Unlock instant, AI-driven research and patent intelligence for your innovation.

Zika virus loop-mediated isothermal amplification detection kit and using method

A ring-mediated isothermal and Zika virus technology, applied in the field of Zika virus detection, can solve the problems of high experimental cost and long detection time

Inactive Publication Date: 2016-12-21
CHINA INSPECTION LAB TECH CO LTD
View PDF2 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the IgM of Zika virus may also cross-react with dengue fever, yellow fever, Japanese encephalitis, and West Nile virus, while the traditional PCR reaction has a certain dependence on temperature, requiring a precise temperature control system and a long detection time , high experimental cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zika virus loop-mediated isothermal amplification detection kit and using method
  • Zika virus loop-mediated isothermal amplification detection kit and using method
  • Zika virus loop-mediated isothermal amplification detection kit and using method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0030] 1. Test materials and methods

[0031] 1.1 Test material

[0032] The artificially synthesized fragment of the Zika virus E gene is artificially synthesized with reference to the sequence published on Genbank (KU312312.1). The fragment is connected to the pCR II vector and transformed into a competent cell DH5α in the form of a 30% glycerol solution store.

[0033] 1.2 Primer design

[0034] Using DNAMAN software to compare the E gene of Zika virus, select the conserved region near the N-glycosylation site of the E gene as the target sequence, and use the online software PrimerExplorer V5 (http: / / primerexplorer.jp / e / ) to design The loop-mediated isothermal amplification primer set of the E gene. The E gene loop-mediated isothermal amplification primer set consists of a pair of outer primers (SEQ No.1, SEQ No.2), a pair of inner primers (SEQ No.3, SEQ No.4) and a pair of loop primers (SEQ No. 5, SEQ No.6) composition, its primer sequence is:

[0035]

[0036] 1.3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a loop-mediated isothermal amplification kit for detecting Zika viruses and a using method of the kit. The kit is characterized by consisting of a Zika virus envelop protein (E) gene loop-mediated isothermal amplification primer mixed solution, a loop-mediated isothermal amplification reaction pre-mixed solution, a Zika virus E gene positive quality control and a Zika virus E gene negative quality control, and the kit is applicable to the rapid detection of the Zika viruses. The Zika virus E gene loop-mediated isothermal amplification primer group comprises a pair of outer primers (5'-3' sequences are shown as: AAGCACTGGCTGGTTCAC and TCCAGAGCTCCAGCAAGG), a pair of inner primers (5'-3' sequences are shown as: GTGGAGTTCCGGTGTCTGCCAAGGAGTGGTTCCACGACAT and AGAGTTCAAGGACGCACATGCCTGCTCCTTCTTGACTCCCTA) and a pair of loop primers (5'-3' sequences are shown as: CAGCGTGCCAAGGTAATGGA and AAAAGGCAAACTGTCGTGGT). The using method of the kit is characterized in that the real-time rapid diagnosis of the Zika viruses can be achieved by virtue of an isothermal amplification fluorescent detection system. The method is strong in specificity and high in sensitivity; therefore, a convenient and rapid way is provided for the prevention and control of the Zika viruses and for conducing trend investigation and analysis.

Description

technical field [0001] The present invention relates to a set of primers, kits and usage methods for rapid virus detection, in particular to a set of loop-mediated isothermal amplification primers for detection of Zika virus outbreaks in Central and South America since May 2015, The kit and the use method thereof belong to the field of Zika virus detection. Background technique [0002] In 1947, scientists at the Yellow Fever Institute in Entebbe, Uganda, isolated a new virus when they used rhesus monkeys in the Zika jungle on the outskirts of the city to study yellow fever, and named it Zika virus (Zika virus), referred to as ZIKV. In 1948, the same virus was also isolated from the Aedes african mosquito in the jungle. According to records, the earliest human infection cases were seen in Nigeria and Tanzania in 1952. Since then, sporadic cases have been reported in many countries, but they are mainly prevalent in tropical and subtropical regions of the world; in 2007, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/701C12Q2531/119C12Q2563/107C12Q2561/113
Inventor 殷宏邹明强薛强
Owner CHINA INSPECTION LAB TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More