" may refer to the enhancement of the barrier function that protects the skin from external stimuli, ultraviolet rays, microorganisms, and moisture evaporation through increased intercellular bonding strength in the stratum corneum or increased structural stability of the epidermis, dermis, or epidermal-dermal junction.

[0017] The term "improvement of skin wrinkles" may mean that the depth, length, or number of visually observable epidermal undulations is reduced by increasing skin thickness or flattening the epidermis through the reorganization of fibrous tissue within the dermis, resulting in the inhibition or inhibition of wrinkle formation or the alleviation of existing wrinkles.

[0018] The term "skin moisturization" can refer to any action that supplies moisture to the skin or blocks moisture evaporation to maintain skin flexibility and induces uniform exfoliation to maintain a smooth surface.

[0019] The term "skin regeneration" may refer to the process of recovery of skin cells or skin tissue damaged by endogenous factors, exogenous factors, or a combination of factors. In this context, endogenous factors may include stress, while exogenous factors may include ultraviolet rays, external pollutants, wounds, trauma, etc.

[0020] In one embodiment, the cosmetic composition may have one or more of the following characteristics: (a) reducing the expression of IL-1α, IL-6, and TNF-α in skin cells; (b) increasing the expression of loricrin (LOR) and filaggrin (FLG) in skin cells; (c) reducing the expression of MMP-1 and increasing the expression of procollagen type I in skin cells; and (d) increasing the expression of HAS2 in skin cells.

[0021] In one embodiment, the above-mentioned characteristics of the cosmetic composition may be exhibited by 15-HEPE or 5,15-HETE included in the composition.

[0022] In one embodiment, the skin cell may be a fibroblast or a keratinocyte, and more specifically, a dermal fibroblast or an epidermal keratinocyte.

[0023] According to one embodiment, when HEKa (human keratinocyte) cells were treated with 15-HEPE and 5,15-HETE, respectively, the expression levels of IL-1α, IL-6, and TNF-α were found to decrease in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, confirming that 15-HEPE and 5,15-HETE have effects that alleviate skin inflammation and irritation (Example 2-1, FIGS. 1 to 3).

[0024] According to one example, when HEKa cells were treated with 15-HEPE and 5,15-HETE, respectively, the expression levels of LOR and FLG were found to increase in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, confirming that 15-HEPE and 5,15-HETE have a skin barrier strengthening effect (Example 2-1, Figs. 4 and 5).

[0025] According to one embodiment, when HDFa (human dermal fibroblast) cells were treated with 15-HEPE and 5,15-HETE, respectively, it was found that the expression level of MMP-1 decreased in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, while the expression level of procollagen type I increased in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, confirming that 15-HEPE and 5,15-HETE have skin barrier strengthening and skin wrinkle improvement effects (Example 2-1, Figs. 6 and 7).

[0026] According to one embodiment, when HDFa cells were treated with 15-HEPE and 5,15-HETE, respectively, the expression level of HAS2 was found to increase in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, confirming that 15-HEPE and 5,15-HETE have a skin moisturizing effect (Example 2-1, Fig. 8).

[0027] According to one embodiment, after treating HEKa with scratches with 15-HEPE and 5,15-HETE respectively and performing a wound healing assay, it was found that the wound gap between cultured cells decreased in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, confirming that 15-HEPE and 5,15-HETE have skin regenerative efficacy (Examples 2-3, FIG. 12 and 13).

[0028] Accordingly, the cosmetic composition can regulate the expression of skin condition-related factors such as IL-1α, IL-6, TNF-α, LOR, FLG, MMP-1, and HAS2 in skin cells through 15-HEPE or 5,15-HETE components, and as a result, can effectively improve the skin condition by exhibiting effects such as alleviating skin inflammation, alleviating skin irritation, strengthening the skin barrier, improving skin wrinkles, moisturizing the skin, and regenerating skin cells.

[0029] In one embodiment, 15-HEPE, 5,15-HETE, or a combination thereof may be included in an amount of 0.00001 to 99 parts by weight relative to 100 parts by weight of the total cosmetic composition. Specifically, 15-HEPE, 5,15-HETE, or a combination thereof is present in an amount of 0.000001 to 99 parts by weight, 0.000001 to 90 parts by weight, 0.000001 to 75 parts by weight, 0.000001 to 50 parts by weight, 0.000001 to 25 parts by weight, 0.000001 to 15 parts by weight, 0.000001 to 10 parts by weight, 0.000001 to 5 parts by weight, 0.000001 to 2.5 parts by weight, 0.000001 to 1 part by weight, 0.000001 to 0.5 parts by weight, 0.000001 to 0.1 parts by weight, and 0.000001 to 0.05 parts by weight, based on 100 parts by weight of the total cosmetic composition. 0.000001 to 0.01 parts by weight, 0.00001 to 99 parts by weight, 0.00001 to 90 parts by weight, 0.00001 to 75 parts by weight, 0.00001 to 50 parts by weight, 0.00001 to 25 parts by weight, 0.00001 to 15 parts by weight, 0.00001 to 10 parts by weight, 0.00001 to 5 parts by weight, 0.00001 to 2.5 parts by weight, 0.00001 to 1 part by weight, 0.00001 to 0.5 parts by weight, 0.00001 to 0.1 parts by weight, 0.00001 to 0.05 parts by weight, 0.00001 to 0.01 parts by weight, 0.0001 to 99 parts by weight, 0.0001 to 90 parts by weight, 0.0001 to 75 parts by weight, 0.0001 to 50 parts by weight, 0.0001 to 25 parts by weight, 0.0001 to 15 parts by weight, 0.0001 to 10 parts by weight, 0.0001 to 5 parts by weight, 0.0001 to 2.5 parts by weight, 0.0001 to 1 part by weight, 0.0001 to 0.5 parts by weight, 0.0001 to 0.1 parts by weight, 0.0001 to 0.05 parts by weight, 0.0001 to 0.01 parts by weight, 0.0005 to 99 parts by weight, 0.0.005 to 90 parts by weight, 0.0005 to 75 parts by weight, 0.0005 to 50 parts by weight, 0.0005 to 25 parts by weight, 0.0005 to 15 parts by weight, 0.0005 to 10 parts by weight, 0.0005 to 5 parts by weight, 0.0005 to 2.5 parts by weight, 0.0005 to 1 part by weight, 0.0005 to 0.5 parts by weight, 0.0005 to 0.1 parts by weight, 0.0005 to 0.05 parts by weight, 0.0005 to 0.01 parts by weight, 0.001 to 99 parts by weight, 0.001 to 90 parts by weight, 0.001 to 75 parts by weight, 0.001 to 50 parts by weight, 0.001 to It may be included in 25 parts by weight, 0.001 to 15 parts by weight, 0.001 to 10 parts by weight, 0.001 to 5 parts by weight, 0.001 to 2.5 parts by weight, 0.001 to 1 part by weight, 0.001 to 0.5 parts by weight, 0.001 to 0.1 parts by weight, 0.001 to 0.05 parts by weight, or 0.001 to 0.01 parts by weight, and more specifically, it may be included in 0.000001 to 0.005 parts by weight.

