T cell antigen conjugates with various construct optimizations

Abstract

A trifunctional molecule is provided, comprising (i) a target-specific ligand, (ii) a ligand that binds a protein associated with the TCR complex, and (iii) a T cell receptor signaling domain polypeptide. Variants of the molecule are provided, including variants that exhibit optimized surface expression, transduction efficiency, and effector function. Variations include, for example, different ligands that bind to CD3ε (e.g., OKT3, L2K, F6A, UCHT1, and humanized UCHT1), different signaling domains, and different linkers between domains.

Description

[0001] Cross-references

[0002] This application claims the benefit of U.S. Provisional Application No. 62 / 699,173, filed July 17, 2018, U.S. Provisional Application No. 62 / 703,037, filed July 25, 2018, U.S. Provisional Application No. 62 / 773,120, filed November 29, 2018, U.S. Provisional Application No. 62 / 826,853, filed March 29, 2019, U.S. Provisional Application No. 62 / 828,879, filed April 3, 2019, U.S. Provisional Application No. 62 / 839,235, filed April 26, 2019, U.S. Non-Provisional Application No. 16 / 442,274, filed June 14, 2019, and U.S. Provisional Application No. 62 / 874,426, filed July 15, 2019, each of which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing submitted electronically in ASCII format and incorporated herein by reference in its entirety. The ASCII copy generated on July 17, 2019 is named 55247704601_SL.txt and is 131,072 bytes in size. Summary of the Invention

[0005] In certain embodiments, disclosed herein are nucleic acid sequences encoding CD19 trifunctional T cell antigen conjugates (CD19-TACs). In certain embodiments, the nucleic acid sequence encoding the CD19 trifunctional T cell antigen conjugate (CD19-TAC) comprises: (a) a first polynucleotide encoding a ligand that selectively binds to the CD19 antigen. In certain embodiments, the nucleic acid sequence encoding the CD19 trifunctional T cell antigen conjugate (CD19-TAC) comprises: (b) a second polynucleotide encoding a UCHT1 ligand that binds to CD3. In certain embodiments, the nucleic acid sequence encoding the CD19 trifunctional T cell antigen conjugate (CD19-TAC) comprises: (c) a third polynucleotide encoding a TCR signaling domain polypeptide comprising a cytoplasmic domain and a transmembrane domain. In certain embodiments, the components encoded by the first, second, and / or third polynucleotides are linked in any suitable manner, for example, in any suitable order and / or comprising any suitable linker. In certain embodiments, the component encoded by (a), the component encoded by (b), and the component encoded by (c) are fused directly to each other or connected by at least one linker. In certain embodiments, the ligand that selectively binds to the CD19 antigen is a single-chain variable fragment (scFv). In certain embodiments, the ligand that selectively binds to the CD19 antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 36. In certain embodiments, the UCHT1 ligand is a single-chain antibody. In certain embodiments, the UCHT1 ligand comprises a Y182T mutation (SEQ ID NO: 72). In certain embodiments, the UCHT1 ligand is a humanized variant of the UCHT1 ligand (huUCHT1) (SEQ ID NO: 44). In certain embodiments, the UCHT1 ligand is a humanized variant of UCHT1 comprising a Y177T mutation (huUCHT1(Y177T)) (SEQ ID NO: 46). In certain embodiments, the UCHT1 ligand comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 14, SEQ ID NO: 72, SEQ ID NO: 44, or SEQ ID NO: 46. In certain embodiments, the cytoplasmic domain is a CD4 cytoplasmic domain and the transmembrane domain is a CD4 transmembrane domain.In certain embodiments, the polypeptide encoded by the third polynucleotide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 18. In certain embodiments, the component encoded by (a) and the component encoded by (c) are fused to the component encoded by (b). In certain embodiments, the component encoded by (b) and the component encoded by (c) are fused to the component encoded by (a). In certain embodiments, at least one linker connects the component encoded by (a) to the component encoded by (b). In certain embodiments, the at least one linker is a G4S flexible linker (SEQ ID NO: 73), a large protein domain, a long helical structure or a short helical structure. In certain embodiments, the at least one linker comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 12 (G4S flexible linker ("G4S" is disclosed as SEQ ID NO: 73)), SEQ ID NO: 32 (large protein domain), SEQ ID NO: 30 (long helical structure), or SEQ ID NO: 28 (short helical structure). In certain embodiments, the CD3 is CD3 of a TCR complex on a cell expressing the second polynucleotide. In certain embodiments, binding of the CD3 induces activation of a cell expressing the second polynucleotide. In certain embodiments, the CD19-TAC comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 63. In certain embodiments, the CD19-TAC comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 64. In certain embodiments, the nucleic acid sequence does not encode a costimulatory domain. In certain embodiments, the nucleic acid sequence does not encode an activation domain.

[0006] In certain embodiments, disclosed herein are vector constructs comprising (a) a nucleic acid sequence disclosed herein (eg, a nucleic acid sequence encoding CD19-TAC); and (b) a promoter functional in mammalian cells.

[0007] In certain embodiments, disclosed herein are T cells comprising a nucleic acid sequence disclosed herein (eg, a nucleic acid sequence encoding CD19-TAC).

[0008] In certain embodiments, disclosed herein are pharmaceutical compositions comprising the T cells disclosed herein and a pharmaceutically acceptable excipient.

[0009] In certain embodiments, disclosed herein are methods for treating cancers expressing CD19 in individuals in need thereof, the methods comprising administering to the individual a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition comprising T cells comprising nucleic acid sequences described herein, such as any one or more nucleic acid sequences described herein as encoding CD19 trifunctional T cell antigen conjugates (CD19-TAC)). In certain embodiments, the cancer is a B cell malignancy. In certain embodiments, the cancer is a B cell lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), or non-Hodgkin's lymphoma. In certain embodiments, the pharmaceutical composition is administered intraarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullaryly, intramuscularly, intravenously, or intraperitoneally.

[0010] In certain embodiments, disclosed herein are nucleic acid sequences encoding trifunctional T cell antigen conjugates (Tri-TACs), comprising: (a) a first polynucleotide encoding a target-specific ligand; (b) a second polynucleotide encoding a ligand that binds a protein associated with the TCR complex; and (c) a third polynucleotide encoding a T cell receptor signaling domain polypeptide; wherein the ligand that binds a protein associated with the TCR complex is selected from OKT3, F6A, or L2K. In certain embodiments, the components encoded by (a), (b), and (c) are directly fused to each other or connected by at least one linker. In certain embodiments, the components encoded by (a) and (b) are directly fused and connected to the component encoded by (c) via a linker. In certain embodiments, the components encoded by (b) and (c) are directly fused and connected to the component encoded by (a) via a linker. In certain embodiments, the at least one connector is a G4S flexible connector (SEQ ID NO: 73), a large protein domain, a long helical structure, or a short helical structure. In certain embodiments, the at least one connector has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 12 (G4S flexible connector ("G4S" is disclosed as SEQ ID NO: 73)), SEQ ID NO: 32 (large protein domain), SEQ ID NO: 30 (long helical structure), or SEQ ID NO: 28 (short helical structure). In certain embodiments, the ligand that binds to a protein associated with the TCR complex is OKT3. In certain embodiments, the ligand that binds a protein associated with the TCR complex comprises an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 22. In certain embodiments, the ligand that binds a protein associated with the TCR complex is F6A. In certain embodiments, the ligand that binds a protein associated with the TCR complex comprises an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 24. In certain embodiments, the ligand that binds a protein associated with the TCR complex is L2K.In certain embodiments, the ligand that binds to a protein associated with the TCR complex comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 26. In certain embodiments, the protein associated with the TCR complex is CD3. In certain embodiments, the target-specific ligand selectively binds to a tumor antigen. In certain embodiments, the target-specific ligand is a designed ankyrin repeat (DARPin) polypeptide or a single-chain variable fragment (scFv). In certain embodiments, the target-specific ligand selectively binds to a CD19 antigen, a HER2 antigen, or a BCMA antigen. In certain embodiments, the target-specific ligand selectively binds to a HER2 antigen and comprises an antigen-binding domain of an antibody selected from trastuzumab, pertuzumab, lapatinib, neratinib, a trastuzumab-emtansine conjugate, gantuzumab, margetuximab, temetuzumab, and ertumaxomab. In certain embodiments, the target-specific ligand that selectively binds to the BCMA antigen comprises an antigen-binding domain of an antibody selected from the group consisting of Belantamab mafodotin and GSK2857916. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 36, SEQ ID NO: 8, or SEQ ID NO: 34. In certain embodiments, the T cell receptor signaling domain polypeptide comprises a cytoplasmic domain and a transmembrane domain. In certain embodiments, the cytoplasmic domain is a CD4 cytoplasmic domain and the transmembrane domain is a CD4 transmembrane domain, or wherein the cytoplasmic domain is a CD8 cytoplasmic domain and the transmembrane domain is a CD8 transmembrane domain. In certain embodiments, the nucleic acid sequence further comprises a leader sequence. In certain embodiments, the leader sequence comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6, SEQ ID NO: 48, or SEQ ID NO: 50. In certain embodiments, the CD3 is CD3 of a TCR complex on a cell expressing the second polynucleotide. In certain embodiments, binding of the CD3 induces activation of a cell expressing the second polynucleotide.In certain embodiments, the Tri-TAC comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, or SEQ ID NO: 61. In certain embodiments, the Tri-TAC comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, or SEQ ID NO: 62. In certain embodiments, the nucleic acid sequence does not encode a costimulatory domain. In certain embodiments, the nucleic acid sequence does not encode an activation domain.

[0011] In certain embodiments, disclosed herein are nucleic acid sequences encoding trifunctional T cell antigen conjugates (Tri-TACs), comprising: (a) a first polynucleotide encoding a target-specific ligand; (b) a second polynucleotide encoding a ligand that binds to a protein associated with the TCR complex; and (c) a third polynucleotide encoding a T cell receptor signaling domain polypeptide; wherein the nucleic acid sequence further comprises a leader sequence, and wherein the component encoded by (a), the component encoded by (b), and the component encoded by (c) are directly fused to each other or connected by at least one linker. In certain embodiments, the target-specific ligand selectively binds to a tumor antigen. In certain embodiments, the target-specific ligand is a designed ankyrin repeat (DARPin) polypeptide or a single-chain variable fragment (scFv). In certain embodiments, the target-specific ligand selectively binds to a CD19 antigen, a HER2 antigen, or a BCMA antigen. In certain embodiments, the target-specific ligand selectively binds to the HER-2 antigen and comprises an antigen-binding domain of an antibody selected from trastuzumab, pertuzumab, lapatinib, neratinib, trastuzumab-emtansine conjugate, gantuzumab, margetuximab, temetuzumab, and ertumaxomab. In certain embodiments, the target-specific ligand selectively binds to the BCMA antigen and comprises an antigen-binding domain of an antibody selected from belantamab mafodotin and GSK2857916. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 36, SEQ ID NO: 8, SEQ ID NO: 34, SEQ ID NO: 52, or SEQ ID NO: 54. In certain embodiments, the ligand that binds to a protein associated with the TCR complex is selected from UCHT1, UCHT1(Y182T), huUCHT1, huUCHT1(Y177T), OKT3, F6A, or L2K. In certain embodiments, the ligand that binds to a protein associated with the TCR complex has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 14, SEQ ID NO: 72, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 26. In certain embodiments, the protein associated with the TCR complex is CD3. In certain embodiments, the T cell receptor signaling domain polypeptide comprises a cytoplasmic domain and a transmembrane domain.In certain embodiments, the cytoplasmic domain is a CD4 cytoplasmic domain and the transmembrane domain is a CD4 transmembrane domain, or wherein the cytoplasmic domain is a CD8 cytoplasmic domain and the transmembrane domain is a CD8 transmembrane domain. In certain embodiments, the leader sequence comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 6, SEQ ID NO: 48 or SEQ ID NO: 50. In certain embodiments, the component encoded by (a) and the component encoded by (b) are directly fused and connected to the component encoded by (c) via a connector. In certain embodiments, the component encoded by (b) and the component encoded by (c) are directly fused and connected to the component encoded by (a) via a connector. In certain embodiments, the at least one connector is a G4S flexible connector (SEQ ID NO: 73), a large protein domain, a long helical structure or a short helical structure. In certain embodiments, the at least one linker has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 12 (G4S flexible linker ("G4S" is disclosed as SEQ ID NO: 73)), SEQ ID NO: 32 (large protein domain), SEQ ID NO: 30 (long helical structure), or SEQ ID NO: 28 (short helical structure). In certain embodiments, the CD3 is CD3 of a TCR complex on a cell expressing the second polynucleotide. In certain embodiments, binding of the CD3 induces activation of a cell expressing the second polynucleotide. In certain embodiments, the Tri-TAC comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59 or SEQ ID NO: 61.In certain embodiments, the Tri-TAC comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, or SEQ ID NO: 62. In certain embodiments, the nucleic acid sequence does not encode a costimulatory domain. In certain embodiments, the nucleic acid sequence does not encode an activation domain.

[0012] Disclosed herein, in certain embodiments, are polypeptides encoded by the nucleic acid sequences disclosed herein.

[0013] In certain embodiments, disclosed herein are vector constructs comprising: (a) a nucleic acid sequence disclosed herein; and (b) a promoter functional in mammalian cells.

[0014] Disclosed herein, in certain embodiments, are T cells comprising a nucleic acid sequence disclosed herein.

[0015] In certain embodiments, disclosed herein are pharmaceutical compositions comprising the T cells disclosed herein and a pharmaceutically acceptable excipient.

[0016] In certain embodiments, disclosed herein are methods for treating cancer in an individual in need thereof, comprising administering to the individual a pharmaceutical composition disclosed herein. In certain embodiments, the subject is a mammal. In certain embodiments, the cancer is a solid cancer or a liquid cancer. In certain embodiments, the cancer is lung cancer, breast cancer, multiple myeloma, glioblastoma, gastric cancer, ovarian cancer, gastric cancer, colorectal cancer, urothelial carcinoma, endometrial cancer, or colon cancer. In certain embodiments, the cancer comprises cancer cells that express CD19. In certain embodiments, the cancer is a B-cell malignancy. In certain embodiments, the cancer is a B-cell lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), or non-Hodgkin's lymphoma. In certain embodiments, the cancer comprises cancer cells that express HER-2. In certain embodiments, the cancer is breast cancer, bladder cancer, pancreatic cancer, ovarian cancer, or gastric cancer. In certain embodiments, the cancer comprises cancer cells that express BCMA. In certain embodiments, the cancer is a leukemia, lymphoma, or multiple myeloma. In certain embodiments, the pharmaceutical composition is administered to the individual intraarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, intravenously, or intraperitoneally. In certain embodiments, the pharmaceutical composition is in unit dosage form. In certain embodiments, the pharmaceutical composition comprises approximately 0.5-2×10 9 In certain embodiments, the pharmaceutical composition is administered daily, weekly, biweekly, monthly, bimonthly, or annually.

[0017] In certain embodiments, disclosed herein is a nucleic acid sequence encoding a CD19 trifunctional T cell antigen conjugate (CD19-TAC), comprising: (a) a first polynucleotide encoding a ligand that selectively binds to the CD19 antigen; (b) a second polynucleotide encoding a humanized variant of the UCHT1 ligand comprising a Y177T mutation (huUCHT1) (huUCHT1(Y177T)) that binds to CD3; and (c) a third polynucleotide encoding a polypeptide comprising a CD4 cytoplasmic domain and a CD4 transmembrane domain; wherein the ligand encoded by (a), the ligand encoded by (b), and the polypeptide encoded by (c) are directly fused to each other or connected by at least one connector. In certain embodiments, the nucleic acid sequence does not encode a costimulatory domain, an activation domain, or both a costimulatory domain and an activation domain. In certain embodiments, the ligand that selectively binds to the CD19 antigen is a single-chain variable fragment (scFv). In certain embodiments, the ligand that selectively binds to the CD19 antigen comprises an amino acid sequence that has at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 36. In certain embodiments, the ligand that selectively binds to the CD19 antigen comprises the amino acid sequence of SEQ ID NO: 36. In certain embodiments, the huUCHT1(Y177T) ligand is a single-chain antibody. In certain embodiments, the huUCHT1(Y177T) ligand comprises an amino acid sequence that has at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 46. In certain embodiments, the huUCHT1(Y177T) ligand comprises the amino acid sequence of SEQ ID NO: 46. In certain embodiments, the polypeptide encoded by the third polynucleotide comprises an amino acid sequence that has at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 18.

[0018] In certain embodiments, the third polynucleotide encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 18. In certain embodiments, the at least one linker is a G4S flexible linker, a large protein domain, a long helical structure, or a short helical structure. In certain embodiments, the at least one linker comprises an amino acid sequence having at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 30, or SEQ ID NO: 28. In certain embodiments, the at least one linker comprises an amino acid sequence having at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 30, or SEQ ID NO: 28. In certain embodiments, the CD3 is expressed on cells expressing the second polynucleotide. In certain embodiments, the CD19-TAC comprises a nucleic acid sequence having at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 63. In certain embodiments, the CD19-TAC comprises an amino acid sequence having at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 64. In certain embodiments, the CD19-TAC comprises the sequence of SEQ ID NO: 63 or SEQ ID NO: 64. In certain embodiments, disclosed herein are vector constructs comprising: (a) a nucleic acid sequence disclosed herein; and (b) a promoter functional in mammalian cells. In certain embodiments, disclosed herein are compositions comprising a vector disclosed herein and an excipient. In certain embodiments, disclosed herein are polypeptides encoded by the nucleic acid sequences disclosed herein.

[0019] In certain embodiments, disclosed herein are nucleic acid sequences encoding HER2 trifunctional T cell antigen conjugates (HER2-TACs) comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 65, SEQ ID NO: 67, or SEQ ID NO: 75. In certain embodiments, the HER2-TAC comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 66, SEQ ID NO: 68, or SEQ ID NO: 76. In certain embodiments, the nucleic acid sequence does not encode a costimulatory domain. In certain embodiments, the nucleic acid sequence does not encode an activation domain.

