Method for generating multivalent and multispecific antibody-expressing cells by targeted integration of multiple expression cassettes in a defined tissue format

Abstract

Reported herein is, inter alia, a method for producing a trivalent bispecific antibody, the method comprising the steps of culturing a mammalian cell comprising a deoxyribonucleic acid encoding the trivalent bispecific antibody, and recovering the trivalent bispecific antibody from the cell or culture medium, wherein the deoxyribonucleic acid encoding the trivalent bispecific antibody is stably integrated into the genome of the mammalian cell and comprises in the 5' to 3' direction a first expression cassette encoding a first heavy chain, a second expression cassette encoding the first heavy chain, a third expression cassette encoding a first light chain, a fourth expression cassette encoding the first light chain, a fifth expression cassette encoding the second heavy chain, a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain, and a seventh expression cassette encoding the second light chain, wherein the first heavy chain The chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, a peptide linker, a second heavy chain variable domain and a CL domain, the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain, the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain, wherein the second heavy chain variable domain and the first light chain variable domain form a first binding site, and the first heavy chain variable domain and the second light chain variable domain form a second binding site.

Description

[0001] The present invention relates to the field of cell line generation and polypeptide production. More specifically, described herein are recombinant mammalian cells obtained by a dual-recombinase-mediated cassette exchange reaction, resulting in integration of specific expression cassette sequences into the mammalian cell genome. These cells can be used in methods for producing multivalent, multispecific antibodies. Background Art

[0002] Secreted and glycosylated polypeptides, such as antibodies, are typically produced by recombinant expression (either stable or transient) in eukaryotic cells.

[0003] One strategy for generating recombinant cells expressing an exogenous polypeptide of interest involves random integration of a nucleotide sequence encoding the polypeptide of interest, followed by selection and isolation steps. However, this approach has several disadvantages. First, functional integration of a nucleotide sequence into the cellular genome is not only a rare event, but given the random nature of nucleotide sequence integration, these rare events can lead to a wide variety of gene expression and cell growth phenotypes. This type of variation, known as "position effect variation," stems, at least in part, from the complex gene regulatory networks present in eukaryotic cell genomes and the accessibility of certain genomic loci for integration and gene expression. Second, random integration strategies generally fail to provide control over the number of nucleotide sequence copies integrated into the cellular genome. In fact, gene amplification methods are often employed to obtain high-yield cells. However, such gene amplification can also lead to undesirable cellular phenotypes, such as unstable cell growth and / or product expression. Third, due to the inherent heterogeneity of integration loci during random integration, screening thousands of cells after transfection to isolate recombinant cells that exhibit the desired expression levels of the polypeptide of interest is both time-consuming and labor-intensive. Even after isolating such cells, stable expression of the polypeptide of interest cannot be guaranteed, and further screening may be required to obtain stable commercial production cells. Fourth, polypeptides produced by cells obtained by random integration exhibit a high degree of sequence variation, which may be due in part to the mutagenicity of the selective agents used to select for high levels of polypeptide expression. Finally, the greater the complexity of the polypeptide to be produced—that is, the greater the number of different polypeptides or polypeptide chains required to form the polypeptide of interest within the cell—the more important it is to control the expression ratio of the different polypeptides or polypeptide chains to each other. This expression ratio needs to be controlled so that the polypeptide of interest is efficiently expressed, correctly assembled, and successfully secreted at high expression yields.

[0004] Targeted integration by recombinase-mediated cassette exchange (RMCE) is a method to specifically and efficiently direct foreign DNA to a predetermined site in the eukaryotic host genome (Turan et al., J. Mol. Biol. 407 (2011) 193-221).

[0005] WO 2006 / 007850 discloses anti-Rhesus D recombinant polyclonal antibodies and methods of production using site-specific integration into the genome of individual host cells.

[0006] Crawford, Y. et al. (Biotechnol. Prog. 29 (2013) 1307-1315) reported the use of a combination of phiC31 integrase and CRE-Lox technology to rapidly identify authentic hosts for target cell line development from limited genomic screens.

[0007] WO 2013 / 006142 discloses a nearly homogeneous population of genetically altered eukaryotic cells having stably incorporated into their genome a donor cassette comprising a strong polyadenylation site operably linked to an isolated nucleic acid fragment comprising a targeting nucleic acid site and a selectable marker protein coding sequence, wherein the isolated nucleic acid fragment is flanked by a first recombination site and a different second recombination site.

[0008] WO 2018 / 162517 discloses that depending on i) the expression cassette sequence and ii) the distribution of the expression cassette between different expression vectors, high variations in expression yield and product quality were observed.

[0009] Tadauchi, T., et al. disclosed the use of a regulated targeted integration cell line construction method to systematically study what makes antibodies difficult to express (Biotechnol. Prog. 35 (2019) No. 2, 1-11).

[0010] WO 2016 / 079076 discloses T cell activating bispecific antigen binding molecules for FolR1 and CD3. In Example 29, transient transfection was used to generate a bispecific FolR1 / CD3-κ-λ antibody, and the plasmid ratio of the three expression vectors was 1:1:1. In Example 36, DP47 GS TCB was prepared by co-transfection of HEK293-EBNA cells, with the corresponding expression vectors in a ratio of 1:2:1:1 ("vector heavy chain Fc (hole)":"vector light chain":"vector light chain CrossFab":"vector heavy chain Fc (knob)-Fab CrossFab").

[0011] WO 2014 / 033074 discloses a blood-brain barrier shuttle. In Example 2, it is disclosed that three expression plasmids with equimolar plasmid ratios were used during transfection to transiently produce trivalent MAb31-scFab (8D3).

[0012] WO 2017 / 184831 purportedly discloses methods for site-specific integration and expression of recombinant proteins in eukaryotic cells, particularly by utilizing expression-enhancing loci to improve the expression of antibodies, including bispecific antibodies, in eukaryotic cells, particularly Chinese hamster (Coleoptera: Cinerea grisea) cell lines. The data in this document are presented in an anonymized format, so no conclusions can be drawn about the actual results. When Cre recombinase is used, it is co-transfected with another plasmid, but the composition or origin of this plasmid is not described.

[0013] Rajendra, Y. et al. disclosed that a single quadruple vector is a simple and efficient alternative for generating stable CHO cell lines and can facilitate the generation of cell lines for heterologous mAb therapy for clinical use (Biotechnol. Prog. 33 (2017) 469-477).

[0014] Gurumurthy, CB and Kent Lloyd, KC disclose mouse models for biomedical research (Dis. Mod. Mech. 12 (2019)). They discuss how conventional gene targeting by homologous recombination in embryonic stem cells has given way to more sophisticated methods that enable allele-specific manipulation in fertilized eggs.

[0015] Bahr, S. et al. disclosed the construction of a platform expression system using targeted integration in Chinese hamster ovary cells (Proceedings of Cell Culture Engineering XVI, 2018).

[0016] WO 2017 / 060144 discloses a tetravalent bispecific antibody against co-stimulatory TNF receptors. WO 2019 / 086497 discloses a combination therapy using an OX40-targeted agonist. Summary of the Invention

[0017] Trivalent bispecific antibodies:

[0018] This article reports a recombinant mammalian cell that expresses a trivalent bispecific antibody, especially a bivalent monospecific antibody, which contains an additional scFv or Fab fragment at one C-terminus of one of its heavy chains. Trivalent bispecific antibodies are heterologous multimeric polypeptides that are non-naturally expressed by the mammalian cells. More specifically, trivalent bispecific antibodies are heterologous multimeric proteins comprising four polypeptides: a light chain that is a full-length light chain; another light chain that is a domain-swapped light chain; a heavy chain that is a full-length heavy chain; and another heavy chain that is an extended heavy chain that contains an additional domain-swapped heavy chain or light chain Fab fragment at its C-terminus. In order to achieve the expression of trivalent bispecific antibodies, a recombinant nucleic acid containing multiple different expression cassettes in specific and defined sequences has been integrated into the genome of the mammalian cell.

[0019] In particular, the methods according to the present invention can be used to generate brain-shuttling antibodies. These brain-shuttling antibodies can have a format such as that described in WO 2014 / 033074. These molecules can simultaneously bind to the human transferrin receptor (first specificity) on blood-brain barrier cells and to a target therapeutic antigen (second specificity), thereby inducing transport and a therapeutic effect.

[0020] Also reported herein is a method for producing recombinant mammalian cells expressing a trivalent bispecific antibody, and a method for producing a trivalent bispecific antibody using the recombinant mammalian cells.

[0021] In a preferred embodiment, the trivalent bispecific antibody comprises

[0022] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, a peptide linker, a second heavy chain variable domain and a CL domain,

[0023] a second heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0024] - a first light chain comprising, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[0025] - a second light chain, which comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0026] wherein the second heavy chain variable domain and the first light chain variable domain form a first binding site, and the first heavy chain variable domain and the second light chain variable domain form a second binding site,

[0027] The first binding site specifically binds to the human transferrin receptor.

[0028] In a preferred embodiment, the trivalent bispecific antibody comprises

[0029] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, a peptide linker, a first light chain variable domain and a CH1 domain,

[0030] a second heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0031] - a first light chain comprising, from N-terminus to C-terminus, a second light chain variable domain and a CH1 domain, and

[0032] a second light chain comprising, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain,

[0033] wherein the second heavy chain variable domain and the first light chain variable domain form a first binding site, and the first heavy chain variable domain and the second light chain variable domain form a second binding site,

[0034] The first binding site specifically binds to the human transferrin receptor.

[0035] In a preferred embodiment, neither the first light chain nor the second light chain of the trivalent bispecific antibody is a common light chain or a universal light chain.

[0036] The present invention is based at least in part on the discovery that the sequences of the different expression cassettes required for expression of heteromultimeric trivalent bispecific antibodies, i.e., the organization of the expression cassettes, influence the expression yield of the trivalent bispecific antibodies (e.g., brain-shuttling antibodies) when integrated into the genome of mammalian cells.

[0037] The present invention is based, at least in part, on the discovery that efficient recombinant expression and production of trivalent bispecific antibodies (e.g., brain-shuttling antibodies) can be achieved by integrating nucleic acids encoding heteromultimeric trivalent bispecific antibodies organized in a specific expression cassette into the genome of mammalian cells.

[0038] It has been found that defined expression cassette sequences can be advantageously integrated into the genome of mammalian cells by a dual recombinase-mediated cassette exchange reaction.