[0030] Alternatively, in one embodiment, 15-HEPE, 5,15-HETE, or a combination thereof may be included in the cosmetic composition at a concentration of 0.01 to 10,000 μg / mL. Specifically, 15-HEPE, 5,15-HETE, or a combination thereof is present in the cosmetic composition at 0.01 to 10,000 μg / mL, 0.01 to 5,000 μg / mL, 0.01 to 1,000 μg / mL, 0.01 to 500 μg / mL, 0.01 to 100 μg / mL, 0.01 to 80 μg / mL, 0.01 to 60 μg / mL, 0.01 to 40 μg / mL, 0.01 to 20 μg / mL, 0.01 to 10 μg / mL, 0.05 to 10,000 μg / mL, 0.05 to 5,000 μg / mL, 0.05 to 1,000 μg / mL, 0.05 to 500 μg / mL, 0.05 to 100 μg / mL, 0.05 to 80 μg / mL, 0.05 to 60 μg / mL, 0.05 to 40 μg / mL, 0.05 to 20 μg / mL, 0.05 to 10 μg / mL, 0.1 to 10,000 μg / mL, 0.1 to 5,000 μg / mL, 0.1 to 1,000 μg / mL, 0.1 to 500 μg / mL, 0.1 to 100 μg / mL, 0.1 to 80 μg / mL, 0.1 to 60 μg / mL, 0.1 to 40 μg / mL, 0.1 to 20 μg / mL, 0.1 to 10 μg / mL, 0.5 to 10,000 μg / mL, 0.5 to 5,000 μg / mL, 0.5 to 1,000 μg / mL, 0.5 to 500 μg / mL, 0.5 to 100 μg / mL, 0.5 to 80 μg / mL, 0.5 to 60 μg / mL, 0.5 to 40 μg / mL, 0.5 to 20 μg / mL, 0.5 to 10 μg / mL, 1 to 10,000 μg / mL, 1 to 5,000 μg / mL, 1 to 1,000 μg / mL, 1 to 500 μg / mL, 1 to 100 μg / mL, 1 to 80 μg / mL, 1 to 60 μg / mL, 1 to 40 μg / mL, 1 to 20 μg / mL, 1 to 10 μg / mL, 5 to 10,000 μg / mL, 5 to 5,000 μg / mL, 5 to 1,000 μg / mL, 5 to 500 μg / mL, 5 to 100 μg / mL, 5 to 80 μg / mL, 5 to 60 μg / mL, 5 to 40 μg / mL, 5 to 20 μg / mL, or 5 It may be included at a concentration of up to 10 μg / mL, and more specifically at a concentration of 0.01 to 50 μg / mL.

[0031] In one embodiment, the cosmetic composition may include both 15-HEPE and 5,15-HETE.

[0032] As a result of treating HEKa cells with a combination of 15-HEPE and 5,15-HETE, it was confirmed that the expression level of IL-6, a factor causing skin inflammation or irritation, was reduced more significantly than when treated with 15-HEPE or 5,15-HETE alone, and the expression level of LOR, a factor playing an important role in skin barrier formation and inhibition of moisture loss, was increased more significantly (Example 2-2, Figs. 9 and 10). Additionally, as a result of treating HDFa cells with a combination of 15-HEPE and 5,15-HETE, it was confirmed that the expression level of MMP-1, a factor causing skin aging and wrinkle formation by degrading collagen in skin tissue, was reduced more significantly (Example 2-2, Fig. 11).

[0033] Therefore, when the cosmetic composition contains both 15-HEPE and 5,15-HETE, the skin condition improvement effect of the cosmetic composition may be enhanced more than that of a single-component composition containing only one of 15-HEPE or 5,15-HETE.