[0020] In certain embodiments, disclosed herein are nucleic acid sequences encoding BCMA trifunctional T cell antigen conjugates (BCMA-TACs) comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, or SEQ ID NO: 61. In certain embodiments, the BCMA-TAC comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, or SEQ ID NO: 62. In certain embodiments, the nucleic acid sequence does not encode a costimulatory domain. In certain embodiments, the nucleic acid sequence does not encode an activation domain. Sequence Listing <110> McMaster University TRIUMVIRA IMMUNOLOGICS USA, INC. <120> T cell antigen conjugates with various construct optimizations <130> 55247-704.601 <140> <141> <150> 62 / 839,235 <151> 2019-04-26 <150> 62 / 828,879 <151> 2019-04-03 <150> 62 / 826,853 <151> 2019-03-29 <150> 62 / 773,120 <151> 2018-11-29 <150> 62 / 703,037 <151> 2018-07-25 <150> 62 / 699,173 <151> 2018-07-17 <160> 77 <170> PatentIn version 3.5 <210> 1 <211> 1521 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 1 atgtcacggg gctccgacct gggcaaaaag ctgctggagg ccgctagggc cgggcaggac 60 gatgaagtga gaatcctgat ggccaacggg gctgacgtga atgctaagga tgagtacggc 120 ctgacccccc tgtatctggc tacagcacac ggccatctgg agatcgtgga agtcctgctg 180 aaaaacggag ccgacgtgaa tgcagtcgat gccattgggt tcactcctct gcacctggca 240 gcctttatcg gacatctgga gattgcagaa gtgctgctga agcacggcgc tgacgtgaac 300 gcacaggata agttcggaaa aaccgctttt gacatcagca ttggcaacgg aaatgaagac 360 ctggctgaaa tcctgcagaa actgaatgaa cagaaactga ttagcgaaga agacctgaac 420 cccgggggag gaggagggag cgggggagga ggcagcggcg ggggaggctc tggaggagga 480 gggagcggat ccatggacat ccagatgact cagaccacaa gctccctgtc tgcaagtctg 540 ggcgaccggg tgacaatctc ctgcagagcc tctcaggata ttaggaacta cctgaattgg 600 tatcagcaga aacctgatgg cacagtcaag ctgctgatct actataccag ccggctgcac 660 tcaggcgtgc caagcaaatt ctcaggaagc ggctccggga ctgactactc cctgaccatc 720 tctaacctgg agcaggaaga tattgctacc tatttctgcc agcagggcaa tacactgccc 780 tggacttttg ccggaggcac caaactggag atcaaggggg gaggcgggag tggaggcggg 840 ggatcaggag gaggaggcag cggaggagga gggtccgagg tccagctgca gcagagcgga 900 ccagaactgg tgaagcccgg agcaagtatg aaaatctcct gtaaggcctc aggatacagc 960 ttcaccggct atacaatgaa ctgggtgaaa cagtcccatg gcaagaacct ggaatggatg 1020 gggctgatta atccttacaa aggcgtcagc acctataatc agaagtttaa agacaaggcc 1080 acactgactg tggataagtc tagttcaacc gcttacatgg agctgctgtc cctgacatct 1140 gaagacagtg ccgtgtacta ttgtgctcgg tctggctact atggggacag tgattggtac 1200 ttcgatgtct ggggacaggg cactaccctg accgtgtttt ctactagtgg cggaggagga 1260 tcactcgaga gcggacaggt gctgctggaa tccaatatca aagtcctgcc cacttggtct 1320 accccccgtgc agcctatggc tctgattgtg ctgggaggag tcgcaggact gctgctgttt 1380 atcgggctgg gaattttcttttgcgtgcgc tgccggcacc ggagaaggca ggccgagcgc 1440 atgagccaga tcaagcgact gctgagcgag aagaaaacct gtcagtgtcc ccatagattc 1500 cagaagacct gttcacccat t 1521 <210> 2 <211> 525 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 2 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Ser Asp Leu Gly Lys Lys Leu Leu Glu Ala 20 25 30 Ala Arg Ala Gly Gln Asp Asp Glu Val Arg Ile Leu Met Ala Asn Gly 35 40 45 Ala Asp Val Asn Ala Lys Asp Glu Tyr Gly Leu Thr Pro Leu Tyr Leu 50 55 60 Ala Thr Ala His Gly His Leu Glu Ile Val Glu Val Leu Leu Lys Asn 65 70 75 80 Gly Ala Asp Val Asn Ala Val Asp Ala Ile Gly Phe Thr Pro Leu His 85 90 95 Leu Ala Ala Phe Ile Gly His Leu Glu Ile Ala Glu Val Leu Leu Lys 100 105 110 His Gly Ala Asp Val Asn Ala Gln Asp Lys Phe Gly Lys Thr Ala Phe 115 120 125 Asp Ile Ser Ile Gly Asn Gly Asn Glu Asp Leu Ala Glu Ile Leu Gln 130 135 140 Lys Leu Asn Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Pro Gly 145 150 155 160 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 165 170 175 Gly Gly Gly Ser Gly Ser Met Asp Ile Gln Met Thr Gln Thr Thr Ser 180 185 190 Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala 195 200 205 Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp 210 215 220 Gly Thr Val Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly 225 230 235 240 Val Pro Ser Lys Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu 245 250 255 Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln 260 265 270 Gln Gly Asn Thr Leu Pro Trp Thr Phe Ala Gly Gly Thr Lys Leu Glu 275 280 285 Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 290 295 300 Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu 305 310 315 320 Leu Val Lys Pro Gly Ala Ser Met Lys Ile Ser Cys Lys Ala Ser Gly 325 330 335 Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val Lys Gln Ser His Gly 340 345 350 Lys Asn Leu Glu Trp Met Gly Leu Ile Asn Pro Tyr Lys Gly Val Ser 355 360 365 Thr Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys 370 375 380 Ser Ser Ser Thr Ala Tyr Met Glu Leu Leu Ser Leu Thr Ser Glu Asp 385 390 395 400 Ser Ala Val Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp 405 410 415 Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Thr Leu Thr Val Phe Ser 420 425 430 Thr Ser Gly Gly Gly Gly Ser Leu Glu Ser Gly Gln Val Leu Leu Glu 435 440 445 Ser Asn Ile Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro Met 450 455 460 Ala Leu Ile Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly 465 470 475 480 Leu Gly Ile Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg Gln Ala 485 490 495 Glu Arg Met Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr Cys 500 505 510 Gln Cys Pro His Arg Phe Gln Lys Thr Cys Ser Pro Ile 515 520 525 <210> 3 <211> 1647 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 3 atggactttc aggtgcagat tttctttt ctgctgatt ccgcaagcgt catcgagctc 60 gggggggggg gtcaggatc catggacatc catgactc agaccacaag ctccctgagc 120 gcatccctgg gcgaccgagt gatactca tgcagagcca gccaggatat taggaactac 180 ctgaattggt atcagcagaa acctgacggc acactcaagc tgctgatcta ctatacttcc 240 cggctgcact ctggcgtgcc aagtaaattc tctgggagtg gatcaggcac tgactactca 300 ctgaccatca gcaacctgga gcaggaagat attgctacct atttctgcca gcaggcaat 360 acacctgccct ggacttgc aggcgggacc aactggaga tcaagggcgg cggcggaagt 420 ggaggaggag gctcaggcgg aggaggaggc ggcagggaggg gcaggcgaggt ggcaggcagg 480 cagagcggac cagaactggt gaagcctggc gcatccatga aaatctcttg taaggcctct 540 gggtacagtt tcaccggata tacaatgaac tggtgaac agtctcatgg cagaacctg 600 gatggatgg gcctgattta tccttacaa ggcgtcagca cctataatca gaagtttaa 660 gandaaggcca cactgactgt ggataagctct agttcaccg cttacatgga gctgctgtca 720 ctgacaagcg aagactccgc cgtgtactat tgcgctagga gcggatacta tggcgactcc 780 gattggtact tcgatgtctg ggggcaggga actaccctga ccgtgtttag cactagtgga 840 ggaggaggct ctggaggagg agggagtgga ggcgggggat caggaggagg aggcagcgat 900 atcatgtcac ggggctccga cctgggcaaa aagctgctgg aggccgctag ggccgggcag 960 gacgatgaag tgagaatcct gatggccaac ggggctgacg tgaatgctaa ggatgagtac 1020 ggcctgaccc ccctgtatct ggctacagca cacggccatc tggagatcgt ggaagtcctg 1080 ctgaaaaacg gagccgacgt gaatgcagtc gatgccattg ggttcactcc tctgcacctg 1140 gcagccttta tcggacatct ggagattgca gaagtgctgc tgaagcacgg cgctgacgtg 1200 aacgcacagg ataagttcgg aaaaaccgct tttgacatca gcattggcaa cggaaatgaa 1260 gacctggctg aaatcctgca gaaactgaat gaacagaaac tgattagcga agaagacctg 1320 aacgtcgacg gaggaggagg gtctggagga gggggaagtg gcgggggagg cagcggggga 1380 ggcgggtctc tcgagagtgg ccaggtgctg ctggaaagca atatcaaggt cctgccaact 1440 tggtccaccc cagtgcagcc tatggctctg attgtgctgg gaggagtcgc aggactgctg 1500 ctgtttatcg gcctggggat tttcttttgc gtgcgctgcc ggcaccggag aaggcaggct 1560 gagcgcatgt ctcagattaa gcgactgctg agcgagaaga agacctgtca gtgcccccat 1620 agattccaga aaacctgttc acccatt 1647 <210> 4 <211> 547 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 4 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Glu Leu Gly Gly Gly Gly Ser Gly Ser Met Asp Ile Gln Met 20 25 30 Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr 35 40 45 Ile Ser Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp Tyr 50 55 60 Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr Tyr Thr Ser 65 70 75 80 Arg Leu His Ser Gly Val Pro Ser Lys Phe Ser Gly Ser Gly Ser Gly 85 90 95 Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala 100 105 110 Thr Tyr Phe Cys Gln Asn Thr Leu Pro Trp Thr Phe Ala Gly Gly Thr 115 120 125 Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 130 135 140 Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Gln Gln Ser 145 150 155 160 Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile Ser Cys Lys 165 170 175 Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val Lys Gln 180 185 190 Ser His Gly Lys Asn Leu Glu Trp Met Gly Leu Ile Asn Pro Tyr Lys 195 200 205 Gly Val Ser Thr Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr 210 215 220 Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Leu Ser Leu Thr 225 230 235 240 Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly 245 250 255 Asp Ser Asp Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Thr Leu Thr 260 265 270 Val Phe Ser Thr Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 275 280 285 Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Met Ser Arg Gly Ser 290 295 300 Asp Leu Gly Lys Lys Leu Leu Glu Ala Ala Arg Ala Gly Gln Asp Asp 305 310 315 320 Glu Val Arg Ile Leu Met Ala Asn Gly Ala Asp Val Asn Ala Lys Asp 325 330 335 Glu Tyr Gly Leu Thr Pro Leu Tyr Leu Ala Thr Ala His Gly His Leu 340 345 350 Glu Ile Val Glu Val Leu Leu Lys Asn Gly Ala Asp Val Asn Ala Val 355 360 365 Asp Ala Ile Gly Phe Thr Pro Leu His Leu Ala Ala Phe Ile Gly His 370 375 380 Leu Glu Ile Ala Glu Val Leu Leu Lys His Gly Ala Asp Val Asn Ala 385 390 395 400 Gln Asp Lys Phe Gly Lys Thr Ala Phe Asp Ile Ser Ile Gly Asn Gly 405 410 415 Asn Glu Asp Leu Ala Glu Ile Leu Gln Lys Leu Asn Glu Gln Lys Leu 420 425 430 Ile Ser Glu Glu Asp Leu Asn Val Asp Gly Gly Gly Gly Ser Gly Gly 435 440 445 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Leu Glu Ser 450 455 460 Gly Gln Val Leu Leu Glu Ser Asn Ile Lys Val Leu Pro Thr Trp Ser 465 470 475 480 Thr Pro Val Gln Pro Met Ala Leu Ile Val Leu Gly Gly Val Ala Gly 485 490 495 Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe Phe Cys Val Arg Cys Arg 500 505 510 His Arg Arg Arg Gln Ala Glu Arg Met Ser Gln Ile Lys Arg Leu Leu 515 520 525 Ser Glu Lys Lys Thr Cys Gln Cys Pro His Arg Phe Gln Lys Thr Cys 530 535 540 Ser Pro Ile 545 <210> 5 <211> 54 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 5 atggatttcc aggtccagat tttctccttc ctgctgattt ccgcaagcgt catt 54 <210> 6 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 6 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile <210> 7 <211> 387 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 7 atgtcacggg gctccgacct gggcaaaaag ctgctggagg ccgctagggc cgggcaggac 60 gatgaagtga gaatcctgat ggccaacggg gctgacgtga atgctaagga tgagtacggc 120 ctgacccccc tgtatctggc tacagcacac ggccatctgg agatcgtgga agtcctgctg 180 aaaaacggag ccgacgtgaa tgcagtcgat gccattgggt tcactcctct gcacctggca 240 gcctttatcg gacatctgga gattgcagaa gtgctgctga agcacggcgc tgacgtgaac 300 gcacaggata agttcggaaa aaccgctttt gacatcagca ttggcaacgg aaatgaagac 360 ctggctgaaa tcctgcagaa actgaat 387 <210> 8 <211> 129 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 8 Met Ser Arg Gly Ser Asp Leu Gly Lys Lys Leu Leu Glu Ala Ala Arg 1 5 10 15 Ala Gly Gln Asp Asp Glu Val Arg Ile Leu Met Ala Asn Gly Ala Asp 20 25 30 Val Asn Ala Lys Asp Glu Tyr Gly Leu Thr Pro Leu Tyr Leu Ala Thr 35 40 45 Ala His Gly His Leu Glu Ile Val Glu Val Leu Leu Lys Asn Gly Ala 50 55 60 Asp Val Asn Ala Val Asp Ala Ile Gly Phe Thr Pro Leu His Leu Ala 65 70 75 80 Ala Phe Ile Gly His Leu Glu Ile Ala Glu Val Leu Leu Lys His Gly 85 90 95 Ala Asp Val Asn Ala Gln Asp Lys Phe Gly Lys Thr Ala Phe Asp Ile 100 105 110 Ser Ile Gly Asn Gly Asn Glu Asp Leu Ala Glu Ile Leu Gln Lys Leu 115 120 125 Asn <210> 9 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 9 gaacagaaac tgattagcga agaagacctg 30 <210> 10 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 10 Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 1 5 10 <210> 11 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 11 aaccccgggg gaggaggagg gagcggggga ggaggcagcg gcgggggagg ctctggagga 60 ggagggagcg gatcc 75 <210> 12 <211> 25 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 12 Asn Pro Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 1 5 10 15 Gly Ser Gly Gly Gly Gly Ser Gly Ser 20 25 <210> 13 <211> 750 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 13 atggacatcc agatgactca gaccacaagc tccctgtctg caagtctggg cgaccgggtg 60 acaatctcct gcagagcctc tcaggatatt aggaactacc tgaattggta tcagcagaaa 120 cctgatggca cagtcaagct gctgatctac tataccagcc ggctgcactc aggcgtgcca 180 agcaaattct caggaagcgg ctccgggact gactactccc tgaccatctc taacctggag 240 caggaagata ttgctaccta tttctgccag cagggcaata cactgccctg gacttttgcc 300 ggaggcacca aactggagat caagggggga ggcggggagtg gaggcggggg atcaggagga 360 ggaggcagcg gaggaggagg gtccgaggtc cagctgcagc agagcggacc agaactggtg 420 aagcccggag caagtatgaa aatctcctgt aaggcctcag gatacagctt caccggctat 480 acaatgaact gggtgaaaca gtcccatggc aagaacctgg aatggatggg gctgattaat 540 ccttacaaag gcgtcagcac ctataatcag aagtttaaag acaaggccac actgactgtg 600 gataagtcta gttcaaccgc ttacatggag ctgctgtccc tgacatctga agacagtgcc 660 gtgtactatt gtgctcggtc tggctactat ggggacagtg attggtactt cgatgtctgg 720 ggacagggca ctaccctgac cgtgttttct 750 <210> 14 <211> 250 <212> PRT <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polypeptide <400> 14 Met Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu 1 5 10 15 Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Arg Asn 20 25 30 Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu 35 40 45 Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser Lys Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu 65 70 75 80 Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro 85 90 95 Trp Thr Phe Ala Gly Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly 100 105 110 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 130 135 140 Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 145 150 155 160 Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Met 165 170 175 Gly Leu Ile Asn Pro Tyr Lys Gly Val Ser Thr Tyr Asn Gln Lys Phe 180 185 190 Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 195 200 205 Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 210 215 220 Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp Trp Tyr Phe Asp Val Trp 225 230 235 240 Gly Gln Gly Thr Thr Leu Thr Val Phe Ser 245 250 <210> 15 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 15 actagtggcg gaggaggatc actcgag 27 <210> 16 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 16 Thr Ser Gly Gly Gly Gly Ser Leu Glu 1 5 <210> 17 <211> 252 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 17 agcggacagg tgctgctgga atccaatatc aaagtcctgc ccacttggtc tacccccgtg 60 cagcctatgg ctctgattgt gctggggagga gtcgcaggac tgctgctgtt tatcgggctg 120 ggaattttct tttgcgtgcg ctgccggcac cggagaaggc aggccgagcg catgagccag 180 atcaagcgac tgctgagcga gaagaaaacc tgtcagtgtc cccatagatt ccagaagacc 240 tgttcaccca tt 252 <210> 18 <211> 84 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 18 Ser Gly Gln Val Leu Leu Glu Ser Asn Ile Lys Val Leu Pro Thr Trp 1 5 10 15 Ser Thr Pro Val Gln Pro Met Ala Leu Ile Val Leu Gly Gly Val Ala 20 25 30 Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe Phe Cys Val Arg Cys 35 40 45 Arg His Arg Arg Arg Gln Ala Glu Arg Met Ser Gln Ile Lys Arg Leu 50 55 60 Leu Ser Glu Lys Lys Thr Cys Gln Cys Pro His Arg Phe Gln Lys Thr 65 70 75 80 Cys Ser Pro Ile <210> 19 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 19 agcggacagg tgctgctgga atccaatatc aaagtcctgc ccacttggtc tacccccgtg 60 cagcct 66 <210> 20 <211> twenty two <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 20 Ser Gly Gln Val Leu Leu Glu Ser Asn Ile Lys Val Leu Pro Thr Trp 1 5 10 15 Ser Thr Pro Val Gln Pro 20 <210> twenty one <211> 769 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> twenty one atggccgaca tcgtgctgac acagagcccc gccatcatgt ctgccagccc tggcgagaaa 60 gtgaccatga cctgtagcgc cagcagcagc gtgtcctaca tgaactggta tcagcagaag 120 tccggcacca gccccaagcg gtggatctac gacacaagca agctggcctc tggcgtgccc 180 gcccacttta gaggctctgg cagcggcaca agctacagcc tgaccatcag cggcatggaa 240 gccgaggatg ccgccaccta ctactgccag cagtggtcca gcaacccctt cacctttggc 300 tccggcacaa agctggaat caaccggggcc gacaccgccc ctacaggcgg cggaggatct ggcggaggcg gatctggggg cggaggagt ggggggggag gatctatggc tcaggtgcag 420 ctgcagcagt ctggcgccga actggctaga cctggcgcct ccgtgaagat gagctgcaag gccagcggct acaccttcac ccggtacacc atgcactggg tcaagcagag gcctggacag 540 ggcctggaat ggatcggcta catcacccc agccggggct acaccaacta caccagaag ttcaaggaca aggccaccct gaccaccgac aagagcagca gcaccgccta catgcagctg tcctccctga ccagcgagga cagcgccgtg tactactgcg cccggtacta cgacgaccac 720 tactccctgg actactgggg ccagggcacc acactgaccg tgtctagta 769 <210> 22 <211> 256 <212> PRT <213> The snowstorm <220> <223> Take a snowflake: a snowflake <400> 22 Met Ala Asp Ile Val Leu Thr Gln Ser Pro Free Mp3 Download 1 5 10 15 Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser 20 25 30 Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp 35 40 45 Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro Ala His Phe Arg 50 55 60 Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Gly Met Glu 65 70 75 80 Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro 85 90 95 Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Asn Arg Ala Asp Thr 100 105 110 Ala Pro Thr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125 Gly Ser Gly Gly Gly Gly Ser Met Ala Gln Val Gln Leu Gln Gln Ser 130 135 140 Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys 145 150 155 160 Ala Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln 165 170 175 Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg 180 185 190 Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr 195 200 205 Thr Asp Lys Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr 210 215 220 Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His 225 230 235 240 Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 245 250 255 <210> 23 <211> 747 <212> DNA <213> The snowstorm <220> <223> Make a snowflake: a snowflake <400> 23 60. cagaccgtgg tgacccagga gcccagcctg accgtgagcc ccggcggcac cgtgaccctg acctgcggca gcagcaccgg cgccgtgacc agcggctact accccaactg ggtgcagcag aagcccggcc aggccccg gggcctgatc ggcggcacca agttcctggc ccccggcacc 180 cccgccaggt tcagcggcag cctgctgggc ggcaaggccg ccctgaccct gagcggcgtg 240 cagcccgagg acgaggccga gtactactgc gccctgtggt acagcaacag gtgggtgttc 300 ggcggcggca ccaagctgac cgtgctgggc ggcggcggca gcggcggcgg cggcagcggc 360 ggcggcggca ccaagctgac cgtgctgggc ggcggcggca gcggcggcgg cggcagcggc 360 ggcggcggca gcgaggtgca gctgctggag agcggcggcg gcctggtgca gcccggcggc 420 ggcggcggca gcgaggtgca gctgctggag agcggcggcg gcctggtgca gcccggcggc 420 agcctgaagc tgagctgcgc cgccagcggc ttcaccttca acatctacgc catgaactgg 480 agcctgaagc tgagctgcgc cgccagcggc ttcaccttca acatctacgc catgaactgg 480 gtgaggcagg cccccggcaa gggcctggag tgggtggcca ggatcaggag caagtacaac 540 gtgaggcagg cccccggcaa gggcctggag tgggtggcca ggatcaggag caagtacaac 540 aactacgcca cctactacgc cgacagcgtg aagagcaggt tcaccatcag cagggacgac 600 aactacgcca cctactacgc cgacagcgtg aagagcaggt tcaccatcag cagggacgac 600 agcaagaaca ccgcctacct gcagatgaac aacctgaaga ccgaggacac cgccgtgtac 660 agcaagaaca ccgcctacct gcagatgaac aacctgaaga ccgaggacac cgccgtgtac 660 tactgcgtga ggcacggcaa cttcggcaac agctacgtga gcttcttcgc ctactggggc 720 tactgcgtga ggcacggcaa cttcggcaac agctacgtga gcttcttcgc ctactggggc 720 cagggcaccc tggtgaccgt gagcagc 747 cagggcaccc tggtgaccgt gagcagc 747 <210> 24<210> 24 <211> 249<211> 249 <212> PRT<212> PRT <213> 人工序列<213> Synthetic sequence <220> <220> <223> 人工序列的描述:合成的多肽 <223> Description of synthetic sequence: Synthetic polypeptide <400> 24 <400> 24 Gln Thr Val Val Thr Gln Glu Pro Ser Leu Thr Val Ser Pro Gly Gly Gln Thr Val Val Thr Gln Glu Pro Ser Leu Thr Val Ser Pro Gly Gly 第1位 第5位 第10位 第15位 Position 1 Position 5 Position 10 Position 15 <000(...)37> Thr Val Thr Leu Thr Cys Gly Ser Ser Thr Gly Ala Val Thr Ser Gly Thr Val Thr Leu Thr Cys Gly Ser Ser Thr Gly Ala Val Thr Ser Gly 第20位 第25位 第30位 Position 20 Position 25 Position 30 Tyr Tyr Pro Asn Trp Val Gln Gln Lys Pro Gly Gln Ala Pro Arg Gly 35 40 45 Leu Ile Gly Gly Thr Lys Phe Leu Ala Pro Gly Thr Pro Ala Arg Phe 50 55 60 Ser Gly Ser Leu Leu Gly Gly Lys Ala Ala Leu Thr Leu Ser Gly Val 65 70 75 80 Gln Pro Glu Asp Glu Ala Glu Tyr Tyr Cys Ala Leu Trp Tyr Ser Asn 85 90 95 Arg Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gly Gly 100 105 110 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu 115 120 125 Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Lys Leu 130 135 140 Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn Ile Tyr Ala Met Asn Trp 145 150 155 160 Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Arg Ile Arg 165 170 175 Ser Lys Tyr Asn Asn Tyr Ala Thr Tyr Tyr Ala Asp Ser Val Lys Ser 180 185 190 Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr Ala Tyr Leu Gln 195 200 205 Met Asn Asn Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Val Arg 210 215 220 His Gly Asn Phe Gly Asn Ser Tyr Val Ser Phe Phe Ala Tyr Trp Gly 225 230 235 240 Gln Gly Thr Leu Free Mp3 Download 245 <210> 25 <211> 720 <212> DNA <213> The snowstorm <220> <223> Make a snowflake: a snowflake <400> 25 60. gacatccagc tgacccagag ccccgccatc atgagcgcca gccccggcga gaaggtgacc atgacctgca gggccagcag cagcgtgagc tacatgaact ggtaccagca gaagagcggc accagcccca agaggtggat ctacgacacc agcaaggtgg ccagcggcgt gccctacagg 180 ttcagcggca gcggcagcgg caccagctac agcctgacca tcagcagcat ggaggccgag 300. ccgccgcca cctactactg ccgcgtgg ccctgacctt cggcgccggc accaagctgg agctgaaggg cggcggcggc agcggcggcg gcggcagcgg cggcggcggc 360 agcgacatca agctgcagca gagcggcgcc gagctggcca ggcccggcgc cagcgtgaag 420. atgagctgca agaccagcgg ctacaccttc accaggtaca ccatgcactg ggtgaagcag aggcccggcc agggcctgga gtggatcggc tacatcaacc ccagcagggg ctacaccaac 600. 600. 600. 600. 600. 600. 600. 600. 600. 600 tacatgcagc tgagcagcct gaccagcgag gacagcgccg tgtactactg cgccaggtac 660 720. actactgcct ggactactgg ggccagggca ccaccctgac cgtgagcagc <210> 26 <211> 240 <212> PRT <213> The snowstorm <220> <223> Take a snowflake: a snowflake <400> 26 Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly 1 5 10 15 Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met 20 25 30 Asn Trp Tyr Gln Gln Light Ser Gly Thr Ser Pro Light Arg Trp Ile Tyr 35 40 45 Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu 65 70 75 80 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr 85 90 95 Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser Gly 100 105 110 Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Lys Leu Gln Gln Ser 115 120 125 Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys 130 135 140 Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln 145 150 155 160 Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg 165 170 175 Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr 180 185 190 Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr 195 200 205 Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His 210 215 220 Tyr Cys Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 27 <211> 51 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 27 gccgaagcag cagcaaagga ggccgcagcg aaggaagcag ctgcgaaggc c 51 <210> 28 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 28 Ala Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys 1 5 10 15 Ala <210> 29 <211> 81 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 29 gccgaggcag ctgcaaagga agctgcggcg aaggaggccg cagcgaaaga agcagcggca 60 aaagaagcag ccgccaaagc c 81 <210> 30 <211> 27 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 30 Ala Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys 1 5 10 15 Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Ala 20 25 <210> 31 <211> 576 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 31 atcgtagtgt tggcatttca aaaagcgtct agcatcgtct ataagaagga aggtgaacaa 60 gtcgagtttt ctttccccct tgcatttacg gtggaaaagc ttacgggtag cggcgagctg 120 tggtggcaag ctgaacgggc ttcaagctca aaatcttgga ttacttttga cttgaagaac 180 aaagaggtga gtgtcaaaag agttatactcag gacccaaagc ttcaaatggg gaagaaactt 240 ccgctgcacc tgacgttgcc tcaggccctg cctcaatatg ccggctcagg caatctgacc 300 ctcgcgctgg aagctaagac cggaaaattg caccaggaag tcaatttggt tgtgatgcgc 360 gccactcagc tccaaaaaaa tctcacttgc gaggtatggg ggcctacgag cccaaaactt 420 atgctgtctt tgaagcttga aaacaaggaa gcgaaagttt ctaagcgcga gaaagcggta 480 tgggttttga atcctgaggc tggaatgtgg caatgcctcc tgagcgatag cgggcaggtg 540 ctgttggaga gcaacatcaa ggttttgcca gcagcc 576 <210> 32 <211> 192 <212> PRT <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polypeptide <400> 32 Ile Val Val Leu Ala Phe Gln Lys Ala Ser Ser Ile Val Tyr Lys Lys 1 5 10 15 Glu Gly Glu Gln Val Glu Phe Ser Phe Pro Leu Ala Phe Thr Val Glu 20 25 30 Lys Leu Thr Gly Ser Gly Glu Leu Trp Trp Gln Ala Glu Arg Ala Ser​​​​​​​​ 65 70 75 80 Pro Leu His Leu Thr Leu Pro Gln Ala Leu Pro Gln Tyr Ala Gly Ser 85 90 95 Gly Asn Leu Thr Leu Ala Leu Glu Ala Lys Thr Gly Lys Leu His Gln 100 105 110 Glu Val Asn Leu Val Val Met Arg Ala Thr Gln Leu Gln Lys Asn Leu 115 120 125 Thr Cys Glu Val Trp Gly Pro Thr Ser Pro Lys Leu Met Leu Ser Leu 130 135 140 Lys Leu Glu Asn Lys Glu Ala Lys Val Ser Lys Arg Glu Lys Ala Val 145 150 155 160 Trp Val Leu Asn Pro Glu Ala Gly Met Trp Gln Cys Leu Leu Ser Asp 165 170 175 Ser Gly Gln Val Leu Leu Glu Ser Asn Ile Lys Val Leu Pro Ala Ala 180 185 190 <210> 33 <211> 801 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 33 atggattttc aggtgcagat tttcagcttc ctgctaatca gtgcctcagt cataatgtct 60 agagacatcg tgctgaccca gagccccccc agcctggcca tgtctctggg caagagagcc 120 accatcagct gccgggccag cgagagcgtg accatcctgg gcagccacct gatccactgg 180 tatcagcaga agcccggcca gccccccacc ctgctgatcc agctcgccag caatgtgcag 240 accggcgtgc ccgccagatt cagcggcagc ggcagcagaa ccgacttcac cctgaccatc 300 gaccccgtgg aagaggacga cgtggccgtg tactactgcc tgcagagccg gaccatcccc 360 cggacctttg gcggaggcac caaactggaa atcaagggca gcaccagcgg ctccggcaag 420 cctggctctg gcgagggcag cacaaaggga cagattcagc tggtgcagag cggccctgag 480 ctgaagaaac ccggcgagac agtgaagatc agctgcaagg cctccggcta caccttcacc 540 gactacagca tcaactgggt gaaaagagcc cctggcaagg gcctgaagtg gatgggctgg 600 atcaacaccg agacaagaga gcccgcctac gcctacgact tccggggcag attcgccttc 660 agcctggaaa ccagcgccag caccgcctac ctgcagatca acaacctgaa gtacgaggac 720 accgccacct acttttgcgc cctggactac agctacgcca tggactactg gggccagggc 780 accagcgtga ccgtgtccag c 801 <210> 34 <211> 267 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 34 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Asp Ile Val Leu Thr Gln Ser Pro Pro Ser Leu 20 25 30 Ala Met Ser Leu Gly Lys Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu 35 40 45 Ser Val Thr Ile Leu Gly Ser His Leu Ile His Trp Tyr Gln Gln Lys 50 55 60 Pro Gly Gln Pro Pro Thr Leu Leu Ile Gln Leu Ala Ser Asn Val Gln 65 70 75 80 Thr Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe 85 90 95 Thr Leu Thr Ile Asp Pro Val Glu Glu Asp Asp Val Ala Val Tyr Tyr 100 105 110 Cys Leu Gln Ser Arg Thr Ile Pro Arg Thr Phe Gly Gly Gly Thr Lys 115 120 125 Leu Glu Ile Lys Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly 130 135 140 Glu Gly Ser Thr Lys Gly Gln Ile Gln Leu Val Gln Ser Gly Pro Glu 145 150 155 160 Leu Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly 165 170 175 Tyr Thr Phe Thr Asp Tyr Ser Ile Asn Trp Val Lys Arg Ala Pro Gly 180 185 190 Lys Gly Leu Lys Trp Met Gly Trp Ile Asn Thr Glu Thr Arg Glu Pro 195 200 205 Ala Tyr Ala Tyr Asp Phe Arg Gly Arg Phe Ala Phe Ser Leu Glu Thr 210 215 220 Ser Ala Ser Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Tyr Glu Asp 225 230 235 240 Thr Ala Thr Tyr Phe Cys Ala Leu Asp Tyr Ser Tyr Ala Met Asp Tyr 245 250 255 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser 260 265 <210> 35 <211> 735 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 35 gatatccaga tgactcagac gacctcatca ttgtccgcca gtttggggga cagggttaca 60 atatcctgcc gggcgagcca agacatcagt aaatatctta attggtacca gcagaaacca 120 gatggtacag taaaacttct tatctaccac acctctcggc tccactctgg ggttccctct 180 aggttcagtg gtagtgggtc aggcaccgac tacagcctta cgataagcaa cttggaacag 240 gaggatatcg caacttactt ctgccaacag ggaaataccc tgccttacac gttcggtgga 300 ggcactaaac tggagatcac tgggtcaacc tctggtagcg gtaagcctgg ctccggcgaa 360 ggctccacaa agggtgaggt gaaactccaa gagtcaggtc ccggtttggt agccccctca 420 caaagtttgt cagttacttg taccgtaagc ggcgtttccc tgcccgatta cggtgtgagc 480 tggataaggc agccaccgag aaaaggtctt gaatggctgg gagtgatctg ggggtctgag 540 acaacgtatt acaactcagc tcttaagagc aggcttacga tcattaaaga taacagcaaa 600 tctcaagtgt tcctcaaaat gaatagcctt caaactgatg atactgccat ctattattgt 660 gctaagcatt attactatgg cggcagttac gcaatggatt attgggggca aggtacctca 720 gtcactgtaa gcagc 735 <210> 36 <211> 245 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 36 Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75 80 Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Gly Ser Thr Ser Gly 100 105 110 Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Glu Val Lys 115 120 125 Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser 130 135 140 Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser 145 150 155 160 Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile 165 170 175 Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu 180 185 190 Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn 195 200 205 Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr 210 215 220 Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser 225 230 235 240 Val Thr Val Ser Ser 245 <210> 37 <211> 237 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 37 ctcgagctga ggcccgaggc ttctagacct gctgccggcg gagccgtgca caccagaggc 60 ctggacttcg ccagcgacat ctacatctgg gcccctctgg ccggcacctg tggcgtgctg 120 ctgctgagcc tggtcatcac cctgtactgc aaccaccgga accggcggag agtgtgcaag 180 tgccccagac ccgtggtcaa gagcggcgac aagcccagcc tgagcgccag atacgtg 237 <210> 38 <211> 79 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 38 Leu Glu Leu Arg Pro Glu Ala Ser Arg Pro Ala Ala Gly Gly Ala Val 1 5 10 15 His Thr Arg Gly Leu Asp Phe Ala Ser Asp Ile Tyr Ile Trp Ala Pro 20 25 30 Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu 35 40 45 Tyr Cys Asn His Arg Asn Arg Arg Arg Val Cys Lys Cys Pro Arg Pro 50 55 60 Val Val Lys Ser Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val 65 70 75 <210> 39 <211> 234 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 39 ctcgagctga ggcccgaggc ttctagacct gctgccggcg gagccgtgca caccagaggc 60 ctggacttcg ccagcgacat ctacatctgg gcccctctgg ccggcacctg tggcgtgctg 120 ctgctgagcc tggtcatcac cctgtacctg tgctgcagac ggcggagagt gtgcaagtgc 180 cccagacccg tggtcaagag cggcgacaag cccagcctga gcgccagata cgtg 234 <210> 40 <211> 78 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 40 Leu Glu Leu Arg Pro Glu Ala Ser Arg Pro Ala Ala Gly Gly Ala Val 1 5 10 15 His Thr Arg Gly Leu Asp Phe Ala Ser Asp Ile Tyr Ile Trp Ala Pro 20 25 30 Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu 35 40 45 Tyr Leu Cys Cys Arg Arg Arg Arg Val Cys Lys Cys Pro Arg Pro Val 50 55 60 Val Lys Ser Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val 65 70 75 <210> 41 <211> 213 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 41 ctcgagaaga agtccaccct gaagaaacgg gtgtcccggc tgcccagacc cgagacacag 60 aagggccccc tgagcagccc tatcaccctg ggactgctgg tggccggcgt gctggtgctg 120 ctggtgtctc tggggagtggc catccacctg tgctgccggc ggagaagggc ctgcaagtgc 180 cccagactgc ggttcatgaa gcagttctac aag 213 <210> 42 <211> 71 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 42 Leu Glu Lys Lys Ser Thr Leu Lys Lys Arg Val Ser Arg Leu Pro Arg 1 5 10 15 Pro Glu Thr Gln Lys Gly Pro Leu Ser Ser Pro Ile Thr Leu Gly Leu 20 25 30 Leu Val Ala Gly Val Leu Val Leu Leu Val Ser Leu Gly Val Ala Ile 35 40 45 His Leu Cys Cys Arg Arg Arg Arg Ala Cys Lys Cys Pro Arg Leu Arg 50 55 60 Phe Met Lys Gln Phe Tyr Lys 65 70 <210> 43 <211> 735 <212> DNA <213> Artificial sequence <​​​​​​​​​​​​​​​​​​​​​cgtcaggccc caggtaaggg cctggaatgg gttgcactga ttaatcctta taaaggtgtt 540 agtacctaca accagaagtt caaggaccgt ttcactataa gcgtagataa atccaaaaac 600 acagcctacc tgcaaatgaa cagcctgcgt gctgaggaca ctgccgtcta ttattgtgct 660 agaagcggat actacggcga tagtgactgg tattttgacg tgtggggtca aggaaccctg 720 gtcaccgtct cctcg 735 <210> 44 <211> 245 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 44 Met Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg Asn 20 25 30 Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Tyr Thr Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln 65 70 75 80 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro 85 90 95 Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly 100 105 110 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val 115 120 125 Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser 130 135 140 Cys Ala Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val 145 150 155 160 Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Leu Ile Asn Pro 165 170 175 Tyr Lys Gly Val Ser Thr Tyr Asn Gln Lys Phe Lys Asp Arg Phe Thr 180 185 190 Ile Ser Val Asp Lys Ser Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser 195 200 205 Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ser Gly Tyr 210 215 220 Tyr Gly Asp Ser Asp Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu 225 230 235 240 Val Thr Val Ser Ser 245 <210> 45 <211> 735 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 45 atggatatcc agatgaccca gtccccgagc tccctgtccg cctctgtggg cgatagggtc 60 accatcacct gccgtgccag tcaggacatc cgtaattatc tgaactggta tcaacagaaa 120 ccaggaaaag ctccgaaact actgatttac tatacctccc gcctggagtc tggagtccct 180 tctcgcttct ctggttctgg ttctgggacg gattacactc tgaccatcag cagtctgcaa 240 ccggaagact tcgcaactta ttactgtcag caaggtaata ctctgccgtg gacgttcgga 300 cagggcacca aggtggagat caaaggcggc ggcggaagtg gaggaggagg ctcaggcgga 360 ggagggagcg aggttcagct ggtggagtct ggcggtggcc tggtgcagcc agggggctca 420 ctccgtttgt cctgtgcagc ttctggctac tcctttaccg gctacactat gaactgggtg 480 cgtcaggccc caggtaaggg cctggaatgg gttgcactga ttaatcctac caaaggtgtt 540 agtacctaca accagaagtt caaggaccgt ttcactataa gcgtagataa atccaaaaac 600 acagcctacc tgcaaatgaa cagcctgcgt gctgaggaca ctgccgtcta ttattgtgct 660 agaagcggat actacggcga tagtgactgg tattttgacg tgtggggtca aggaaccctg 720 gtcaccgtct cctcg 735 <210> 46 <211> 245 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 46 Met Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg Asn 20 25 30 Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Tyr Thr Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln 65 70 75 80 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro 85 90 95 Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly 100 105 110 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val 115 120 125 Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser 130 135 140 Cys Ala Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val 145 150 155 160 Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Leu Ile Asn Pro 165 170 175 Thr Lys Gly Val Ser Thr Tyr Asn Gln Lys Phe Lys Asp Arg Phe Thr 180 185 190 Ile Ser Val Asp Lys Ser Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser 195 200 205 Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ser Gly Tyr 210 215 220 Tyr Gly Asp Ser Asp Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu 225 230 235 240 Val Thr Val Ser Ser 245 <210> 47 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 47 atggagaccc ccgcccagct gctgttcctg ctgctgctgt ggctgcccga caccaccggc 60 <210> 48 <211> 20 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 48 Met Glu Thr Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly 20 <210> 49 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 49 atggctttgc ctgtcacggc tcttctgctc cctctggccc tgcttctgca cgcggcgcga 60 ccc 63 <210> 50 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 50 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro 20 <210> 51 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 51 gaggtgcagc tggtggagtc tggaggaggc ctggtgcagc ctggcggctc cctgaggctg 60 tcttgcgcag caagcggctt caacatctac tatagctaca tgcactgggt gcgccaggcc 120 cctggcaagg gcctggagtg ggtggcctcc atctctccat actatggcta cacctcctat 180 gccgactctg tgaagggccg gtttacaatc agcgccgata cctccaagaa cacagcctat 240 ctgcagatga attccctgag ggcagaggac accgccgtgt actattgcgc cagacacggc 300 tacgccctgg attattgggg ccagggcacc ctggtgacag tgagctccgg cagcacatcc 360 ggatctggca agccaggctc tggagaggga agcaccaagg gcgacatcca gatgacacag 420 tccccatcta gcctgagcgc ctccgtgggc gatagggtga ccatcacatg tcgcgcctct 480 cagagcgtgt cctctgccgt ggcatggtac cagcagaagc ccggcaaggc ccctaagctg 540 ctgatctaca gcgccagctc cctgtattcc ggcgtgcctt ctcggttctc cggctctaga 600 agcggcaccg actttaccct gacaatctct agcctgcagc ccgaggattt cgccacatac 660 tattgtcagc agagcgtgtg ggtgggctac tccctgatca cctttggcca gggcacaaag 720 gtggagatca ag 732 <210> 52 <211> 244 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 52 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Ile Tyr Tyr Ser 20 25 30 Tyr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Ser Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg His Gly Tyr Ala Leu Asp Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110 Thr Val Ser Ser Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly 115 120 125 Glu Gly Ser Thr Lys Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser 130 135 140 Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 145 150 155 160 Gln Ser Val Ser Ser Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 165 170 175 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Leu Tyr Ser Gly Val 180 185 190 Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr Asp Phe Thr Leu Thr 195 200 205 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 210 215 220 Ser Val Trp Val Gly Tyr Ser Leu Ile Thr Phe Gly Gln Gly Thr Lys 225 230 235 240 Val Glu Ile Lys <210> 53 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 53 gacatccaga tgacacagtc cccaagctcc ctgtccgcct ctgtgggcga tagggtgacc 60 atcacatgca gggcaagcca gtccgtgtct agcgccgtgg catggtacca gcagaagccc 120 ggcaaggccc ctaagctgct gatctacagc gcctcctctc tgtattccgg cgtgccatct 180 cggttctctg gcagcagatc cggcaccgac tttaccctga caatcagctc cctgcagccc 240 gaggatttcg ccacatacta ttgccagcag agcgtgtggg tgggctactc cctgatcacc 300 tttggccagg gcacaaaggt ggagatcaag ggatctacca gcggatccgg caagcctggc 360 agcggagagg gatccacaaa gggagaggtg cagctggtgg agtctggagg aggcctggtg 420 cagcctggcg gctctctgag gctgagctgt gcagcatccg gcttcaacat ctactatagc 480 tacatgcact gggtgcgcca ggcccccggc aagggcctgg agtgggtggc ctctatcagc 540 ccttactatg gctacacctc ttatgccgac agcgtgaagg gccggtttac aatctccgcc 600 gatacctcta agaacacagc ctatctgcag atgaattccc tgagggcaga ggacaccgcc 660 gtgtactatt gtgccagaca cggctacgcc ctggattatt ggggccaggg caccctggtg 720 acagtgtcta gc 732 <210> 54 <211> 244 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 54 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Ser Ser Ala 20 25 30 Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ser Ala Ser Ser Leu Tyr Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Arg Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Val Trp Val Gly Tyr 85 90 95 Ser Leu Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Ser 100 105 110 Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly 115 120 125 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 130 135 140 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Ile Tyr Tyr Ser 145 150 155 160 Tyr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 165 170 175 Ala Ser Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser Tyr Ala Asp Ser Val 180 185 190 Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 195 200 205 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 210 215 220 Ala Arg His Gly Tyr Ala Leu Asp Tyr Trp Gly Gln Gly Thr Leu Val 225 230 235 240 Thr Val Ser Ser <210> 55 <211> 1905 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 55 atggccctgc cagtgaccgc cctgctgctg ccactggccc tgctgctgca cgccgccaga 60 cccgaggtgc agctggtgga gtctggagga ggcctggtgc agcctggcgg ctccctgagg 120 ctgtcttgcg cagcaagcgg cttcaacatc tactatagct acatgcactg ggtgcgccag 180 gcccctggca agggcctgga gtgggtggcc tccatctctc catactatgg ctacacctcc 240 tatgccgact ctgtgaaggg ccggtttaca atcagcgccg atacctccaa gaacacagcc 300 tatctgcaga tgaattccct gagggcagag gacaccgccg tgtactattg cgccagacac 360 ggctacgccc tggattattg gggccagggc accctggtga cagtgagctc cggcagcaca 420 tccggatctg gcaagccagg ctctggagag ggaagcacca agggcgacat ccagatgaca 480 cagtccccat ctagcctgag cgcctccgtg ggcgataggg tgaccatcac atgtcgcgcc 540 tctcagagcg tgtcctctgc cgtggcatgg taccagcaga agcccggcaa ggcccctaag 600 ctgctgatct acagcgccag ctccctgtat tccggcgtgc cttctcggtt ctccggctct 660 agaagcggca ccgactttac cctgacaatc tctagcctgc agcccgagga tttcgccaca 720 tactattgtc agcagagcgt gtgggtgggc tactccctga tcacctttgg ccagggcaca 780 aaggtggaga tcaaggagca gaagctgatc agcgaggagg acctgaatcc cggggccgaa 840 gcagcagcaa aggaggccgc agcgaaggaa gcagctgcga aggccggatc catggatatc 900 cagatgaccc agtccccgag ctccctgtcc gcctctgtgg gcgatagggt caccatcacc 960 tgccgtgcca gtcaggacat ccgtaattat ctgaactggt atcaacagaa accaggaaaa 1020 gctccgaaac tactgattta ctatacctcc cgcctggagt ctggagtccc ttctcgcttc 1080 tctggttctg gttctgggac ggattacact ctgaccatca gcagtctgca accggaagac 1140 ttcgcaactt attactgtca gcaaggtaat actctgccgt ggacgttcgg acagggcacc 1200 aaggtggaga tcaaaggcgg cggcggaagt ggaggaggag gctcaggcgg aggagggagc 1260 gaggttcagc tggtggagtc tggcggtggc ctggtgcagc cagggggctc actccgtttg 1320 tcctgtgcag cttctggcta ctcctttacc ggctacacta tgaactgggt gcgtcaggcc 1380 ccaggtaagg gcctggaatg ggttgcactg attaatcctt ataaaggtgt tagtacctac 1440 aaccagaagt tcaaggaccg