[0039] According to one aspect of the present invention is a method for producing a trivalent bispecific antibody, the method comprising the following steps:

[0040] a) optionally culturing a mammalian cell comprising a deoxyribonucleic acid encoding the trivalent bispecific antibody under conditions suitable for expression of the trivalent bispecific antibody, and

[0041] b) recovering the multispecific antibody from the cells or culture medium,

[0042] wherein the deoxyribonucleic acid encoding the trivalent bispecific antibody is stably integrated into the genome of the mammalian cell and comprises in the 5' to 3' direction (1)

[0044] - a first expression cassette encoding a first heavy chain,

[0045] - a second expression cassette encoding the first heavy chain,

[0046] - a third expression cassette encoding the first light chain,

[0047] - a fourth expression cassette encoding the first light chain,

[0048] - a fifth expression cassette encoding the second heavy chain,

[0049] - a sixth expression cassette encoding the first light chain,

[0050] - a seventh expression cassette encoding the second light chain, and

[0051] - an eighth expression cassette encoding the second light chain,

[0052] or (2)

[0053] - a first expression cassette encoding a first heavy chain,

[0054] - a second expression cassette encoding the first heavy chain,

[0055] - a third expression cassette encoding the first light chain,

[0056] - a fourth expression cassette encoding the first light chain,

[0057] - a fifth expression cassette encoding the second heavy chain,

[0058] - a sixth expression cassette encoding the second heavy chain,

[0059] - a seventh expression cassette encoding the second light chain, and

[0060] - an eighth expression cassette encoding the second light chain,

[0061] or (3)

[0062] - a first expression cassette encoding a first heavy chain,

[0063] - a second expression cassette encoding the first heavy chain,

[0064] - a third expression cassette encoding the first light chain,

[0065] - a fourth expression cassette encoding the first light chain,

[0066] - a fifth expression cassette encoding the second heavy chain,

[0067] - a sixth expression cassette encoding the first light chain, and

[0068] - a seventh expression cassette encoding the first light chain.

[0069] In one embodiment, one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0070] One aspect of the present invention is a deoxyribonucleic acid encoding a trivalent bispecific antibody comprising in the 5' to 3' direction (1)

[0072] - a first expression cassette encoding a first heavy chain,

[0073] - a second expression cassette encoding the first heavy chain,

[0074] - a third expression cassette encoding the first light chain,

[0075] - a fourth expression cassette encoding the first light chain,

[0076] - a fifth expression cassette encoding the second heavy chain,

[0077] - a sixth expression cassette encoding the first light chain,

[0078] - a seventh expression cassette encoding the second light chain, and

[0079] - an eighth expression cassette encoding the second light chain,

[0080] or (2)

[0081] - a first expression cassette encoding a first heavy chain,

[0082] - a second expression cassette encoding the first heavy chain,

[0083] - a third expression cassette encoding the first light chain,

[0084] - a fourth expression cassette encoding the first light chain,

[0085] - a fifth expression cassette encoding the second heavy chain,

[0086] - a sixth expression cassette encoding the second heavy chain,

[0087] - a seventh expression cassette encoding the second light chain, and

[0088] - an eighth expression cassette encoding the second light chain,

[0089] or (3)

[0090] - a first expression cassette encoding a first heavy chain,

[0091] - a second expression cassette encoding the first heavy chain,

[0092] - a third expression cassette encoding the first light chain,

[0093] - a fourth expression cassette encoding the first light chain,

[0094] - a fifth expression cassette encoding the second heavy chain,

[0095] - a sixth expression cassette encoding the first light chain, and

[0096] - a seventh expression cassette encoding the first light chain.

[0097] One aspect of the present invention is the use of a deoxyribonucleic acid comprising in the 5' to 3' direction a trivalent bispecific antibody for expressing in a mammalian cell (1)

[0099] - a first expression cassette encoding a first heavy chain,

[0100] - a second expression cassette encoding the first heavy chain,

[0101] - a third expression cassette encoding the first light chain,

[0102] - a fourth expression cassette encoding the first light chain,

[0103] - a fifth expression cassette encoding the second heavy chain,

[0104] - a sixth expression cassette encoding the first light chain,

[0105] - a seventh expression cassette encoding the second light chain, and

[0106] - an eighth expression cassette encoding the second light chain,

[0107] or (2)

[0108] - a first expression cassette encoding a first heavy chain,

[0109] - a second expression cassette encoding the first heavy chain,

[0110] - a third expression cassette encoding the first light chain,

[0111] - a fourth expression cassette encoding the first light chain,

[0112] - a fifth expression cassette encoding the second heavy chain,

[0113] - a sixth expression cassette encoding the second heavy chain,

[0114] - a seventh expression cassette encoding the second light chain, and

[0115] - an eighth expression cassette encoding the second light chain,

[0116] or (3)

[0117] - a first expression cassette encoding a first heavy chain,

[0118] - a second expression cassette encoding the first heavy chain,

[0119] - a third expression cassette encoding the first light chain,

[0120] - a fourth expression cassette encoding the first light chain,

[0121] - a fifth expression cassette encoding the second heavy chain,

[0122] - a sixth expression cassette encoding the first light chain, and

[0123] - a seventh expression cassette encoding the first light chain.

[0124] In one embodiment of this use, the deoxyribonucleic acid is integrated into the genome of the mammalian cell.

[0125] In one embodiment of use, exactly one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0126] One aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent bispecific antibody integrated into the genome of the cell.

[0127] The deoxyribonucleic acid encoding the trivalent bispecific antibody comprises in the 5' to 3' direction (1)

[0129] - a first expression cassette encoding a first heavy chain,

[0130] - a second expression cassette encoding the first heavy chain,

[0131] - a third expression cassette encoding the first light chain,

[0132] - a fourth expression cassette encoding the first light chain,

[0133] - a fifth expression cassette encoding the second heavy chain,

[0134] - a sixth expression cassette encoding the first light chain,

[0135] - a seventh expression cassette encoding the second light chain, and

[0136] - an eighth expression cassette encoding the second light chain,

[0137] or (2)

[0138] - a first expression cassette encoding a first heavy chain,

[0139] - a second expression cassette encoding the first heavy chain,

[0140] - a third expression cassette encoding the first light chain,

[0141] - a fourth expression cassette encoding the first light chain,

[0142] - a fifth expression cassette encoding the second heavy chain,

[0143] - a sixth expression cassette encoding the second heavy chain,

[0144] - a seventh expression cassette encoding the second light chain, and

[0145] - an eighth expression cassette encoding the second light chain,

[0146] or (3)

[0147] - a first expression cassette encoding a first heavy chain,

[0148] - a second expression cassette encoding the first heavy chain,

[0149] - a third expression cassette encoding the first light chain,

[0150] - a fourth expression cassette encoding the first light chain,

[0151] - a fifth expression cassette encoding the second heavy chain,

[0152] - a sixth expression cassette encoding the first light chain, and

[0153] - a seventh expression cassette encoding the first light chain.

[0154] In one embodiment, one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0155] In one embodiment of all of the aforementioned aspects, the deoxyribonucleic acid encoding the trivalent, bispecific antibody further comprises

[0156] - a first recombination recognition sequence located 5' of said first (most 5') expression cassette,

[0157] - a second recombination recognition sequence located 3' to the seventh or eighth (most 3') expression cassette, and

[0158] - a third recombination recognition sequence located at

[0159] - between the first recombination recognition sequence and the second recombination recognition sequence, and

[0160] - between two of the expression cassettes,

[0161] and

[0162] All recombination recognition sequences are different.

[0163] In one embodiment, the third recombination recognition sequence is located between the fourth expression cassette and the fifth expression cassette.

[0164] In one embodiment, the deoxyribonucleic acid encoding the trivalent bispecific antibody comprises an additional expression cassette encoding a selection marker, and the expression cassette encoding the selection marker is located partially 5' and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises the coding sequence without the start codon and a poly A signal, wherein the start codon is operably linked to the coding sequence.

[0165] One aspect of the present invention is a composition comprising two deoxyribonucleic acids, which in turn comprises three different recombination recognition sequences and seven or eight expression cassettes, wherein

[0166] - the first deoxyribonucleic acid comprises in the 5' to 3' direction

[0167] - a first recombination recognition sequence,

[0168] - a first expression cassette encoding a first heavy chain,

[0169] - a second expression cassette encoding the first heavy chain,

[0170] - a third expression cassette encoding the first light chain,

[0171] - a fourth expression cassette encoding the first light chain, and

[0172] - a first copy of the third recombination recognition sequence,

[0173] and

[0174] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0176] - a second copy of the third recombination recognition sequence,

[0177] - a fifth expression cassette encoding the second heavy chain,

[0178] - a sixth expression cassette encoding the first light chain,

[0179] - a seventh expression cassette encoding the second light chain,

[0180] - an eighth expression cassette encoding the second light chain, and

[0181] - a second recombination recognition sequence,

[0182] or (2)

[0183] - a second copy of the third recombination recognition sequence,

[0184] - a fifth expression cassette encoding the second heavy chain,

[0185] - a sixth expression cassette encoding the second heavy chain,

[0186] - a seventh expression cassette encoding the second light chain,

[0187] - an eighth expression cassette encoding the second light chain, and

[0188] - a second recombination recognition sequence,

[0189] or (3)

[0190] - a second copy of the third recombination recognition sequence,

[0191] - a fifth expression cassette encoding the second heavy chain,

[0192] - a sixth expression cassette encoding the first light chain,

[0193] - a seventh expression cassette encoding the first light chain, and

[0194] - a second recombination recognition sequence.

[0195] In one embodiment of all the aforementioned aspects the deoxyribonucleic acid encoding the trivalent, bispecific antibody further comprises an additional expression cassette encoding a selectable marker.

[0196] In one embodiment, the expression cassette encoding the selection marker is located relative to the third recombination recognition sequence.

[0197] i) located at 5', or

[0198] ii) located 3', or

[0199] iii) partially located 5' and partially located 3'.

[0200] In one embodiment, the expression cassette encoding the selection marker is partially located 5' of the third recombination recognition sequence and partially located 3' of the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises a coding sequence without a start codon and a poly A signal.

[0201] In one embodiment, the 5' portion of the expression cassette encoding the selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by a fourth expression cassette (i.e., positioned downstream of the fourth expression cassette) and the start codon is flanked downstream by a third recombination recognition sequence (i.e., positioned upstream of the third recombination recognition sequence); and the 3' portion of the expression cassette encoding the selection marker comprises a nucleic acid encoding a selection marker lacking a start codon and is flanked upstream by the third recombination recognition sequence and downstream by a fifth expression cassette.

[0202] In one embodiment, the start codon is a translation start codon. In one embodiment, the start codon is ATG.

[0203] One aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent bispecific antibody integrated into the genome of the cell.

[0204] The deoxyribonucleic acid encoding the trivalent bispecific antibody comprises the following elements:

[0205] a first recombination recognition sequence, a second recombination recognition sequence and a third recombination recognition sequence,

[0206] a first selection marker and a second selection marker, and

[0207] The first expression cassette to the eighth expression cassette,

[0208] The sequence of the element in the 5' to 3' direction is

[0209] RRS1-1 st EC-2 nd EC-3 rd EC-4 th EC-RRS3-SM1-5 th EC-6 th EC-7 th EC-8 th EC-RRS2

[0210] or

[0211] RRS1-1 st EC-2 nd EC-3 rd EC-4 th EC-RRS3-SM1-5 th EC-6 th EC-7 th EC-RRS2

[0212] in

[0213] RRS = Recombination Recognition Sequence,

[0214] EC = expression cassette,

[0215] SM = selection marker.