[0034] In one embodiment, the weight ratio of 15-HEPE to 5,15-HETE in the cosmetic composition may be 1:99 to 99:1. Specifically, the weight ratio of 15-HEPE and 5,15-HETE in the cosmetic composition is 1:99 to 99:1, 1:99 to 74:1, 1:99 to 49:1, 1:99 to 24:1, 1:99 to 19:1, 1:99 to 14:1, 1:99 to 9:1, 1:99 to 4:1, 1:99 to 3:1, 1:99 to 2:1, 1:74 to 99:1, 1:74 to 74:1, 1:74 to 49:1, 1:74 to 24:1, 1:74 to 19:1, 1:74 to 14:1, 1:74 to 9:1, 1:74 to 4:1, 1:74 to 3:1. 1:74 to 2:1, 1:49 to 99:1, 1:49 to 74:1, 1:49 to 49:1, 1:49 to 24:1, 1:49 to 19:1, 1:49 to 14:1, 1:49 to 9:1, 1:49 to 4:1, 1:49 to 3:1, 1:49 to 2:1, 1:24 to 99:1, 1:24 to 74:1, 1:24 to 49:1, 1:24 to 24:1, 1:24 to 19:1, 1:24 to 14:1, 1:24 to 9:1, 1:24 to 4:1, 1:24 to 3:1, 1:24 to 2:1, 1:19 to 99:1, 1:19 to 74:1, 1:19 to 49:1, 1:19 to 24:1, 1:19 to 19:1, 1:19 to 14:1, 1:19 to 9:1, 1:19 to 4:1, 1:19 to 3:1, 1:19 to 2:1, 1:14 to 99:1, 1:14 to 74:1, 1:14 to 49:1, 1:14 to 24:1, 1:14 to 19:1, 1:14 to 14:1, 1:14 to 9:1, 1:14 to 4:1, 1:14 to 3:1, 1:14 to 2:1, 1:9 to 99:1, 1:9 to 74:1, 1:9 to 49:1, 1:9 to 24:1, 1:9 to 19:1, 1:9 to 14:1,1:9 to 9:1, 1:9 to 4:1, 1:9 to 3:1, 1:9 to 2:1, 1:4 to 99:1, 1:4 to 74:1, 1:4 to 49:1, 1:4 to 24:1, 1:4 to 19:1, 1:4 to 14:1, 1:4 to 9:1, 1:4 to 4:1, 1:4 to 3:1, 1:4 to 2:1, 1:3 to 99:1, 1:3 to 74:1, 1:3 to 49:1, 1:3 to 24:1, 1:3 to 19:1, 1:3 to 14:1, 1:3 to 9:1, 1:3 to 4:1, 1:3 to 3:1, 1:3 It may be up to 2:1, 1:2 to 99:1, 1:2 to 74:1, 1:2 to 49:1, 1:2 to 24:1, 1:2 to 19:1, 1:2 to 14:1, 1:2 to 9:1, 1:2 to 4:1, 1:2 to 3:1, or 1:2 to 2:1, and more specifically, it may be 1:9 to 9:1.

[0035] Due to the nature of being applied to the skin, the cosmetic composition may be manufactured in formulations such as solution, suspension, emulsion, paste, gel, cream, lotion, powder, cleanser, oil, powder foundation, emulsion foundation, wax foundation, and spray, and the cosmetic composition may include a carrier component suitable for each formulation.

[0036] In addition to the active ingredient exhibiting an effect of improving skin health or promoting the recovery of skin damage, the cosmetic composition may further include commonly used additives or auxiliary agents. For example, a cosmetic composition for improving skin health or promoting the recovery of skin damage may further include purified water, a moisturizer, a thickener, an emulsifier, a surfactant, a preservative, a stabilizer, a pH adjuster, a disinfectant, a colorant, or a functional additive.

[0037] Additive ingredients such as carriers, moisturizers, thickeners, emulsifiers, surfactants, preservatives, colorants, functional additives, whitening agents, thickeners, gelling agents, emollients, foaming agents, fragrances, chelating agents, and various skin nutrients, which may be appropriately included depending on the formulation or function of the cosmetic composition, may be included in an amount of 0.01 to 95 weight% relative to the total weight of the composition so as to maintain a high skin condition improvement effect of the cosmetic composition without causing excessive skin irritation.

[0038] For example, each additive ingredient is present in an amount of 0.01 to 95 wt%, 0.01 to 80 wt%, 0.01 to 65 wt%, 0.01 to 50 wt%, 0.1 to 95 wt%, 0.1 to 80 wt%, 0.1 to 65 wt%, 0.1 to 50 wt%, 1 to 95 wt%, 1 to 80 wt%, 1 to 65 wt%, 1 to 50 wt%, 5 to 95 wt%, 5 to 80 wt%, 5 to 65 wt%, 5 to 50 wt%, 10 to 95 wt%, 10 to 80 wt%, 10 to 65 wt%, 10 to 50 wt%, 20 to 95 wt%, 20 to 80 wt%, and 20 to 65 wt% based on the total weight of the cosmetic composition. It may contain 20 to 50 weight%, 30 to 95 weight%, 30 to 80 weight%, 30 to 65 weight%, 30 to 50 weight%, 40 to 95 weight%, 40 to 80 weight%, 40 to 65 weight%, or 40 to 50 weight%.

[0039] Another aspect provides a topical skin composition for improving skin condition comprising 15-HEPE, 5,15-HETE, or a combination thereof. A detailed description of the 15-HEPE, 5,15-HETE, or a combination thereof, and the skin condition improvement effect resulting therefrom, is as described above.

[0040] The topical skin composition may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof. The topical skin composition may further include ingredients commonly used in topical skin preparations such as cosmetics or pharmaceuticals. For example, aqueous components, oily components, powder components, alcohols, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, metal ion chelators, sugars, or combinations thereof may be formulated or added in appropriate amounts according to the formulation and purpose of the topical skin preparation.

[0041] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight)% for solid / solid, (weight / volume)% for solid / liquid, and (volume / volume)% for liquid / liquid, unless otherwise noted.

[0042] Unless otherwise specified, all numbers, values, and / or expressions used herein to denote ingredients, reaction conditions, and the content of ingredients shall be understood to be modified by the term “approximately” in all cases, as these numbers are essentially approximations reflecting the various uncertainties of measurement that occur in obtaining these values ​​among others.

[0043] Additionally, where numerical ranges are disclosed in this specification, such ranges are continuous and, unless otherwise specified, include all values ​​from the minimum value of such range up to the maximum value including the maximum value.