tttcactata agcgtagata aatccaaaaa cacagcctac 1500 ctgcaaatga acagcctgcg tgctgaggac actgccgtct attattgtgc tagaagcgga 1560 tactacggcg atagtgactg gtattttgac gtgtggggtc aaggaaccct ggtcaccgtc 1620 tcctcgacta gtggcggagg aggatcactc gagagcggac aggtgctgct ggaatccaat 1680 atcaaagtcc tgcccacttg gtctaccccc gtgcagccta tggctctgat tgtgctggga 1740 ggagtcgcag gactgctgct gtttatcggg ctgggaattt tcttttgcgt gcgctgccgg 1800 caccggagaa ggcaggccga gcgcatgagc cagatcaagc gactgctgag cgagaagaaa 1860 acctgtcagt gtccccatag attccagaag acctgttcac ccatt 1905 <210> 56 <211> 635 <212> PRT <213> Synthetic Sequence <220> <223> Description of synthetic sequence: Synthetic polypeptide <400> 56 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe 35 40 45 Asn Ile Tyr Tyr Ser Tyr Met His Trp Val Arg Gln Ala Pro Gly Lys 50 55 60 Gly Leu Glu Trp Val Ala Ser Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser 65 70 75 80 Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser 85 90 95 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Arg His Gly Tyr Ala Leu Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Ser Thr Ser Gly Ser Gly 130 135 140 Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Arg Ala Ser Gln Ser Val Ser Ser Ala Val Ala Trp Tyr Gln 180 185 190 Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser 195 200 205 Leu Tyr Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr 210 215 220 Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr 225 230 235 240 Tyr Tyr Cys Gln Gln Ser Val Trp Val Gly Tyr Ser Leu Ile Thr Phe 245 250 255 Gly Gln Gly Thr Lys Val Glu Ile Lys Glu Gln Lys Leu Ile Ser Glu 260 265 270 Glu Asp Leu Asn Pro Gly Ala Glu Ala Ala Ala Lys Glu Ala Ala Ala 275 280 285 Lys Glu Ala Ala Ala Lys Ala Gly Ser Met Asp Ile Gln Met Thr Gln 290 295 300 Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr 305 310 315 320 Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp Tyr Gln Gln 325 330 335 Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu 340 345 350 Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 355 360 365 Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 370 375 380 Tyr Cys Gln Gln Gly Asn Thr Leu Pro Trp Thr Phe Gly Gln Gly Thr 385 390 395 400 Lys Val Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 405 410 415 Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val 420 425 430 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser 435 440 445 Phe Thr Gly Tyr Thr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly 450 455 460 Leu Glu Trp Val Ala Leu Ile Asn Pro Tyr Lys Gly Val Ser Thr Tyr 465 470 475 480 Asn Gln Lys Phe Lys Asp Arg Phe Thr Ile Ser Val Asp Lys Ser Lys 485 490 495 Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 500 505 510 Val Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp Trp Tyr 515 520 525 Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Thr Ser 530 535 540 Gly Gly Gly Gly Ser Leu Glu Ser Gly Gln Val Leu Leu Glu Ser Asn 545 550 555 560 Ile Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro Met Ala Leu 565 570 575 Ile Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly 580 585 590 Ile Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg Gln Ala Glu Arg 595 600 605 Met Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr Cys Gln Cys 610 615 620 Pro His Arg Phe Gln Lys Thr Cys Ser Pro Ile {625 630 635} <210> 57 <211> 1905 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 57 atggccctgc cagtgaccgc cctgctgctg ccactggccc tgctgctgca cgccgcccgg 60 cctgacatcc agatgacaca gtccccaagc tccctgtccg cctctgtggg cgatagggtg 120 accatcacat gcagggcaag ccagtccgtg tctagcgccg tggcatggta ccagcagaag 180 cccggcaagg cccctaagct gctgatctac agcgcctcct ctctgtattc cggcgtgcca 240 tctcggttct ctggcagcag atccggcacc gactttaccc tgacaatcag ctccctgcag 300 cccgaggatt tcgccacata ctattgccag cagagcgtgt gggtgggcta ctccctgatc 360 acctttggcc agggcacaaa ggtggagatc aagggatcta ccagcggatc cggcaagcct 420 ggcagcggag agggatccac aaagggagag gtgcagctgg tggagtctgg aggaggcctg 480 gtgcagcctg gcggctctct gaggctgagc tgtgcagcat ccggcttcaa catctactat 540 agctacatgc actgggtgcg ccaggccccc ggcaagggcc tggagtgggt ggcctctatc 600 agcccttact atggctacac ctcttatgcc gacagcgtga agggccggtt tacaatctcc 660 gccgatacct ctaagaacac agcctatctg cagatgaatt ccctgagggc agaggacacc 720 gccgtgtact attgtgccag acacggctac gccctggatt attggggcca gggcaccctg 780 gtgacagtgt ctagcgagca gaagctgatc agcgaggagg acctgaatcc cggggccgaa 840 gcagcagcaa aggaggccgc agcgaaggaa gcagctgcga aggccggatc catggatatc 900 cagatgaccc agtccccgag ctccctgtcc gcctctgtgg gcgatagggt caccatcacc 960 tgccgtgcca gtcaggacat ccgtaattat ctgaactggt atcaacagaa accaggaaaa 1020 gctccgaaac tactgattta ctatacctcc cgcctggagt ctggagtccc ttctcgcttc 1080 tctggttctg gttctgggac ggattacact ctgaccatca gcagtctgca accggaagac 1140 ttcgcaactt attactgtca gcaaggtaat actctgccgt ggacgttcgg acagggcacc 1200 aaggtggaga tcaaaggcgg cggcggaagt ggaggaggag gctcaggcgg aggagggagc 1260 gaggttcagc tggtggagtc tggcggtggc ctggtgcagc cagggggctc actccgtttg 1320 tcctgtgcag cttctggcta ctcctttacc ggctacacta tgaactgggt gcgtcaggcc 1380 ccaggtaagg gcctggaatg ggttgcactg attaatcctt ataaaggtgt tagtacctac 1440 aaccagaagt tcaaggaccg tttcactata agcgtagata aatccaaaaa cacagcctac 1500 ctgcaaatga acagcctgcg tgctgaggac actgccgtct attattgtgc tagaagcgga 1560 tactacggcg atagtgactg gtattttgac gtgtggggtc aaggaaccct ggtcaccgtc 1620 tcctcgacta gtggcggagg aggatcactc gagagcggac aggtgctgct ggaatccaat 1680 atcaaagtcc tgcccacttg gtctaccccc gtgcagccta tggctctgat tgtgctggga 1740 ggagtcgcag gactgctgct gtttatcggg ctgggaattt tcttttgcgt gcgctgccgg 1800 caccggagaa ggcaggccga gcgcatgagc cagatcaagc gactgctgag cgagaagaaa 1860 acctgtcagt gtccccatag attccagaag acctgttcac ccatt 1905 [[ID=?]] <210> 58 <211> 635 <212> PRT <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polypeptide <400> 58 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 It should be noted that there seems to be an unclear "? " in the original text where the "ID=?" is shown. This might be an error in the original input. If this is a critical error in the original patent text, it may need to be verified and corrected in the source to ensure accurate translation and understanding.His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu 20 25 30 Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln 35 40 45 Ser Val Ser Ser Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala 50 55 60 Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Leu Tyr Ser Gly Val Pro 65 70 75 80 Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr Asp Phe Thr Leu Thr Ile 85 90 95 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser 100 105 110 Val Trp Val Gly Tyr Ser Leu Ile Thr Phe Gly Gln Gly Thr Lys Val 115 120 125 Glu Ile Lys Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu 130 135 140 Gly Ser Thr Lys Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 145 150 155 160 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe 165 170 175 Asn Ile Tyr Tyr Ser Tyr Met His Trp Val Arg Gln Ala Pro Gly Lys 180 185 190 Gly Leu Glu Trp Val Ala Ser Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser 195 200 205 Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser 210 215 220 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 225 230 235 240 Ala Val Tyr Tyr Cys Ala Arg His Gly Tyr Ala Leu Asp Tyr Trp Gly 245 250 255 Gln Gly Thr Leu Val Thr Val Ser Ser Glu Gln Lys Leu Ile Ser Glu 260 265 270 Glu Asp Leu Asn Pro Gly Ala Glu Ala Ala Ala Lys Glu Ala Ala Ala 275 280 285 Lys Glu Ala Ala Ala Lys Ala Gly Ser Met Asp Ile Gln Met Thr Gln 290 295 300 Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr 305 310 315 320 Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp Tyr Gln Gln 325 330 335 Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu 340 345 350 Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 355 360 365 Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 370 375 380 Tyr Cys Gln Gln Gly Asn Thr Leu Pro Trp Thr Phe Gly Gln Gly Thr 385 390 395 400 Lys Val Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 405 410 415 Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val 420 425 430 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser 435 440 445 Phe Thr Gly Tyr Thr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly 450 455 460 Leu Glu Trp Val Ala Leu Ile Asn Pro Tyr Lys Gly Val Ser Thr Tyr 465 470 475 480 Asn Gln Lys Phe Lys Asp Arg Phe Thr Ile Ser Val Asp Lys Ser Lys 485 490 495 Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 500 505 510 Val Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp Trp Tyr 515 520 525 Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Thr Ser 530 535 540 Gly Gly Gly Gly Ser Leu Glu Ser Gly Gln Val Leu Leu Glu Ser Asn 545 550 555 560 Ile Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro Met Ala Leu 565 570 575 Ile Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly 580 585 590 Ile Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg Gln Ala Glu Arg 595 600 605 Met Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr Cys Gln Cys 610 615 620 Pro His Arg Phe Gln Lys Thr Cys Ser Pro Ile 625 630 635 <210> 59 <211> 1914 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 59 atggccctgc cagtgaccgc cctgctgctg ccactggccc tgctgctgca cgccgccaga 60 cccgaggtgc agctggtgga gtctggagga ggcctggtgc agcctggcgg ctccctgagg 120 ctgtcttgcg cagcaagcgg cttcaacatc tactatagct acatgcactg ggtgcgccag 180 gcccctggca agggcctgga gtgggtggcc tccatctctc catactatgg ctacacctcc 240 tatgccgact ctgtgaaggg ccggtttaca atcagcgccg atacctccaa gaacacagcc 300 tatctgcaga tgaattccct gagggcagag gacaccgccg tgtactattg cgccagacac 360 ggctacgccc tggattattg gggccagggc accctggtga cagtgagctc cggcagcaca 420 tccggatctg gcaagccagg ctctggagag ggaagcacca agggcgacat ccagatgaca 480 cagtccccat ctagcctgag cgcctccgtg ggcgataggg tgaccatcac atgtcgcgcc 540 tctcagagcg tgtcctctgc cgtggcatgg taccagcaga agcccggcaa ggcccctaag 600 ctgctgatct acagcgccag ctccctgtat tccggcgtgc cttctcggtt ctccggctct 660 agaagcggca ccgactttac cctgacaatc tctagcctgc agcccgagga tttcgccaca 720 tactattgtc agcagagcgt gtgggtgggc tactccctga tcacctttgg ccagggcaca 780 aaggtggaga tcaaggagca gaagctgatc agcgaggagg acctgaatcc cgggggagga 840 ggagggagcg ggggaggagg cagcggcggg ggaggctctg gaggaggagg gagcggatcc 900 atggatatcc agatgaccca gtccccgagc tccctgtccg cctctgtggg cgatagggtc 960 accatcacct gccgtgccag tcaggacatc cgtaattatc tgaactggta tcaacagaaa 1020 ccaggaaaag ctccgaaact actgatttac tatacctccc gcctggagtc tggagtccct 1080 tctcgcttct ctggttctgg ttctgggacg gattacactc tgaccatcag cagtctgcaa 1140 ccggaagact tcgcaactta ttactgtcag caaggtaata ctctgccgtg gacgttcgga 1200 cagggcacca aggtggagat caaaggcggc ggcggaagtg gaggaggagg ctcaggcgga 1260 ggagggagcg aggttcagct ggtggagtct ggcggtggcc tggtgcagcc agggggctca 1320 ctccgtttgt cctgtgcagc ttctggctac tctttaccg gctacactat gaactgggtg 1380 cgtcaggccc caggtaaggg cctggaatgg gttgcactga ttaatcctta taaaggtgtt 1440 agtacctaca accagaagtt caaggaccgt ttcactataa gcgtagataa atccaaaaac 1500 acagcctacc tgcaaatgaa cagcctgcgt gctgaggaca ctgccgtcta ttattgtgct 1560 agaagcggat actacggcga tagtgactgg tattttgacg tgtggggtca aggaaccctg 1620 gtcaccgtct cctcgactag tggcggagga ggatcactcg agagcggaca ggtgctgctg 1680 gaatccaata tcaaagtcct gcccacttgg tctacccccg tgcagcctat ggctctgatt 1740 gtgctgggag gagtcgcagg actgctgctg tttatcgggc tgggaatttt cttttgcgtg 1800 cgctgccggc accggagaag gcaggccgag cgcatgagcc agatcaagcg actgctgagc 1860 gagaagaaaa cctgtcagtg tccccataga ttccagaaga cctgttcacc catt 1914 <210> 60 <211> 638 <212> PRT <213> Synthetic Sequence <220> <223> Description of synthetic sequence: Synthetic polypeptide <400> 60 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe 35 40 45 Asn Ile Tyr Tyr Ser Tyr Met His Trp Val Arg Gln Ala Pro Gly Lys 50 55 60 Gly Leu Glu Trp Val Ala Ser Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser 65 70 75 80 Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser 85 90 95 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Arg His Gly Tyr Ala Leu Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Ser Thr Ser Gly Ser Gly 130 135 140 Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Arg Ala Ser Gln Ser Val Ser Ser Ala Val Ala Trp Tyr Gln 180 185 190 Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser 195 200 205 Leu Tyr Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr 210 215 220 Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr 225 230 235 240 Tyr Tyr Cys Gln Gln Ser Val Trp Val Gly Tyr Ser Leu Ile Thr Phe 245 250 255 Gly Gln Gly Thr Lys Val Glu Ile Lys Glu Gln Lys Leu Ile Ser Glu 260 265 270 Glu Asp Leu Asn Pro Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 275 280 285 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser Met Asp Ile Gln 290 295 300 Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val 305 310 315 320 Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp 325 330 335 Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Tyr Thr 340 345 350 Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser 355 360 365 Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe 370 375 380 Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Trp Thr Phe Gly 385 390 395 400 Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly 405 410 415 Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly 420 425 430 Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser 435 440 445 Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val Arg Gln Ala Pro 450 455 460 Gly Lys Gly Leu Glu Trp Val Ala Leu Ile Asn Pro Tyr Lys Gly Val 465 470 475 480 Ser Thr Tyr Asn Gln Lys Phe Lys Asp Arg Phe Thr Ile Ser Val Asp 485 490 495 Lys Ser Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 500 505 510 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly Asp Ser 515 520 525 Asp Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser 530 535 540 Ser Thr Ser Gly Gly Gly Gly Ser Leu Glu Ser Gly Gln Val Leu Leu 545 550 555 560 Glu Ser Asn Ile Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro 565 570 575 Met Ala Leu Ile Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile 580 585 590 Gly Leu Gly Ile Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg Gln 595 600 605 Ala Glu Arg Met Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr 610 615 620 Cys Gln Cys Pro His Arg Phe Gln Lys Thr Cys Ser Pro Ile 625 630 635 <210> 61 <211> 1914 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 61 atggccctgc cagtgaccgc cctgctgctg ccactggccc tgctgctgca cgccgcccgg 60 cctgacatcc agatgacaca gtccccaagc tccctgtccg cctctgtggg cgatagggtg 120 accatcacat gcagggcaag ccagtccgtg tctagcgccg tggcatggta ccagcagaag 180 cccggcaagg cccctaagct gctgatctac agcgcctcct ctctgtattc cggcgtgcca 240 tctcggttct ctggcagcag atccggcacc gactttaccc tgacaatcag ctccctgcag 300 cccgaggatt tcgccacata ctattgccag cagagcgtgt gggtgggcta ctccctgatc 360 acctttggcc agggcacaaa ggtggagatc aagggatcta ccagcggatc cggcaagcct 420 ggcagcggag agggatccac aaagggagag gtgcagctgg tggagtctgg aggaggcctg 480 gtgcagcctg gcggctctct gaggctgagc tgtgcagcat ccggcttcaa catctactat 540 agctacatgc actgggtgcg ccaggccccc ggcaagggcc tggagtgggt ggcctctatc 600 agcccttact atggctacac ctcttatgcc gacagcgtga agggccggtt tacaatctcc 660 gccgatacct ctaagaacac agcctatctg cagatgaatt ccctgagggc agaggacacc 720 gccgtgtact attgtgccag acacggctac gccctggatt attggggcca gggcaccctg 780 gtgacagtgt ctagcgagca gaagctgatc agcgaggagg acctgaatcc cgggggagga 840 ggagggagcg ggggaggagg cagcggcggg ggaggctctg gaggaggagg gagcggatcc 900 atggatatcc agatgaccca gtccccgagc tccctgtccg cctctgtggg cgatagggtc 960 accatcacct gccgtgccag tcaggacatc cgtaattatc tgaactggta tcaacagaaa 1020 ccaggaaaag ctccgaaact actgatttac tatacctccc gcctggagtc tggagtccct 1080 tctcgcttct ctggttctgg ttctgggacg gattacactc tgaccatcag cagtctgcaa 1140 ccggaagact tcgcaactta ttactgtcag caaggtaata ctctgccgtg gacgttcgga 1200 cagggcacca aggtggagat caaaggcggc ggcggaagtg gaggaggagg ctcaggcgga 1260 ggagggagcg aggttcagct ggtggagtct ggcggtggcc tggtgcagcc agggggctca 1320 ctccgtttgt cctgtgcagc ttctggctac tctttaccg gctacactat gaactgggtg 1380 cgtcaggccc caggtaaggg cctggaatgg gttgcactga ttaatcctta taaaggtgtt 1440 agtacctaca accagaagtt caaggaccgt ttcactataa gcgtagataa atccaaaaac 1500 acagcctacc tgcaaatgaa cagcctgcgt gctgaggaca ctgccgtcta ttattgtgct 1560 agaagcggat actacggcga tagtgactgg tattttgacg tgtggggtca aggaaccctg 1620 gtcaccgtct cctcgactag tggcggagga ggatcactcg agagcggaca ggtgctgctg 1680 gaatccaata tcaaagtcct gcccacttgg tctacccccg tgcagcctat ggctctgatt 1740 gtgctgggag gagtcgcagg actgctgctg tttatcgggc tgggaatttt cttttgcgtg 1800 cgctgccggc accggagaag gcaggccgag cgcatgagcc agatcaagcg actgctgagc 1860 gagaagaaaa cctgtcagtg tccccataga ttccagaaga cctgttcacc catt 1914 <210> 62 <211> 638 <212> PRT <213> Synthetic Sequence <220> <223> Description of synthetic sequence: Synthetic polypeptide <400> 62 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu 20 25 30 Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln 35 40 45 Ser Val Ser Ser Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala 50 55 60 Pro Lys Leu Leu Ile Tyr Ser Ala Ser Ser Leu Tyr Ser Gly Val Pro 65 70 75 80 Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr Asp Phe Thr Leu Thr Ile 85 90 95 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser 100 105 110 Val Trp Val Gly Tyr Ser Leu Ile Thr Phe Gly Gln Gly Thr Lys Val 115 120 125 Glu Ile Lys Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu 130 135 140 Gly Ser Thr Lys Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 145 150 155 160 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe 165 170 175 Asn Ile Tyr Tyr Ser Tyr Met His Trp Val Arg Gln Ala Pro Gly Lys 180 185 190 Gly Leu Glu Trp Val Ala Ser Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser 195 200 205 Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser 210 215 220 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 225 230 235 240 Ala Val Tyr Tyr Cys Ala Arg His Gly Tyr Ala Leu Asp Tyr Trp Gly 245 250 255 Gln Gly Thr Leu Val Thr Val Ser Ser Glu Gln Lys Leu Ile Ser Glu 260 265 270 Glu Asp Leu Asn Pro Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 275 280 285 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser Met Asp Ile Gln 290 295 300 Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val 305 310 315 320 Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp 325 330 335 Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Tyr Thr 340 345 350 Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser 355 360 365 Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe 370 375 380 Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Trp Thr Phe Gly 385 390 395 400 Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly 405 410 415 Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly 420 425 430 Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser 435 440 445 Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val Arg Gln Ala Pro 450 455 460 Gly Lys Gly Leu Glu Trp Val Ala Leu Ile Asn Pro Tyr Lys Gly Val 465 470 475 480 Ser Thr Tyr Asn Gln Lys Phe Lys Asp Arg Phe Thr Ile Ser Val Asp 485 490 495 Lys Ser Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 500 505 510 Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly Asp Ser 515 520 525 Asp Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser 530 535 540 Ser Thr Ser Gly Gly Gly Gly Ser Leu Glu Ser Gly Gln Val Leu Leu 545 550 555 560 Glu Ser Asn Ile Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro 565 570 575 Met Ala Leu Ile Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile 580 585 590 Gly Leu Gly Ile Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg Gln 595 600 605 Ala Glu Arg Met Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr 610 615 620 Cys Gln Cys Pro His Arg Phe Gln Lys Thr Cys Ser Pro Ile 625 630 635 <210> 63 <211> 1917 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polynucleotide <400> 63 atggctttgc ctgtcacggc tcttctgctc cctctggccc tgcttctgca cgcggcgcga 60 cccgatatcc agatgactca gacgacctca tcattgtccg ccagtttggg ggacagggtt 120 acaatatcct gccgggcgag ccaagacatc agtaaatatc ttaattggta ccagcagaaa 180 ccagatggta cagtaaaact tcttatctac cacacctctc ggctccactc tggggttccc 240 tctaggttca gtggtagtgg gtcaggcacc gactacagcc ttacgataag caacttggaa 300 caggaggata tcgcaactta cttctgccaa cagggaaata ccctgcctta cacgttcggt 360 ggaggcacta aactggagat cactgggtca acctctggta gcggtaagcc tggctccggc 420 gaaggctcca caaagggtga ggtgaaactc caagagtcag gtcccggttt ggtagccccc 480 tcacaaagtt tgtcagttac ttgtaccgta agcggcgttt ccctgcccga ttacggtgtg 540 agctggataa ggcagccacc gagaaaaggt cttgaatggc tgggagtgat ctgggggtct 600 gagacaacgt attacaactc agctcttaag agcaggctta cgatcattaa agataacagc 660 aaatctcaag tgttcctcaa aatgaatagc cttcaaactg atgatactgc catctattat 720 tgtgctaagc attattacta tggcggcagt tacgcaatgg attattgggg gcaaggtacc 780 tcagtcactg taagcagcga acagaagctc atttctgaag aagacctcaa ccccggaggg 840 ggagggggaa gtggggggagg gggtagtggt ggcggaggat caggcggggg gggatcagga 900 tccatggata tccagatgac ccagtccccg agctccctgt ccgcctctgt gggcgatagg 960 gtcaccatca cctgccgtgc cagtcaggac atccgtaatt atctgaactg gtatcaacag 1020 aaaccaggaa aagctccgaa actactgatt tactatacct cccgcctgga gtctggagtc 1080 ccttctcgct tctctggttc tggttctggg acggattaca ctctgaccat cagcagtctg 1140 caaccggaag acttcgcaac ttattactgt cagcaaggta atactctgcc gtggacgttc 1200 ggacagggca ccaaggtgga gatcaaaggc ggcggcggaa gtggaggagg aggctcaggc 1260 ggaggaggga gcgaggttca gctggtggag tctggcggtg gcctggtgca gccagggggc 1320 tcactccgtt tgtcctgtgc agcttctggc tactccttta ccggctacac tatgaactgg 1380 gtgcgtcagg ccccaggtaa gggcctggaa tgggttgcac tgattaatcc taccaaaggt 1440 gttagtacct acaaccagaa gttcaaggac cgtttcacta taagcgtaga taaatccaaa 1500 aacacagcct acctgcaaat gaacagcctg cgtgctgagg acactgccgt ctattattgt 1560 gctagaagcg gatactacgg cgatagtgac tggtattttg acgtgtgggg tcaaggaacc 1620 ctggtcaccg tctcctcgac tagtggcgga ggaggatcac tcgagagcgg acaggtgctg 1680 ctggaatcca atatcaaagt cctgcccact tggtctaccc ccgtgcagcc tatggctctg 1740 attgtgctgg gaggagtcgc aggactgctg ctgtttatcg ggctgggaat tttcttttgc 1800 gtgcgctgcc ggcaccggag aaggcaggcc gagcgcatga gccagatcaa gcgactgctg 1860 agcgagaaga aaacctgtca gtgtccccat agattccaga agacctgttc acccatt 1917 <210> 64 <211> 639 <212> PRT <213> Synthetic Sequence <220> <223> Description of synthetic sequence: Synthetic polypeptide <400> 64 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu 20 25 30 Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln 35 40 45 Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr 50 55 60 Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro 65 70 75 80 Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile 85 90 95 Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly 100 105 110 Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr 115 120 125 Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr 130 135 140 Lys Gly Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro 145 150 155 160 Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro 165 170 175 Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu 180 185 190 Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala 195 200 205 Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val 210 215 220 Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr 225 230 235 240 Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp 245 250 255 Gly Gln Gly Thr Ser Val Thr Val Ser Ser Glu Gln Lys Leu Ile Ser 260 265 270 Glu Glu Asp Leu Asn Pro Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly 275 280 285 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser Met Asp Ile 290 295 300 Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg 305 310 315 320 Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr Leu Asn 325 330 335 Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Tyr 340 345 350 Thr Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly 355 360 365 Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp 370 375 380 Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Trp Thr Phe 385 390 395 400 Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly 405 410 415 Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly 420 425 430 Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala 435 440 445 Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val Arg Gln Ala 450 455 460 Pro Gly Lys Gly Leu Glu Trp Val Ala Leu Ile Asn Pro Thr Lys Gly 465 470 475 480 Val Ser Thr Tyr Asn Gln Lys Phe Lys Asp Arg Phe Thr Ile Ser Val 485 490 495 Asp Lys Ser Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala 500 505 510 Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly Asp 515 520 525 Ser Asp Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val 530 535 540 Ser Ser Thr Ser Gly Gly Gly Gly Ser Leu Glu Ser Gly Gln Val Leu 545 550 555 560 Leu Glu Ser Asn Ile Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln 565 570 575 Pro Met Ala Leu Ile Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe 580 585 590 Ile Gly Leu Gly Ile Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg 595 600 605 Gln Ala Glu Arg Met Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys 610 615 620 Thr Cys Gln Cys Pro His Arg Phe Gln Lys Thr Cys Ser Pro Ile 625 630 635 <210> 65 <211> 1566 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: synthetic polynucleotide <400> 65 atggagaccc ccgcccagct gctgttcctg ctgctgctgt ggctgcccga caccaccggc 60 atgtcacggg gctccgacct gggcaaaaag ctgctggagg ccgctagggc cgggcaggac 120 gatgaagtga gaatcctgat ggccaacggg gctgacgtga atgctaagga tgagtacggc 180 ctgacccccc tgtatctggc tacagcacac ggccatctgg agatcgtgga agtcctgctg 240 aaaaacggag ccgacgtgaa tgcagtcgat gccattgggt tcactcctct gcacctggca 300 gcctttatcg gacatctgga gattgcagaa gtgctgctga agcacggcgc tgacgtgaac 360 gcacaggata agttcggaaa aaccgctttt gacatcagca ttggcaacgg aaatgaagac 420 ctggctgaaa tcctgcagaa actgaatgaa cagaaactga ttagcgaaga agacctgaac 480 cccgggggag gaggagggag cgggggagga ggcagcggcg ggggaggctc tggaggagga 540 gggagcggat ccatggatat ccagatgacc cagtccccga gctccctgtc cgcctctgtg 600 ggcgataggg tcaccatcac ctgccgtgcc agtcaggaca tccgtaatta tctgaactgg 660 tatcaacaga aaccaggaaa agctccgaaa ctactgattt actatacctc ccgcctggag 720 tctggagtcc cttctcgctt ctctggttct ggttctggga cggattacac tctgaccatc 780 agcagtctgc aaccggaaga cttcgcaact tattactgtc agcaaggtaa tactctgccg 840 tggacgtcg gacagggcac caaggtggag atcaaaggcg gcggcggaag tggaggagga 900 ggctcaggcg gaggagggag cgaggttcag ctggtggagt ctggcggtgg cctggtgcag 960 ccagggggct cactccgttt gtcctgtgca gcttctggct actcctttac cggctacact 1020 atgaactggg tgcgtcaggc cccaggtaag ggcctggaat gggttgcact gattaatcct 1080 tataaaggtg ttagtaccta caaccagaag ttcaaggacc gtttcactat aagcgtagat 1140 aaatccaaaa acacagccta cctgcaaatg aacagcctgc gtgctgagga cactgccgtc 1200 tattattgtg ctagaagcgg atactacggc gatagtgact ggtattttga cgtgtggggt 1260 caaggaaccc tggtcaccgt ctcctcgact agtggcggag gaggatcact cgagagcgga 1320 caggtgctgc tggaatccaa tatcaaagtc ctgcccactt ggtctacccc cgtgcagcct 1380 atggctctga ttgtgctggg aggagtcgca ggactgctgc tgtttatcgg gctgggaatt 1440 ttcttttgcg tgcgctgccg gcaccggaga aggcaggccg agcgcatgag ccagatcaag 1500 cgactgctga gcgagaagaa aacctgtcag tgtccccata gattccagaa gacctgttca 1560 cccatt 1566 <210> 66 <211> 522 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 66 Met Glu Thr Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly Met Ser Arg Gly Ser Asp Leu Gly Lys Lys Leu Leu 20 25 30 Glu Ala Ala Arg Ala Gly Gln Asp Asp Glu Val Arg Ile Leu Met Ala 35 40 45 Asn Gly Ala Asp Val Asn Ala Lys Asp Glu Tyr Gly Leu Thr Pro Leu 50 55 60 Tyr Leu Ala Thr Ala His Gly His Leu Glu Ile Val Glu Val Leu Leu 65 70 75 80 Lys Asn Gly Ala Asp Val Asn Ala Val Asp Ala Ile Gly Phe Thr Pro 85 90 95 Leu His Leu Ala Ala Phe Ile Gly His Leu Glu Ile Ala Glu Val Leu 100 105 110 Leu Lys His Gly Ala Asp Val Asn Ala Gln Asp Lys Phe Gly Lys Thr 115 120 125 Ala Phe Asp Ile Ser Ile Gly Asn Gly Asn Glu Asp Leu Ala Glu Ile 130 135 140 Leu Gln Lys Leu Asn Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn 145 150 155 160 Pro Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 165 170 175 Ser Gly Gly Gly Gly Ser Gly Ser Met Asp Ile Gln Met Thr Gln Ser 180 185 190 Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys 195 200 205 Arg Ala Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp Tyr Gln Gln Lys 210 215 220 Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu Glu 225 230 235 240 Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr 245 250 255 Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr 260 265 270 Cys Gln Gln Gly Asn Thr Leu Pro Trp Thr Phe Gly Gln Gly Thr Lys 275 280 285 Val Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 290 295 300 Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser Phe 325 330 335 Thr Gly Tyr Thr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Ala Leu Ile Asn Pro Tyr Lys Gly Val Ser Thr Tyr Asn 355 360 365 Gln Lys Phe Lys Asp Arg Phe Thr Ile Ser Val Asp Lys Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp Trp Tyr Phe 405 410 415 Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Thr Ser Gly 420 425 430 Gly Gly Gly Ser Leu Glu Ser Gly Gln Val Leu Leu Glu Ser Asn Ile 435 440 445 Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro Met Ala Leu Ile 450 455 460 Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile 465 470 475 480 Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg Gln Ala Glu Arg Met 485 490 495 Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr Cys Gln Cys Pro 500 505 510 His Arg Phe Gln Lys Thr Cys Ser Pro Ile 515 520 <210> 67 <211> 1569 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 67 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccgatgtcac ggggctccga cctgggcaaa aagctgctgg aggccgctag ggccgggcag 120 gacgatgaag tgagaatcct gatggccaac ggggctgacg tgaatgctaa ggatgagtac 180 ggcctgaccc ccctgtatct ggctacagca cacggccatc tggagatcgt ggaagtcctg 240 ctgaaaaacg gagccgacgt gaatgcagtc gatgccattg ggttcactcc tctgcacctg 300 gcagccttta tcggacatct ggagattgca gaagtgctgc tgaagcacgg cgctgacgtg 360 aacgcacagg ataagttcgg aaaaaccgct tttgacatca gcattggcaa cggaaatgaa 420 gacctggctg aaatcctgca gaaactgaat gaacagaaac tgattagcga agaagacctg 480 aaccccgggg gaggaggagg gagcggggga ggaggcagcg gcgggggagg ctctggagga 540 ggagggagcg gatccatgga tatccagatg acccagtccc cgagctccct gtccgcctct 600 gtgggcgata gggtcaccat cacctgccgt gccagtcagg acatccgtaa ttatctgaac 660 tggtatcaac agaaaccagg aaaagctccg aaactactga tttactatac ctcccgcctg 720 gagtctggag tcccttctcg cttctctggt tctggttctg ggacggatta cactctgacc 780 atcagcagtc tgcaaccgga agacttcgca acttattact gtcagcaagg taatactctg 840 ccgtggacgt tcggacaggg caccaaggtg gagatcaaag gcggcggcgg aagtggagga 900 ggaggctcag gcggaggagg gagcgaggtt cagctggtgg agtctggcgg tggcctggtg 960 cagccagggg gctcactccg tttgtcctgt gcagcttctg gctactcctt taccggctac 1020 actatgaact gggtgcgtca ggccccaggt aagggcctgg aatgggttgc actgattaat 1080 ccttataaag gtgttagtac ctacaaccag aagttcaagg accgtttcac tataagcgta 1140 gataaatcca aaaacacagc ctacctgcaa atgaacagcc tgcgtgctga ggacactgcc 1200 gtctattatt gtgctagaag cggatactac ggcgatagtg actggtattt tgacgtgtgg 1260 ggtcaaggaa ccctggtcac cgtctcctcg actagtggcg gaggaggatc actcgagagc 1320 ggacaggtgc tgctggaatc caatatcaaa gtcctgccca cttggtctac ccccgtgcag 1380 cctatggctc tgattgtgct gggaggagtc gcaggactgc tgctgtttat cgggctggga 1440 attttctttt gcgtgcgctg ccggcaccgg agaaggcagg ccgagcgcat gagccagatc 1500 aagcgactgc tgagcgagaa gaaaacctgt cagtgtcccc atagattcca gaagacctgt 1560 tcacccatt 1569 <210> 68 <211> 523 <212> PRT <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polypeptide <400> 68 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Met Ser Arg Gly Ser Asp Leu Gly Lys Lys Leu 20 25 30 Leu Glu Ala Ala Arg Ala Gly Gln Asp Asp Glu Val Arg Ile Leu Met 35 40 45 Ala Asn Gly Ala Asp Val Asn Ala Lys Asp Glu Tyr Gly Leu Thr Pro 50 55 60 Leu Tyr Leu Ala Thr Ala His Gly His Leu Glu Ile Val Glu Val Leu 65 70 75 80 Leu Lys Asn Gly Ala Asp Val Asn Ala Val Asp Ala Ile Gly Phe Thr 85 90 95 Pro Leu His Leu Ala Ala Phe Ile Gly His Leu Glu Ile Ala Glu Val 100 105 110 Leu Leu Lys His Gly Ala Asp Val Asn Ala Gln Asp Lys Phe Gly Lys 115 120 125 Thr Ala Phe Asp Ile Ser Ile Gly Asn Gly Asn Glu Asp Leu Ala Glu 130 135 140 Ile Leu Gln Lys Leu Asn Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 145 150 155 160 Asn Pro Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 165 170 175 Gly Ser Gly Gly Gly Gly Ser Gly Ser Met Asp Ile Gln Met Thr Gln 180 185 190 Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr 195 200 205 Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp Tyr Gln Gln 210 215 220 Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu 225 230 235 240 Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 245 250 255 Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 260 265 270 Tyr Cys Gln Gln Gly Asn Thr Leu Pro Trp Thr Phe Gly Gln Gly Thr 275 280 285 Lys Val Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val 305 310 315 320 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser 325 330 335 Phe Thr Gly Tyr Thr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly 340 345 350 Leu Glu Trp Val Ala Leu Ile Asn Pro Tyr Lys Gly Val Ser Thr Tyr 355 360 365 Asn Gln Lys Phe Lys Asp Arg Phe Thr Ile Ser Val Asp Lys Ser Lys 370 375 380 Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 385 390 395 400 Val Tyr Tyr Cys Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp Trp Tyr 405 410 415 Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Thr Ser 420 425 430 Gly Gly Gly Gly Ser Leu Glu Ser Gly Gln Val Leu Leu Glu Ser Asn 435 440 445 Ile Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro Met Ala Leu 450 455 460 Ile Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly 465 470 475 480 Ile Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg Gln Ala Glu Arg 485 490 495 Met Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr Cys Gln Cys 500 505 510 Pro His Arg Phe Gln Lys Thr Cys Ser Pro Ile 515 520 <210> 69 <211> 20 <212> PRT <213> Synthetic sequence <220> <223> Description of synthetic sequence: Synthetic peptide <400> 69 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Gly Ser 20 <210> 70 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 70 ggaggaggag ggagcggggg aggaggcagc ggcggggggag gctctggagg aggagggagc 60 <210> 71 <211> 750 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 71 atggacatcc agatgactca gaccacaagc tccctgtctg caagtctggg cgaccgggtg 60 acaatctcct gcagagcctc tcaggatatt aggaactacc tgaattggta tcagcagaaa 120 cctgatggca cagtcaagct gctgatctac tataccagcc ggctgcactc aggcgtgcca 180 agcaaattct caggaagcgg ctccgggact gactactccc tgaccatctc taacctggag 240 caggaagata ttgctaccta tttctgccag cagggcaata cactgccctg gacttttgcc 300 ggaggcacca aactggagat caagggggga ggcggggagtg gaggcggggg atcaggagga 360 ggaggcagcg gaggaggagg gtccgaggtc cagctgcagc agagcggacc agaactggtg 420 aagcccggag caagtatgaa aatctcctgt aaggcctcag gatacagctt caccggctat 480 acaatgaact gggtgaaaca gtcccatggc aagaacctgg aatggatggg gctgattaat 540 cctaccaaag gcgtcagcac ctataatcag aagtttaaag acaaggccac actgactgtg 600 gataagtcta gttcaaccgc ttacatggag ctgctgtccc tgacatctga agacagtgcc 660 gtgtactatt gtgctcggtc tggctactat ggggacagtg attggtactt cgatgtctgg 720 ggacagggca ctaccctgac cgtgttttct 750 <210> 72 <211> 250 <212> PRT <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic polypeptide <400> 72 Met Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu 1 5 10 15 Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Arg Asn 20 25 30 Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu 35 40 45 Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser Lys Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu 65 70 75 80 Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro 85 90 95 Trp Thr Phe Ala Gly Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly 100 105 110 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 130 135 140 Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 145 150 155 160 Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Met 165 170 175 Gly Leu Ile Asn Pro Thr Lys Gly Val Ser Thr Tyr Asn Gln Lys Phe 180 185 190 Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 195 200 205 Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 210 215 220 Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp Trp Tyr Phe Asp Val Trp 225 230 235 240 Gly Gln Gly Thr Thr Leu Thr Val Phe Ser 245 250 <210> 73 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 73 Gly Gly Gly Gly Ser 1 5 <210> 74 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 74 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 75 <211> 1560 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic polynucleotides <400> 75 atggatttcc aggtccagat tttctccttc ctgctgattt ccgcaagcgt cattatgtca 60 cggggctccg acctgggcaa aaagctgctg gaggccgcta gggccgggca ggacgatgaa 120 gtgagaatcc tgatggccaa cggggctgac gtgaatgcta aggatgagta cggcctgacc 180 cccctgtatc tggctacagc acacggccat ctggagatcg tggagtcct gctgaaaaac 240 ggagccgacg tgaatgcagt cgatgccatt gggttcactc ctctgcacct ggcagccttt 300 atcggacatc tggattgc agaagtgctg ctgaagcacg gcgctgacgt gaacgcacag 360 gataagttcg gaaaaaccgc ttttgacatc agcattggca acggaatga agacctggct 420 gaaatcctgc agaactgaa tgaacagaaa ctgattagcg aagagacct gaaccccggg 480 ggaggaggag ggcgggggg ggcggggg ggcggggg ggcggggg 540 ggatccatgg atatccagat gacccagtcc ccgagctccc tgtccgcctc tgtgggcgat 600 agggtcacca tcacctgccg tgccagtcag gataccgta attatctgaa ctggtatcaa 660 cagaaaccag gaaaagctcc gaaactactg atttactata cctcccgcct ggagtctgga 720 gtccctctc gcttctctgg tctgttct gggacggatt acacctgac catcagcagt 780 ctgcaaccgg agacttcgc aacttac tgtcagcaag gtaatactct gccgtggacg 840 ttcggacagg gcaccaaggt ggagatcaaa ggcggcggcg gaagtggagg aggaggctca 900 ggcggaggag ggagcgaggt tcagctgtg gagtctggcg gtggctggt gcagccaggg 960 ggctcactcc gttgtcctg tgcagcttct ggctactcct ttaccggcta cactatgac 1020 tgggtgcgtc aggccccagg taagggctg gatgggttg cactgattaa tccttataa 1080 ggtgttagta cctacaacca gaagttcaag gaccgtttca ctataagcgt agataaatcc 1140 aaaaacacag cctacctgca aatgaacagc ctgcgtgctg aggacactgc cgtctattat 1200 tgtgctagaa gcggatacta cggcgatagt gactggtatt tgacgtgtg gggtcaagga 1260 accctgtca ccgtctccctc gactagtgc ggaggat cactcgagag cggacaggtg 1320 ctgctggaat ccaatatca agtcctgccc acttgtcta cccccgtgca gcctatggct 1380 ctgattgtgc tgggaggt cgcaggactg ctgctttta tcggctggg aattcttt 1440 tgcgtgcgct gccggcaccg gagaggcag gccgagcgca tgagccagat caagcgactg 1500 ctgagcgaga agaaaacctg tcagtgtccc catagattcc agaagacctg ttcaccatt 1560 <210> 76 <211> 520 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 76 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Ser Asp Leu Gly Lys Lys Leu Leu Glu Ala 20 25 30 Ala Arg Ala Gly Gln Asp Asp Glu Val Arg Ile Leu Met Ala Asn Gly 35 40 45 Ala Asp Val Asn Ala Lys Asp Glu Tyr Gly Leu Thr Pro Leu Tyr Leu 50 55 60 Ala Thr Ala His Gly His Leu Glu Ile Val Glu Val Leu Leu Lys Asn 65 70 75 80 Gly Ala Asp Val Asn Ala Val Asp Ala Ile Gly Phe Thr Pro Leu His 85 90 95 Leu Ala Ala Phe Ile Gly His Leu Glu Ile Ala Glu Val Leu Leu Lys 100 105 110 His Gly Ala Asp Val Asn Ala Gln Asp Lys Phe Gly Lys Thr Ala Phe 115 120 125 Asp Ile Ser Ile Gly Asn Gly Asn Glu Asp Leu Ala Glu Ile Leu Gln 130 135 140 Lys Leu Asn Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Pro Gly 145 150 155 160 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 165 170 175 Gly Gly Gly Ser Gly Ser Met Asp Ile Gln Met Thr Gln Ser Pro Ser 180 185 190 Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala 195 200 205 Ser Gln Asp Ile Arg Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly 210 215 220 Lys Ala Pro Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu Glu Ser Gly 225 230 235 240 Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu 245 250 255 Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln 260 265 270 Gln Gly Asn Thr Leu Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu 275 280 285 Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 290 295 300 Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 305 310 315 320 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser Phe Thr Gly 325 330 335 Tyr Thr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp 340 345 350 Val Ala Leu Ile Asn Pro Tyr Lys Gly Val Ser Thr Tyr Asn Gln Lys 355 360 365 Phe Lys Asp Arg Phe Thr Ile Ser Val Asp Lys Ser Lys Asn Thr Ala 370 375 380 Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr 385 390 395 400 Cys Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp Trp Tyr Phe Asp Val 405 410 415 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Thr Ser Gly Gly Gly 420 425 430 Gly Ser Leu Glu Ser Gly Gln Val Leu Leu Glu Ser Asn Ile Lys Val 435 440 445 Leu Pro Thr Trp Ser Thr Pro Val Gln Pro Met Ala Leu Ile Val Leu 450 455 460 Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe Phe 465 470 475 480 Cys Val Arg Cys Arg His Arg Arg Arg Gln Ala Glu Arg Met Ser Gln 485 490 495 Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr Cys Gln Cys Pro His Arg 500 505 510 Phe Gln Lys Thr Cys Ser Pro Ile 515 520 <210> 77 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic oligonucleotides <400> 77 ggcggcggcg gaagtggagg aggaggctca ggcggaggag ggagc 45 BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The novel features of the present invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by referring to the following detailed description which illustrates illustrative embodiments utilizing the principles of the invention and the accompanying drawings, in which:

[0022] Figure 1A Schematic diagram of naive T-cell activation.

[0023] Figure 1B Schematic diagram of CAR-based T-cell activation.

[0024] Figure 1CSchematic diagram of T cell activation based on trifunctional-T cell antigen conjugate (Tri-TAC).

[0025] Figure 1D Schematic diagram of naive T-cell activation.

[0026] Figure 1E Schematic diagram of CAR-based T-cell activation.

[0027] Figure 1F Schematic diagram of Tri-TAC-based T cell activation.

[0028] Figure 2A is a schematic diagram of the Tri-TAC configuration, in which the UCHT1 domain is centrally located between the transmembrane domain (TM) and the antigen-binding domain.

[0029] Figure 2B is a schematic diagram of the Tri-TAC configuration, in which the UCHT1 domain is at the N-terminus, followed by the antigen-binding domain and the transmembrane domain.

[0030] Figure 2C Schematic diagram of the Tri-TAC molecule with a universal antigen-binding domain and a UCHT1 domain.

[0031] Figure 3A Schematic diagram of a Tri-TAC molecule with a universal antigen-binding domain.

[0032] Figure 3B Schematic diagram of Tri-TAC with anti-HER-2 DARPin antigen-binding domain.

[0033] Figure 3C Schematic diagram of Tri-TAC with anti-CD19 scFv antigen-binding domain.

[0034] Figure 3D Schematic diagram of Tri-TAC with anti-BCMA scFv antigen-binding domain.

[0035] Figure 3E Schematic diagram of a Tri-TAC molecule with an anti-HER-2 DARPin antigen-binding domain.

[0036] Figure 3F Schematic diagram of the Tri-TAC molecule with the anti-BCMA scFv antigen-binding domain.

[0037] Figures 4A-4D T cells engineered with Tri-TAC against HER-2 or CD28-based CAR using DARPins are exemplified. Figure 4ASurface expression of the Tri-TAC and CAR compared to T cells not expressing the chimeric receptor is illustrated. Figure 4B The growth of three cell populations is illustrated. Figure 4C-4D The percentage of engineered cells that are positive for various T cell activation markers following stimulation with antigen are illustrated.

[0038] Figure 5 A model of the CD19-TAC protein structure is shown.

[0039] Figures 6A-6J Receptor surface expression and activation of various anti-HER-2 DARPin Tri-TAC controls are shown.T cells were engineered with Tri-TAC variants lacking the targeting element (-DARPin), Tri-TAC variants lacking UCHT1 (-UCHT1), or full-length Tri-TAC. Figure 6A 、 Figure 6D 、 Figure 6G T cell transduction and Her2 binding capacity are shown (left); Figure 6B 、 Figure 6E 、 Figure 6H Threshing is shown (center), and Figure 6C 、 Figure 6F 、 Figure 6I Cytokine production is shown (right). Figure 6J It was shown that only the full-length anti-HER-2 DARPin Tri-TAC was able to elicit a cytotoxic response.

[0040] Figures 7A-7C Anti-tumor activity, toxicity, and cytokine production of T cells engineered with anti-HER-2 DARPin Tri-TAC or anti-HER-2 DARPin CD28-based CARs are shown. Mice bearing established OVCAR-3 tumors were treated with T cells engineered with anti-HER-2 DARPin Tri-TAC or anti-HER-2 DARPin CARs. Figure 7A The changes in tumor growth relative to the day of T cell infusion (day 35) are illustrated. Figure 7B The changes in body weight as a measure of toxicity in the same mice are illustrated. Figure 7C Shown are cytokine concentrations in mouse serum on day 7 after T-cell infusion.

[0041] Figures 8A-8H Shown are Tri-TACs designed with various replacements to the UCHT1 scFv-CD3 recruiting domain. Figure 8A Schematic diagrams of TAC receptor constructs utilizing anti-HER-2 DARPins paired with UCHT1 or OKT3 anti-CD3 scFv are provided. Figure 8B HER-2 TAC surface expression on CD8+NGFR+ (left) or CD4+NGFR+ T cells (right) is shown. Figure 8C 、 Figure 8C1 Shown are cytokine production by HER-2-specific TAC-T cells stimulated with antigen-positive SK-OV-3 tumor cells. Figure 8D Figure 2 shows the killing of SK-OV-3 tumor cells by HER-2 TAC and vector control (vector carrying only tNGFR) T cells. Vector control T cells (circles) were compared against HER-2 specific TAC-T cells carrying UCHT1 (squares) or OKT3 (triangles). Figure 8E Schematic diagrams of TAC receptor constructs utilizing anti-CD19 scFv paired with huUCHT1, F6A, or L2K anti-CD3 scFv are provided. Figure 8F Shown are CD19-TAC surface expression on CD8+NGFR+ (left) or CD4+NGFR+ T cells (right). Figure 8G 、 Figure 8G1 Cytokine production by CD19-specific TAC-T cells stimulated with antigen-positive Raji tumor cells is shown. Cytokine-producing cells were compared with TAC-T cells harboring huUCHT1 (squares), F6A (triangles), or L2K (diamonds). Figure 8H Figure 2 shows the killing of NALM-6 tumor cells by CD19 TAC and vector control (vector carrying only tNGFR) T cells. Vector control T cells (circles) were compared against CD19-specific TAC-T cells carrying huUCHT1 (squares), F6A (triangles), or L2K (diamonds).

[0042] Figures 9A-9H Shown are the effects of various anti-CD3 scFvs on TCR surface expression. Figure 9A 、 Figure 9E Shown are TCR surface expression of T cells engineered with control vector (tNGFR), UCHT1 or OKT3 TAC variants. Figure 9B 、 Figure 9F It was shown that T cells engineered with OKT3-TAC had significantly reduced TCR surface expression relative to UCHT1-TAC. Figure 9C 、 Figure 9G Shown are TCR surface expression of T cells engineered with control vector (tNGFR), huUCHT1, F6A, or L2K TAC variants. Figure 9D 、 Figure 9H It was shown that T cells engineered with L2K TAC had significantly reduced TCR surface expression relative to huUCHT1-TAC.

[0043] Figures 10A-10B Linker domain variants are shown. The domain that connects the antigen binding domain to the TCR recruiting domain is called the linker domain. Figure 10A Schematic diagrams of TAC variants with different linker domains are provided: (i) flexible linker, (ii) large domain linker (built from domains 3 and 4 derived from the extracellular CD4 domain), (iii) long helical linker, and (iv) short helical linker. Figure 10B Provided Figure 10A Exemplary amino acid sequences of the domains represented in (SEQ ID NOS 69, 28, 30 and 32, respectively, in order of appearance).

[0044] Figures 11A-11E Exemplary in vitro parameters of CD19 TACs engineered with different linker variants are shown. Figure 11A Surface expression of TAC variants in both CD4 and CD8 cells is shown. Figure 11B Shown are the surface expression of TACs containing flexible linkers relative to TACs containing helical or large domain linkers. Figure 11C Shown are the overall transduction of TACs containing alternative linkers relative to flexible linkers. Figure 11D 、 Figure 11E Relative cellular reactivity to antigen-positive Raji cells is shown.

[0045] Figure 12A Shown are the in vitro cytotoxicity of BCMA Tri-TAC variants engineered with different linkers. Figure 12B Shown are in vivo tumor control of BCMA Tri-TAC variants engineered with flexible linkers compared to short helical linkers.

[0046] Figures 13A-13C The properties of CD8α Tri-TAC scFv anti-HER-2 and CD8α Tri-TAC DARPin anti-HER-2 are shown. Figure 13A 、 Figure 13C Surface expression is shown. Figure 13B Cytokine production is shown.

[0047] Figures 14A-14D Schematic diagrams of CD8 Tri-TAC variants are provided. Anti-HER-2-DARPin was used as an exemplary antigen binding domain, and UCHT1 CD3 recruiting domain was used as an exemplary recruiting domain. Figure 14AShown are Tri-TACs encompassing the CD4 transmembrane and cytoplasmic domains (left) and comparable regions of the CD8α / CD8β heterodimer (right). Regions critical for coreceptor function (arginine-rich domain and CXCP motif) are highlighted. Figure 14B Schematic diagram of CD8α Tri-TAC containing a cysteine ​​to serine mutation to ensure monomeric receptor distribution and the CD8α cytoplasmic domain. Figure 14C Schematic diagram of a CD8α+Rβ Tri-TAC containing a cysteine ​​to serine mutation to ensure monomeric receptor distribution and a chimeric CD8α cytoplasmic domain in which the arginine-rich region of CD8α is replaced by the arginine-rich region of CD8β. Figure 14D Schematic diagram of a CD8β+Lck Tri-TAC containing a cysteine ​​to serine mutation to ensure monomeric receptor distribution and a chimeric CD8β cytoplasmic domain in which the CD8α CXCP domain containing the Lck binding motif is added to the C-terminus of the CD8β cytoplasmic domain.