[0216] One aspect of the present invention is a method for producing a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent bispecific antibody and secreting the trivalent bispecific antibody, the method comprising the following steps:

[0217] a) providing a mammalian cell comprising an exogenous nucleotide sequence integrated at a single site within a locus of the genome of the mammalian cell, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all of the recombination recognition sequences are different;

[0218] b) introducing into the cell provided in a) a composition of two deoxyribonucleic acids, the composition comprising three different recombination recognition sequences and seven or eight expression cassettes, wherein

[0219] - the first deoxyribonucleic acid comprises in the 5' to 3' direction

[0220] - a first recombination recognition sequence,

[0221] - a first expression cassette encoding a first heavy chain,

[0222] - a second expression cassette encoding the first heavy chain,

[0223] - a third expression cassette encoding the first light chain,

[0224] - a fourth expression cassette encoding the first light chain, and

[0225] - a first copy of the third recombination recognition sequence,

[0226] and

[0227] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0229] - a second copy of the third recombination recognition sequence,

[0230] - a fifth expression cassette encoding the second heavy chain,

[0231] - a sixth expression cassette encoding the first light chain,

[0232] - a seventh expression cassette encoding the second light chain,

[0233] - an eighth expression cassette encoding the second light chain, and

[0234] - a second recombination recognition sequence,

[0235] or (2)

[0236] - a second copy of the third recombination recognition sequence,

[0237] - a fifth expression cassette encoding the second heavy chain,

[0238] - a sixth expression cassette encoding the second heavy chain,

[0239] - a seventh expression cassette encoding the second light chain,

[0240] - an eighth expression cassette encoding the second light chain, and

[0241] - a second recombination recognition sequence,

[0242] or (3)

[0243] - a second copy of the third recombination recognition sequence,

[0244] - a fifth expression cassette encoding the second heavy chain,

[0245] - a sixth expression cassette encoding the first light chain,

[0246] - a seventh expression cassette encoding the first light chain, and

[0247] - a second recombination recognition sequence,

[0248] wherein the first to the third recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid match the first to the third recombination recognition sequences on the integrated exogenous nucleotide sequence,

[0249] wherein the 5' terminal portion and the 3' terminal portion of the expression cassette encoding one second selection marker when taken together form a functional expression cassette for said one second selection marker;

[0250] c) Introduction

[0251] i) is introduced simultaneously with the first deoxyribonucleic acid and the second deoxyribonucleic acid of b); or

[0252] ii) subsequently introduced

[0253] one or more recombinases,

[0254] wherein the one or more recombinases recognize the recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid; (and optionally wherein the one or more recombinases perform two recombinase-mediated cassette exchanges;)

[0255] as well as

[0256] d) selecting cells that express the second selection marker and secrete the trivalent bispecific antibody,

[0257] This generates recombinant mammalian cells that contain deoxyribonucleic acid encoding the trivalent bispecific antibody and secrete the trivalent bispecific antibody.

[0258] In a preferred embodiment of all aspects and embodiments, the first binding site specifically binds to human transferrin receptor.

[0259] In one embodiment of all aspects and embodiments, the trivalent bispecific antibody is an anti-TfR / CD20 bispecific antibody. Such antibodies are reported in WO 2017 / 055542, which is incorporated herein by reference in its entirety.

[0260] In one embodiment of all aspects and embodiments, the trivalent bispecific antibody is an anti-TfR / Aβ bispecific antibody. Such antibodies are reported in WO 2017 / 055540, which is incorporated herein by reference in its entirety.

[0261] Bispecific trivalent antibodies:

[0262] This article reports a recombinant mammalian cell that expresses trivalent antibodies (especially bispecific, trivalent antibodies), such as T cell bispecific antibodies (TCBs). Trivalent antibodies are heterogeneous multimeric polypeptides that are non-naturally expressed by the mammalian cells. More specifically, trivalent antibodies are heterogeneous multimeric proteins composed of four polypeptides or polypeptide chains: a light chain that is a full-length light chain; another light chain that is a domain-exchanged light chain; a heavy chain that is a full-length heavy chain; and another heavy chain that is an extended heavy chain containing an additional domain-exchanged heavy chain or a light chain Fab fragment. In order to achieve the expression of trivalent antibodies, a recombinant nucleic acid containing multiple different expression cassettes in a specific and defined sequence has been integrated into the genome of the mammalian cell.

[0263] In particular, the methods according to the present invention can be used to generate T cell bispecific antibodies (TCBs). These brain-binding antibodies can have a format such as that described in WO 2013 / 026831. These molecules can simultaneously bind to CD3 on T cells (a first specificity) and an antigen on a target (e.g., tumor) cell (a second specificity), thereby inducing killing of the target cell.

[0264] Also reported herein is a method for producing recombinant mammalian cells expressing trivalent antibodies, particularly trivalent bispecific antibodies, more particularly TCBs, and a method for producing trivalent antibodies, particularly trivalent, bispecific antibodies, more particularly TCBs, using said recombinant mammalian cells.

[0265] In a preferred embodiment, the bispecific trivalent antibody comprises

[0266] a) a first Fab fragment and a second Fab fragment, each binding to a first antigen,

[0267] b) a domain-exchange Fab fragment that specifically binds to a second antigen, in which the CH1 domain and the CL domain are exchanged with each other,

[0268] c) an Fc-region comprising a first heavy chain Fc-region polypeptide and a second heavy chain Fc-region polypeptide,

[0269] wherein the C-terminus of the CH1 domain of the first Fab fragment is linked to the N-terminus of one of the heavy chain Fc region polypeptides, and the C-terminus of the CL domain of the domain-swapped Fab fragment is linked to the N-terminus of the other heavy chain Fc region polypeptide, and

[0270] wherein the C-terminus of the CH1 domain of the second Fab fragment is linked to the N-terminus of the VH domain of the first Fab fragment, or to the N-terminus of the VH domain of the domain-swapped Fab fragment, and

[0271] The first antigen or the second antigen is human CD3.

[0272] In a preferred embodiment, the bispecific trivalent antibody comprises

[0273] a) a first Fab fragment and a second Fab fragment, each binding to a first antigen,

[0274] b) a domain-exchange Fab fragment that specifically binds to a second antigen, in which the VH domain and the VL domain are exchanged with each other,

[0275] c) an Fc-region comprising a first heavy chain Fc-region polypeptide and a second heavy chain Fc-region polypeptide,

[0276] wherein the C-terminus of the CH1 domain of the first Fab fragment is linked to the N-terminus of one of the heavy chain Fc region polypeptides, and the C-terminus of the CH1 domain of the domain-swapped Fab fragment is linked to the N-terminus of the other heavy chain Fc region polypeptide, and

[0277] wherein the C-terminus of the CH1 domain of the second Fab fragment is linked to the N-terminus of the VH domain of the first Fab fragment, or to the N-terminus of the VL domain of the domain-swapped Fab fragment, and

[0278] The first antigen or the second antigen is human CD3.

[0279] In a preferred embodiment, neither the first light chain nor the second light chain of the trivalent bispecific antibody is a common light chain or a universal light chain.

[0280] The present invention is based, at least in part, on the discovery that the sequences of the different expression cassettes required for expression of heteromultimeric trivalent antibodies, i.e., the organization of the expression cassettes, influence the expression yield of the trivalent antibody (eg, TCB) when integrated into the genome of a mammalian cell.

[0281] The present invention is based, at least in part, on the discovery that efficient recombinant expression and production of trivalent antibodies (e.g., TCBs) can be achieved by integrating nucleic acids encoding heteromultimeric trivalent antibodies (e.g., TCBs) organized in a specific expression cassette into the genome of mammalian cells.

[0282] It has been found that defined expression cassette sequences can be advantageously integrated into the genome of mammalian cells by a dual recombinase-mediated cassette exchange reaction.

[0283] According to one aspect of the present invention, there is a method for producing a trivalent antibody (e.g., TCB), the method comprising the following steps:

[0284] a) optionally culturing a mammalian cell comprising a deoxyribonucleic acid encoding a trivalent antibody (eg, TCB) under conditions suitable for expression of the trivalent antibody (eg, TCB), and

[0285] b) recovering the trivalent antibody (e.g., TCB) from the cells or culture medium,

[0286] wherein the deoxyribonucleic acid encoding the trivalent antibody (eg, TCB) is stably integrated into the genome of a mammalian cell and comprises in the 5' to 3' direction

[0287] or 1)

[0289] - a first expression cassette encoding a first heavy chain,

[0290] - a second expression cassette encoding the first light chain,

[0291] - a third expression cassette encoding the first light chain,

[0292] - a fourth expression cassette encoding the second heavy chain,

[0293] - a fifth expression cassette encoding the second light chain, and

[0294] - optionally a sixth expression cassette encoding a second light chain,

[0295] or 2)

[0297] - a first expression cassette encoding a first light chain,

[0298] - a second expression cassette encoding the first light chain,

[0299] - a third expression cassette encoding the first heavy chain,

[0300] - a fourth expression cassette encoding the second heavy chain,

[0301] - a fifth expression cassette encoding the second light chain, and

[0302] - a sixth expression cassette encoding the second light chain,

[0303] The first expression cassette to the third expression cassette are arranged in one direction, and the fourth expression cassette to the sixth expression cassette are arranged in one direction and in the opposite direction from the first expression cassette to the third expression cassette;

[0304] or 3)

[0306] - a first expression cassette encoding a first heavy chain,

[0307] - a second expression cassette encoding the first light chain,

[0308] - a third expression cassette encoding the second light chain,

[0309] - a fourth expression cassette encoding the second heavy chain,

[0310] - a fifth expression cassette encoding the second light chain, and

[0311] - a sixth expression cassette encoding the first light chain,

[0312] or

[0313] - a first expression cassette encoding a first heavy chain,

[0314] - a second expression cassette encoding the first light chain,

[0315] - a third expression cassette encoding the second light chain,

[0316] - a fourth expression cassette encoding the second heavy chain,

[0317] - a fifth expression cassette encoding the second light chain, and

[0318] - a sixth expression cassette encoding the second light chain.

[0319] In a preferred embodiment, the first heavy chain comprises the mutation T366W in the CH3 domain (according to Kabat numbering), and the second heavy chain comprises the mutations T366S, L368A and Y407V in the CH3 domain, or vice versa (according to Kabat numbering). In one embodiment, one of the heavy chains further comprises the mutation S354C, and the corresponding other heavy chain comprises the mutation Y349C (according to Kabat numbering). In one embodiment, the first heavy chain is an extended heavy chain comprising an additional domain-swapped Fab fragment. In one embodiment, the first light chain is a domain-swapped light chain.