[0044] Furthermore, throughout this specification, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components; and the term "or" means an implied "or" rather than an exclusive "or," and "A or B" includes the case of A, the case of B, and the case of both A and B.

[0045] A composition comprising 15-HEPE, 5,15-HETE, or a combination thereof according to one aspect alleviates skin inflammation or irritation and exhibits skin barrier strengthening, wrinkle improvement, moisturizing, and skin regeneration effects, so it can be used as a cosmetic for improving skin condition and as an external skin preparation.

[0046] Figure 1 is a graph showing the results of evaluating IL-1α expression levels according to the concentration of 15-HEPE or 5,15-HETE treatment on skin cells (HEKa).

[0047] Figure 2 is a graph showing the results of evaluating IL-6 expression levels according to the concentration of 15-HEPE or 5,15-HETE treatment on skin cells (HEKa).

[0048] Figure 3 is a graph showing the results of evaluating TNF-α expression levels according to the concentration of 15-HEPE or 5,15-HETE treatment on skin cells (HEKa).

[0049] Figure 4 is a graph showing the results of evaluating loricrin (LOR) expression levels according to the concentration of 15-HEPE or 5,15-HETE treatment on skin cells (HEKa).

[0050] Figure 5 is a graph showing the results of evaluating filaggrin (FLG) expression levels according to the concentration of 15-HEPE or 5,15-HETE treatment on skin cells (HEKa).

[0051] Figure 6 is a graph showing the results of evaluating the MMP-1 expression levels according to the concentration of 15-HEPE or 5,15-HETE treatment on skin cells (HDFa).

[0052] Figure 7 is a graph showing the results of evaluating the procollagen type I expression levels according to the concentration of 15-HEPE or 5,15-HETE treatment on skin cells (HDFa).

[0053] Figure 8 is a graph showing the results of evaluating the HAS2 expression levels according to the concentration of 15-HEPE or 5,15-HETE treatment on skin cells (HDFa).

[0054] Figure 9 is a graph showing the results of evaluating IL-6 expression levels according to the mixing weight ratio and treatment concentration of 15-HEPE and 5,15-HETE when skin cells (HEKa) are treated with a combination of 15-HEPE and 5,15-HETE.

[0055] Figure 10 is a graph showing the results of evaluating the loricrin (LOR) expression levels according to the mixing weight ratio and treatment concentration of 15-HEPE and 5,15-HETE when skin cells (HEKa) are treated with a combination of 15-HEPE and 5,15-HETE.

[0056] Figure 11 is a graph showing the results of evaluating the MMP-1 expression level according to the mixing weight ratio and treatment concentration of 15-HEPE and 5,15-HETE when skin cells (HDFa) are treated with a combination of 15-HEPE and 5,15-HETE.

[0057] Figure 12 is a diagram showing the results of a wound healing assay performed to confirm the skin regeneration effect according to the concentration of 15-HEPE treatment on skin cells (HEKa).

[0058] Figure 13 is a diagram showing the results of a wound healing assay performed to confirm the skin regeneration effect according to the concentration of 5,15-HETE treatment on skin cells (HEKa).

[0059] A cosmetic composition for improving skin condition comprising 15-HEPE (15(S)-hydroxy-eicosapentaenoic acid), 5,15-HETE (5(S)15(S)-DiHETE), or a combination thereof.

[0060] The following examples will be explained in more detail. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

[0061]

[0062] Example 1. Preparation of EPA-derived oxylipins (15-HEPE and 5,15-HETE)

[0063] 15-HEPE (15(S)-hydroxy-eicosapentaenoic acid) and 5,15-HETE (5S,15S-dihydroxy-6E,8Z,10Z,13E-eicosatetraenoic acid)) were prepared using EPA (eicosapentaenoic acid) as a raw material.

[0064] Specifically, lipoxygenase (Cayman, USA) was mixed with 100 μM EPA (Cayman, USA) at a concentration of 20 kU / mL while maintaining a pH of 8.0, and the reaction was carried out at 25 °C for 15 minutes. Subsequently, sodium borohydride was added to increase the concentration of sodium borohydride in the solution to 50 mM, and the reaction was carried out for 15 minutes to reduce the oxylipin product in the form of peroxide. Then, 1 N HCl was added to adjust the pH to 4.0, and the reaction was terminated.

[0065] Next, a synthetic adsorbent (HP-20, Samyang Corporation) equivalent to one-tenth of the reaction volume was added to the solution after the reaction was completed, and the mixture was reacted for one hour to recover the product. Subsequently, the synthetic adsorbent was removed by filtration, followed by dehydration and drying. Then, anhydrous ethanol in a 1:1 (v / v) volume ratio with HP-20 was added and reacted for one hour to recover the product (extraction was repeated five times).

[0066] After confirming that the final product contained 15-HEPE and 5,15-HETE, each substance was separated using prep HPLC equipped with a C18 column or a diol column and used for subsequent efficacy evaluation.

[0067]

[0068] Example 2. Evaluation of the efficacy of EPA-derived oxylipin 15-HEPE and 5,15-HETE

[0069] 2-1. Evaluation of Expression Levels of Factors Related to Skin Condition Improvement in Skin Cells Following Treatment with 15-HEPE or 5,15-HETE

[0070] To confirm the skin condition improvement effects, such as skin irritation relief, skin barrier strengthening, skin wrinkle improvement, and skin moisturization, of the two types of oxylipins (15-HEPE and 5,15-HETE) prepared according to Example 1, each substance was treated to skin cells (keratinocytes or fibroblasts), and the changes in the expression of factors related to skin condition improvement (IL-1α, IL-6, TNF-α, LOR, FLG, MMP-1, procollagen type I, HAS2) were evaluated.