[0048] Figures 15A-15E Shown are in vitro characterizations of CD8 Tri-TAC variants relative to the prototype Tri-TAC containing the CD4 region. Figures 15A-15B Shown are the surface expression of CD8-Tri TAC variants relative to the prototype Tri-TAC. Figure 15C In vitro cytotoxicity of CD8-TriTAC variants co-cultured with LOX IMVI (HER-2 negative) or A549, SKOV3, SKBR3, or MBA MB 231 (HER-2 positive) is shown. Figure 15D Shown are cell divisions of T cells engineered with CD8 Tri-TAC variants or the prototype Tri-TAC. Figure 15E Shown are TCR surface expression of engineered T cells containing CD8 Tri-TAC variants or the prototype Tri-TAC.

[0049] Figure 16 Various Tri-TACs are shown.

[0050] Figure 17 The TAC-CD19 insert in the pCCL lentiviral vector is shown. Figure 17 The various domains of TAC-CD19 are shown (CD8a leader, FMC63 scFv, Myc tag, huUCHT1 Y177T mutant, and truncated CD4-anchoring coreceptor domain).

[0051] Figure 18 The in vivo potency of TAC-CD19 generated from different donors is shown.

[0052] Figures 19A-19C In vitro examples of TAC-CD19 cytotoxicity against tumor cell lines are shown. Figure 19A NALM-6 (acute lymphoblastic leukemia), Figure 19B Jeko-1 (mantle cell lymphoma), Figure 19C Raji (Burkitt lymphoma).

[0053] Figure 19D Schematic representation of three different in vivo tumor models in NRG mice is shown.

[0054] Figure 19E-19G CD19-TAC is shown in NALM-6 (acute lymphoblastic leukemia) Figure 19E , Jeko-1 (mantle cell lymphoma) Figure 19F and Raji (Burkitt's lymphoma) Figure 19G In vivo efficacy.

[0055] Figure 20A The experimental setup of TAC-CD19 treated mice bearing NALM-6 tumors is shown. After successful treatment, mice were then re-challenged with NALM-6 (CD19 positive) or KMS11 (CD19 negative) tumor cells.

[0056] Figure 20B In vivo efficacy in mice treated with TAC-CD19 is shown.

[0057] Figure 21A The experimental design to evaluate the effects of dose regimen and administration on efficacy and cell expansion is shown.

[0058] Figure 21B Shown are the in vivo survival rates of NALM-6 bearing mice treated with single or fractionated doses of TAC-CD19.

[0059] Figures 22A-22B Shown are the experimental setup and data for in vivo expansion of TAC-CD19 following fractionated dosing. Figure 22A Shown is the gating strategy used to identify T cells in mouse blood. Figure 22B In vivo results are shown for T cell expansion in blood.

[0060] Figures 23A-23C Shown are long-term in vivo studies of TAC-CD19 in mice. Figure 23A Shown is the experimental protocol for treating NALM-6 bearing mice with various controls and TAC-CD19 at two dose levels. Figure 23B Shown are the in vivo efficacy of the control group compared to the TAC-CD19 treatment groups at two dose levels. Figure 23CShown is the long-term survival rate of mice treated with low-dose TAC-CD19.

[0061] Figure 24 Shown are clinical chemistry analysis results from mice treated with TAC-CD19 or untransduced T cells.

[0062] Figure 25 Shown are human cytokines released into the blood of mice after treatment with TAC-CD19 or untransduced T cells.

[0063] Figures 26A-26C The efficacy of BCMA-TAC in different configurations is shown. Figure 26A The experimental design is shown. Figure 26B Various controls and test articles are shown. Figure 26C The in vivo efficacy of various TAC constructs is shown. Figures 26A-26C "G4S:" is disclosed as SEQ ID NO:73.

[0064] Figure 27 It was shown that the TAC proliferated when it encountered antigen on cells, but not when the antigen was present on artificial beads; whereas the CAR proliferated regardless of whether the antigen was present on beads or cells.

[0065] Figures 28A-28B TAC-engineered T cells were shown to expand in vivo and provide long-term protection, indicating persistent persistence of the cells in a myeloma model. Figures 28A-28B Shown is the KMS-11 xenograft model engineered with NanoLuc (KMS 11-NanoLuc) (BCMA pos ) in multiple myeloma tumors. Following tumor implantation, mice were treated with BCMA-TAC-T cells (expressing firefly luciferase). TAC-T cells expanded significantly following administration, correlating with tumor regression. Treated mice were resistant to tumor rechallenge, demonstrating long-term persistence of TAC-T cells.

[0066] Figure 29 Shown are human cytokines released into the blood of mice after treatment with TAC-CD19 or untransduced T cells.

[0067] Figure 30Shown are exemplary histograms of TAC receptor surface expression in CD4 and CD8 engineered T cells. Cells were engineered with muIgG HER2 TAC (EF1α promoter), huIgG HER2 TAC (MSCV promoter), and muIgG HER2 TAC (MSCV promoter). After engineering, T cells were stained with TAC-specific reagents and measured using flow cytometry. All constructs showed comparable levels of surface expression, with higher expression driven by EF1α compared to the MSCV construct.

[0068] Figure 31 The relative percentage of T cells expressing TNFα, IFNγ, or IL-2 after co-culture with OVCAR3 (HER2 positive) or LOX IMVI (HER2 negative) cells is shown. T cells were engineered with muIgG HER2 TAC (EF1α promoter), a TAC construct lacking the HER2 binding domain (Δ binding TAC; EF1α promoter), huIgG HER2 TAC (MSCV promoter), or muIgG HER2 TAC (MSCV promoter). neg ) co-cultured with OVCAR3 (HER2), Δ combined TAC control and HER2 TAC cells did not show significant cytokine expression. pos All HER2 TAC-engineered constructs co-cultured with Δ binding TACs showed similar cytokine production capacity, while control T cells engineered with Δ binding TACs did not show significant cytokine production.

[0069] Figure 32 The in vivo efficacy of TAC-engineered T cells in the OVCAR3 solid tumor model is shown. T cells were engineered with Δ binding TAC (EF1α promoter), muIgG HER2 TAC (EF1α promoter), huIgG HER2 TAC (MSCV promoter), or muIgG HER2 TAC (MSCV promoter). Mice were subcutaneously inoculated with OVCAR3 (HER-2 positive) tumors. These tumors were grown to a size of approximately 100 mm. 3 . Mice were then treated with a total of 6 million HER2 TAC-engineered or Δbinding TAC control T cells in divided doses 48 hours apart via tail vein injection. Tumor progression was tracked by biweekly measurements. Δbinding TAC showed no tumor control or tumor regression. All HER2 TAC-engineered T cells showed significantly reduced tumor progression, including tumor regression, relative to control mice. All HER2 TAC-engineered T cells had similar anti-tumor activity.

[0070] Detailed description

[0071] Cancer is a major health challenge, with more than 150,000 cases expected to be diagnosed in Canada alone. While patients with early-stage disease can sometimes be effectively treated with conventional therapies (surgery, radiation, chemotherapy), patients with advanced disease have fewer options available, and those that are available are often palliative in nature.

[0072] Active immunotherapy attempts to use the patient's immune system to eliminate tumors and provides an option for patients who have failed conventional therapy. Typically, this treatment involves infusing a large number of tumor-specific T cells into the patient. This approach has been shown to be successful in early clinical trials for a variety of diseases including melanoma, myeloma, leukemia, lymphoma, and synovial sarcoma. As a specific example, several clinical studies have demonstrated that immunotherapy using T cells is curative in patients with advanced melanoma, confirming the use of this approach. In addition, patients with chronic lymphocytic leukemia (CLL) and acute lymphoblastic leukemia (ALL) have also been effectively treated and cured by T cell immunotherapy.

[0073] The key challenge faced by the clinical application of adoptive T cell therapy is the source of T cells. Typically, T cells isolated from patients carrying tumors are grown in vitro to a large number and administered back to the patient to induce a robust anti-tumor immune response. Tumor specificity is achieved by any of the following methods: (i) isolating naturally occurring tumor-specific T cells from the patient; or (ii) engineering the subject T cells from peripheral blood to express tumor-specific receptors. Naturally occurring tumor-specific T cells are rare, and isolating such cells from cancer patients in therapeutic amounts is a laborious and expensive process. In contrast, peripheral blood T cells that are easily obtained through genetic manipulation using tumor-specific receptor engineering are becoming more and more efficient. Clinically feasible technologies for this engineering process have been developed, and several clinical studies have confirmed the feasibility and efficacy of genetically engineered T cells for treating cancer.

[0074] So far, most engineered T cell therapies involving genetic modification of T cells produce: (i) forced expression of T cell receptors (TCRs); or (ii) chimeric antigen receptors (CARs) specific for antigen targets on tumors. To date, the chimeric antigen receptors for engineered T cells are composed of the following domains: (i) targeting domains, typically single-chain variable fragments (scFv); (ii) transmembrane domains; and (iii) cytoplasmic domains containing signal transduction elements from T cell receptors and associated proteins. Such chimeric antigen receptors are also referred to as "T-bodies" or "chimeric immune receptors" (CIRs), but most current researchers use the term "CAR". An advantage of the CAR approach is that it allows any patient's immune cells to be targeted to any desired target in a manner independent of the major histocompatibility complex (MHC). This is attractive because MHC presentation is typically defective in tumor cells.

[0075] Consider taking modular form CAR, and scientists have spent a lot of time studying the effect of different cytoplasmic signaling domains on CAR function. Conventional CAR usually has two main components: (i) CD3ζ cytoplasmic domain, which contains the immunotyrosine-based activation motif (ITAM) that is critical for T cell activation; and (ii) components of the co-stimulatory receptor that trigger important survival pathways such as the Akt pathway.

[0076] The first generation of CAR utilizes a single signaling domain from CD3ζ or FcεRIγ. The second generation CAR combines the signaling domain of CD3ζ with the cytoplasmic domain of the auxiliary stimulatory receptor from the CD28 or TNFR receptor family. Most of the CAR engineered T cells currently tested in the clinic utilize second generation CARs in which CD3ζ is coupled to the cytoplasmic domain of CD28 or CD137. These second generation CARs have shown anti-tumor activity in CD19 positive tumors. The third generation CAR combines multiple auxiliary stimulatory domains, but there is a concern that the third generation CAR may lose antigen specificity.

[0077] Although CAR engineered T cells have shown considerable promise in clinical applications, they rely on synthetic methods to replace the native activation signal provided by T cell receptors (TCRs). Since this synthetic receptor cannot deliver all signal transduction components associated with TCR (such as ITAM on CD3γ, CD3δ, CD3ε), it is still unclear whether T cells are optimally activated by CAR or how CAR activation affects T cell differentiation (such as developing into memory T cells). In addition, since it is the nature of the CAR structure that separates the CAR signal transduction domain from their natural regulatory partners, there is an inherent risk that CAR may cause low-level constitutive activation, thereby potentially leading to off-target toxicity. Therefore, the essence of the synthesis of the prototype CAR may destroy the canonical mechanism that limits TCR activation and may exacerbate the severe toxicity typically associated with conventional CAR T cells of therapeutic doses.

[0078] In view of these limitations, T cells are preferably redirected to attack tumors through their natural TCR. For this purpose, a class of recombinant proteins referred to as "bispecific T-cell engagers" (BiTEs) have been created. These proteins utilize bispecific antibody fragments to cross-link T-cell TCR receptors with target antigens. This results in efficient T-cell activation, triggering cytotoxicity. Similarly, bispecific antibodies that achieve this goal have been produced, and some scientists simply utilize chemical bonding to connect anti-CD3 antibodies to tumor-specific antibodies. Although these bispecific proteins have shown certain activity in vitro, GMP production, short biological half-life and limited bioavailability represent major challenges to the successful use of these molecules in cancer treatment. In addition, these molecules also cannot correctly repeat natural TCR signaling because they do not engage TCR co-receptors (CD8 and CD4).

[0079] In view of the above, there remains a need for chimeric receptors with enhanced activity and safety.

[0080] An optional chimeric receptor called a trifunctional T cell antigen conjugate (Tri-TAC or TAC) receptor has been developed that uses unique biology to guide T cells to attack tumors. CAR is a fully synthetic receptor that pieces together the components of the T cell receptor (TCR) signaling complex, while the TAC receptor redirects the TCR to the tumor target and repeats the original TCR signaling structure. For example, in certain embodiments, the TAC disclosed herein activates natural major histocompatibility complex (MHC) signaling through the T-cell receptor (TCR) while retaining targeting that is not restricted by MHC. In addition, the TAC disclosed herein is combined with auxiliary receptor stimulation to summon T-cell receptors (TCRs). In addition, in certain embodiments, the Tri-TAC disclosed herein shows enhanced activity and safety.

[0081] Certain terms

[0082] As used herein, the term "T cell" refers to a type of lymphocyte that plays a central role in cell-mediated immunity. T cells, also known as T lymphocytes, differ from other lymphocytes, such as B cells and natural killer cells, in the presence of a T-cell receptor (TCR) on the cell surface. There are several subclasses of T cells with different functions, including but not limited to helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, and natural killer T cells.

[0083] The term "T cell antigen conjugate" or TAC is used interchangeably with "trifunctional T cell antigen conjugate" or Tri-TAC and refers to an engineered nucleic acid construct or polypeptide that, when expressed on a T cell, helps promote the targeting of the T cell to a specific antigen. In certain embodiments, the TAC comprises (a) a target-specific ligand, (b) a ligand that binds to a protein associated with the T cell receptor (TCR) complex, and (c) a T cell receptor signaling domain.

[0084] As used herein, the terms "polynucleotide" and / or "nucleic acid sequence" and / or "nucleic acid" refer to a sequence of nucleoside or nucleotide monomers consisting of bases, sugars, and intersugar (backbone) linkages. The terms also include sequences comprising modifications or replacements of non-naturally occurring monomers or portions thereof. The nucleic acid sequences of the present application can be deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences (RNA), and can include naturally occurring bases, including adenine, guanine, cytosine, thymine, and uracil. The sequences may also contain modified bases. Examples of such modified bases include aza- and deazaadenine, guanine, cytosine, thymine, and uracil, as well as xanthine and hypoxanthine. The nucleic acids of the present disclosure can be isolated from biological organisms, formed by laboratory methods of genetic recombination, or obtained by chemical synthesis or other known protocols for producing nucleic acids.

[0085] As used herein, the term "isolated polynucleotide" or "isolated nucleic acid sequence" refers to a nucleic acid that is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. An isolated nucleic acid is also substantially free of sequences that naturally flank the nucleic acid in the nucleic acid from which it is derived (i.e., sequences located at the 5' and 3' ends of the nucleic acid). The term "nucleic acid" is intended to include DNA and RNA and is double-stranded or single-stranded, and represents a sense or antisense strand. In addition, the term "nucleic acid" includes complementary nucleic acid sequences.

[0086] As used herein, the term "recombinant nucleic acid" or "engineered nucleic acid" refers to a nucleic acid or polynucleotide that does not occur in a biological organism. For example, a recombinant nucleic acid can be formed by laboratory methods of genetic recombination (e.g., molecular cloning) to produce a sequence that does not otherwise occur in nature. A recombinant nucleic acid can also be produced by chemical synthesis or other known methods for producing nucleic acids.

[0087] As used herein, the term "polypeptide" or "protein" describes a chain of amino acids. The polypeptides or proteins of the present disclosure are peptides, which generally describe a chain of amino acids. As used herein, the term protein also describes a macromolecule comprising one or more amino acid chains, and in certain embodiments, a fragment or domain of a protein or a full-length protein. In addition, as used herein, the term protein refers to a linear chain of amino acids, or to an amino acid chain that has been processed and folded into a functional protein. Protein structure is divided into four different levels: (1) primary structure - refers to the sequence of amino acids in the polypeptide chain, (2) secondary structure - refers to the regular local substructures of the polypeptide backbone chain, such as α-helices and β-sheets, (3) tertiary structure - refers to the three-dimensional structure for monomeric or multimeric protein molecules, and (4) quaternary structure - refers to the three-dimensional structure of an aggregate comprising two or more individual polypeptide chains that function as a single functional unit. In certain embodiments, the proteins of the present disclosure are obtained by isolating and purifying the proteins from cells in which they are naturally produced, by enzymatic (e.g., proteolytic) cleavage, and / or by recombinant expression of nucleic acids encoding the proteins or fragments of the present disclosure. In certain embodiments, the proteins and / or fragments of the present disclosure are obtained by chemical synthesis or other known protocols for producing proteins and fragments.

[0088] The term "isolated polypeptide" refers to a polypeptide that is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

[0089] As used herein, the term "antibody" is intended to include monoclonal antibodies, polyclonal antibodies, single-chain antibodies, chimeric antibodies, and antibody fusions. The antibodies can be derived from recombinant sources and / or produced in transgenic animals. As used herein, the term "antibody fragment" is intended to include, but is not limited to, Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof, multispecific antibody fragments, and domain antibodies.

[0090] As used herein, the term "vector" refers to a polynucleotide for delivering a nucleic acid to the interior of a cell. In certain embodiments, a vector is an expression vector comprising an expression control sequence (e.g., a promoter) operably linked to a nucleic acid to be expressed in a cell. Vectors known in the art include, but are not limited to, plasmids, phagemids, cosmids, and viruses.

[0091] As used herein, the term "tumor antigen" or "tumor-associated antigen" refers to an antigenic substance produced in tumor cells that triggers an immune response in a host (e.g., presented by an MHC complex). In certain embodiments, the tumor antigen is on the surface of a tumor cell.

[0092] As used herein, the term "T cell receptor" or TCR refers to a complex of integral membrane proteins involved in the activation of T cells in response to the binding of antigens. TCR is a membrane-anchored heterodimer linked by disulfide bonds, typically composed of highly variable alpha (α) and beta (β) chains, expressed as part of a complex with an invariant CD3 (cluster of differentiation 3) chain molecule. T cells that express this receptor are called α:β (or αβ) T cells, although a small number of T cells express an alternative receptor formed by variable gamma (γ) and delta (δ) chains and are called γδ T cells. CD3 is a protein complex composed of 4 different chains. In mammals, the complex contains CD3γ chain, CD3δ chain, two CD3ε chains and two CD3ζ chains.

[0093] As used herein, the term "transmembrane and cytoplasmic domain" refers to a polypeptide comprising a transmembrane domain and a cytoplasmic domain of a protein associated with a T cell receptor (TCR) complex. In certain embodiments, such transmembrane and cytoplasmic domains may include, but are not limited to, protein domains that (a) are associated with lipid rafts and / or (b) bind to Lck.

[0094] As used herein, "TCR co-receptor" refers to a molecule that assists the communication of the T cell receptor (TCR) with antigen presenting cells and can be considered part of the first signal that leads to activation of the TCR. Examples of TCR co-receptors include, but are not limited to, CD4, LAG3, and CD8.

[0095] As used herein, "TCR co-stimulator" refers to a molecule that enhances the response of T cells to antigens and can be considered as a second signal that leads to the activation of the TCR. Examples of TCR co-stimulators include, but are not limited to, ICOS, CD27, CD28, 4-1BB (CD 137), OX40 (CD134), CD30, CD40, lymphocyte fictitious associated antigen 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds to CD83.

[0096] As used herein, "TCR co-inhibitors" or "checkpoint receptors" refer to molecules that inhibit the response of T cells to antigens. Examples of TCR co-inhibitors include, but are not limited to, PD-1, TIM3, LAG-3, TIGIT, BTLA, CD160, and CD37.

[0097] The terms "recipient," "individual," "subject," "host," and "patient" are used interchangeably herein and, in certain embodiments, refer to any mammalian subject, particularly a human, for whom diagnosis, treatment, or therapy is desired. For the purposes of treatment, "mammal" refers to any animal classified as a mammal, including humans, domesticated and farm animals, and laboratory, zoo, sport, or pet animals, such as dogs, horses, cats, cows, sheep, goats, pigs, mice, rats, rabbits, guinea pigs, monkeys, and the like. In certain embodiments, the mammal is a human. None of these terms require the supervision of medical personnel.

[0098] When used herein, the term "treat" and the like refer, in certain embodiments, to the administration of an agent or the performance of a procedure for the purpose of obtaining an effect. The effect may be preventive in terms of completely or partially preventing a disease or its symptoms, and / or therapeutic in terms of affecting a partial or complete cure of a disease and / or the symptoms of the disease. As used herein, "treatment" may include treating a disease or disorder (e.g., cancer) in mammals, particularly humans, and includes: (a) preventing the occurrence of the disease or disease symptoms in a subject who may be susceptible to the disease but has not yet been diagnosed with the disease (e.g., including a disease that may be associated with or caused by a primary disease); (b) inhibiting the disease, i.e., stopping its development; and (c) alleviating the disease, i.e., causing regression of the disease. Treatment may refer to any sign of success in the treatment, improvement, or prevention of cancer, including any objective or subjective parameter, such as reduction, remission, alleviation of symptoms, making the disease condition more tolerable for the patient, slowing the rate of degeneration or decline, or making the endpoint of degeneration less debilitating. Treatment or improvement of symptoms is based on one or more objective or subjective parameters, including the results of an examination performed by a physician. Thus, the term "treating" includes administering a compound or agent of the invention to prevent, delay, alleviate, terminate, or inhibit the development of symptoms or conditions associated with a disease (e.g., cancer). The term "therapeutic effect" refers to reducing, eliminating, or preventing the disease, disease symptoms, or side effects of the disease in the subject.

[0099] As used herein, reference to no specific number includes plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an antibody" includes a plurality of antibodies, and reference to "the antibody" in certain embodiments includes a plurality of antibodies, and so forth.

[0100] As used herein, all values ​​or ranges of values ​​include all integers within or encompassing these ranges and fractions of values ​​or integers within or encompassing these ranges unless the context clearly indicates otherwise. Thus, for example, reference to a range of 90-100% includes 91%, 92%, 93%, 94%, 95%, 95%, 96%, 97%, etc., as well as 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, etc., 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, etc., and so on. In another example, reference to a range of 1-5,000 times includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 times, etc., as well as 1.1, 1.2, 1.3, 1.4, 1.5 times, etc., 2.1, 2.2, 2.3, 2.4, 2.5 times, etc., and so on.

[0101] As used herein, "about" a number includes the number and ranges from 10% below the number to 10% above the number. "About" a range spans from 10% below the lower limit of the range to 10% above the upper limit of the range.

[0102] "Percent (%) identity" refers to the extent to which two sequences (nucleotide or amino acid) have the same residue at the same position in the alignment. For example, "an amino acid sequence is X% identical to SEQ ID NO: Y" means that the amino acid sequence is X% identical to SEQ ID NO: Y, and specifies that X% of the residues in the amino acid sequence are identical to the residues in the sequence disclosed in SEQ ID NO: Y. Typically, such calculations are performed using computer programs. Exemplary programs for comparing and aligning pairwise sequences include ALIGN (Myers and Miller, 1988), FASTA (Pearson and Lipman, 1988; Pearson, 1990), and Gapped BLAST (Altschul et al., 1997), BLASTP, BLASTN, or GCG (Devereux et al., 1984).

[0103] As used herein, the term "selectively binds" refers to a molecule (e.g., a protein such as a target binding ligand of a TAC) that binds to its target molecule (e.g., a target antigen such as HER-2, BCMA, or CD19) with a higher affinity than other molecules.

[0104] T cell antigen conjugate (Tri-TAC or TAC)

[0105] In certain embodiments, disclosed herein are nucleic acids encoding trifunctional T cell antigen conjugates (Tri-TACs). In certain embodiments, the nucleic acid encoding Tri-TAC comprises: (a) a first polynucleotide encoding a target-specific ligand; (b) a second polynucleotide encoding a ligand that binds to the TCR complex; and (c) a third polynucleotide encoding a transmembrane domain and a cytoplasmic domain. In certain embodiments, the nucleic acid encoding Tri-TAC does not encode a costimulatory domain. In certain embodiments, the nucleic acid encoding Tri-TAC does not encode an auxiliary activation domain.

[0106] Target-specific ligands

[0107] The target-specific ligand, also referred to as an antigen-binding domain, refers to any substance or molecule that binds directly or indirectly to a target cell. In certain embodiments, the target-specific ligand binds to an antigen on the target cell. In certain embodiments, the target cell is a cell associated with a disease state including but not limited to cancer, hematological malignancies, large B-cell lymphoma, diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, high-grade B-cell lymphoma, or large B-cell lymphoma caused by follicular lymphoma. In certain embodiments, the target cell is a tumor cell. In certain embodiments, the target-specific ligand binds to a tumor antigen or tumor-associated antigen on a tumor cell. In certain embodiments, the target antigen is a tumor antigen. In certain embodiments, the tumor antigen, when a protein, is a sequence of 8 or more amino acids up to a complete protein. In certain embodiments, the tumor antigen has any number of amino acids between 8 amino acids and a full-length protein, comprising at least one antigenic fragment of the full-length protein presented in the major histocompatibility complex (MHC). Examples of tumor antigens include, but are not limited to, CD19, HER-2 (erbB-2), B-cell maturation antigen (BCMA), alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), prostate-specific antigen (PSA), glioma-associated antigen, beta-human chorionic gonadotropin, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mut hsp70-2, M-CSF, prostate enzyme, PAP, NY-ESO-1, LAGE-1a, p53, prostein, PSMA, survivin and telomerase, prostate cancer tumor antigen-1 (PCTA-1), ELF2M, neutrophil elastase, CD22, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor, and mesothelin.

[0108] In certain embodiments, the target-specific ligand includes but is not limited to antibodies and fragments thereof that bind to target cells and / or antigens, such as single-chain antibodies such as single-chain antibodies (scFv), single domain antibodies, peptides, peptide mimetics, proteins, glycoproteins or proteoglycans. In certain embodiments, the target-specific ligand includes but is not limited to naturally occurring ligands of designed ankyrin repeat proteins (DARPins), lectins, knottins, centryrins, anticalins or tumor antigens, such as growth factors, enzyme substrates, receptors or binding proteins. In certain embodiments, the target-specific ligand includes non-protein compounds that bind to target cells and / or antigens, including but not limited to carbohydrates, lipids, nucleic acids or small molecules. In certain embodiments, the target-specific ligand is a designed ankyrin repeat protein (DARPin) that targets specific cells and / or antigens. In certain embodiments, the target-specific ligand is a single-chain variable fragment (ScFv) that targets specific cells and / or antigens.

[0109] In certain embodiments, the tumor antigen is a HER-2 antigen. In certain embodiments, the HER-2-specific ligand comprises an antigen-binding domain of an antibody selected from trastuzumab, pertuzumab, lapatinib, neratinib, a trastuzumab-emtansine conjugate, gantuzumab, margetuximab, temetuzumab, and ertumaxomab. In certain embodiments, the target-specific ligand is a DARPin that selectively binds to the HER-2 (erbB-2) antigen. In certain embodiments, the target-specific ligand is a DARPin that specifically binds to the HER-2 (erbB-2) antigen. In certain embodiments, the DARPin targeting HER-2 (erb-2) comprises SEQ ID NO: 7 or SEQ ID NO: 8.

[0110] In certain embodiments, the first polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 7. In certain embodiments, the first polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 7. In certain embodiments, the first polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 7. In certain embodiments, the first polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 7. In certain embodiments, the first polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 7. In certain embodiments, the first polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 7. In certain embodiments, the first polynucleotide comprises the nucleotide sequence of SEQ ID NO: 7.

[0111] In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 8. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 8. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 8. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 8. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 8. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 8. In certain embodiments, the target-specific ligand comprises the amino acid sequence of SEQ ID NO: 8.

[0112] In certain embodiments, the tumor antigen is a BCMA antigen. In certain embodiments, the BCMA-specific ligand comprises an antigen-binding domain of an antibody selected from Belantamab mafodotin and GSK2857916. In certain embodiments, the target-specific ligand is a scFv that selectively binds to BCMA. In certain embodiments, the target-specific ligand is a scFv that specifically binds to BCMA. In certain embodiments, the BCMA-binding scFv comprises SEQ ID NO: 33 or SEQ ID NO: 34.

[0113] In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 70% sequence identity to SEQ ID NO: 33. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 77% sequence identity to SEQ ID NO: 33. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 80% sequence identity to SEQ ID NO: 33. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 85% sequence identity to SEQ ID NO: 33. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 90% sequence identity to SEQ ID NO: 33. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 95% sequence identity to SEQ ID NO: 33. In certain embodiments, the first polynucleotide comprises the nucleotide sequence of SEQ ID NO: 33.

[0114] In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 34. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 34. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 34. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 34. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 34. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 34. In certain embodiments, the target-specific ligand comprises the amino acid sequence of SEQ ID NO: 34.

[0115] In certain embodiments, the tumor antigen is a CD19 antigen. In certain embodiments, the target-specific ligand is a scFv that selectively binds to CD19. In certain embodiments, the target-specific ligand is a scFv that specifically binds to CD19. In certain embodiments, the CD19-binding scFv comprises SEQ ID NO: 35 or SEQ ID NO: 36.

[0116] In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 70% sequence identity to SEQ ID NO: 35. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 75% sequence identity to SEQ ID NO: 35. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 80% sequence identity to SEQ ID NO: 35. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 85% sequence identity to SEQ ID NO: 35. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 90% sequence identity to SEQ ID NO: 35. In certain embodiments, the first polynucleotide comprises a nucleotide sequence that has at least 95% sequence identity to SEQ ID NO: 35. In certain embodiments, the first polynucleotide comprises the nucleotide sequence of SEQ ID NO: 35.

[0117] In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 36. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 36. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 36. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 36. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 36. In certain embodiments, the target-specific ligand comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 36. In certain embodiments, the target-specific ligand comprises the amino acid sequence of SEQ ID NO: 36.