[0320] In one embodiment, the deoxyribonucleic acid comprises an additional expression cassette between the first expression cassette and the second expression cassette encoding the second heavy chain.

[0321] In one embodiment

[0322] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0323] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0324] - the first light chain comprises, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[0325] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0326] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0327] In one embodiment

[0328] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[0329] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0330] - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[0331] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0332] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0333] In one embodiment, the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0334] One aspect of the present invention is a deoxyribonucleic acid encoding a trivalent antibody (eg, TCB) comprising in the 5' to 3' direction

[0335] or 1)

[0337] - a first expression cassette encoding a first heavy chain,

[0338] - a second expression cassette encoding the first light chain,

[0339] - a third expression cassette encoding the first light chain,

[0340] - a fourth expression cassette encoding the second heavy chain,

[0341] - a fifth expression cassette encoding the second light chain, and

[0342] - optionally a sixth expression cassette encoding a second light chain,

[0343] or 2)

[0345] - a first expression cassette encoding a first light chain,

[0346] - a second expression cassette encoding the first light chain,

[0347] - a third expression cassette encoding the first heavy chain,

[0348] - a fourth expression cassette encoding the second heavy chain,

[0349] - a fifth expression cassette encoding the second light chain, and

[0350] - a sixth expression cassette encoding the second light chain,

[0351] The first expression cassette to the third expression cassette are arranged in one direction, and the fourth expression cassette to the sixth expression cassette are arranged in one direction and in the opposite direction from the first expression cassette to the third expression cassette;

[0352] or 3)

[0354] - a first expression cassette encoding a first heavy chain,

[0355] - a second expression cassette encoding the first light chain,

[0356] - a third expression cassette encoding the second light chain,

[0357] - a fourth expression cassette encoding the second heavy chain,

[0358] - a fifth expression cassette encoding the second light chain, and

[0359] - a sixth expression cassette encoding the first light chain,

[0360] or

[0361] - a first expression cassette encoding a first heavy chain,

[0362] - a second expression cassette encoding the first light chain,

[0363] - a third expression cassette encoding the second light chain,

[0364] - a fourth expression cassette encoding the second heavy chain,

[0365] - a fifth expression cassette encoding the second light chain, and

[0366] - a sixth expression cassette encoding the second light chain.

[0367] In a preferred embodiment, the first heavy chain comprises the mutation T366W in the CH3 domain (according to Kabat numbering), and the second heavy chain comprises the mutations T366S, L368A and Y407V in the CH3 domain, or vice versa (according to Kabat numbering). In one embodiment, one of the heavy chains further comprises the mutation S354C, and the corresponding other heavy chain comprises the mutation Y349C (according to Kabat numbering). In one embodiment, the first heavy chain is an extended heavy chain comprising an additional domain-swapped Fab fragment. In one embodiment, the first light chain is a domain-swapped light chain.

[0368] In one embodiment, the deoxyribonucleic acid comprises an additional expression cassette between the first expression cassette and the second expression cassette encoding the second heavy chain.

[0369] In one embodiment

[0370] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0371] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0372] - the first light chain comprises, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[0373] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0374] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0375] In one embodiment

[0376] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[0377] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0378] - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[0379] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0380] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0381] One aspect of the present invention is the use of a deoxyribonucleic acid comprising in the 5' to 3' direction a trivalent antibody (eg TCB) for expressing in a mammalian cell

[0382] or 1)

[0384] - a first expression cassette encoding a first heavy chain,

[0385] - a second expression cassette encoding the first light chain,

[0386] - a third expression cassette encoding the first light chain,

[0387] - a fourth expression cassette encoding the second heavy chain,

[0388] - a fifth expression cassette encoding the second light chain, and

[0389] - optionally a sixth expression cassette encoding a second light chain,

[0390] or 2)

[0392] - a first expression cassette encoding a first light chain,

[0393] - a second expression cassette encoding the first light chain,

[0394] - a third expression cassette encoding the first heavy chain,

[0395] - a fourth expression cassette encoding the second heavy chain,

[0396] - a fifth expression cassette encoding the second light chain, and

[0397] - a sixth expression cassette encoding the second light chain,

[0398] The first expression cassette to the third expression cassette are arranged in one direction, and the fourth expression cassette to the sixth expression cassette are arranged in one direction and in the opposite direction from the first expression cassette to the third expression cassette;

[0399] or 3)

[0401] - a first expression cassette encoding a first heavy chain,

[0402] - a second expression cassette encoding the first light chain,

[0403] - a third expression cassette encoding the second light chain,

[0404] - a fourth expression cassette encoding the second heavy chain,

[0405] - a fifth expression cassette encoding the second light chain, and

[0406] - a sixth expression cassette encoding the first light chain,

[0407] or

[0408] - a first expression cassette encoding a first heavy chain,

[0409] - a second expression cassette encoding the first light chain,

[0410] - a third expression cassette encoding the second light chain,

[0411] - a fourth expression cassette encoding the second heavy chain,

[0412] - a fifth expression cassette encoding the second light chain, and

[0413] - a sixth expression cassette encoding the second light chain.

[0414] In a preferred embodiment, the first heavy chain comprises the mutation T366W in the CH3 domain (according to Kabat numbering), and the second heavy chain comprises the mutations T366S, L368A and Y407V in the CH3 domain, or vice versa (according to Kabat numbering). In one embodiment, one of the heavy chains further comprises the mutation S354C, and the corresponding other heavy chain comprises the mutation Y349C (according to Kabat numbering). In one embodiment, the first heavy chain is an extended heavy chain comprising an additional domain-swapped Fab fragment. In one embodiment, the first light chain is a domain-swapped light chain.

[0415] In one embodiment, the deoxyribonucleic acid comprises an additional expression cassette between the first expression cassette and the second expression cassette encoding the second heavy chain.

[0416] In one embodiment

[0417] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0418] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0419] - the first light chain comprises, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[0420] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0421] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0422] In one embodiment

[0423] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[0424] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0425] - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[0426] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0427] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0428] In one embodiment of this use, the deoxyribonucleic acid is integrated into the genome of the mammalian cell.

[0429] In one embodiment of this use, the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0430] One aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent antibody (e.g., TCB) integrated into the genome of the cell.

[0431] Wherein, the deoxyribonucleic acid encoding the trivalent antibody (eg, TCB) comprises in the 5' to 3' direction

[0432] or 1)

[0434] - a first expression cassette encoding a first heavy chain,

[0435] - a second expression cassette encoding the first light chain,

[0436] - a third expression cassette encoding the first light chain,

[0437] - a fourth expression cassette encoding the second heavy chain,

[0438] - a fifth expression cassette encoding the second light chain, and

[0439] - optionally a sixth expression cassette encoding a second light chain,

[0440] or 2)

[0442] - a first expression cassette encoding a first light chain,

[0443] - a second expression cassette encoding the first light chain,

[0444] - a third expression cassette encoding the first heavy chain,

[0445] - a fourth expression cassette encoding the second heavy chain,

[0446] - a fifth expression cassette encoding the second light chain, and

[0447] - a sixth expression cassette encoding the second light chain,

[0448] The first expression cassette to the third expression cassette are arranged in one direction, and the fourth expression cassette to the sixth expression cassette are arranged in one direction and in the opposite direction from the first expression cassette to the third expression cassette;

[0449] or 3)

[0451] - a first expression cassette encoding a first heavy chain,

[0452] - a second expression cassette encoding the first light chain,

[0453] - a third expression cassette encoding the second light chain,

[0454] - a fourth expression cassette encoding the second heavy chain,

[0455] - a fifth expression cassette encoding the second light chain, and

[0456] - a sixth expression cassette encoding the first light chain,

[0457] or

[0458] - a first expression cassette encoding a first heavy chain,

[0459] - a second expression cassette encoding the first light chain,

[0460] - a third expression cassette encoding the second light chain,

[0461] - a fourth expression cassette encoding the second heavy chain,

[0462] - a fifth expression cassette encoding the second light chain, and

[0463] - a sixth expression cassette encoding the second light chain.

[0464] In a preferred embodiment, the first heavy chain comprises the mutation T366W in the CH3 domain (according to Kabat numbering), and the second heavy chain comprises the mutations T366S, L368A and Y407V in the CH3 domain, or vice versa (according to Kabat numbering). In one embodiment, one of the heavy chains further comprises the mutation S354C, and the corresponding other heavy chain comprises the mutation Y349C (according to Kabat numbering). In one embodiment, the first heavy chain is an extended heavy chain comprising an additional domain-swapped Fab fragment. In one embodiment, the first light chain is a domain-swapped light chain.

[0465] In one embodiment, the deoxyribonucleic acid comprises an additional expression cassette between the first expression cassette and the second expression cassette encoding the second heavy chain.

[0466] In one embodiment of all of the foregoing aspects and embodiments,

[0467] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0468] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0469] - the first light chain comprises, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[0470] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0471] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0472] In one embodiment of all of the foregoing aspects and embodiments,

[0473] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[0474] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0475] - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[0476] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0477] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0478] In one embodiment, the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0479] In one embodiment of all of the aforementioned aspects and embodiments, the deoxyribonucleic acid encoding the trivalent antibody (e.g., TCB) further comprises

[0480] - a first recombination recognition sequence located 5' of said first (most 5') expression cassette,

[0481] - a second recombination recognition sequence located 3' to the sixth (most 3') expression cassette, and

[0482] - a third recombination recognition sequence located at

[0483] - between the first recombination recognition sequence and the second recombination recognition sequence, and

[0484] - between two of the expression cassettes,

[0485] and

[0486] All recombination recognition sequences are different.

[0487] In one embodiment of all of the aforementioned aspects and embodiments, the third recombination recognition sequence is located between the third expression cassette and the fourth expression cassette.

[0488] In one embodiment of all of the foregoing aspects and embodiments, the deoxyribonucleic acid encoding the trivalent antibody (e.g., TCB) comprises an additional expression cassette encoding a selectable marker, and the expression cassette encoding the selectable marker is located partially 5' to the third recombination recognition sequence and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises a coding sequence without a start codon and a poly A signal, wherein the start codon is operably linked to the coding sequence.

[0489] One aspect of the present invention is a composition comprising two DNAs, which in turn comprise three different recombination recognition sequences and six expression cassettes, wherein

[0490] - the first deoxyribonucleic acid comprises in the 5' to 3' direction

[0491] - a first recombination recognition sequence,

[0492] - a first expression cassette encoding a first heavy chain,

[0493] - a second expression cassette encoding the first light chain,

[0494] - a third expression cassette encoding the first light chain, and

[0495] - a first copy of the third recombination recognition sequence,

[0496] and

[0497] - the second deoxyribonucleic acid comprises in the 5' to 3' direction

[0498] - a second copy of the third recombination recognition sequence,

[0499] - a fourth expression cassette encoding the second heavy chain,

[0500] - a fifth expression cassette encoding the second light chain,

[0501] - a sixth expression cassette encoding the second light chain, and

[0502] - a second recombination recognition sequence.