[0071] Specifically, the HEKa (human keratinocyte) cell line was used to evaluate the expression levels of factors (IL-1α, IL-6, TNF-α, loricrin, filaggrin) related to the efficacy of alleviating skin inflammation or irritation and improving the skin barrier, and the HDFa (human dermal fibroblast) cell line was used to evaluate the expression levels of factors (MMP-1, procollagen type I, HAS2) related to the efficacy of skin moisturization and improving skin wrinkles. Dulbecco Modified Eagle Medium (DMEM, GIBCO, Canada) was used for HEKa culture, and Fibroblast Basal Medium (Medium 106, GIBCO, Canada) was used for HDFa culture. Both cell lines were cultured in an incubator containing 37°C and 5% CO2.

[0072] Subsequently, to confirm the expression of IL-1α, IL-6, TNF-α, and MMP-1, the culture medium was removed, and the cells were treated with two types of oxylipins at concentrations of 0.1, 1, 5, or 10 μg / mL, respectively, and cultured for 48 hours. At this time, 10 μM hydrocortisone (HC) was used as a control for evaluating the expression of IL-1α, IL-6, and TNF-α, and 50 μM retinyl palmitate (RP) was used as a control for evaluating the expression of MMP-1. Afterward, to induce cell damage, the cultured cells were exposed to UVB at 20 mJ / cm² for 5 minutes. 2 After investigating, the culture medium was replaced with a new one and cultured for an additional 24 hours.

[0073] Then, to confirm the expression of loricrin (LOR), filaggrin (FLG), procollagen type I, and HAS2, the culture medium was removed, and the cells were treated with two types of oxylipins at concentrations of 0.1, 1, 5, or 10 μg / mL, respectively, and cultured for 48 hours. At this time, 10 mM calcium chloride (CaCl2) was used as a control for evaluating the expression of LOR and FLG, 50 μM RP was used as a control for evaluating the expression of procollagen type I, and 50 ppm hyaluronic acid (HA) was used as a control for evaluating the expression of HAS2.

[0074] Next, RNA was extracted from each cell using TransZol reagent (TRANS, China), and cDNA was obtained using the PrimeScript 1st cDNA Synthesis Kit (TRANS, China). RT-PCR was then performed by mixing the cDNA with primers of IL-1α, IL-6, TNF-α, MMP-1, LOR, FLG, procollagen type I, and HAS2 using the Taq polymerase Kit (TRANS, China). GAPDH was used as an internal control. The primer information for each factor used in the RT-PCR is shown in Table 1 below.

[0075] Name Base sequence (5' -> 3') Sequence number GAPDH(HEKa)_primer_forwardCTGGCACCCAGCACAATGAAG1 GAPDH(HEKa)_primer_reverseACCGACTGCTGTCACCTTCA2 GAPDH(HDFa)_primer_forwardATTGTTGCCATCAATGACCC3 GAPDH(HDFa)_primer_reverseAGTAGAGGCAGGGATGATGT4 IL-1α_primer_forwardACGGCTGAGTTTCAGTGAGACC5 IL-1α_primer_reverseCACTCTGGTAGGTGTAAGGTGC6 IL-6_primer_forwardCTGCAAGAGACTTCCATCCAG7 IL-6_primer_reverseAGTGGTATAGACAGGTCTGTTGG8 TNF-α_primer_forwardCATTCTGGGAGGGGTCTTCC9 TNF-α_primer_reverseGGTTGAGGGTGTCTGA AGGA10MMP1_primer_forwardCGACTCTAGAAACACAAGAGCAAGA11MMP1_primer_reverseAAGGTTAGCTTACTGTCACACGCTT12FLG_primer_forwardAGTGCACTCAGGGGCTCACA13FLG_primer_reverseCCGGCTTGGCCGTAATGTGT14LOR_primer_forwardTCATGATGCTACCCGAGGTTT15L OR_primer_reverseCAGAACTAGATGCAGCCGGAG16procollagen_primer_forwardGGCCCAGAAGAACTGGTACA17procollagen_primer_reverseCGCTGTTCTTGCAGTGGTAG18HAS2_primer_forwardATGCTTGACCCAGCCTCATC19HAS2_primer_reverseTTAAAATCTGGACATCTCCCCCAA20

[0076] Changes in the expression of each factor in the experimental and control groups compared to the untreated group were quantitatively measured using a Gel documentation system, and the results of comparative measurements of the expression levels of IL-1α, IL-6, TNF-α, LOR, FLG, MMP-1, procollagen type I, and HAS2 are shown in Tables 2 to 9 and Figures 1 to 8 below. For convenience, oxylipin at a concentration of 1 μg / mL was denoted as 1 ppm.

[0077] Relative IL-1α Expression Level (%) Untreated Group (UVB and experimental substance untreated) 30.04±2.01 Negative Control Group (UVB treated) 100 Experimental Group 1 (UVB and 15-HEPE treated) Experimental Group 1-1 (0.1 ppm 15-HEPE treated) 61.65±4.17 Experimental Group 1-2 (1 ppm 15-HEPE treated) 65.51±2.13 Experimental Group 1-3 (5 ppm 15-HEPE treated) 43.96±1.74 Experimental Group 1-4 (10 ppm 5,15-HETE treated) 38.15±8.39 Experimental Group 2 (UVB and 5,15-HETE treated) Experimental Group 2-1 (0.1 ppm 5,15-HETE treated) 60.82±2.86 Experimental Group 2-2 (1 ppm 5,15-HETE Treatment) 51.10±6.86 Experimental Groups 2-3 (5 ppm 5,15-HETE treatment) 34.94±8.35 Experimental Groups 2-4 (10 ppm 5,15-HETE treatment) 29.83±6.96 Positive Control (UVB and 10 μM HC treatment) 40.29±2.58