[0118] Ligands that bind to the TCR complex

[0119] In certain embodiments, the TAC comprises a ligand that binds to a protein associated with the TCR complex. In certain embodiments, the ligand that binds to a protein associated with the TCR complex includes a substance that binds directly or indirectly to the protein of the TCR. In certain embodiments, the ligand that binds to a protein associated with the TCR complex includes a substance that selectively binds to the protein of the TCR. In certain embodiments, the ligand that binds to a protein associated with the TCR complex includes a substance that specifically binds to the protein of the TCR. Proteins associated with the TCR include but are not limited to TCR alpha (α) chain, TCR beta (β) chain, TCR gamma (γ) chain, TCR delta (δ) chain, CD3γ chain, CD3δ chain and CD3ε chain. In certain embodiments, the ligand that binds to a protein associated with the TCR complex is an antibody against the TCR alpha (α) chain, TCR beta (β) chain, TCR gamma (γ) chain, TCR delta (δ) chain, CD3γ chain, CD3δ chain and / or CD3ε chain. In certain embodiments, the protein associated with the TCR complex is CD3. In certain embodiments, the protein associated with the TCR complex is CD3ε. Examples of CD3 antibodies include, but are not limited to. In certain embodiments, the antibody that binds to CD3 is a single-chain antibody, such as a single-chain variable fragment (scFv). In certain embodiments, the ligand that binds to the TCR is an anti-CD3 antibody or a fragment thereof, such as muromonab, oximax, teplizumab, visilizumab, CD3-12, MEM-57, 4D10A6, CD3D, or TR66.

[0120] In certain embodiments, the CD3 is CD3 of a TCR complex on a cell expressing the second polynucleotide. In certain embodiments, binding of the CD3 induces activation of a cell expressing the second polynucleotide.

[0121] In certain embodiments, the ligand that binds the TCR complex is UCHT1 or a variant thereof. In certain embodiments, the ligand that binds the TCR complex is UCHT1 (SEQ ID NO: 13, SEQ ID NO: 14, or a homolog thereof). In certain embodiments, the UCHT1 ligand binds to CD3. In certain embodiments, the UCHT1 ligand selectively binds to CD3. In certain embodiments, the UCHT1 ligand specifically binds to CD3. In certain embodiments, the UCHT1 ligand binds to CD3ε. In certain embodiments, the UCHT1 ligand selectively binds to CD3ε. In certain embodiments, the UCHT1 ligand specifically binds to CD3ε. In certain embodiments, the UCHT1 ligand is encoded by SEQ ID NO: 13. In certain embodiments, the UCHT1 ligand comprises SEQ ID NO: 14. In certain embodiments, the UCHT1 ligand is mutated. In certain embodiments, the UCHT1 ligand comprises the Y182T mutation (also referred to as UCHT1(Y182T)) (SEQ ID NO: 71 and SEQ ID NO: 72). In certain embodiments, the UCHT1(Y182T) ligand binds to CD3. In certain embodiments, the UCHT1(Y182T) ligand selectively binds to CD3. In certain embodiments, the UCHT1(Y182T) ligand specifically binds to CD3. In certain embodiments, the UCHT1(Y182T) ligand binds to CD3ε. In certain embodiments, the UCHT1(Y182T) ligand selectively binds to CD3ε. In certain embodiments, the UCHT1(Y182T) ligand specifically binds to CD3ε. In certain embodiments, the UCHT1(Y182T) ligand is encoded by SEQ ID NO: 71. In certain embodiments, the UCHT1(Y182T) ligand comprises SEQ ID NO: 72. In certain embodiments, the ligand that binds to the TCR complex is humanized UCHT1 (huUCHT1). In certain embodiments, the ligand that binds to the TCR complex is huUCHT1 (SEQ ID NO: 43, SEQ ID NO: 44, or a homolog thereof). In certain embodiments, the huUCHT1 ligand binds CD3. In certain embodiments, the huUCHT1 ligand selectively binds CD3. In certain embodiments, the huUCHT1 ligand specifically binds CD3. In certain embodiments, the huUCHT1 ligand binds CD3ε. In certain embodiments, the huUCHT1 ligand selectively binds CD3ε. In certain embodiments, the huUCHT1 ligand specifically binds CD3ε.In certain embodiments, the huUCHT1 ligand is encoded by SEQ ID NO 43. In certain embodiments, the huUCHT1 ligand comprises SEQ ID NO 44. In certain embodiments, the huUCHT1 has a Y177T mutation (also referred to as huUCHT1(Y177T)) (SEQ ID NO: 45 and SEQ ID NO: 46). In certain embodiments, the huUCHT1(Y177T) ligand binds CD3. In certain embodiments, the huUCHT1(Y177T) ligand selectively binds CD3. In certain embodiments, the huUCHT1(Y177T) ligand specifically binds CD3. In certain embodiments, the huUCHT1(Y177T) ligand binds CD3ε. In certain embodiments, the huUCHT1(Y177T) ligand selectively binds CD3ε. In certain embodiments, the huUCHT1(Y177T) ligand specifically binds CD3ε. In certain embodiments, the huUCHT1(Y177T) ligand is encoded by SEQ ID NO 45. In certain embodiments, the huUCHT1 ligand comprises SEQ ID NO 46.

[0122] In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 13. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 13. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 13. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 13. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 13. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 13. In certain embodiments, the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 13.

[0123] In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 14. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 14. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 14. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 14. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 14. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 14. In certain embodiments, the ligand that binds to the TCR complex comprises the amino acid sequence of SEQ ID NO: 14.

[0124] In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 71. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 71. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 71. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 71. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 71. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 71. In certain embodiments, the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 71.

[0125] In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 72. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 72. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 72. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 72. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 72. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 72. In certain embodiments, the ligand that binds to the TCR complex comprises the amino acid sequence of SEQ ID NO: 72.

[0126] In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 43. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 43. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 43. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 43. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 43. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 43. In certain embodiments, the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 43.

[0127] In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 44. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 44. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 44. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 44. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 44. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 44. In certain embodiments, the ligand that binds to the TCR complex comprises the amino acid sequence of SEQ ID NO: 44.

[0128] In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 45. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 45. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 45. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 45. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 45. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 45. In certain embodiments, the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 45.

[0129] In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 46. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 46. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 46. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 46. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 46. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 46. In certain embodiments, the ligand that binds to the TCR complex comprises the amino acid sequence of SEQ ID NO: 46.

[0130] In certain embodiments, the ligand that binds to CD3 is OKT3. In certain embodiments, the OKT3 ligand binds to CD3. In certain embodiments, the OKT3 ligand selectively binds to CD3. In certain embodiments, the OKT3 ligand specifically binds to CD3. In certain embodiments, the OKT3 ligand binds to CD3ε. In certain embodiments, the OKT3 ligand selectively binds to CD3ε. In certain embodiments, the OKT3 ligand specifically binds to CD3ε. In certain embodiments, the murine OKT3 ligand is encoded by SEQ ID NO: 21. In certain embodiments, the OKT3 ligand comprises SEQ ID NO: 22.

[0131] In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 21. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 21. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 21. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 21. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 21. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 21. In certain embodiments, the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 21.

[0132] In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 22. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 22. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 22. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 22. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 22. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 22. In certain embodiments, the ligand that binds to the TCR complex comprises the amino acid sequence of SEQ ID NO: 22.

[0133] In certain embodiments, the ligand that binds to CD3 is F6A. In certain embodiments, the F6A ligand binds to CD3. In certain embodiments, the F6A ligand selectively binds to CD3. In certain embodiments, the F6A ligand specifically binds to CD3. In certain embodiments, the F6A ligand binds to CD3ε. In certain embodiments, the F6A ligand selectively binds to CD3ε. In certain embodiments, the F6A ligand specifically binds to CD3ε. In certain embodiments, the murine F6A ligand is encoded by SEQ ID NO: 23. In certain embodiments, the F6A ligand comprises SEQ ID NO: 24.

[0134] In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 23. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 23. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 23. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 23. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 23. In certain embodiments, the second polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 23. In certain embodiments, the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 23.

[0135] In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 24. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 24. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 24. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 24. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 24. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 24. In certain embodiments, the ligand that binds to the TCR complex comprises the amino acid sequence of SEQ ID NO: 24.

[0136] In certain embodiments, the ligand that binds to CD3 is L2K. In certain embodiments, the L2K ligand binds to CD3. In certain embodiments, the L2K ligand selectively binds to CD3. In certain embodiments, the L2K ligand specifically binds to CD3. In certain embodiments, the L2K ligand binds to CD3ε. In certain embodiments, the L2K ligand selectively binds to CD3ε. In certain embodiments, the L2K ligand specifically binds to CD3ε. In certain embodiments, the murine L2K ligand is encoded by SEQ ID NO: 25. In certain embodiments, the L2K ligand comprises SEQ ID NO: 26.

[0137] In certain embodiments, the second polynucleotide comprises a nucleotide sequence that has at least 70% sequence identity to SEQ ID NO: 25. In certain embodiments, the second polynucleotide comprises a nucleotide sequence that has at least 75% sequence identity to SEQ ID NO: 25. In certain embodiments, the second polynucleotide comprises a nucleotide sequence that has at least 80% sequence identity to SEQ ID NO: 25. In certain embodiments, the second polynucleotide comprises a nucleotide sequence that has at least 85% sequence identity to SEQ ID NO: 25. In certain embodiments, the second polynucleotide comprises a nucleotide sequence that has at least 90% sequence identity to SEQ ID NO: 25. In certain embodiments, the second polynucleotide comprises a nucleotide sequence that has at least 95% sequence identity to SEQ ID NO: 25. In certain embodiments, the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 25.

[0138] In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 26. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 26. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 26. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 26. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 26. In certain embodiments, the ligand that binds to the TCR complex comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 26. In certain embodiments, the ligand that binds to the TCR complex comprises the amino acid sequence of SEQ ID NO: 26.

[0139] Transmembrane domain and cytoplasmic domain

[0140] In certain embodiments, the T cell antigen conjugate comprises a T cell receptor signaling domain polypeptide. In certain embodiments, the TCR signaling domain polypeptide comprises a transmembrane domain. In certain embodiments, the TCR signaling domain polypeptide comprises a cytoplasmic domain. In certain embodiments, the TCR signaling domain polypeptide comprises a transmembrane domain and a cytoplasmic domain. In certain embodiments, the cytoplasmic domain and the transmembrane domain are optionally connected by a linker. In certain embodiments, the T cell receptor signaling domain polypeptide comprises a TCR coreceptor domain. In certain embodiments, the T cell receptor signaling domain polypeptide does not comprise a TCR co-stimulator domain. In certain embodiments, the TCR signaling domain polypeptide comprises the transmembrane domain and / or cytoplasmic domain of a TCR coreceptor. In certain embodiments, the TCR coreceptor is CD4, CD8, LAG3, or a chimeric variant thereof.

[0141] In certain embodiments, the TCR coreceptor is CD4. In certain embodiments, the TCR signaling domain polypeptide comprises the transmembrane and cytoplasmic domains of the CD4 coreceptor encoded by SEQ ID NO: 17. In certain embodiments, the TCR signaling domain polypeptide comprises the transmembrane and cytoplasmic domains of the CD4 coreceptor comprising SEQ ID NO: 18.

[0142] In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 17. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 17. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 17. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 17. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 17. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 17. In certain embodiments, the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 17.

[0143] In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 18. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 18. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 18. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 18. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 18. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 18. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise the amino acid sequence of SEQ ID NO: 18.

[0144] In certain embodiments, the TCR coreceptor is CD8. In certain embodiments, the TCR coreceptor is CD8α. In certain embodiments, the TCR signaling domain polypeptide comprises the transmembrane and cytoplasmic domains of the CD8α coreceptor encoded by SEQ ID NO: 37. In certain embodiments, the TCR signaling domain polypeptide comprises the transmembrane and cytoplasmic domains of the CD8α coreceptor comprising SEQ ID NO: 38.

[0145] In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 37. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 37. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 37. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 37. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 37. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 37. In certain embodiments, the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 37.

[0146] In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 38. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 38. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 38. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 38. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 38. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 38. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise the amino acid sequence of SEQ ID NO: 38.

[0147] In certain embodiments, the TCR signaling domain polypeptide comprises a chimera of a sequence or domain from a coreceptor. In certain embodiments, the TCR signaling domain polypeptide comprises a chimera of CD8α and CD8β, wherein the arginine-rich region of CD8α is replaced by the arginine-rich region of CD8β. In certain embodiments, the T cell receptor signaling domain polypeptide comprises the transmembrane and cytoplasmic domains of the CD8α+R(β) coreceptor chimera encoded by SEQ ID NO: 39. In certain embodiments, the T cell receptor signaling domain polypeptide comprises the transmembrane and cytoplasmic domains of the CD8α+R(β) coreceptor chimera provided by SEQ ID NO: 40. In certain embodiments, the TCR signaling domain polypeptide comprises a chimera of CD8α and CD8β, wherein the CD8αCXCP domain containing the Lck binding motif is attached to the C-terminus of the CD8β cytoplasmic domain. In certain embodiments, the T cell receptor signaling domain polypeptide comprises the transmembrane and cytoplasmic domains of the CD8β+Lck coreceptor chimera encoded by SEQ ID NO: 41. In certain embodiments, the T cell receptor signaling domain polypeptide comprises the transmembrane and cytoplasmic domains of the CD8β+Lck coreceptor chimera provided by SEQ ID NO: 42.

[0148] In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 39. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 39. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 39. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 39. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 39. In certain embodiments, the third polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 39. In certain embodiments, the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 39.

[0149] In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 40. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 40. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 40. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 40. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 40. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 40. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise the amino acid sequence of SEQ ID NO: 40.

[0150] In certain embodiments, the third polynucleotide comprises a nucleotide sequence that has at least 70% sequence identity to SEQ ID NO: 41. In certain embodiments, the third polynucleotide comprises a nucleotide sequence that has at least 75% sequence identity to SEQ ID NO: 41. In certain embodiments, the third polynucleotide comprises a nucleotide sequence that has at least 80% sequence identity to SEQ ID NO: 41. In certain embodiments, the third polynucleotide comprises a nucleotide sequence that has at least 85% sequence identity to SEQ ID NO: 41. In certain embodiments, the third polynucleotide comprises a nucleotide sequence that has at least 90% sequence identity to SEQ ID NO: 41. In certain embodiments, the third polynucleotide comprises a nucleotide sequence that has at least 95% sequence identity to SEQ ID NO: 41. In certain embodiments, the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 41.

[0151] In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 42. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 42. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 42. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 42. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 42. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 42. In certain embodiments, the transmembrane domain and the cytoplasmic domain comprise the amino acid sequence of SEQ ID NO: 42.

[0152] In certain embodiments, the T cell receptor signaling domain polypeptide comprises a TCR co-stimulator domain. In certain embodiments, the TCR co-stimulator is ICOS. In certain embodiments, the TCR co-stimulator is CD27. In certain embodiments, the TCR co-stimulator is CD28. In certain embodiments, the TCR co-stimulator is 4-1BB (CD137). In certain embodiments, the TCR co-stimulator is OX40 (CD134). In certain embodiments, the TCR co-stimulator is CD30. In certain embodiments, the TCR co-stimulator is CD40. In certain embodiments, the TCR co-stimulator is lymphocyte fictitious associated antigen 1 (LFA-1). In certain embodiments, the TCR co-stimulator is CD2. In certain embodiments, the TCR co-stimulator is CD7. In certain embodiments, the TCR co-stimulator is LIGHT. In certain embodiments, the TCR co-stimulator is NKG2C. In certain embodiments, the TCR co-stimulator is B7-H3. In certain embodiments, the TCR co-stimulator is a ligand that specifically binds CD83.

[0153] In certain embodiments, the TCR signaling domain polypeptide comprises a transmembrane domain and / or a cytoplasmic domain of a TCR co-inhibitor. In certain embodiments, the TCR co-inhibitor is PD-1. In certain embodiments, the TCR co-inhibitor is TIM3. In certain embodiments, the TCR co-inhibitor is LAG-3. In certain embodiments, the TCR co-inhibitor is TIGIT. In certain embodiments, the TCR co-inhibitor is BTLA. In certain embodiments, the TCR co-inhibitor is CD160. In certain embodiments, the TCR co-inhibitor is CD37.

[0154] In certain embodiments, the TCR signaling domain polypeptide comprises both the cytoplasmic domain and the transmembrane domain of a TCR co-receptor or co-stimulator protein. In certain embodiments, the cytoplasmic domain and the transmembrane domain are derived from the same co-receptor or co-stimulator or from different co-receptors or co-stimulators. In certain embodiments, the TAC further comprises other polypeptides that act directly or indirectly to target or activate the T cell.

[0155] Connectors, adapters, and configurations

[0156] In certain embodiments, the nucleic acids disclosed herein are in the following order: (1) a first polynucleotide encoding a target-specific ligand; (2) a second polynucleotide encoding a ligand that binds to the TCR complex; (3) a third polynucleotide encoding a transmembrane domain and a cytoplasmic domain. In certain embodiments, the nucleic acids disclosed herein are in the following order: (1) a first polynucleotide encoding a target-specific ligand; (2) a second polynucleotide encoding a ligand that binds to the TCR complex; (3) a third polynucleotide encoding a transmembrane domain and a cytoplasmic domain, wherein the order is from the 5' end to the 3' end. In certain embodiments, the nucleic acids disclosed herein are in the following order: (1) a first polynucleotide encoding a target-specific ligand; (2) a second polynucleotide encoding a ligand that binds to the TCR complex; (3) a third polynucleotide encoding a transmembrane domain and a cytoplasmic domain, wherein the order is from the 3' end to the 5' end. In certain embodiments, the nucleic acids described herein are in the following order: (1) a first polynucleotide encoding a ligand that binds to a TCR complex; (2) a second polynucleotide encoding a target-specific ligand; (3) a third polynucleotide encoding a transmembrane domain and a cytoplasmic domain. In certain embodiments, the nucleic acids described herein are in the following order: (1) a first polynucleotide encoding a ligand that binds to a TCR complex; (2) a second polynucleotide encoding a target-specific ligand; (3) a third polynucleotide encoding a transmembrane domain and a cytoplasmic domain, wherein the order is from the 5' end to the 3' end. In certain embodiments, the nucleic acids described herein are in the following order: (1) a first polynucleotide encoding a ligand that binds to a TCR complex; (2) a second polynucleotide encoding a target-specific ligand; (3) a third polynucleotide encoding a transmembrane domain and a cytoplasmic domain, wherein the order is from the 3' end to the 5' end.

[0157] In certain embodiments, the first nucleic acid encodes a first polypeptide, the second nucleic acid encodes a second polypeptide, and the third nucleic acid encodes a third polypeptide. In certain embodiments, the first polypeptide, the second polypeptide, and the third polypeptide are directly fused. For example, both the target-specific ligand and the T cell receptor signaling domain polypeptide are fused to the ligand that binds the TCR complex. In certain embodiments, the first polypeptide, the second polypeptide, and the third polypeptide are connected by at least one connector. In certain embodiments, the first polypeptide and the second polypeptide are directly fused and connected to the third polypeptide via a connector. In certain embodiments, the second polypeptide and the third polypeptide are directly fused and connected to the first polypeptide via a connector.

[0158] In certain embodiments, the connector is a peptide connector. In certain embodiments, the peptide connector comprises 1 to 40 amino acids. In certain embodiments, the peptide connector comprises 1 to 30 amino acids. In certain embodiments, the peptide connector comprises 1 to 15 amino acids. In certain embodiments, the peptide connector comprises 1 to 10 amino acids. In certain embodiments, the peptide connector comprises 1 to 6 amino acids. In certain embodiments, the peptide connector comprises 30 to 40 amino acids. In certain embodiments, the peptide connector comprises 32 to 36 amino acids. In certain embodiments, the peptide connector comprises 5 to 30 amino acids. In certain embodiments, the peptide connector comprises 5 amino acids. In certain embodiments, the peptide connector comprises 10 amino acids. In certain embodiments, the peptide connector comprises 15 amino acids. In certain embodiments, the peptide connector comprises 20 amino acids. In certain embodiments, the peptide connector comprises 25 amino acids. In certain embodiments, the peptide connector comprises 30 amino acids.

[0159] In certain embodiments, the peptide linker comprises a G4S3 linker (SEQ ID NO: 74). In certain embodiments, the peptide linker comprises SEQ ID NO: 11, 12, 15, 16, 19, 20, or a variant or fragment thereof.

[0160] In certain embodiments, the peptide connector that connects the target-specific ligand to the ligand that binds the TCR complex (e.g., UCHT1) is referred to as a linker to distinguish this protein domain from other connectors in the Tri-TAC. The linker has any size. In certain embodiments, the linker between the ligand that binds the TCR complex and the target-specific ligand is a short helix comprising SEQ ID NO ID: 28. In certain embodiments, the linker between the ligand that binds the TCR complex and the target-specific ligand is a short helix encoded by SEQ ID NO ID: 27. In certain embodiments, the linker between the ligand that binds the TCR complex and the target-specific ligand is a long helix comprising SEQ ID NO ID: 30. In certain embodiments, the linker between the ligand that binds the TCR complex and the target-specific ligand is a long helix encoded by SEQ ID NO ID: 29. In certain embodiments, the linker between the ligand that binds the TCR complex and the target-specific ligand is a large domain comprising SEQ ID NO ID: 32. In certain embodiments, the linker between the ligand that binds the TCR complex and the target-specific ligand is a large domain encoded by SEQ ID NO ID:31.

[0161] In certain embodiments, the nucleic acids disclosed herein comprise a leader sequence. In certain embodiments, the leader sequence comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 5, 47, or 49. In certain embodiments, the leader sequence comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 5, 47, or 49. In certain embodiments, the leader sequence comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 5, 47, or 49. In certain embodiments, the leader sequence comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 5, 47, or 49. In certain embodiments, the leader sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 5, 47, or 49. In certain embodiments, the leader sequence comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 5, 47, or 49. In certain embodiments, the leader sequence comprises the nucleotide sequence of SEQ ID NO: 5, 47, or 49.

[0162] In certain embodiments, the nucleic acids disclosed herein comprise a leader sequence. In certain embodiments, the leader sequence comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 6, 48, or 50. In certain embodiments, the leader sequence comprises an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 6, 48, or 50. In certain embodiments, the leader sequence comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 6, 48, or 50. In certain embodiments, the leader sequence comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 6, 48, or 50. In certain embodiments, the leader sequence comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 6, 48, or 50. In certain embodiments, the leader sequence comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 6, 48, or 50. In certain embodiments, the leader sequence comprises the amino acid sequence of SEQ ID NO: 6, 48, or 50.

[0163] As disclosed herein, it is contemplated that the Tri-TACs are present in various configurations and combinations of (a) target-specific ligands, (b) ligands that bind to the TCR complex, and (c) TCR signaling domains.

[0164] In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) a single-chain antibody (scFv) that binds to CD3ε, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) UCHT1, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) UCHT1(Y182T), and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) huUCHT1, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) huUCHT1(Y177T), and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) OKT3, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor.

[0165] In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) UCHT1, and (c) a transmembrane and cytoplasmic domain of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) UCHT1(Y182T), and (c) a transmembrane and cytoplasmic domain of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) huUCHT1(Y177T), and (c) a transmembrane and cytoplasmic domain of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) OKT3, and (c) a transmembrane and cytoplasmic domain of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor.

[0166] In certain embodiments, the Tri-TAC comprises (a) scFv, (b) UCHT1, and (c) the transmembrane and cytoplasmic domains of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) UCHT1(Y182T), and (c) the transmembrane and cytoplasmic domains of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) huUCHT1, and (c) the transmembrane and cytoplasmic domains of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) huUCHT1, and (c) the transmembrane and cytoplasmic domains of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) huUCHT1(Y177T), and (c) the transmembrane and cytoplasmic domains of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) OKT3, and (c) the transmembrane and cytoplasmic domains of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor.

[0167] In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) UCHT1, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) UCHT1(Y182T), and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) huUCHT1, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) huUCHT1(Y177T), and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) OKT3, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor.

[0168] In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) UCHT1, and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) UCHT1(Y182T), and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) huUCHT1(Y177T), and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) OKT3, and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor.

[0169] In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) UCHT1, and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) UCHT1(Y182T), and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) huUCHT1(Y177T), and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) OKT3, and (c) a transmembrane and cytoplasmic domain of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD4 coreceptor.

[0170] In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) a single-chain antibody (scFv) that binds to CD3ε, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) UCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) UCHT1(Y182T), and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) huUCHT1(Y177T), and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) OKT3, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) F6A, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) L2K, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor.

[0171] In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) UCHT1, and (c) the transmembrane and cytoplasmic domains of a CD4 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) UCHT1(Y182T), and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) huUCHT1, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) huUCHT1(Y177T), and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) OKT3, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD8 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a DARPin, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD8 coreceptor.

[0172] In certain embodiments, the Tri-TAC comprises (a) scFv, (b) UCHT1, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) UCHT1(Y182T), and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) huUCHT1, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) huUCHT1, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) huUCHT1(Y177T), and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) OKT3, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD8 coreceptor. In certain embodiments, the Tri-TAC comprises (a) scFv, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD8 coreceptor.

[0173] In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) UCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) UCHT1(Y182T), and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a target-specific ligand, (b) huUCHT1(Y177T), and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) OKT3, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD8 coreceptor. In certain embodiments, the Tri-TAC comprises (a) a HER-2-specific DARPin, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD8 coreceptor.

[0174] In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) UCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) UCHT1(Y182T), and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) huUCHT1(Y177T), and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) OKT3, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a BCMA-specific ScFv, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor.

[0175] In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) UCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) UCHT1(Y182T), and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) huUCHT1, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) huUCHT1(Y177T), and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) OKT3, and (c) a transmembrane and cytoplasmic domain of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) F6A, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor. In certain embodiments, the Tri-TAC comprises (a) a CD19-specific ScFv, (b) L2K, and (c) the transmembrane and cytoplasmic domains of a CD8 co-receptor.

[0176] In certain embodiments, the Tri-TAC pulls CD3 and TCR into the lipid raft region of the membrane and brings Lck into proximity with the TCR, similar to native MHC binding.

[0177] In certain embodiments, the TAC disclosed herein is an anti-HER-2 DARPin Tri-TAC (also referred to as Configuration 1; SEQ ID NOs: 1 and 2), and comprises, in order:

[0178] Leader sequence (secretion signal) of anti-HER-2 Tri-TAC (SEQ ID NOs: 5 and 6)

[0179] DARPin specific for HER-2 antigen (SEQ ID NO: 7 and 8)

[0180] Myc tag (SEQ ID NOs: 9 and 10)

[0181] Linker (SEQ ID NO: 11 and 12)

[0182] UCHT1 (SEQ ID NOs: 13 and 14)

[0183] Linker (SEQ ID NO: 15 and 16)

[0184] CD4 (SEQ ID NOs: 17 and 18).

[0185] In certain embodiments, the TAC disclosed herein is a HER2-TAC. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 65. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 65. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 65. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 65. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 65. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 65. In certain embodiments, the HER2-TAC comprises the nucleotide sequence of SEQ ID NO: 65.

[0186] In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 66. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 66. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 66. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 66. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 66. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 66. In certain embodiments, the HER2-TAC comprises the amino acid sequence of SEQ ID NO: 66.

[0187] In certain embodiments, the TAC disclosed herein is a HER2-TAC. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 67. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 67. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 67. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 67. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 67. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 67. In certain embodiments, the HER2-TAC comprises the nucleotide sequence of SEQ ID NO: 67.

[0188] In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 68. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 68. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 68. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 68. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 68. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 68. In certain embodiments, the HER2-TAC comprises the amino acid sequence of SEQ ID NO: 68.

[0189] In certain embodiments, the TAC disclosed herein is a HER2-TAC. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 75. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 75. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 75. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 75. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 75. In certain embodiments, the HER2-TAC comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 75. In certain embodiments, the HER2-TAC comprises the nucleotide sequence of SEQ ID NO: 75.

[0190] In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 76. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 76. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 76. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 76. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 76. In certain embodiments, the HER2-TAC comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 76. In certain embodiments, the HER2-TAC comprises the amino acid sequence of SEQ ID NO: 76.

[0191] In certain embodiments, the TAC disclosed herein is a BCMA-TAC. In certain embodiments, the BCMA-TAC comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 55, 57, 59, or 61. In certain embodiments, the BCMA-TAC comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 55, 57, 59, or 61. In certain embodiments, the BCMA-TAC comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 55, 57, 59, or 61. In certain embodiments, the BCMA-TAC comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 55, 57, 59, or 61. In certain embodiments, the BCMA-TAC comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 55, 57, 59, or 61. In certain embodiments, the BCMA-TAC comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 55, 57, 59, or 61. In certain embodiments, the BCMA-TAC comprises the nucleotide sequence of SEQ ID NO: 55, 57, 59, or 61.

[0192] In certain embodiments, the BCMA-TAC comprises an amino acid sequence that has at least 70% sequence identity to SEQ ID NO: 56, 58, 60, or 62. In certain embodiments, the BCMA-TAC comprises an amino acid sequence that has at least 75% sequence identity to SEQ ID NO: 56, 58, 60, or 62. In certain embodiments, the BCMA-TAC comprises an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 56, 58, 60, or 62. In certain embodiments, the BCMA-TAC comprises an amino acid sequence that has at least 85% sequence identity to SEQ ID NO: 56, 58, 60, or 62. In certain embodiments, the BCMA-TAC comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 56, 58, 60, or 62. In certain embodiments, the BCMA-TAC comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 56, 58, 60, or 62. In certain embodiments, the BCMA-TAC comprises the amino acid sequence of SEQ ID NO: 56, 58, 60, or 62.

[0193] In certain embodiments, the TAC disclosed herein is a CD19-TAC. In certain embodiments, the CD19-TAC comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO: 63. In certain embodiments, the CD19-TAC comprises a nucleotide sequence having at least 75% sequence identity to SEQ ID NO: 63. In certain embodiments, the CD19-TAC comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 63. In certain embodiments, the CD19-TAC comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 63. In certain embodiments, the CD19-TAC comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 63. In certain embodiments, the CD19-TAC comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 63. In certain embodiments, the CD19-TAC comprises the nucleotide sequence of SEQ ID NO: 63.