[0503] In a preferred embodiment, the first heavy chain comprises the mutation T366W in the CH3 domain (according to Kabat numbering), and the second heavy chain comprises the mutations T366S, L368A and Y407V in the CH3 domain, or vice versa (according to Kabat numbering). In one embodiment, one of the heavy chains further comprises the mutation S354C, and the corresponding other heavy chain comprises the mutation Y349C (according to Kabat numbering). In one embodiment, the first heavy chain is an extended heavy chain comprising an additional domain-swapped Fab fragment. In one embodiment, the first light chain is a domain-swapped light chain.

[0504] In one embodiment of all of the foregoing aspects and embodiments,

[0505] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0506] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0507] - the first light chain comprises, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[0508] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0509] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0510] In one embodiment of all of the foregoing aspects and embodiments,

[0511] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[0512] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0513] - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[0514] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0515] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0516] In one embodiment of all of the aforementioned aspects and embodiments, the deoxyribonucleic acid encoding the trivalent antibody (eg, TCB) further comprises an additional expression cassette encoding a selectable marker.

[0517] In one embodiment of all of the aforementioned aspects and embodiments, the expression cassette encoding the selectable marker is positioned relative to the third recombination recognition sequence

[0518] i) located at 5', or

[0519] ii) located 3', or

[0520] iii) partially located 5' and partially located 3'.

[0521] In one embodiment of all the aforementioned aspects and embodiments, the expression cassette encoding the selection marker is located partially 5' and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises the coding sequence without the start codon and a poly A signal.

[0522] In one embodiment of all of the aforementioned aspects and embodiments, the 5' portion of the expression cassette encoding the selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by a third expression cassette (i.e., positioned downstream of the third expression cassette) and the start codon is flanked downstream by a third recombination recognition sequence (i.e., positioned upstream of the third recombination recognition sequence); and the 3' portion of the expression cassette encoding the selection marker comprises a nucleic acid encoding a selection marker lacking a start codon and is flanked upstream by a third recombination recognition sequence and downstream by a fourth expression cassette.

[0523] In one embodiment of all of the aforementioned aspects and embodiments, the start codon is a translation start codon. In one embodiment, the start codon is ATG.

[0524] One aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent antibody (e.g., TCB) integrated into the genome of the cell.

[0525] Among them, the deoxyribonucleic acid encoding the trivalent antibody (e.g., TCB) comprises the following elements:

[0526] a first recombination recognition sequence, a second recombination recognition sequence and a third recombination recognition sequence,

[0527] a first selection marker and a second selection marker, and

[0528] The first expression cassette to the sixth expression cassette,

[0529] The sequence of the element in the 5' to 3' direction is

[0530] RRS1-1 st EC-2 nd EC-3 rd EC-RRS3-SM1-4 th EC-5 th EC-6 th EC-RRS2

[0531] in

[0532] RRS = Recombination Recognition Sequence,

[0533] EC = expression cassette,

[0534] SM = selection marker.

[0535] One aspect of the present invention is a method for producing a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent antibody (e.g., TCB) and secreting the trivalent antibody (e.g., TCB), the method comprising the steps of:

[0536] a) providing a mammalian cell comprising an exogenous nucleotide sequence integrated at a single site within a locus of the genome of the mammalian cell, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all of the recombination recognition sequences are different;

[0537] b) introducing into the cell provided in a) a composition of two deoxyribonucleic acids, the composition comprising three different recombination recognition sequences and six expression cassettes, wherein

[0538] The first deoxyribonucleic acid comprises in the 5' to 3' direction

[0539] - a first recombination recognition sequence,

[0540] - a first expression cassette encoding a first heavy chain,

[0541] - a second expression cassette encoding the first light chain,

[0542] - a third expression cassette encoding the first light chain,

[0543] - the 5' terminal portion of the expression cassette encoding a second selection marker, and

[0544] - a first copy of the third recombination recognition sequence,

[0545] and

[0546] The second deoxyribonucleic acid comprises in the 5' to 3' direction

[0547] - a second copy of the third recombination recognition sequence,

[0548] - the 3' terminal part of the expression cassette encoding said one second selection marker,

[0549] - a fourth expression cassette encoding the second heavy chain,

[0550] - a fifth expression cassette encoding the second light chain,

[0551] - a sixth expression cassette encoding the second light chain, and

[0552] - a second recombination recognition sequence,

[0553] wherein the first to the third recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid match the first to the third recombination recognition sequences on the integrated exogenous nucleotide sequence,

[0554] wherein the 5' terminal portion and the 3' terminal portion of the expression cassette encoding one second selection marker when taken together form a functional expression cassette for said one second selection marker;

[0555] c) Introduction

[0556] i) is introduced simultaneously with the first deoxyribonucleic acid and the second deoxyribonucleic acid of b); or

[0557] ii) subsequently introduced

[0558] one or more recombinases,

[0559] wherein the one or more recombinases recognize the recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid; (and optionally wherein the one or more recombinases perform two recombinase-mediated cassette exchanges;)

[0560] as well as

[0561] d) selecting cells that express the second selection marker and secrete the trivalent antibody (e.g., TCB),

[0562] Recombinant mammalian cells are thereby generated that contain deoxyribonucleic acid encoding the trivalent antibody (eg, TCB) and secrete the trivalent antibody (eg, TCB).

[0563] In one embodiment of all the aforementioned aspects and embodiments, the first heavy chain comprises the mutation T366W in the CH3 domain (according to Kabat numbering), and the second heavy chain comprises the mutations T366S, L368A, and Y407V in the CH3 domain, or vice versa (according to Kabat numbering). In one embodiment, one of the heavy chains further comprises the mutation S354C, and the corresponding other heavy chain comprises the mutation Y349C (according to Kabat numbering). In one embodiment, the first heavy chain is an extended heavy chain comprising an additional domain-swapped Fab fragment.

[0564] In one embodiment of all of the aforementioned aspects and embodiments, the first light chain is a domain swap light chain.

[0565] In one embodiment of all of the foregoing aspects and embodiments,

[0566] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0567] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0568] - the first light chain comprises, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[0569] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0570] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0571] In one embodiment of all of the foregoing aspects and embodiments,

[0572] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[0573] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0574] - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[0575] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0576] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0577] In one embodiment of all the aforementioned aspects and embodiments, the expression cassette encoding the one second selection marker is located partially 5' and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises the coding sequence of the one second selection marker without a start codon and a poly A signal.

[0578] In one embodiment of all of the aforementioned aspects and embodiments, the 5' terminal portion of the expression cassette encoding the one second selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence flanks the expression cassette upstream (i.e., is positioned downstream of the expression cassette) and the start codon is flanked downstream by a third recombination recognition sequence (i.e., is positioned upstream of the third recombination recognition sequence); and the 3' terminal portion of the expression cassette encoding the one second selection marker comprises a coding sequence encoding the one second selection marker lacking a start codon, which coding sequence is flanked upstream by the third recombination recognition sequence and downstream by the expression cassette.

[0579] In one embodiment of all of the aforementioned aspects and embodiments, the start codon is a translation start codon. In one embodiment, the start codon is ATG.

[0580] In one embodiment of all of the foregoing aspects and embodiments,

[0581] i) a first expression cassette comprising in 5' to 3' direction a promoter, the nucleic acid encoding the first heavy chain and a polyadenylation signal sequence, and optionally a terminator sequence,

[0582] ii) a second expression cassette comprising in 5' to 3' direction a promoter, the nucleic acid encoding the first light chain and a polyadenylation signal sequence, and optionally a terminator sequence,

[0583] iii) a third expression cassette comprising, in 5' to 3' direction, a promoter, the nucleic acid encoding the first light chain and a polyadenylation signal sequence, and optionally a terminator sequence,

[0584] iv) a fourth expression cassette comprising in 5' to 3' direction a promoter, the nucleic acid encoding the second heavy chain and a polyadenylation signal sequence, and optionally a terminator sequence,

[0585] v) a fifth expression cassette comprising, in 5' to 3' direction, a promoter, the nucleic acid encoding the second light chain and a polyadenylation signal sequence, and optionally a terminator sequence,

[0586] vi) a sixth expression cassette comprising, in 5' to 3' direction, a promoter, the nucleic acid encoding the second light chain and a polyadenylation signal sequence, and optionally a terminator sequence, and

[0587] vii) The expression cassette encoding the selectable marker comprises, in 5' to 3' direction, a promoter, the nucleic acid encoding the selectable marker and a polyadenylation signal sequence, and optionally a terminator sequence.

[0588] In one embodiment of all aspects and embodiments, the trivalent bispecific (therapeutic) antibody (TCB) comprises

[0589] - a first Fab fragment and a second Fab fragment, wherein each binding site of the first Fab fragment and the second Fab fragment specifically binds to a second antigen,

[0590] a third Fab fragment, wherein the binding site of the third Fab fragment specifically binds to the first antigen, and wherein the third Fab fragment comprises a domain crossover such that the variable light chain domain (VL) and the variable heavy chain domain (VH) are replaced with each other, and

[0591] an Fc region comprising a first Fc region polypeptide and a second Fc region polypeptide,

[0592] wherein the first Fab fragment and the second Fab fragment each comprise a heavy chain fragment and a full-length light chain,

[0593] wherein the C-terminus of the heavy chain fragment of the first Fab fragment is fused to the N-terminus of the first Fc region polypeptide,

[0594] The C-terminus of the heavy chain fragment of the second Fab fragment is fused to the N-terminus of the variable light chain domain of the third Fab fragment, and the C-terminus of the heavy chain constant domain 1 of the third Fab fragment is fused to the N-terminus of the second Fc region polypeptide.

[0595] In one embodiment of all aspects and embodiments herein, the at least one selectable marker expression cassette is in the opposite orientation to the antibody heavy and light chain expression cassettes.

[0596] In one embodiment of all aspects and embodiments herein, the antibody heavy chain expression cassette and the antibody light chain expression cassette are unidirectionally arranged relative to each other (i.e., have the same orientation in the 3' to 5' direction), and the at least one selectable marker expression cassette is bidirectionally arranged relative to the antibody heavy chain expression cassette and the antibody light chain expression cassette.

[0597] In one embodiment of all aspects and embodiments, the trivalent antibody is an anti-CD3 / CD20 bispecific antibody. In one embodiment, the anti-CD3 / CD20 bispecific antibody is a TCB with CD20 as the second antigen. In one embodiment, the bispecific anti-CD3 / CD20 antibody is RG6026. Such antibodies are described in WO 2016 / 020309, which is incorporated herein by reference in its entirety.