[0078] Relative IL-6 Expression Level (%) Untreated Group (UVB and experimental substance untreated) 32.71±3.43 Negative Control Group (UVB treated) 100 Experimental Group 1 (UVB and 15-HEPE treated) Experimental Group 1-1 (0.1 ppm 15-HEPE treated) 71.28±8.69 Experimental Group 1-2 (1 ppm 15-HEPE treated) 64.98±5.81 Experimental Group 1-3 (5 ppm 15-HEPE treated) 66.18±5.02 Experimental Group 1-4 (10 ppm 5,15-HETE treated) 62.03±4.83 Experimental Group 2 (UVB and 5,15-HETE treated) Experimental Group 2-1 (0.1 ppm 5,15-HETE treated) 51.99±1.88 Experimental Group 2-2 (1 ppm 5,15-HETE Treatment) 51.16±0.69 Experimental Group 2-3 (5 ppm 5,15-HETE treatment) 46.44±1.06 Experimental Group 2-4 (10 ppm 5,15-HETE treatment) 42.41±1.61 Positive Control (UVB and 10 μM HC treatment) 42.82±4.97

[0079] Relative TNF-α Expression Level (%) Untreated Group (UVB and experimental substance untreated) 26.04±3.60 Negative Control Group (UVB treated) 100 Experimental Group 1 (UVB and 15-HEPE treated) Experimental Group 1-1 (0.1 ppm 15-HEPE treated) 54.54±3.07 Experimental Group 1-2 (1 ppm 15-HEPE treated) 43.33±3.24 Experimental Group 1-3 (5 ppm 15-HEPE treated) 33.00±2.46 Experimental Group 1-4 (10 ppm 5,15-HETE treated) 30.51±3.25 Experimental Group 2 (UVB and 5,15-HETE treated) Experimental Group 2-1 (0.1 ppm 5,15-HETE treated) 50.69±3.94 Experimental Group 2-2 (1 ppm 5,15-HETE Treatment) 44.41±1.72 Experimental Group 2-3 (5 ppm 5,15-HETE treatment) 29.38±1.41 Experimental Group 2-4 (10 ppm 5,15-HETE treatment) 24.17±0.97 Positive Control (UVB and 10 μM HC treatment) 35.32±3.58

[0080] Relative LOR Expression Amount (%) Negative Control (Untreated with experimental substance) 100 Experimental Group 3 (Treated with 15-HEPE) Experimental Group 3-1 (Treated with 0.1 ppm 15-HEPE) 111.10±7.80 Experimental Group 3-2 (Treated with 1 ppm 15-HEPE) 127.14±6.21 Experimental Group 3-3 (Treated with 5 ppm 15-HEPE) 131.63±3.73 Experimental Group 3-4 (Treated with 10 ppm 5,15-HETE) 133.95±3.11 Experimental Group 4 (Treated with 5,15-HETE) Experimental Group 4-1 (Treated with 0.1 ppm 5,15-HETE) 100.17±5.06 Experimental Group 4-2 (Treated with 1 ppm 5,15-HETE) 112.42±4.17 Experimental Group 4-3 (5 ppm 5,15-HETE treatment) 126.43±8.29 Experimental group 4-4 (10 ppm 5,15-HETE treatment) 136.68±5.75 Positive control group (10 mM CaCl2 treatment) 153.99±5.14

[0081] Relative FLG Expression Amount (%) Negative Control (Untreated with experimental substance) 100 Experimental Group 3 (Treated with 15-HEPE) Experimental Group 3-1 (Treated with 0.1 ppm 15-HEPE) 108.13±8.79 Experimental Group 3-2 (Treated with 1 ppm 15-HEPE) 119.24±7.87 Experimental Group 3-3 (Treated with 5 ppm 15-HEPE) 134.87±4.46 Experimental Group 3-4 (Treated with 10 ppm 5,15-HETE) 194.54±1.26 Experimental Group 4 (Treated with 5,15-HETE) Experimental Group 4-1 (Treated with 0.1 ppm 5,15-HETE) 157.30±3.86 Experimental Group 4-2 (Treated with 1 ppm 5,15-HETE) 166.31±2.53 Experimental Group 4-3 (5 ppm 5,15-HETE treatment) 175.47±1.42 Experimental group 4-4 (10 ppm 5,15-HETE treatment) 206.96±10.41 Positive control group (10 mM CaCl2 treatment) 190.34±10.19

[0082] Relative MMP-1 Expression Level (%) Untreated Group (UVB and experimental substance untreated) 36.41±2.58 Negative Control Group (UVB treated) 100 Experimental Group 1 (UVB and 15-HEPE treated) Experimental Group 1-1 (0.1 ppm 15-HEPE treated) 70.27±6.02 Experimental Group 1-2 (1 ppm 15-HEPE treated) 66.76±6.72 Experimental Group 1-3 (5 ppm 15-HEPE treated) 60.25±5.65 Experimental Group 1-4 (10 ppm 5,15-HETE treated) 50.93±6.99 Experimental Group 2 (UVB and 5,15-HETE treated) Experimental Group 2-1 (0.1 ppm 5,15-HETE treated) 59.19±4.18 Experimental Group 2-2 (1 ppm 5,15-HETE Treatment) 47.40±1.52 Experimental Groups 2-3 (5 ppm 5,15-HETE treatment) 46.22±3.75 Experimental Groups 2-4 (10 ppm 5,15-HETE treatment) 41.67±6.90 Positive Control (UVB and 50 μm RP treatment) 44.84±2.10