[0194] In certain embodiments, the CD19-TAC comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 64. In certain embodiments, the CD19-TAC comprises an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 64. In certain embodiments, the CD19-TAC comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 64. In certain embodiments, the CD19-TAC comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 64. In certain embodiments, the CD19-TAC comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 64. In certain embodiments, the CD19-TAC comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 64. In certain embodiments, the CD19-TAC comprises the amino acid sequence of SEQ ID NO: 64.

[0195] Peptides and vector constructs

[0196] In certain embodiments, disclosed herein are polypeptides encoded by the nucleic acid sequences disclosed herein. Also disclosed herein are vectors comprising the nucleic acid sequences disclosed herein. In certain embodiments, the vectors further comprise a promoter. In certain embodiments, the promoter is functional in mammalian cells. Promoters are regions of DNA that initiate transcription of a specific nucleic acid sequence and are well known in the art. A "promoter functional in mammalian cells" refers to a promoter that drives expression of the associated nucleic acid sequence in mammalian cells. A promoter that drives expression of a nucleic acid sequence is said to be "operably linked" to the nucleic acid sequence.

[0197] A variety of delivery vehicles and expression vectors are used to introduce the nucleic acids described herein into cells.

[0198] In certain embodiments, the present disclosure provides a polynucleotide contained in a vector to provide a vector construct, also referred to herein as a vector. In certain embodiments, the present disclosure provides a vector comprising:

[0199] a. a first polynucleotide encoding a target-specific ligand;

[0200] b. a second polynucleotide encoding a ligand that binds to a protein associated with the TCR complex;

[0201] c. a third polynucleotide encoding a T cell receptor signaling domain polypeptide; and

[0202] d. Promoters that are functional in mammalian cells.

[0203] In certain embodiments, the target of the target-specific ligand binds to HER-2, BCMA, or CD19. In certain embodiments, the target-specific ligand is a DARPin that selectively binds to the HER-2 (erbB-2) antigen. In certain embodiments, the target-specific ligand is a DARPin that specifically binds to the HER-2 (erbB-2) antigen. In certain embodiments, the DARPin that targets HER-2 (erb-2) comprises SEQ ID NO: 7 or SEQ ID NO: 8. In certain embodiments, the target-specific ligand is a scFv that selectively binds to BCMA. In certain embodiments, the target-specific ligand is a scFv that specifically binds to BCMA. In certain embodiments, the scFv that binds to BCMA comprises SEQ ID NO: 33 or SEQ ID NO: 34. In certain embodiments, the target-specific ligand is a scFv that selectively binds to CD19. In certain embodiments, the target-specific ligand is a scFv that specifically binds to CD19. In certain embodiments, the scFv that binds to CD19 comprises SEQ ID NO: 35 or SEQ ID NO: 36.

[0204] In certain embodiments, the ligand that binds a protein associated with the TCR complex is UCHT1, humanized UCHT1 (huUCHT1), OKT3, F6A, or L2K. In certain embodiments, the ligand that binds a protein associated with the TCR complex is UCHT1 or a variant thereof. In certain embodiments, the ligand that binds a protein associated with the TCR complex is UCHT1 and is encoded by SEQ ID NO: 13. In certain embodiments, the ligand that binds a protein associated with the TCR complex is UCHT1 and comprises SEQ ID NO: 14. In certain embodiments, the ligand that binds a protein associated with the TCR complex has a Y182T mutation (UCHT1(Y182T)) and is encoded by SEQ ID NO: 71. In certain embodiments, the ligand that binds a protein associated with the TCR complex is UCHT1(Y182T) and comprises SEQ ID NO: 72. In certain embodiments, the ligand that binds a protein associated with the TCR complex is humanized UCHT1 (huUCHT1) or a variant thereof. In certain embodiments, the ligand that binds a protein associated with the TCR complex is humanized UCHT1 (huUCHT1) and is encoded by SEQ ID NO: 43. In certain embodiments, the ligand that binds a protein associated with the TCR complex is huUCHT1 and comprises SEQ ID NO: 44. In certain embodiments, the huUCHT1 ligand that binds a protein associated with the TCR complex has a Y177T mutation (huUCHT1(Y177T)) and is encoded by SEQ ID NO: 45. In certain embodiments, the ligand that binds a protein associated with the TCR complex is huUCHT1(Y177T) and comprises SEQ ID NO: 46.

[0205] In certain embodiments, the ligand that binds a protein associated with the TCR complex is OKT3 or a variant thereof. In certain embodiments, the ligand that binds a protein associated with the TCR complex is OKT3 and is encoded by SEQ ID NO: 21. In certain embodiments, the ligand that binds a protein associated with the TCR complex is OKT3 and comprises SEQ ID NO: 22.

[0206] In certain embodiments, the ligand that binds to a protein associated with the TCR complex is F6A or a variant thereof. In certain embodiments, the ligand that binds to a protein associated with the TCR complex is F6A and is encoded by SEQ ID NO: 23. In certain embodiments, the ligand that binds to a protein associated with the TCR complex is F6A and comprises SEQ ID NO: 24.

[0207] In certain embodiments, the ligand that binds to a protein associated with the TCR complex is L2K or a variant thereof. In certain embodiments, the ligand that binds to a protein associated with the TCR complex is L2K and is encoded by SEQ ID NO: 25. In certain embodiments, the ligand that binds to a protein associated with the TCR complex is L2K and comprises SEQ ID NO: 26.

[0208] In certain embodiments, the protein associated with the TCR complex is CD3. In certain embodiments, the protein associated with the TCR complex is CD3ε.

[0209] In certain embodiments, the TCR signaling domain polypeptide comprises a transmembrane domain and / or a cytoplasmic domain of a TCR co-receptor. In certain embodiments, the TCR co-receptor is CD4, CD8, LAG3, or a chimeric variant thereof.

[0210] In some embodiments, the first polynucleotide and the third polynucleotide are fused to the second polynucleotide, and the coding sequence is operably linked to a promoter. In some embodiments, the second polynucleotide and the third polynucleotide are fused to the first polynucleotide, and the coding sequence is operably linked to a promoter. In some embodiments, the vector is designed to be expressed in mammalian cells, such as T cells. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a retroviral vector.

[0211] In certain embodiments, useful vectors include those derived from lentiviruses, murine stem cell virus (MSCV), poxviruses, oncorretroviruses, adenoviruses, and adeno-associated viruses. Other useful delivery vectors include those derived from herpes simplex virus, transposons, vaccinia virus, human papillomavirus, simian immunodeficiency virus, HTLV, human foamy virus, and variants thereof. Other useful vectors include those derived from foamy virus, mammalian B retrovirus, mammalian C retrovirus, avian C retrovirus, mammalian D retrovirus, and HTLV / BLV retrovirus. An example of a lentiviral vector useful in the disclosed compositions and methods is the pCCL4 vector.

[0212] In certain embodiments, the nucleic acid is a recombinant or engineered nucleic acid. In certain embodiments, the first, second, and / or third polynucleotides are recombinant or engineered polynucleotides. In certain embodiments, the polynucleotides described herein are modified or mutated to optimize the function of the encoded polypeptide and / or the function, activity, and / or expression of the T cell antigen conjugate. In certain embodiments, the nucleic acid encodes a polypeptide.

[0213] In certain embodiments, modifications are made to the polynucleotide sequences and polypeptide sequences disclosed herein, including vector sequences. Modifications include substitutions, insertions, or deletions of nucleotides or amino acids, or changes in the relative position or order of nucleotides or amino acids.

[0214] Expression in T cells

[0215] In certain embodiments, disclosed herein are engineered T cells comprising a nucleic acid sequence disclosed herein or a vector disclosed herein. In certain embodiments, disclosed herein are human T cells engineered to express a Tri-TAC disclosed herein. In certain embodiments, the T cells express a Tri-TAC disclosed herein. Also disclosed herein are T cells transduced or transfected with a T cell antigen conjugate or a vector comprising a Tri-TAC. In certain embodiments, the T cells are isolated T cells.

[0216] In certain embodiments, the human T cells engineered to express Tri-TAC exhibit in vitro functionality equivalent to that of conventional CARs. In certain embodiments, the T cells engineered with Tri-TAC exhibit in vitro functionality superior to that of conventional CARs. In certain embodiments, disclosed herein are human T cells engineered with Tri-TAC that exhibit enhanced safety compared to conventional CARs. In certain embodiments, human T cells engineered to express Tri-TAC exhibit enhanced safety compared to conventional CARs.

[0217] In some embodiments, T cells are obtained from a large number of sources, including but not limited to blood (such as peripheral blood mononuclear cells), bone marrow, thymus tissue, lymph node tissue, umbilical cord blood, thymus tissue, tissue from infection site, spleen tissue or tumor. In some embodiments, the T cell is an autologous T cell. In some embodiments, the T cell is obtained from the cell line of the T cell. In some embodiments, the T cell is obtained from a donor (allogeneic T cell). In some embodiments, the T cell is obtained by differentiation of embryonic or adult stem cells or from induced pluripotent stem cells. In some embodiments, no matter the source of the T cell, the T cell has been modified so that they lack the expression of endogenous TCR and / or permanently or temporarily lack the expression of MHC / HLA molecules (universal donor T cells). In some embodiments, the T cell is autologous for the object. In some embodiments, the T cell is allogeneic, syngeneic or xenogeneic for the object.

[0218] In certain embodiments, once obtained, the T cells are optionally enriched in vitro. In certain embodiments, the cell population is enriched by positive or negative selection. Additionally, the T cells are optionally frozen or cryopreserved and then thawed at a later date.

[0219] In certain embodiments, the T cells are activated and / or expanded before or after the Tri-TAC is introduced into the T cells. In certain embodiments, the T cells are expanded by contacting a surface to which is attached an agent that stimulates CD3 / TCR complex-associated signals and a ligand that stimulates a co-stimulatory molecule on the surface of the T cells. In certain embodiments, the T cells are expanded by contacting with one or more soluble agents that stimulate CD3 / TCR complex signaling and co-stimulatory molecule signaling.

[0220] In certain embodiments, the T cells are transduced or transfected with a nucleic acid sequence. The transduced or transfected T cells express a protein encoded by the transfected or transduced nucleic acid sequence. Nucleic acids can be introduced into cells by physical, chemical, or biological means. Physical means include, but are not limited to, microinjection, electroporation, ion bombardment, lipofection, and calcium phosphate precipitation. Biological means include the use of DNA and RNA vectors.

[0221] Viral vectors, including retroviral vectors, are used to introduce and express nucleic acids in T cells. Viral vectors include vectors derived from lentivirus, murine stem cell virus (MSCV), poxvirus, herpes simplex virus I, adenovirus, and adeno-associated virus. The vector optionally includes a promoter (e.g., CMV promoter, eF1a promoter, or MSCV promoter) that drives expression of the transduced nucleic acid molecule in T cells.

[0222] Any suitable assay can be used to confirm the presence and / or expression of the transduced nucleic acid sequence and / or the polypeptide encoded by the nucleic acid in the T cells. Assays include, but are not limited to, Southern and Northern blot analysis, RT-PCR and PCR, ELISA, Western blot analysis, and flow cytometry.

[0223] Compared to T cells that do not express TAC and / or compared to T cells that express traditional CAR, T cells expressing TAC have improved T cell activation in the presence of antigen. Improved T cell activation is determined by a large number of methods, including but not limited to improved tumor cell line killing, improved cytokine production, improved cell lysis, improved degranulation and / or activation markers such as CD107α, IFNγ, IL2 or TNFα. In certain embodiments, the improvement is measured in individual cells or in cell populations.

[0224] As used herein, the term "increased" or "increase" refers to an increase of at least 1%, 2%, 5%, 10%, 25%, 50%, 100% or 200% in T cells or T cell populations expressing a TAC compared to T cells or T cell populations that do not express the TAC and / or compared to T cells or T cell populations that express a conventional CAR.

[0225] Pharmaceutical composition

[0226] In certain embodiments, disclosed herein are pharmaceutical compositions comprising engineered T cells disclosed herein (transduced with and / or expressing TACs) and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, but are not limited to, buffers such as neutral buffered saline, phosphate buffered saline, and the like, sugars such as glucose, mannose, sucrose, or dextran, mannitol, proteins, polypeptides, or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide), or preservatives. In certain embodiments, the engineered T cells are formulated for intravenous administration.

[0227] The pharmaceutical composition is administered in a manner appropriate to the disease to be treated (or prevented). The amount and frequency of administration are determined by factors such as the patient's condition and the type and severity of the patient's disease, although suitable dosages are determined by clinical trials. Where an "immunologically effective amount," "anti-tumor effective amount," "tumor transplantation effective amount," or "therapeutic amount" is indicated, the exact amount of the composition of the present invention to be administered is determined by the physician taking into account individual differences in age, weight, tumor size, degree of infection or metastasis, and condition of the patient (subject).

[0228] In certain embodiments, the modified T cells and / or pharmaceutical compositions described herein are administered at 10 1 to 10 15 cells per kg body weight, 10 4 to 10 9 cells per kg body weight, optionally 10 5 to 10 8 cells per kg body weight, 10 6 to 10 7 cells per kg body weight or 10 5 to 10 6 In certain embodiments, the modified T cells and / or pharmaceutical compositions described herein are administered at a dose of more than 10 cells per kg body weight, including all integer values ​​within those ranges. 1 In certain embodiments, the modified T cells and / or pharmaceutical compositions described herein are administered at a dose of less than 10 15 The dose was 10 cells per kg body weight.

[0229] In certain embodiments, the modified T cells and / or pharmaceutical compositions described herein are administered at a concentration of 0.5 x 10 6 cells, 2x10 6 cells, 4x10 6 cells, 5x10 6 cells, 1.2x10 7 cells, 2x10 7 cells, 5x10 7 cells, 2x10 8 cells, 5x10 8 cells, 2x10 9 cells, 0.5-2000x10 6 cells, 0.5-2x10 6 cells, 0.5-2x10 7 cells, 0.5-2x10 8 cells or 0.5-2x10 9 The present invention provides for a dosage of 100 cells per day, including all integer values ​​within those ranges.

[0230] In certain embodiments, the T cell composition is administered multiple times at these doses. In certain embodiments, the dose is administered single or multiple times, such as daily, weekly, biweekly, monthly, hourly, or after the cancer being treated reappears, relapses, or develops. In certain embodiments, the cells are administered using perfusion techniques known in immunotherapy (see, for example, Rosenberg et al., New Eng. J. of Med. 319:1676, 1988).

[0231] The pharmaceutical composition is substantially free of, e.g., absent detectable levels of, contaminants selected from, for example, endotoxins, mycoplasmas, replicating lentivirus (RCL), p24, VSV-G nucleic acid, HIV gag, residual anti-CD3 / anti-CD28 antibody-coated beads, mouse antibodies, pooled human serum, bovine serum albumin, bovine serum, culture medium components, vector packaging cells or plasmid components, bacteria, fungi, mycoplasmas, IL-2, and IL-7.

[0232] In certain embodiments, the engineered T-cells disclosed herein are administered to a subject and subsequently blood is redrawn (or apheresis is performed), and the T-cells obtained therefrom are activated and re-infused into the patient having the engineered T-cells. In certain embodiments, this process is performed multiple times every few weeks. T-cells are activated from a 10cc to 400cc blood sample. T-cells are activated from a 20cc, 30cc, 40cc, 50cc, 60cc, 70cc, 80cc, 90cc, or 100cc blood sample.

[0233] The modified / engineered T cells and / or pharmaceutical compositions are administered by methods including but not limited to aerosol inhalation, injection, perfusion, ingestion, infusion, implantation or transplantation. The modified T cells and / or pharmaceutical compositions are administered to the subject via artery, subcutaneous, intradermal, intratumoral, intranodal, intramedullary, intramuscular, intravenous (iv) injection, intravenous (iv) perfusion or intraperitoneal administration. The modified / engineered T cells and / or pharmaceutical compositions thereof are administered to the patient via intradermal or subcutaneous injection. The modified / engineered T cells and / or pharmaceutical compositions thereof are administered by iv injection. The modified / engineered T cells and / or pharmaceutical compositions thereof are injected directly into a tumor, lymph node or site of infection.

[0234] The modified / engineered T cells and / or pharmaceutical compositions are administered in a volume of about 5 mL, 10 mL, 15 mL, 20 mL, 25 mL, 30 mL, 35 mL, 40 mL, 45 mL, 50 mL, 60 mL, 70 mL, 80 mL, 90 mL, 100 mL, 110 mL, 120 mL, 130 mL, 140 mL, 150 mL, 200 mL, 300 mL, 400 mL, or 500 mL.

[0235] The modified / engineered T cells and / or pharmaceutical compositions are administered in a volume of up to about 5 mL, 10 mL, 15 mL, 20 mL, 25 mL, 30 mL, 35 mL, 40 mL, 45 mL, 50 mL, 60 mL, 70 mL, 80 mL, 90 mL, 100 mL, 110 mL, 120 mL, 130 mL, 140 mL, 150 mL, 200 mL, 300 mL, 400 mL, or 500 mL.

[0236] The modified / engineered T cells and / or pharmaceutical compositions are administered in a volume of at least about 5 mL, 10 mL, 15 mL, 20 mL, 25 mL, 30 mL, 35 mL, 40 mL, 45 mL, 50 mL, 60 mL, 70 mL, 80 mL, 90 mL, 100 mL, 110 mL, 120 mL, 130 mL, 140 mL, 150 mL, 200 mL, 300 mL, 400 mL, or 500 mL.

[0237] The pharmaceutical composition is prepared by methods known per se for preparing pharmaceutical compositions for administration to a subject, such that an effective amount of the T cells is combined in a mixture with a pharmaceutically acceptable carrier. Suitable carriers are described, for example, in Remington's Pharmaceutical Sciences (20th edition, Mack Publishing Company, Easton, Pa., USA, 2000). Based on this, the composition includes, but is not limited to, a solution of the substance associated with one or more pharmaceutically acceptable carriers or diluents, and is contained in a buffer solution having a suitable pH and isotonic with physiological fluids.

[0238] Suitable pharmaceutically acceptable carriers include compositions that are chemically inert and non-toxic in nature and do not interfere with the effectiveness of the biological activity of the pharmaceutical composition. Examples of suitable pharmaceutical carriers include, but are not limited to, water, saline solutions, glycerol solutions, N-(1(2,3-dioleyloxy)propyl)N,N,N-trimethylammonium chloride (DOTMA), dioleylphosphatidylethanolamine (DOPE), and liposomes. In certain embodiments, such compositions contain a therapeutically effective amount of the compound and a suitable amount of carrier to provide a form for direct administration to the patient.

[0239] Pharmaceutical compositions include, but are not limited to, lyophilized powders or aqueous or non-aqueous sterile injectable solutions or suspensions, which may also contain antioxidants, buffers, bacteriostatics, and solutes that make the compositions compatible with the tissue or blood of the target recipient. Other components that may be present in such compositions include, for example, water, surfactants (e.g., tweens), alcohols, polyols, glycerol, and vegetable oils. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions.

[0240] Pharmaceutical composition disclosed herein is formulated into various forms and is administered by a variety of different means. Pharmaceutical dosage forms are administered orally, rectally or parenterally in the dosage form containing conventional acceptable carriers, adjuvants and medium as needed. When used in this article, term "parenteral" includes subcutaneous, intravenous, intramuscular or intrasternal injection and perfusion technology. Administration includes injection or perfusion (including intra-arterial, intracardiac, intraventricular, intradermal, intraduodenal, intramedullary, intramuscular, intraosseous, intraperitoneal, intrathecal, intravascular, intravenous, intravitreal, epidural and subcutaneous), suction, transdermal, transmucosal, sublingual, cheek and local (including epidermis, dermis, enema, eye drops, ear drops, intranasal, vaginal) administration. In some exemplary embodiments, route of administration is by injection, such as intramuscular, intravenous, subcutaneous or intraperitoneal injection.

[0241] Liquid dosage forms include oral dosage forms, intravenous dosage forms, intranasal dosage forms, ophthalmic dosage forms, otic dosage forms, aerosols, etc. In certain embodiments, a combination of various dosage forms is administered. In certain embodiments, the composition is formulated for extended release.

[0242] Treatment and usage

[0243] In certain embodiments, disclosed herein are methods of treating cancer in an individual in need thereof using a Tri-TAC disclosed herein. In certain embodiments, a target-specific ligand of a TAC disclosed herein binds to a tumor antigen or tumor-associated antigen on a tumor cell. In certain embodiments, a target-specific ligand of a TAC disclosed herein selectively binds to a tumor antigen or tumor-associated antigen on a tumor cell. In certain embodiments, a target-specific ligand of a TAC disclosed herein specifically binds to a tumor antigen or tumor-associated antigen on a tumor cell. In certain embodiments, the target antigen is a tumor antigen. Examples of tumor antigens include, but are not limited to, CD19, HER-2 (erbB-2), B-cell maturation antigen (BCMA), alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), prostate-specific antigen (PSA), glioma-associated antigen, beta-human chorionic gonadotropin, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, muthsp70-2, M-CSF, prostate enzyme, PAP, NY-ESO-1, LAGE-1a, p53, prostein, PSMA, survivin and telomerase, prostate cancer tumor antigen-1 (PCTA-1), ELF2M, neutrophil elastase, CD22, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor, and mesothelin.

[0244] In certain embodiments, disclosed herein is a method for treating a cancer expressing a target antigen in an individual in need, the method comprising administering to the individual an engineered T cell disclosed herein. In certain embodiments, the target antigen is CD19. In certain embodiments, the method for treating a cancer expressing CD19 in an individual in need comprises administering to the individual an engineered T cell comprising a TAC containing a CD19 targeting ligand. In certain embodiments, examples of cancers treated by TACs comprising CD19 targeting ligands include, but are not limited to, B cell malignancies. In certain embodiments, examples of cancers treated by TACs comprising CD19 targeting ligands include, but are not limited to, B cell lymphomas, acute lymphoblastic leukemia (ALL), and chronic lymphocytic leukemia (CLL). In certain embodiments, examples of cancers treated by TACs comprising CD19 targeting ligands include, but are not limited to, non-Hodgkin lymphomas (NHL).

[0245] In certain embodiments, the target antigen is HER-2. In certain embodiments, the method of treating a cancer in a subject in need thereof wherein the cancer cells express HER-2 comprises administering to the subject an engineered T cell comprising a TAC comprising a HER-2 targeting ligand. In certain embodiments, examples of cancers treatable by a TAC comprising a HER-2 targeting ligand include, but are not limited to, breast cancer, bladder cancer, pancreatic cancer, ovarian cancer, and gastric cancer.

[0246] In certain embodiments, the target antigen is BCMA. In certain embodiments, the method of treating a cancer in which cancer cells express BCMA in an individual in need thereof comprises administering to the individual an engineered T cell comprising a TAC comprising a BCMA targeting ligand. In certain embodiments, examples of cancers treatable by a TAC comprising a BCMA targeting ligand include, but are not limited to, leukemia, lymphoma, and multiple myeloma.

[0247] Also disclosed herein are uses of the engineered T cells disclosed herein for preparing a medicament for treating cancer in an individual in need thereof. Also disclosed herein are uses of mixtures of T cells comprising modified and unmodified cells, or comprising different populations of modified cells with or without unmodified cells. One of ordinary skill in the art will appreciate that a therapeutic amount of modified T cells need not be homogeneous in nature.

[0248] In certain embodiments, the engineered T cells disclosed herein are part of a combination therapy. In certain embodiments, the effectiveness of the therapies disclosed herein is evaluated multiple times. In certain embodiments, patients are stratified based on their response to the therapies disclosed herein. In certain embodiments, the effectiveness of the therapy determines whether to enter a trial.

[0249] In certain embodiments, the cancer treated by the engineered T cells comprising any of the TACs disclosed herein includes any form of neoplastic disease. In certain embodiments, examples of cancers treated include but are not limited to breast cancer, lung cancer, and leukemias such as mixed lineage leukemia (MLL), chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL). In certain embodiments, examples of cancers treated include but are not limited to large B-cell lymphoma, diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, high-grade B-cell lymphoma, or large B-cell lymphoma caused by follicular lymphoma. Other cancers include epithelial cancer, blastoma, melanoma, sarcoma, hematologic cancer, lymphoid malignancies, benign and malignant tumors, and malignant tumors. In certain embodiments, the cancer includes non-solid tumors or solid tumors. In certain embodiments, the cancer treated includes tumors that are not vascularized or substantially not yet vascularized and vascularized tumors. In certain embodiments, the cancer is a solid cancer or comprises a solid tumor. In certain embodiments, the cancer is a liquid cancer or comprises a liquid tumor. In certain embodiments, the cancer is lung cancer, breast cancer, colon cancer, multiple myeloma, glioblastoma, gastric cancer, ovarian cancer, gastric cancer, colorectal cancer, urothelial carcinoma, endometrial cancer, or melanoma. In certain embodiments, the cancer is lung cancer. In certain embodiments, the cancer is breast cancer. In certain embodiments, the cancer is colon cancer. In certain embodiments, the cancer is multiple myeloma. In certain embodiments, the cancer is glioblastoma. In certain embodiments, the cancer is gastric cancer. In certain embodiments, the cancer is ovarian cancer. In certain embodiments, the cancer is gastric cancer. In certain embodiments, the cancer is colorectal cancer. In certain embodiments, the cancer is urothelial carcinoma. In certain embodiments, the cancer is endometrial cancer. In certain embodiments, the cancer is melanoma.

[0250] Table 1. Sequence Listing

[0251]

[0252]

[0253]

[0254] 1 Light chain, nucleotides 1-324; linker, nucleotides 3250-387; heavy chain, nucleotides 388-750

[0255] 2Light chain, amino acids 1-108; linker, amino acids 109-128; heavy chain, amino acids 129-250

[0256] 3 Extracellular linker, nucleotides 1-66; transmembrane domain, nucleotides 67-132; cytoplasmic domain, nucleotides 133-254

[0257] 4 Extracellular linker, amino acids 1-22; transmembrane domain, amino acids 23-44; cytoplasmic domain, amino acids 45-84 Example

[0258] The following examples are provided for the purpose of illustrating various embodiments of the present invention and are not intended to limit the present invention in any way. The present examples and the methods described herein are representatives of current preferred embodiments and are exemplary and are not intended to limit the scope of the present invention. Those skilled in the art will appreciate that variations therein and other uses encompassed within the spirit of the present invention as defined by the scope of the claims will be appreciated.

[0259] Example 1. Characterization of Tri-TAC Technology

[0260] An overview of Tri-TAC technology is provided in Figure 1A-1C middle.

[0261] Figure 1A Shown is an example of CD8 T-cell activation based on the co-assembly of different receptors and their associated protein partners. At the beginning, major histocompatibility complex I is presenting antigen (helix). This is recognized by the T cell receptor (TCR) complex that can bind to the antigen. The TCR complex contains several separate subunits. The α / β domain can directly interact with the antigen presented on MHC-I. The α / β domain then interacts with several other domains (ε, γ, δ and ζ), which all participate in T-cell activation through various intracellular activation domains. The TCR complex and CD8 co-receptors interact with MHC-I at the same time. The CD8 co-receptors bind to the MHC-I in an antigen-independent manner. CD8 directly interacts with Lck, which is a protein kinase important for activating the TCR receptor complex. The interaction of the CD8 with Lck also ensures their association with lipid rafts (membrane fraction) microdomains, which are hypothesized to organize and encapsulate other related signaling components (dark spheres). Later stages of activation then lead to the recruitment of CD28. If this cascade of interactions occurs several times in parallel, T cells become activated and are able to exert their cytotoxic effects.

[0262] Figure 1B An overview of chimeric antigen receptors (CARs) is provided. CARs attempt to reproduce the complex mechanism of T- cell activation by combining several key activation domains such as CD3ζ and CD28 in a single synthetic engineered molecule. The CAR then interacts with the selected antigen using a specific binding domain. Depicted here is ankyrin repeat protein (DARPin). It is believed that several such interactions occurring in parallel cause T- cell activation.

[0263] Figure 1C This is an overview of Tri-TAC technology, which mimics the natural activation process. Tri-TACs were developed to better recapitulate natural signaling through the TCR while retaining MHC-independent targeting. T-cell activation occurs after MHC ligation by the TCR and a T-cell coreceptor (CD4 or CD8), both of which bind simultaneously to conserved regions within the MHC molecule. Coreceptors are specifically located within "lipid rafts," membrane microdomains that are crucial for the formation of the TCR signaling complex. In addition to ensuring the correct microdomain localization of the TCR activation complex, these coreceptors also directly bind to Lck, a protein kinase critical for T-cell activation. Conventional chimeric receptors or bifunctional proteins are unable to engage coreceptor molecules or Lck. A molecule was generated in which the transmembrane and intracellular regions of the CD4 coreceptor, which localize to lipid rafts and bind to Lck, respectively, were fused to a single-chain antibody that binds CD3 (UCHT1; SEQ ID NOs: 13, 14, and homologs thereof). This construct is designed to pull CD3 molecules and TCRs into lipid rafts and bring Lck into proximity with the TCR, similar to natural MHC binding. To target this receptor, a designed ankyrin repeat (DARPin) was attached to the CD4-UCHT1 chimera to create a trifunctional T cell antigen conjugate (Tri-TAC). In this example, the DARPin is specific for the proto-oncogene HER-2 (erbB-2).

[0264] Various Tri-TAC configurations are possible ( Figure 2A and Figure 2B ). In configuration 1( Figure 2A ), the antigen binding domain is located at the N-terminus and is connected to the CD3 ligand binding domain, followed by the coreceptor domain. In configuration 2 ( Figure 2B ), the CD3 ligand binding domain is located at the N-terminus and is linked to the antigen binding domain, which in turn is linked to the coreceptor domain.