[0598] In one embodiment of all aspects and embodiments, the trivalent antibody is an anti-CD3 / CEA bispecific antibody. In one embodiment, the anti-CD3 / CEA bispecific antibody is a TCB with CEA as the second antigen. In one embodiment, the bispecific anti-CD3 / CEA antibody is RO6958688 or RG7802 or cibisatamab. Such antibodies are reported in WO2017 / 055389, which is incorporated herein by reference in its entirety.

[0599] In a preferred embodiment of all aspects and embodiments, the first binding site specifically binds human CD3.

[0600] In a preferred embodiment of all aspects and embodiments, the second binding site specifically binds human CD3.

[0601] Bivalent bispecific antibodies with domain swapping:

[0602] This article reports recombinant mammalian cells expressing bivalent bispecific antibodies, particularly bivalent bispecific antibodies with domain swaps. Bivalent bispecific antibodies are heteromultimeric polypeptides that are non-naturally expressed by the mammalian cells. More specifically, bivalent bispecific antibodies are heteromultimeric proteins composed of four polypeptides or polypeptide chains: one light chain that is a full-length light chain; another light chain that is a domain-swapped light chain; one heavy chain that is a full-length heavy chain; and another heavy chain that is a domain-swapped heavy chain. In order to achieve expression of bivalent bispecific antibodies, recombinant nucleic acids comprising multiple different expression cassettes in specific and defined sequences have been integrated into the genome of mammalian cells.

[0603] Also reported herein is a method for producing a recombinant mammalian cell expressing a bivalent, bispecific antibody, and a method for producing a bivalent, bispecific antibody using the recombinant mammalian cell.

[0604] In a preferred embodiment, the bivalent bispecific antibody comprises

[0605] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0606] a second heavy chain, which comprises, from N-terminus to C-terminus, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0607] - a first light chain comprising, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[0608] - a second light chain, which comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0609] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0610] In a preferred embodiment, the bivalent bispecific antibody comprises

[0611] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[0612] - the second heavy chain comprises, from N-terminus to C-terminus, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[0613] - a first light chain comprising, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[0614] - a second light chain, which comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0615] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0616] The present invention is based at least in part on the discovery that the sequences of the different expression cassettes required for the expression of heteromultimeric bivalent bispecific antibodies, ie, the organization of the expression cassettes, influence the expression yield of the bivalent bispecific antibodies when integrated into the genome of mammalian cells.

[0617] The present invention is based, at least in part, on the discovery that efficient recombinant expression and production of bivalent, bispecific antibodies can be achieved by integrating nucleic acids encoding heteromultimeric, bivalent, bispecific antibodies organized as specific expression cassettes into the genome of mammalian cells.

[0618] It has been found that defined expression cassette sequences can be advantageously integrated into the genome of mammalian cells by a dual recombinase-mediated cassette exchange reaction.

[0619] According to one aspect of the present invention is a method for producing a bivalent bispecific antibody, the method comprising the following steps:

[0620] a) optionally culturing a mammalian cell comprising a deoxyribonucleic acid encoding the bivalent bispecific antibody under conditions suitable for expression of the bivalent bispecific antibody, and

[0621] b) recovering the bivalent bispecific antibody from the cells or culture medium,

[0622] The deoxyribonucleic acid encoding the bivalent bispecific antibody is stably integrated into the genome of the mammalian cell and comprises (1)

[0624] - a first expression cassette encoding a first light chain,

[0625] - a second expression cassette encoding the first heavy chain,

[0626] - a third expression cassette encoding a second light chain, and

[0627] - a fourth expression cassette encoding the second heavy chain,

[0628] or (2)

[0629] - a first expression cassette encoding a first light chain,

[0630] - a second expression cassette encoding a second heavy chain,

[0631] - a third expression cassette encoding a second light chain, and

[0632] - a fourth expression cassette encoding the first heavy chain.

[0633] In one embodiment, one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0634] One aspect of the present invention is a deoxyribonucleic acid encoding a bivalent bispecific antibody, the deoxyribonucleic acid comprising in the 5' to 3' direction (1)

[0636] - a first expression cassette encoding a first light chain,

[0637] - a second expression cassette encoding the first heavy chain,

[0638] - a third expression cassette encoding a second light chain, and

[0639] - a fourth expression cassette encoding the second heavy chain,

[0640] or (2)

[0641] - a first expression cassette encoding a first light chain,

[0642] - a second expression cassette encoding a second heavy chain,

[0643] - a third expression cassette encoding a second light chain, and

[0644] - a fourth expression cassette encoding the first heavy chain.

[0645] One aspect of the present invention is the use of a deoxyribonucleic acid comprising in the 5' to 3' direction a bivalent bispecific antibody for expressing in a mammalian cell (1)

[0647] - a first expression cassette encoding a first light chain,

[0648] - a second expression cassette encoding the first heavy chain,

[0649] - a third expression cassette encoding a second light chain, and

[0650] - a fourth expression cassette encoding the second heavy chain,

[0651] or (2)

[0652] - a first expression cassette encoding a first light chain,

[0653] - a second expression cassette encoding a second heavy chain,

[0654] - a third expression cassette encoding a second light chain, and

[0655] - a fourth expression cassette encoding the first heavy chain.

[0656] In one embodiment of this use, the deoxyribonucleic acid is integrated into the genome of the mammalian cell.

[0657] In one embodiment, exactly one copy of the deoxyribonucleic acid used is stably integrated into the genome of the mammalian cell at a single site or locus.

[0658] One aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a bivalent bispecific antibody integrated into the genome of the cell,

[0659] The deoxyribonucleic acid encoding the bivalent bispecific antibody comprises in the 5' to 3' direction (1)

[0661] - a first expression cassette encoding a first light chain,

[0662] - a second expression cassette encoding the first heavy chain,

[0663] - a third expression cassette encoding a second light chain, and

[0664] - a fourth expression cassette encoding the second heavy chain,

[0665] or (2)

[0666] - a first expression cassette encoding a first light chain,

[0667] - a second expression cassette encoding a second heavy chain,

[0668] - a third expression cassette encoding a second light chain, and

[0669] - a fourth expression cassette encoding the first heavy chain.

[0670] In one embodiment, one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0671] In one embodiment of all of the aforementioned aspects, the deoxyribonucleic acid encoding the bivalent, bispecific antibody further comprises

[0672] - a first recombination recognition sequence located 5' of said first (most 5') expression cassette,

[0673] - a second recombination recognition sequence located 3' to the fourth (most 3') expression cassette, and

[0674] - a third recombination recognition sequence located at

[0675] - between the first recombination recognition sequence and the second recombination recognition sequence, and

[0676] - between two of the expression cassettes,

[0677] and

[0678] All recombination recognition sequences are different.

[0679] In one embodiment, the third recombination recognition sequence is located between the second expression cassette and the third expression cassette.

[0680] In one embodiment, the deoxyribonucleic acid encoding the bivalent bispecific antibody comprises an additional expression cassette encoding a selection marker, and the expression cassette encoding the selection marker is located partially 5' and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises the coding sequence without the start codon and a poly A signal, wherein the start codon is operably linked to the coding sequence.

[0681] One aspect of the present invention is a composition comprising two DNAs, which in turn comprise three different recombination recognition sequences and eight expression cassettes, wherein

[0682] - the first deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0684] - a first recombination recognition sequence,

[0685] - a first expression cassette encoding a first light chain,

[0686] - a second expression cassette encoding the first heavy chain, and

[0687] - a first copy of the third recombination recognition sequence,

[0688] or (2)

[0689] - a first recombination recognition sequence,

[0690] - a first expression cassette encoding a first light chain,

[0691] - a second expression cassette encoding a second heavy chain, and

[0692] - a first copy of the third recombination recognition sequence,

[0693] and

[0694] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0696] - a second copy of the third recombination recognition sequence,

[0697] - a third expression cassette encoding the second light chain,

[0698] - a fourth expression cassette encoding the second heavy chain, and

[0699] - a second recombination recognition sequence,

[0700] or (2)

[0701] - a second copy of the third recombination recognition sequence,

[0702] - a third expression cassette encoding the second light chain,

[0703] - a fourth expression cassette encoding the first heavy chain, and

[0704] - a second recombination recognition sequence.

[0705] In one embodiment, both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (1); or both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (2).

[0706] In one embodiment of all the aforementioned aspects the deoxyribonucleic acid encoding the bivalent, bispecific antibody further comprises an additional expression cassette encoding a selectable marker.

[0707] In one embodiment, the expression cassette encoding the selection marker is located 5' relative to the third recombination recognition sequence i), or

[0708] ii) located 3', or

[0709] iii) partially located 5' and partially located 3'.

[0710] In one embodiment, the expression cassette encoding the selection marker is partially located 5' of the third recombination recognition sequence and partially located 3' of the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises a coding sequence without a start codon and a poly A signal.

[0711] In one embodiment, the 5' portion of the expression cassette encoding the selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by a second expression cassette (i.e., positioned downstream of the second expression cassette) and the start codon is flanked downstream by a third recombination recognition sequence (i.e., positioned upstream of the third recombination recognition sequence); and the 3' portion of the expression cassette encoding the selection marker comprises a nucleic acid encoding a selection marker lacking a start codon and is flanked upstream by a third recombination recognition sequence and downstream by a third expression cassette.

[0712] In one embodiment, the start codon is a translation start codon. In one embodiment, the start codon is ATG.

[0713] One aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a bivalent bispecific antibody integrated into the genome of the cell,

[0714] The DNA encoding the bivalent bispecific antibody comprises the following elements:

[0715] a first recombination recognition sequence, a second recombination recognition sequence and a third recombination recognition sequence,

[0716] a first selection marker and a second selection marker, and

[0717] The first expression cassette to the fourth expression cassette,

[0718] The sequence of the element in the 5' to 3' direction is

[0719] RRS1-1st EC-2nd EC-RRS3-SM1-3rd EC-4th EC-RRS2

[0720] in

[0721] RRS = Recombination Recognition Sequence,

[0722] EC = expression cassette,

[0723] SM = selection marker.