[0083] Relative procollagen type I expression level (%) Negative control (untreated with experimental substance) 100 Experimental group 3 (treated with 15-HEPE) Experimental group 3-1 (treated with 0.1 ppm 15-HEPE) 133.83±7.26 Experimental group 3-2 (treated with 1 ppm 15-HEPE) 143.64±4.57 Experimental group 3-3 (treated with 5 ppm 15-HEPE) 184.78±3.10 Experimental group 3-4 (treated with 10 ppm 5,15-HETE) 192.26±4.43 Experimental group 3 (treated with 5,15-HETE) Experimental group 4-1 (treated with 0.1 ppm 5,15-HETE) 154.16±3.60 Experimental group 4-2 (treated with 1 ppm 5,15-HETE) 174.96±7.74 Experimental group 4-3 (5 ppm 5,15-HETE treatment) 184.16±6.45 Experimental group 4-4 (10 ppm 5,15-HETE treatment) 209.73±5.88 Positive control group (50 μM RP treatment) 203.74±5.68

[0084] Relative HAS2 Expression Level (%) Negative Control (Untreated with experimental substance) 100 Experimental Group 3 (Treated with 15-HEPE) Experimental Group 3-1 (Treated with 0.1 ppm 15-HEPE) 101.08±3.24 Experimental Group 3-2 (Treated with 1 ppm 15-HEPE) 107.35±1.05 Experimental Group 3-3 (Treated with 5 ppm 15-HEPE) 114.89±8.70 Experimental Group 3-4 (Treated with 10 ppm 5,15-HETE) 120.71±0.94 Experimental Group 4 (Treated with 5,15-HETE) Experimental Group 4-1 (Treated with 0.1 ppm 5,15-HETE) 108.09±4.18 Experimental Group 4-2 (Treated with 1 ppm 5,15-HETE) 114.09±5.72 Experimental Group 4-3 (5 ppm 5,15-HETE treatment) 125.12±6.55 Experimental group 4-4 (10 ppm 5,15-HETE treatment) 135.12±9.32 Positive control group (50 ppm HA treatment) 141.30±10.14

[0085] As a result of evaluating changes in expression for each factor, it was found that the expression levels of IL-1α, IL-6, and TNF-α decreased in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, confirming that 15-HEPE and 5,15-HETE have effects that alleviate skin inflammation and irritation (Figs. 1 to 3).

[0086] In addition, the expression levels of LOR and FLG were found to increase in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, confirming that 15-HEPE and 5,15-HETE have the effect of improving the skin barrier by promoting skin barrier protein synthesis (Figs. 4 and 5).

[0087] Meanwhile, the expression level of MMP-1, which is involved in collagen degradation and skin aging, decreased in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, whereas the expression level of procollagen type I, which is a precursor of type 1 collagen and is involved in skin elasticity and wrinkle improvement, increased in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, confirming that 15-HEPE and 5,15-HETE have a skin wrinkle improvement effect (Figs. 6 and 7).

[0088] In addition, the expression level of HAS2 was found to increase in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE, and from this, it was confirmed that 15-HEPE and 5,15-HETE have the effect of moisturizing the skin or improving skin hydration by promoting the expression of hyaluronic acid synthase (Fig. 8).

[0089]

[0090] 2-2. Evaluation of Expression Levels of Genes Related to Skin Condition Improvement in Skin Cells Following Combined Treatment with 15-HEPE and 5,15-HETE

[0091] To confirm the skin condition improvement effect when two types of oxylipins (15-HEPE and 5,15-HETE) prepared according to Example 1 are combined and treated on the skin, changes in the expression of factors (IL-6, LOR, MMP-1) related to skin condition improvement were evaluated after combining 15-HEPE and 5,15-HETE with skin cells (keratinocytes or fibroblasts).

[0092] The remaining process, excluding the combined treatment of HEKa or HDFa cells with oxylipin, was carried out in the same manner as in Example 2-1, and the results of comparative measurements of expression levels of IL-6, LOR, and MMP-1 are shown in Tables 10 to 12 and Figures 9 to 11 below.

[0093] Relative IL-6 Expression Level (%) Untreated group (untreated with UVB and experimental substance) 33.34±4.45 Negative control group (treated with UVB) 100 Experimental Group 5 (treated with UVB and 15-HEPE 25% + 5,15-HETE 75% mixture) Experimental Group 5-1 (treated with mixture 5 ppm) 65.22±1.22 Experimental Group 5-2 (treated with mixture 10 ppm) 45.51±2.81 Experimental Group 6 (treated with UVB and 15-HEPE 50% + 5,15-HETE 50% mixture) Experimental Group 6-1 (treated with mixture 5 ppm) 66.18±5.02 Experimental Group 6-2 (treated with mixture 10 ppm) 49.95±2.83 Experimental Group 7 (treated with UVB and 15-HEPE 75% + 5,15-HETE 25% Mixture Treatment) Experimental Group 7-1 (5 ppm Mixture Treatment) 69.17±1.88 Experimental Group 7-2 (10 ppm Mixture Treatment) 60.01±0.69 Experimental Group 1-4 (UVB and 10 ppm 15-HEPE Treatment) 63.88±3.24 Experimental Group 2-4 (UVB and 10 ppm 5,15-HEPE Treatment) 52.66±2.90 Positive Control (UVB and 10 μM HC Treatment) 45.16±2.50

[0094] Relative LOR Expression Amount (%) Negative Control (Untreated with experimental substance) 100 Experimental Group 8 (Treated with 15-HEPE 25% + 5,15-HETE 75% mixture) Experimental Group 8-1 (Treated with mixture 5 ppm) 133.27±4.80 Experimental Group 8-2 (Treated with mixture 10 ppm) 139.19±3.21 Experimental Group 9 (Treated with 15-HEPE 50% + 5,15-HETE 50% mixture) Experimental Group 9-1 (Treated with mixture 5 ppm) 143.38±3.11 Experimental Group 9-2 (Treated with mixture 10 ppm) 147.35±4.11 Experimental Group 10 (Treated with 15-HEPE 75% + 5,15-HETE 25% mixture) Experimental Group 10-1 (Treated with mixture 5 ppm Treatment) 142.11±4.06 Experimental Group 10-2 (Treated with 10 ppm mixture) 149.55±3.68 Experimental Group 3-3 (Treated with 5 ppm 15-HEPE) 139.28±4.29 Experimental Group 4-4 (Treated with 10 ppm 5,15-HETE) 141.22±5.75 Positive Control (Treated with 10 mM CaCl2) 162.71±1.14