[0265] Multiple types of ligand binding domains can be incorporated into the Tri-TAC molecule ( Figures 3A-3DThe examples herein show configuration 1 Tri-TAC ( Figure 3A ), Tri-TAC with HER-2 specific DARPin ( Figure 3B ), Tri-TAC with CD19-specific scFv ( Figure 3C ) and Tri-TAC with BCMA-specific scFv ( Figure 3D ) is a general schematic diagram of the .

[0266] Figures 4A-4D The function of Tri-TAC with HER-2 specific DARPin is shown. Human T cells were engineered to express Tri-TAC disclosed herein or conventional CAR with the same DARPin. It was determined that in all cases, the T cells engineered with the Tri-TAC showed at least equivalent function to conventional CAR. Interestingly, for two parameters (TNF-α production and CD107a mobilization), it was observed that in some cases the Tri-TAC was more active than the conventional CAR.

[0267] Figure 4A Surface expression of anti-HER-2 DARPin Tri-TAC compared to anti-HER-2 DARPin CAR and control T cells is shown. The chimeric receptor was detected by incubation with recombinant HER-2. The anti-HER-2 DARPin Tri-TAC expressed well on the surface of engineered T cells. Figure 4B The growth of the engineered T cell cultures is shown. T cells were activated with anti-CD3 / anti-CD28 antibody Dynabeads and engineered with lentivirus encoding Tri-TAC, CAR, or no receptor (control). After 2 weeks, the CAR and control cultures grew to similar numbers, while the Tri-TAC cultures grew slightly slower. Figure 4C and Figure 4D The functional properties of the engineered T cells are shown. T cells engineered to express the Tri-TAC or CAR with the HER-2 DARPin were stimulated with plate-bound antigen. The engineered T cells expressing the Tri-TAC and CAR could perform all measured functions (TNF-α production, IFN-γ production, and CD107a mobilization, Figure 3C and Figure 3D Compared with T cells engineered with CAR, T cells engineered with Tri-TAC showed a high frequency of CD107a-positive cells after stimulation ( Figure 3D ), indicating enhanced cytotoxicity on a per-cell basis.

[0268] Figures 6A-6JThe data presented demonstrate the importance of both the ligand binding domain and the UCHT1 CD3 binding domain for Tri-TAC function. Figure 6G 、 Figure 6H 、 Figure 6I , bottom row), Tri-TAC variants lacking DARPin ( Figure 6A 、 Figure 6B 、 Figure 6C , top row) or the Tri-TAC variant lacking UCHT1 ( Figure 6D 、 Figure 6E 、 Figure 6F , middle row). All three engineered T cell populations were stimulated with HER-2 positive tumor cells. The T cells engineered with full-length Tri-TAC produced IFN-g, TNF-α, and IL-2 upon stimulation, while the variants failed to produce any cytokines upon stimulation. The three T cell populations were also co-cultured with D2F2 / E2 cells (expressing HER-2) or D2F2 cells (HER-2 negative) at a 4:1 effector cell:target cell ratio ( Figure 6J T cells engineered with the full-length Tri-TAC showed robust killing of D2F2 / E2 cells, but not D2F2 cells. Other Tri-TAC variants lacking DARPin or UCHT1 showed no killing.

[0269] Figures 7A-7C Results are shown for mice treated with vehicle control (NGFR), anti-HER-2 DARPin CAR, or anti-HER-2 DARPin Tri-TAC. A xenograft mouse model was used. OVCAR-3 tumor cells were administered subcutaneously to mice and allowed to grow until tumors reached 100-200 mm. 3 size. Figure 7A Relative tumor progression normalized to tumor size on the day of treatment is shown. Anti-HER-2 DARPin Tri-TAC engineered T-cells caused a rapid reduction in tumor volume, controls had no effect, and CAR cells slowed tumor growth and showed a delayed reduction in tumor size. Figure 7B The relative change in body weight after T-cell infusion is shown. Both the control and anti-HER-2 DARPin Tri-TAC engineered cells did not show significant changes in mouse body weight after treatment. In contrast, anti-HER-2 DARPin CAR treated mice showed a significant loss of body weight, indicating severe toxicity. Figure 7C Shown are cytokine concentrations in mouse serum on day 7 after T-cell infusion. Cytokine levels were higher in CAR-treated mice compared to Tri-TAC-treated mice.

[0270] Example 2. Substitution of UCHT1 affects Tri-TAC function

[0271] Figures 8A-8H The functionality of Tri-TAC with alternative CD3 binding domains is shown. The domains are listed in Figure 8A and Figure 8E Contains UCHT1( Figure 8B )、OKT3( Figure 8B ) and huUCHT1( Figure 8F ) showed high surface expression, while Tri-TAC containing F6A ( Figure 8F ) and L2K( Figure 8F ) showed lower surface expression of Tri-TAC. Cells expressing Tri-TAC containing OKT3 showed low cytokine production after Tri-TAC ligation ( Figure 8C 、 Figure 8C1 ) and moderate cytotoxicity ( Figure 8D Cells expressing Tri-TAC containing F6A showed strong cytokine production after Tri-TAC ligation ( Figure 8G 、 Figure 8G1 ) and cytotoxicity ( Figure 8H Cells expressing Tri-TAC containing L2K showed low cytokine production ( Figure 8G 、 Figure 8G1 ) and moderate cytotoxicity ( Figure 8H ).

[0272] Figures 9A-9H Shows the Figure 8A and Figure 8E TCR surface expression on T cells engineered with different Tri-TAC variants shown in FIG. Figure 9A 、 Figure 9E and Figure 9B 、 Figure 9F ) or L2K( Figure 9C 、 Figure 9G and Figure 9D 、 Figure 9H ) exhibited lower TCR surface expression relative to T cells engineered with Tri-TAC variants containing UCHT1 or huUCHT1, respectively. In contrast, T cells engineered with Tri-TAC variants containing F6A did not exhibit TCR downregulation relative to Tri-TAC with huUCHT1 ( Figure 9C 、 Figure 9G and Figure 9D 、 Figure 9H). The F6A substitution reduced Tri-TAC receptor surface expression while retaining appropriate cytokine production and cytotoxicity. The L2K substitution moderately reduced surface expression and reduced cytokine production, but retained moderate cytotoxicity. The OKT3 substitution resulted in high Tri-TAC surface expression, low cytokine production, and moderate cytotoxicity. These data suggest that Tri-TAC surface expression and T cell effector function are not inherently proportional, and that in some cases replacement of the Tri-TAC domain alters effector function independently of surface expression levels. It is conceivable that TAC variants with reduced cytotoxicity and low surface expression may be valuable in certain clinical applications.

[0273] In many cases, the scFv replacement reduces the ability of the engineered T cells to produce IFN-γ, TNF-α, and IL-2, but the engineered T cells still retain the ability to kill target cells. Excessive cytokine production has been associated with side effects in clinical settings, limiting current CAR technology to life-threatening diseases. The ability to modify TAC molecules to reduce their cytokine production while retaining appropriate cytotoxicity allows the generation of Tri-TAC receptors with the exact level of reactivity required to meet clinical efficacy and safety.

[0274] The ability of the OKT3-containing Tri-TAC variants to inhibit TCR surface expression and cytokine production while retaining cytotoxicity may be of great value in the allogeneic setting, where inhibition of the TCR can suppress graft-versus-host disease.

[0275] These data demonstrate that scFv substitution of UCHT1 impacts Tri-TAC function. Further modifications will yield Tri-TACs that can be used in a variety of different applications (e.g., oncology, autoimmunity, allergy).

[0276] Example 3. Introduction of various linkages linking the ligand binding to the TCR complex to the target binding ligand domain thing

[0277] Figures 10A-10B Several TAC variants with different linkers connecting the ligand that binds the TCR complex to the target-binding ligand domain are shown. Flexible linkers allow movement between the two domains. Large domain linkers contain two folded domains and are very large and rigid. Small and long helical linkers also introduce rigidity but are less restrictive than the large domain linkers.

[0278] Figures 11A-11E Shown are the effects of linker replacement on Tri-TAC surface expression, Tri-TAC transduction efficiency, and cytokine production after Tri-TAC ligation. Figure 11A and Figure 11B It was shown that the helical linker enhanced surface expression and transduction efficiency when compared to the flexible linker, whereas the large domain linker enhanced transduction efficiency but not surface expression. Figure 11D 、 Figure 11E Cytokine production by cells expressing Tri-TACs with short-helix, long-helix, or large domain linkers is shown.

[0279] Figure 12A Enhanced in vitro cytotoxicity of T cells expressing Tri-TAC with a short helical linker is shown. Figure 12B Enhanced in vivo tumor control of T cells expressing Tri-TAC with a short helical linker is shown. The short helical linker is associated with high in vitro cytotoxicity and effective in vivo tumor control.

[0280] Example 4. Introduction of CD8α / β cytoplasmic domain

[0281] Figure 13A Shown with anti-HER-2 scFv or Figure 13C Surface expression of CD8α Tri-TAC paired with anti-HER-2 DARPin. Figure 13B Shown are cytokine production by T cells expressing CD8α Tri-TAC paired with anti-HER-2 scFv or anti-HER-2 DARPin.

[0282] Figure 14A The CD4 Tri-TAC monomer and the CD8 α / β heterodimer are shown. Both CD4 and CD8 TCR coreceptors carry functional domains that are important for coreceptor function. These regions include an arginine-rich region that is hypothesized to be important for lipid raft association and a CXCP motif required for Lck binding. Unlike CD4, which is a monomer, the CD8 coreceptor is a heterodimer composed of α and β subunits ( Figure 14A Both the α and β CD8 subunits contain arginine-rich regions, but only the α subunit contains the CXCP motif.

[0283] Figures 14B-14D Provides a merge from Figure 14A Schematic diagram of the Tri-TAC variants of the CD8 coreceptor elements is shown in Figure 2. In all CD8 Tri-TAC variants, the cysteine ​​responsible for the dimerization of CD8α and CD8β is replaced with alanine. Figure 14B Schematic diagram of CD8α Tri-TAC containing a cysteine ​​to serine mutation to ensure monomeric receptor distribution and the CD8α cytoplasmic domain. Figure 14CSchematic diagram of a CD8α+Rβ Tri-TAC containing a cysteine ​​to serine mutation to ensure monomeric receptor distribution and a chimeric CD8α cytoplasmic domain in which the arginine-rich region of CD8α is replaced by the arginine-rich region of CD8β. Figure 14D Schematic diagram of a CD8β+Lck Tri-TAC containing a cysteine ​​to serine mutation to ensure monomeric receptor distribution and a chimeric CD8β cytoplasmic domain in which a CD8αCXCP domain containing an Lck binding motif is added to the C-terminus of the CD8β cytoplasmic domain.

[0284] Figures 15A-15D Various distinct phenotypic and functional attributes of CD8-based Tri-TAC variants relative to the prototype Tri-TAC are shown. Figures 15A-15B Surface expression of CD8-Tri TAC variants relative to the prototype Tri-TAC is shown. Surface expression was comparable between the different Tri-TACs. Figure 15C In vitro cytotoxicity of CD8-Tri TAC variants co-cultured with LOX IMVI (HER-negative) and A549, SKOV3, SKBR3 or MBA MB 231 (all HER-2 positive) is shown. All T cells engineered with Tri-TAC exhibited cytotoxicity. Figure 15D Cell division of T cells engineered with CD8 Tri-TAC variants or prototype Tri-TAC is shown ( Figure 15D ). Figure 15E Figure 2 shows TCR surface expression of engineered T cells containing CD8 Tri-TAC variants or prototype Tri-TAC. All Tri-TAC variants have similar effects on TCR expression. Although both CD4 co-receptors with scFv and DARPin anti-HER-2 show good surface expression and function, CD8α constructs only show activity in the context of DARPin antigen binding domains. When testing different CD8α cytoplasmic domains, all configurations contain reported key sequence attributes related to co-receptor function (arginine-rich region and CXCP). When compared to the CD4 prototype, all CD8α / β constructs show similar performance. This emphasizes that the retention of specific biochemical properties such as lipid raft affinity and Lck binding is more important for determining TriTAC performance than specific cytoplasmic polypeptide sequences.

[0285] The growth of T cells engineered with the CD8α+R(β) and CD8β+Lck Tri-TACs was significantly impaired relative to the growth of T cells engineered with the other variants. Despite the significant effect on growth, these Tri-TACs all demonstrated comparable ability to activate T cells. The reduced growth of the CD8α+R(β) and CD8β+Lck Tri-TACs may be advantageous for certain applications where maximal T cell expansion is undesirable.

[0286] Example 5. Development of CD19-TAC Constructs

[0287] Figure 16 The progressive development of the CD19-TAC construct is shown. Several generations of lentiviral vectors were generated with various changes in design elements to ensure CD19 specificity, suitable TAC expression, and GMP-grade lentiviral production. Each box represents a lentiviral vector and specifies the three main design elements: (A) antigen binding domain, (B) TCR / CD3 binding domain, and (C) coreceptor domain. Shaded areas indicate domains that were the subject of modification during vector development.

[0288] In the first step, the TAC, comprising a HER-2-specific designed ankyrin repeat protein (DARPin), a murine UCHT1 CD3-specific scFv, and a flexible transmembrane and cytoplasmic CD4 polypeptide, was cloned into the pCCL4 lentiviral vector.

[0289] To generate a CD19-specific Tri-TAC, the HER-2-specific DARPin was replaced with a polypeptide comprising an N-terminal CD8a leader peptide fused to an anti-CD19 scFv whose heavy and light chains are linked by a glycine-serine linker region.

[0290] The UCHT1 domain was replaced with a humanized version (huUCHT1) to reduce immunogenicity.This TAC construct exhibited superior surface expression levels compared to its precursor.

[0291] To further enhance receptor expression on the cell surface of T cells without compromising function, two independent modifications were evaluated in parallel. To improve single-chain stability, the G4S linker (SEQ ID NO: 73) used in the anti-CD19 scFv was replaced with a more structured Whitlow linker. Separately, a Y177T mutation was introduced into the huUCHT1 domain. Both strategies enhanced TAC receptor expression and generated receptors with both a Whitlow linker and a Y177T mutation.

[0292] Figure 17The CD19-TAC insert in the pCCL lentiviral vector is shown. The pCCL vector features a bidirectional promoter system, with ΔNGFR(hu) under the control of the mCMV promoter and TAC expression driven by the EF-1α promoter. ΔNGFR(hu) is a truncated version of human CD271 (tumor necrosis factor receptor superfamily member 16) that possesses a transmembrane domain but lacks the cytoplasmic signaling domain. Expression product of ΔNGFR(hu) was used for quantitative lentiviral transduction. The CD19-TAC #921 open reading frame is magnified to illustrate the key elements of the TAC construct: the CD8α leader peptide, FMC63 single chain (anti-CD19 scFv), human c-Myc tag, huUCHT1(Y177T), and ΔCD4 domain. The huUCHT1(Y177T) mutation was identified by examining point mutations introduced into residues that are directly within the murine UCHT1 CD3ε binding interface. The (Y177T) mutation was successfully identified in the screening. The (Y177T) mutation resulted in better Tri TAC surface expression while retaining T cell activation. ΔCD4 lacks the four CD4 extracellular immunoglobulin-like domains and retains the extracellular linker, transmembrane, and cytoplasmic domains.

[0293] To produce GMP-grade lentiviral vectors, the CD19-Tri-TAC construct was cloned into a new lentiviral vector under the control of the MSCV promoter. Figure 17 Same as shown in .

[0294] Example 6. Ability to generate T cells expressing CD19-TAC from different donor materials

[0295] Figure 18 The efficacy of CD19 TAC-expressing T cells generated from multiple donors is shown. T cells from three different donors were used to generate CD19-TAC-expressing T cells and tested in the NALM-6 tumor model. Mice bearing established NALM-6 tumors were treated with a single dose of 4 x 10 6 The study was conducted on 24 healthy mice treated with CD19 TAC-expressing T cells. Control mice showed rapid tumor growth, and all mice reached endpoint by the end of the study. T cell products from donors 1 and 2 resulted in complete tumor control in all mice. T cell products from donor 3 resulted in robust tumor control in all mice and long-term control in 2 / 4 of the treated mice. The study demonstrated that tumor rejection was achieved by CD19 TAC-expressing T cells derived from multiple healthy donors. Figure 18 Results from the NALM-6 tumor model in

[15] demonstrated that effective CD19 TACs were generated from material derived from multiple donors.

[0296] Example 7. In vitro cytotoxicity and in vivo efficacy of T cells expressing CD19-TAC

[0297] To evaluate the ability of CD19-TAC to effectively engage a variety of CD19-positive cells, Tri-TAC-engineered T cells were co-cultured with NALM-6 (acute lymphoblastic leukemia), Raji (Burkitt lymphoma), or Jeko-1 (mantle cell lymphoma). NALM-6, Jeko-1, and Raji cells were engineered to have enhanced firefly luciferase to enable tracking of tumor burden in vitro and in living animals by bioluminescent imaging.

[0298] Figures 19A-19C The results show that tumor cell lines are killed by T cells expressing CD19-TAC. The effect is dose-dependent and increases with the increase of the effector cell to target cell (E:T) ratio. As negative controls, cells engineered with ΔTAC (lacking the antigen binding domain) or untransduced T cells were used. These results confirm that T cells expressing CD19-TAC kill CD19-positive tumor cells.

[0299] Figure 19D-19G The design and results of an in vivo study evaluating the efficacy of CD19-TAC in mice transplanted with NALM-6 (acute lymphoblastic leukemia), Raji (Burkitt lymphoma) or Jeko-1 (mantle cell lymphoma) liquid tumors are shown. In order to induce NALM-6, Raji and Jeko-1 tumors, mice were inoculated with NALM-6, Raji or Jeko-1 cells and raised for 4 or 7 days to allow for the implantation of tumors. On the 4th or 7th day, T cells expressing CD19-TAC were administered by intravenous injection into the tail vein. Tumor burden was measured at weekly intervals and the data were plotted as average irradiance [p / s / cm^2 / sr].

[0300] Figure 19E-19G We demonstrated that CD19-TAC engineered T cells were effective in inducing tumor regression and long-term tumor control in NALM-6 (acute lymphoblastic leukemia), Raji (Burkitt lymphoma), or Jeko-1 (mantle cell lymphoma) liquid tumors.

[0301] Figures 19A-19G The results of NAML-6, Raji or Jeko-1 tumor models showed that CD19-TAC was effective in various CD19-positive tumor models.

[0302] Example 8. Persistence and sustained tumor immunity of T cells expressing CD19-TAC

[0303] Figure 20A-Figure 20BShown is the persistence of tumor immunity and resistance to rechallenge in mice receiving CD19-TAC expressing T cells.Mice bearing established NALM-6 tumors were treated with CD19-TAC expressing T cells.

[0304] Figure 20A The experimental setup for determining the persistence of CD19-TAC in mice is shown. Mice were first inoculated with NALM-6 cells and treated with CD19-TAC after a 4-day implantation period. All mice showed tumor regression and complete tumor control. 56 days after the initial treatment, mice were re-challenged with NALM-6 (CD19 positive) or KMS11 (CD19 negative) liquid tumors. In all cases, naive mice were co-injected with tumor cells and used as negative controls. Tumor burden was tracked by luminescence signals.

[0305] Figure 20B Mice bearing established NALM-6 tumors were treated with CD19-TAC-expressing T cells administered as split doses for a total of 4 x 10 6 Engineered cells. As a control, a group of untreated animals was used. After ACT, the treated mice showed a persistent anti-tumor response. In contrast, the control mice showed exponential growth of the tumor mass and reached an endpoint related to tumor burden. On day 56 after ACT, the mice were re-challenged with NALM-6 tumor cells (CD19 positive) or KMS11 tumor cells (CD19 negative). Mice treated with CD19-TAC were still protected from NALM-6 (CD19 positive) tumor cells, but not from KMS11 (CD19 negative) tumor cells.

[0306] Figure 20A and Figure 20B Results from rechallenge experiments in demonstrated that CD19-TACs differentiated into long-lived memory cells that retained anti-tumor properties in certain circumstances.

[0307] Example 9. In vivo expansion and dose dependence of CD19-TAC expressing T cells

[0308] Figures 21 and 22 show the dose dependency, dosing schedule (fractionated or single), and expansion of CD19-TAC expressing T cells in the NALM-6 cancer model. Figure 21A The experimental design is shown. Mice received a single dose of CD19-TAC expressing T cells on day 4 after tumor inoculation or received split doses delivered 7 days apart. Multiple doses of CD19-TAC expressing T cells were tested: 0.5x10 6 , 1x10 6 and 4x10 6 cells. Figure 21B Shown to accept 4x106 A control group of mice was maintained with either untransduced cells or freezing medium (medium control).

[0309] Figure 21B Figure 2 shows the survival rate of mice after NALM-6 injection and CD19-TAC injection. A dose-dependent improvement in survival was observed in both the single-dose and split-dose groups, with the highest single-dose dose limiting tumor growth and improving mouse survival.

[0310] Figure 22A The gating strategy used to assess T cell proliferation is shown. Cells are first selected based on forward and side scatter to select the lymphocyte population. Single T cells are identified by the forward scatter area above the height gate. Live cells are identified by near-IR gating. Human cells are identified by the hCD45 gate. The resulting cell subsets are further divided into CD3-positive cells. These cells are then gated based on CD4 / CD8 and protein L. The staining strategy also includes muCD45_1 to identify murine blood cells. CD19 is included to stain NALM-6 cells.

[0311] Figure 22B Figure 2 shows the expansion of T cells in mice after fractionated dose adoptive T cell transfer (ACT). Blood samples were obtained regularly after ACT and analyzed by flow cytometry. Values ​​were normalized to the total number of T cells present in the blood after ACT1. Values ​​were also normalized to the total number of CD45.1+ (murine) cells to account for differences in blood draws. T cells in mice treated with CD19-TAC engineered cells showed expansion in recipient mice approximately 1-2 weeks after the first ACT ( Figure 22B ). Untransduced cells do not expand ( Figure 22B ).

[0312] Various doses, dosage regimens ( Figure 21B ) and T cell count ( Figure 22B ) showed that the efficacy of CD19-TAC was dose-dependent, the engineered T cells expanded in vivo, and this expansion was specific to CD19-TAC-engineered cells in animals bearing CD19-positive tumors.

[0313] Example 10. In vivo efficacy, long-term efficacy and safety of CD19-TAC treatment

[0314] Figure 23- Figure 25 Long-term safety and efficacy (Figure 23) and the absence of any treatment-related acute toxicity ( Figure 24-25 ).

[0315] Figure 23A The experimental design is shown. Mice were treated with 0.5 x 10 6The mice were then treated with two dose levels (4 and 12 x 10 6 The researchers used a single dose of CD19-TAC-engineered T cells (100 engineered cells) to treat the mice. Tumor growth was then tracked by regular luminescence measurements. Mouse health was regularly assessed by examining behavioral and physical characteristics (grooming behavior, mobility, and fur integrity).

[0316] Figure 23B Shown are the differences in T cell numbers between cells treated with medium alone (freezing medium), non-engineered control cells (total T cell dose equal to the highest engineered treatment group), and 4 or 12 x 10 6 Tumor burden measured by luminescence after treatment with engineered CD19-TAC engineered T cells. Both controls showed rapid tumor growth and no anti-tumor efficacy. The control agent caused a delay in tumor growth relative to vehicle alone, presumably due to competition between high-dose T cells and tumor cells for the engraftment niche. The engineered T cells showed tumor regression in all cases. The high-dose treatment group showed complete tumor control in all cases. 6 The treatment group showed complete control in 3 mice, delayed tumor growth in 1 mouse, and controlled but high tumor burden in 1 mouse.

[0317] Figure 23C The overall survival rates for the different treatment groups are shown. In both the vehicle and non-engineered control mice, all mice succumbed to tumors within 23 to 35 days, respectively. In the case of high-dose CD19-TAC treatment, all mice developed symptoms of GvHD and succumbed to GvHD within 61 days. GvHD is a result of the mouse model itself, not the modified T cell treatment. Low-dose mice showed that 3 mice survived the end of the study at 90 days, 1 mouse succumbed to high tumor burden, and 1 mouse succumbed to GvHD.

[0318] Figure 24 and Figure 25 Shown are the results from vehicle control, non-engineered and CD19-TAC (4 and 12 x 10 6 Clinical chemistry parameters and cytokine levels were compared in mice treated with ACT (using a combination of ACT-treated and non-engineered cells) using a single-cell, effective CD19-TAC engineered cell line. Mice were followed for 33 days after ACT, and blood samples were obtained on days 5, 12, and 33. Only mice treated with CD19-TAC survived 33 days. Vehicle control mice succumbed to tumor burden before a third blood sample could be collected, while mice in the non-engineered cell group were sacrificed as early as day 26, before reaching tumor burden-related endpoints. All blood samples were analyzed for several clinical chemistry parameters and cytokine levels.

[0319] Figure 24 CD19-TAC-treated mice showed no significantly higher parameters compared to control mice at days 5 and 12. At day 33, all treated mice showed clinical chemistry parameters comparable to earlier treatment time points, with the exception of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), where some mice experienced high levels similar to those of mice treated with non-engineered cells sampled at day 26.

[0320] Figure 25 Cytokine responses at days 5, 12, and 33 are shown. At day 5 post-ACT, CD19-TAC but not control mice showed elevations in all cytokines tested. The cytokine increases were consistent with an inflammatory response in which the CD19-TAC engineered T cells recognized and reacted with antigen-positive NALM-6 tumor cells. Following their initial response, cytokine levels declined by day 12, correlating with the subsequent induction of tumor regression and generally low tumor burden. At day 12, cytokine levels in the CD19-TAC treated groups were similar to or lower than those in the non-engineered T cell groups, with the exception of IL10. At later stages, all mice treated with non-transduced or CD19-TAC engineered T cells showed increases in cytokines, presumably associated with the onset of GvHD. See also Figure 29 , which shows cytokine responses at days 5, 12, 26, and 33.

[0321] The results of long-term follow-up of mice treated with CD19-TAC and their clinical chemistry confirmed that the engineered T cells were safe for use and did not show any signs of toxicity specifically caused by the CD19-TAC engineering. The results of the cytokine studies confirmed an early inflammatory response associated with anti-tumor efficacy, followed by a decrease in all cytokine levels, indicating a controlled inflammatory response.

[0322] Example 11. Several BCMAs In vivo efficacy of Tri-TAC variants

[0323] Figure 26 shows in vivo efficacy studies of various BCMA Tri-TAC constructs. Figure 26A The overall experimental design is shown. One million luciferase engineered KMS11 (BCMA positive) tumor cells were allowed to implant for 12 days. Mice were then treated with a single effective dose of 4 million BCMA constructs and controls ( Figure 26B Tumor burden was assessed regularly by luminescence measurement. All mice showing tumor regression and tumor control were then re-challenged with 1 million KMS11 cells on day 25 after ACT.

[0324] Figure 26C Following ACT, control mice exhibited rapid tumor cell growth, reaching tumor-related endpoints within 19 to 25 days. In contrast, all BCMA-TAC-treated mice showed initial tumor regression. Tumor control varied by construct, with G4S (SEQ ID NO: 73) 3625 VH-VL showing the lowest level of initial tumor control and short helix 3625 VL-VH showing the highest level of initial tumor control. Following rechallenge, the majority of all constructs that had maintained tumor control until day 25 remained protective against rechallenge.

[0325] Results from this in vivo study demonstrate that various BCMA Tri-TAC constructs are effective in controlling KMS11 (BCMA-positive) liquid tumors. However, certain preferred configurations offer superior efficacy. Overall, the helical linker region offers relative benefits when compared to flexible linkers within the same scFv configuration.

[0326] Example 12. In vivo efficacy of TAC-Her2

[0327] Mice were inoculated with OVCAR3 solid tumors in the flank. Tumors were allowed to establish and grow to 100 mm. 3 The mice were then treated with tail vein injection of TAC-Her2 engineered T cells. Tumor volume was measured regularly.

[0328] Example 13. Clinical trial

[0329] A clinical study was conducted in which subjects aged at least 18 years with CD19-positive diffuse large B-cell lymphoma who had failed at least two current first-line therapies, including ASCT, or were ineligible for ASCT, were treated with T cells expressing CD19-TAC. The study was an open-label, single-arm, phase 1 / 2 two-stage trial, featuring a dose-escalation phase to determine the maximum tolerated dose (MTD) or recommended phase II dose (RPh2D), followed by expansion cohorts at the selected dose.

[0330] After selection, the subject undergoes leukocyte apheresis to obtain T cells for the manufacture of T cells expressing CD19-TAC. After successful manufacture, the subject enters the treatment phase. This phase includes chemotherapy...

Claims

1. A human epidermal growth factor receptor 2 (HER2) T cell antigen conjugate (HER2-TAC) polypeptide, which consists of an amino acid sequence having 100% sequence identity with SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO:

76.

2. A nucleic acid molecule encoding the HER2-TAC according to claim 1.

3. The nucleic acid molecule of claim 2, wherein the nucleic acid molecule has 100% sequence identity to SEQ ID NO: 65, SEQ ID NO: 67 or SEQ ID NO:

75.

4. A vector construct comprising: (a) the nucleic acid molecule of claim 2; and (b) Promoters that are functional in mammalian cells.

5. The vector construct of claim 4, wherein the nucleic acid molecule has 100% sequence identity to SEQ ID NO: 65, SEQ ID NO: 67 or SEQ ID NO:

75. 6 . A T cell comprising (a) the HER2-TAC of claim 1 ; (b) the nucleic acid molecule of claim 2 or 3 ; or (c) the vector construct of claim 4 or 5 .

7. A pharmaceutical composition comprising the T cell according to claim 6 and a pharmaceutically acceptable excipient.

8. Use of the T cell of claim 6 in the preparation of a medicament for treating a cancer expressing HER2 in an individual in need thereof.

Images