[0724] One aspect of the present invention is a method for producing a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a bivalent bispecific antibody and secreting the bivalent bispecific antibody, the method comprising the following steps:

[0725] a) providing a mammalian cell comprising an exogenous nucleotide sequence integrated at a single site within a locus of the genome of the mammalian cell, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all of the recombination recognition sequences are different;

[0726] b) introducing into the cell provided in a) a composition of two deoxyribonucleic acids, said two deoxyribonucleic acids comprising three different recombination recognition sequences and four expression cassettes, wherein

[0727] - the first deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0729] - a first recombination recognition sequence,

[0730] - a first expression cassette encoding a first light chain,

[0731] - a second expression cassette encoding the first heavy chain, and

[0732] - a first copy of the third recombination recognition sequence,

[0733] or (2)

[0734] - a first recombination recognition sequence,

[0735] - a first expression cassette encoding a first light chain,

[0736] - a second expression cassette encoding a second heavy chain, and

[0737] - a first copy of the third recombination recognition sequence,

[0738] and

[0739] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0741] - a second copy of the third recombination recognition sequence,

[0742] - a third expression cassette encoding the second light chain,

[0743] - a fourth expression cassette encoding the second heavy chain, and

[0744] - a second recombination recognition sequence,

[0745] or (2)

[0746] - a second copy of the third recombination recognition sequence,

[0747] - a third expression cassette encoding the second light chain,

[0748] - a fourth expression cassette encoding the first heavy chain, and

[0749] - a second recombination recognition sequence,

[0750] wherein the first to the third recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid match the first to the third recombination recognition sequences on the integrated exogenous nucleotide sequence,

[0751] wherein the 5' terminal portion and the 3' terminal portion of the expression cassette encoding one second selection marker when taken together form a functional expression cassette for said one second selection marker;

[0752] c) Introduction

[0753] i) is introduced simultaneously with the first deoxyribonucleic acid and the second deoxyribonucleic acid of b); or

[0754] ii) subsequently introduced

[0755] one or more recombinases,

[0756] wherein the one or more recombinases recognize the recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid; (and optionally wherein the one or more recombinases perform two recombinase-mediated cassette exchanges;)

[0757] as well as

[0758] d) selecting cells that express the second selection marker and secrete the bivalent bispecific antibody,

[0759] This generates recombinant mammalian cells that contain deoxyribonucleic acid encoding the bivalent bispecific antibody and secrete the bivalent bispecific antibody.

[0760] In one embodiment, both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (1); or both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (2).

[0761] In one embodiment of all aspects and embodiments, the bivalent bispecific antibody is an anti-ANG2 / VEGF bispecific antibody. In one embodiment, the bispecific anti-ANG2 / VEGF antibody is RG7221 or vanucizumab.

[0762] In one embodiment of all aspects and embodiments, the bivalent bispecific antibody is an anti-ANG2 / VEGF bispecific antibody. In one embodiment, the bispecific anti-ANG2 / VEGF antibody is RG7716 or faricimab.

[0763] Such ANG2 / VEGF bispecific antibodies are reported in WO 2010 / 040508, WO 2011 / 117329, WO 2014 / 009465, which are incorporated herein by reference in their entirety.

[0764] In one embodiment of all aspects and embodiments, the bivalent bispecific antibody is an anti-PD1 / TIM3 bispecific antibody. Such antibodies are reported in WO 2017 / 055404, which is incorporated herein by reference in its entirety.

[0765] In one embodiment of all aspects and embodiments, the bivalent bispecific antibody is an anti-PD1 / Lag3 bispecific antibody. Such antibodies are reported in WO 2018 / 185043, which is incorporated herein by reference in its entirety.

[0766] Multivalent bispecific antibodies:

[0767] This article reports a recombinant mammalian cell that expresses a multivalent bispecific antibody. The multivalent bispecific antibody is a heterologous multimeric polypeptide that is non-naturally expressed by the mammalian cell. More specifically, the multivalent bispecific antibody is a heterologous multimeric protein comprising three polypeptides or polypeptide chains: a light chain that is a full-length light chain; a heavy chain that is an extended heavy chain that contains an additional heavy chain Fab fragment at the N-terminus of the extended heavy chain and an additional light chain variable domain at the C-terminus of the extended heavy chain; and another heavy chain that is an extended heavy chain that contains an additional heavy chain Fab fragment at the N-terminus of the extended heavy chain and an additional heavy chain variable domain at the C-terminus of the extended heavy chain. In order to achieve the expression of the multivalent bispecific antibody, a recombinant nucleic acid comprising multiple different expression cassettes in specific and defined sequences has been integrated into the genome of the mammalian cell. In a preferred embodiment, the multivalent bispecific antibody is at least tetravalent. In a preferred embodiment, the multivalent bispecific antibody is at most ten-valent, more preferably at most eight-valent.

[0768] Also reported herein is a method for producing recombinant mammalian cells expressing multivalent bispecific antibodies, and a method for producing multivalent bispecific antibodies using the recombinant mammalian cells.

[0769] In a preferred embodiment, the multivalent bispecific antibody comprises

[0770] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CHI domain, a second copy of the first heavy chain variable domain, a CHI domain, a hinge region, a CH2 domain, a CH3 domain and a first light chain variable domain,

[0771] a second heavy chain comprising, from N-terminus to C-terminus, a first heavy chain variable domain, a CHI domain, a second copy of the first heavy chain variable domain, a CHI domain, a hinge region, a CH2 domain, a CH3 domain, and a second heavy chain variable domain, and

[0772] - a first light chain comprising, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0773] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0774] In a preferred embodiment, neither the first light chain nor the second light chain of the multivalent bispecific antibody is a common light chain or a universal light chain.

[0775] The present invention is based, at least in part, on the discovery that the sequences of the different expression cassettes required for the expression of heteromultimeric multivalent bispecific antibodies, i.e., the organization of the expression cassettes, influence the expression yield of the multivalent bispecific antibodies when integrated into the genome of mammalian cells.

[0776] The present invention is based, at least in part, on the discovery that efficient recombinant expression and production of multivalent bispecific antibodies can be achieved by integrating nucleic acids encoding heteromultimeric multivalent bispecific antibodies organized in specific expression cassettes into the genome of mammalian cells.

[0777] It has been found that defined expression cassette sequences can be advantageously integrated into the genome of mammalian cells by a dual recombinase-mediated cassette exchange reaction.

[0778] According to one aspect of the present invention is a method for producing a multivalent bispecific antibody, the method comprising the following steps:

[0779] a) optionally culturing mammalian cells comprising deoxyribonucleic acid encoding the multivalent bispecific antibody under conditions suitable for expression of the multivalent bispecific antibody, and

[0780] b) recovering the multivalent bispecific antibody from the cells or culture medium,

[0781] The deoxyribonucleic acid encoding the multivalent bispecific antibody is stably integrated into the genome of the mammalian cell and comprises (1)

[0783] - a first expression cassette encoding a first heavy chain,

[0784] - a second expression cassette encoding the first light chain,

[0785] - a third expression cassette encoding the first light chain,

[0786] - a fourth expression cassette encoding the second heavy chain,

[0787] - a fifth expression cassette encoding the first light chain, and

[0788] - a sixth expression cassette encoding the first light chain,

[0789] or (2)

[0790] - a first expression cassette encoding a first heavy chain,

[0791] - a second expression cassette encoding the first light chain,

[0792] - a third expression cassette encoding the first light chain,

[0793] - a fourth expression cassette encoding the first light chain,

[0794] - a fifth expression cassette encoding the second heavy chain,

[0795] - a sixth expression cassette encoding the first light chain,

[0796] - a seventh expression cassette encoding the first light chain, and

[0797] - an eighth expression cassette encoding the first light chain.

[0798] In one embodiment, one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0799] One aspect of the present invention is a deoxyribonucleic acid encoding a multivalent bispecific antibody, the deoxyribonucleic acid comprising in the 5' to 3' direction (1)

[0801] - a first expression cassette encoding a first heavy chain,

[0802] - a second expression cassette encoding the first light chain,

[0803] - a third expression cassette encoding the first light chain,

[0804] - a fourth expression cassette encoding the second heavy chain,

[0805] - a fifth expression cassette encoding the first light chain, and

[0806] - a sixth expression cassette encoding the first light chain,

[0807] or (2)

[0808] - a first expression cassette encoding a first heavy chain,

[0809] - a second expression cassette encoding the first light chain,

[0810] - a third expression cassette encoding the first light chain,

[0811] - a fourth expression cassette encoding the first light chain,

[0812] - a fifth expression cassette encoding the second heavy chain,

[0813] - a sixth expression cassette encoding the first light chain,

[0814] - a seventh expression cassette encoding the first light chain, and

[0815] - an eighth expression cassette encoding the first light chain.

[0816] One aspect of the present invention is the use of a deoxyribonucleic acid comprising in the 5' to 3' direction a multivalent bispecific antibody for expressing in a mammalian cell (1)

[0818] - a first expression cassette encoding a first heavy chain,

[0819] - a second expression cassette encoding the first light chain,

[0820] - a third expression cassette encoding the first light chain,

[0821] - a fourth expression cassette encoding the second heavy chain,

[0822] - a fifth expression cassette encoding the first light chain, and

[0823] - a sixth expression cassette encoding the first light chain,

[0824] or (2)

[0825] - a first expression cassette encoding a first heavy chain,

[0826] - a second expression cassette encoding the first light chain,

[0827] - a third expression cassette encoding the first light chain,

[0828] - a fourth expression cassette encoding the first light chain,

[0829] - a fifth expression cassette encoding the second heavy chain,

[0830] - a sixth expression cassette encoding the first light chain,

[0831] - a seventh expression cassette encoding the first light chain, and

[0832] - an eighth expression cassette encoding the first light chain.

[0833] In one embodiment of this use, the deoxyribonucleic acid is integrated into the genome of the mammalian cell.

[0834] In one embodiment of use, exactly one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0835] One aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a multivalent bispecific antibody integrated into the genome of the cell.

[0836] The deoxyribonucleic acid encoding the multivalent bispecific antibody comprises in the 5' to 3' direction (1)

[0838] - a first expression cassette encoding a first heavy chain,

[0839] - a second expression cassette encoding the first light chain,

[0840] - a third expression cassette encoding the first light chain,

[0841] - a fourth expression cassette encoding the second heavy chain,

[0842] - a fifth expression cassette encoding the first light chain, and

[0843] - a sixth expression cassette encoding the first light chain,

[0844] or (2)

[0845] - a first expression cassette encoding a first heavy chain,

[0846] - a second expression cassette encoding the first light chain,

[0847] - a third expression cassette encoding the first light chain,

[0848] - a fourth expression cassette encoding the first light chain,

[0849] - a fifth expression cassette encoding the second heavy chain,

[0850] - a sixth expression cassette encoding the first light chain,

[0851] - a seventh expression cassette encoding the first light chain, and

[0852] - an eighth expression cassette encoding the first light chain.

[0853] In one embodiment, one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[0854] In one embodiment of all of the aforementioned aspects, the deoxyribonucleic acid encoding the multivalent bispecific antibody further comprises

[0855] - a first recombination recognition sequence located 5' of said first (most 5') expression cassette,

[0856] - a second recombination recognition sequence located 3' to the sixth or eighth (most 3') expression cassette, and

[0857] - a third recombination recognition sequence located at

[0858] - between the first recombination recognition sequence and the second recombination recognition sequence, and

[0859] - between two of the expression cassettes,

[0860] and

[0861] All recombination recognition sequences are different.