[0095] Relative MMP-1 Expression Level (%) Untreated group (untreated with UVB and experimental substance) 28.15±1.24 Negative control group (treated with UVB) 100 Experimental Group 5 (treated with UVB and 15-HEPE 25% + 5,15-HETE 75% mixture) Experimental Group 5-1 (treated with 5 ppm mixture) 50.34±4.83 Experimental Group 5-2 (treated with 10 ppm mixture) 39.56±3.61 Experimental Group 6 (treated with UVB and 15-HEPE 50% + 5,15-HETE 50% mixture) Experimental Group 6-1 (treated with 5 ppm mixture) 60.25±5.65 Experimental Group 6-2 (treated with 10 ppm mixture) 50.93±6.99 Experimental Group 7 (treated with UVB and 15-HEPE 75% + 5,15-HETE 25% Mixture Treatment) Experimental Group 7-1 (5 ppm Mixture Treatment) 59.19±4.18 Experimental Group 7-2 (10 ppm Mixture Treatment) 47.40±1.52 Experimental Group 1-4 (UVB and 10 ppm 15-HEPE Treatment) 46.22±3.75 Experimental Group 2-4 (UVB and 10 ppm 5,15-HEPE Treatment) 41.67±6.90 Positive Control (UVB and 50 μM RP Treatment) 34.46±4.00

[0096] As a result of evaluating changes in expression for each factor, it was confirmed that in the combined treatment group treated with 15-HEPE and 5,15-HETE, the expression level of IL-6, a factor causing skin inflammation or irritation, decreased more significantly than in the single treatment groups of 15-HEPE or 5,15-HETE, and the expression level of LOR, a factor playing an important role in skin barrier formation and inhibition of moisture loss, increased more significantly. (Figs. 9 and 10)

[0097] In addition, it was confirmed that in the combined treatment group in which skin cells were treated with 15-HEPE and 5,15-HETE, the expression level of MMP-1, a factor that causes skin aging and wrinkle formation by degrading collagen in skin tissue, was reduced more significantly than in the single treatment groups of 15-HEPE or 5,15-HETE (Fig. 11).

[0098] From these results, it was believed that a complex oxylipin composition containing a combination of 15-HEPE and 5,15-HETE could achieve a superior skin condition improvement effect compared to a single oxylipin composition.

[0099]

[0100] 2-3. Evaluation of Skin Cell Regeneration Efficacy Following Treatment with 15-HEPE or 5,15-HETE

[0101] A wound healing assay was performed to confirm the skin regeneration effect of the two types of oxylipins (15-HEPE and 5,15-HETE) prepared according to Example 1.

[0102] Specifically, skin cells (HEKa) were cultured in a 6-well plate, and the bottom of the plate was scraped using a pipette tip to create a non-adherent area. Then, two types of oxylipins were treated at concentrations of 0.1, 1, 5, and 10 μg / mL, respectively, and cultured for 18 hours. 0.1% madecassoside (MD) was used as a control.

[0103] The same location was photographed under a microscope at 0 and 18 hours after the injury occurred to observe the reduced area over 18 hours. The results of the observation of each plate are shown in Figures 12 and 13.

[0104] As a result, in the 15-HEPE and 5,15-HETE treatment groups, cell proliferation, migration, and recovery were promoted, and the area of ​​the non-cell-attached region (wound gap) was significantly reduced compared to the control group. In particular, the wound gap was found to decrease in a concentration-dependent manner depending on the treatment concentrations of 15-HEPE and 5,15-HETE. From this, it was confirmed that 15-HEPE and 5,15-HETE possess skin regenerative efficacy.

[0105] This relates to a composition for improving skin condition containing oxylipin.

Claims

A cosmetic composition for improving skin condition comprising 1,15-HEPE (15(S)-hydroxy-eicosapentaenoic acid), 5,15-HETE (5(S)15(S)-DiHETE), or a combination thereof.

2. A cosmetic composition for improving skin condition according to claim 1, wherein the skin condition improvement comprises one or more selected from alleviating skin inflammation, alleviating skin irritation, strengthening the skin barrier, improving skin wrinkles, moisturizing the skin, and regenerating the skin.

3. A cosmetic composition for improving skin condition according to claim 1, wherein the cosmetic composition has one or more of the following characteristics (a) to (d): (a) Reduces the expression of IL-1α, IL-6, and TNF-α in skin cells, (b) Increases the expression of loricrin (LOR) and filaggrin (FLG) in skin cells, (c) Decrease the expression of MMP-1 in skin cells and increase the expression of procollagen type I, and (d) Increases the expression of HAS2 in skin cells.

4. A cosmetic composition for improving skin condition according to claim 3, wherein the skin cells are fibroblasts or keratinocytes.

5. A cosmetic composition for improving skin condition according to Claim 1, wherein the 15-HEPE, 5,15-HETE, or a combination thereof is included in the cosmetic composition at a concentration of 0.01 to 50 μg / mL.

6. In claim 1, the cosmetic composition comprises both 15-HEPE and 5,15-HETE, and A cosmetic composition for improving skin condition, wherein the weight ratio of the 15-HEPE and 5,15-HETE is 1:9 to 9:

1. A topical skin composition for improving skin condition, comprising 7,15-HEPE, 5,15-HETE, or a combination thereof.