[0862] In one embodiment, the third recombination recognition sequence is located between the third expression cassette and the fourth expression cassette, or between the fourth expression cassette and the fifth expression cassette.

[0863] In one embodiment, the deoxyribonucleic acid encoding the multivalent bispecific antibody comprises an additional expression cassette encoding a selection marker, and the expression cassette encoding the selection marker is located partially 5' to the third recombination recognition sequence and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises a coding sequence without a start codon and a poly A signal, wherein the start codon is operably linked to the coding sequence.

[0864] One aspect of the present invention is a composition comprising two DNAs, which in turn comprise three different recombination recognition sequences and eight expression cassettes, wherein

[0865] - the first deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0867] - a first recombination recognition sequence,

[0868] - a first expression cassette encoding a first heavy chain,

[0869] - a second expression cassette encoding the first light chain,

[0870] - a third expression cassette encoding the first light chain, and

[0871] - a first copy of the third recombination recognition sequence,

[0872] or (2)

[0873] - a first recombination recognition sequence,

[0874] - a first expression cassette encoding a first heavy chain,

[0875] - a second expression cassette encoding the first light chain,

[0876] - a third expression cassette encoding the first light chain,

[0877] - a fourth expression cassette encoding the first light chain, and

[0878] - a first copy of the third recombination recognition sequence,

[0879] and

[0880] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0882] - a second copy of the third recombination recognition sequence,

[0883] - a fourth expression cassette encoding the second heavy chain,

[0884] - a fifth expression cassette encoding the first light chain, and

[0885] - a sixth expression cassette encoding the first light chain, and

[0886] - a second recombination recognition sequence,

[0887] or (2)

[0888] - a second copy of the third recombination recognition sequence,

[0889] - a fifth expression cassette encoding the second heavy chain,

[0890] - a sixth expression cassette encoding the first light chain,

[0891] - a seventh expression cassette encoding the first light chain,

[0892] - an eighth expression cassette encoding the first light chain, and

[0893] - a second recombination recognition sequence.

[0894] In one embodiment, both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (1); or both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (2).

[0895] In one embodiment of all the aforementioned aspects, the deoxyribonucleic acid encoding the multivalent bispecific antibody further comprises an additional expression cassette encoding a selectable marker.

[0896] In one embodiment, the expression cassette encoding the selection marker is located relative to the third recombination recognition sequence.

[0897] i) located at 5', or

[0898] ii) located 3', or

[0899] iii) partially located 5' and partially located 3'.

[0900] In one embodiment, the expression cassette encoding the selection marker is partially located 5' of the third recombination recognition sequence and partially located 3' of the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises a coding sequence without a start codon and a poly A signal.

[0901] In one embodiment, the 5' portion of the expression cassette encoding the selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by a third expression cassette or a fourth expression cassette, respectively (i.e., positioned downstream of the third expression cassette or the fourth expression cassette, respectively), and the start codon is flanked downstream by a third recombination recognition sequence (i.e., positioned upstream of the third recombination recognition sequence); and the 3' portion of the expression cassette encoding the selection marker comprises a nucleic acid encoding a selection marker lacking a start codon, and is flanked upstream by a third recombination recognition sequence, and is flanked downstream by a fourth expression cassette or a fifth expression cassette, respectively.

[0902] In one embodiment, the start codon is a translation start codon. In one embodiment, the start codon is ATG.

[0903] One aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a multivalent bispecific antibody integrated into the genome of the cell.

[0904] The DNA encoding the multivalent bispecific antibody comprises the following elements:

[0905] a first recombination recognition sequence, a second recombination recognition sequence and a third recombination recognition sequence,

[0906] a first selection marker and a second selection marker, and

[0907] the first expression cassette to the sixth expression cassette, or the first expression cassette to the eighth expression cassette,

[0908] The sequence of the element in the 5' to 3' direction is

[0909] RRS1-1 st EC-2 nd EC-3 rd EC-RRS3-SM1-4 th EC-5 th EC-6 th EC-RRS2

[0910] or

[0911] RRS1-1 st EC-2 nd EC-3 rd EC-4 th EC-RRS3-SM1-5 th EC-6 th EC-7 th EC-8 th EC-RRS2

[0912] in

[0913] RRS = Recombination Recognition Sequence,

[0914] EC = expression cassette,

[0915] SM = selection marker.

[0916] One aspect of the present invention is a method for producing a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a multivalent bispecific antibody and secreting the multivalent bispecific antibody, the method comprising the steps of:

[0917] a) providing a mammalian cell comprising an exogenous nucleotide sequence integrated at a single site within a locus of the genome of the mammalian cell, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all of the recombination recognition sequences are different;

[0918] b) introducing into the cell provided in a) a composition of two deoxyribonucleic acids, said two deoxyribonucleic acids comprising three different recombination recognition sequences and six or eight expression cassettes, wherein

[0919] - the first deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0921] - a first recombination recognition sequence,

[0922] - a first expression cassette encoding a first heavy chain,

[0923] - a second expression cassette encoding the first light chain,

[0924] - a third expression cassette encoding the first light chain, and

[0925] - a first copy of the third recombination recognition sequence,

[0926] or (2)

[0927] - a first recombination recognition sequence,

[0928] - a first expression cassette encoding a first heavy chain,

[0929] - a second expression cassette encoding the first light chain,

[0930] - a third expression cassette encoding the first light chain,

[0931] - a fourth expression cassette encoding the first light chain, and

[0932] - a first copy of the third recombination recognition sequence,

[0933] and

[0934] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[0936] - a second copy of the third recombination recognition sequence,

[0937] - a fourth expression cassette encoding the second heavy chain,

[0938] - a fifth expression cassette encoding the first light chain,

[0939] - a sixth expression cassette encoding the first light chain, and

[0940] - a second recombination recognition sequence,

[0941] or (2)

[0942] - a second copy of the third recombination recognition sequence,

[0943] - a fifth expression cassette encoding the second heavy chain,

[0944] - a sixth expression cassette encoding the first light chain,

[0945] - a seventh expression cassette encoding the first light chain,

[0946] - an eighth expression cassette encoding the first light chain, and

[0947] - a second recombination recognition sequence,

[0948] wherein the first to the third recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid match the first to the third recombination recognition sequences on the integrated exogenous nucleotide sequence,

[0949] wherein the 5' terminal portion and the 3' terminal portion of the expression cassette encoding one second selection marker when taken together form a functional expression cassette for said one second selection marker;

[0950] c) Introduction

[0951] i) is introduced simultaneously with the first deoxyribonucleic acid and the second deoxyribonucleic acid of b); or

[0952] ii) subsequently introduced

[0953] one or more recombinases,

[0954] wherein the one or more recombinases recognize the recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid; (and optionally wherein the one or more recombinases perform two recombinase-mediated cassette exchanges;)

[0955] as well as

[0956] d) selecting cells that express the second selection marker and secrete the multivalent bispecific antibody,

[0957] This generates recombinant mammalian cells that contain deoxyribonucleic acid encoding the multivalent bispecific antibody and secrete the multivalent bispecific antibody.

[0958] In one embodiment, both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (1); or both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (2).

[0959] In one embodiment of all of the foregoing aspects and embodiments,

[0960] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain and a first light chain variable domain,

[0961] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CHI domain, a first heavy chain variable domain, a CHI domain, a hinge region, a CH2 domain, a CH3 domain, and a second heavy chain variable domain, and

[0962] - the first light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[0963] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[0964] In one embodiment of all the aforementioned aspects and embodiments, each of the expression cassettes comprises, in the 5' to 3' direction, a promoter, a coding sequence and a polyadenylation signal sequence, optionally followed by a terminator sequence.

[0965] In one embodiment of all the aforementioned aspects and embodiments, all expression cassettes are arranged unidirectionally.

[0966] In one embodiment of all aspects and embodiments, the multivalent bispecific antibody is an anti-FAP / Ox40 bispecific antibody. Such antibodies are reported in WO 2017 / 060144, which is incorporated herein by reference in its entirety.

[0967] Using Cre Targeted integration of mRNA:

[0968] Also reported herein is a method for producing a recombinant mammalian cell expressing a heterologous polypeptide, and a method for producing a heterologous polypeptide using the recombinant mammalian cell.

[0969] The present invention is based at least in part on the discovery that if Cre recombinase mRNA (Cre mRNA) is used instead of, for example, Cre recombinase DNA (Cre DNA), the number of clones obtained by targeted integration can be improved. In more detail, it has been found that after the selection period, the absolute number of clones in the recombinant cell pool produced by Cre mRNA is higher than the number of clones in the recombinant cell pool produced by CRE plasmid. Therefore, by using Cre mRNA instead of, for example, a Cre recombinase encoding plasmid (Cre plasmid), a recombinant cell pool with increased clone number and heterogeneity can be obtained. Without being bound by this theory, it is assumed that the possibility of finding recombinant cell clones with high titer and good product quality is thereby increased. In addition, it has been found that the increase in the number of recombinant cell clones from the pool produced by Cre mRNA is stable compared to the cell pool produced by Cre plasmid.

[0970] It must be pointed out that in the method according to the present invention, the Cre mRNA introduced for the recombinase reaction is the only source of isolated Cre mRNA and Cre recombinase.

[0971] According to an independent aspect of the present invention there is a method for producing a polypeptide, the method comprising the steps of:

[0972] a) optionally culturing a mammalian cell comprising a deoxyribonucleic acid encoding the polypeptide under conditions suitable for expression of the polypeptide, and

[0973] b) recovering the polypeptide from the cells or culture medium,

[0974] wherein the deoxyribonucleic acid encoding the polypeptide has been stably integrated into the mammalian cell genome by Cre recombinase-mediated cassette exchange using Cre mRNA.

[0975] Another independent aspect of the present invention is a method for producing a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a polypeptide and secreting the polypeptide, wherein the method comprises the steps of:

[0976] a) providing a mammalian cell comprising an exogenous nucleotide sequence integrated at a single site within a locus of the genome of the mammalian cell, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all of the recombination recognition sequences are different;

[0977] b) introducing into the cell provided in a) a composition of two deoxyribonucleic acids, said two deoxyribonucleic acids comprising three different recombination recognition sequences and one to eight expression cassettes, wherein

[0978] The first deoxyribonucleic acid comprises in the 5' to 3' direction

[0979] - a first recombination recognition sequence,

[0980] - one or more expression cassettes,

[0981] - the 5' terminal portion of the expression cassette encoding a second selection marker, and

[0982] - a first copy of the third recombination recognition sequence,

[0983] and

[0984] The second deoxyribonucleic acid comprises in the 5' to 3' direction

[0985] - a second copy of the third recombination recognition sequence,

[0986] - the 3' terminal part of the expression cassette encoding said one second selection marker,

[0987] - one or more expression cassettes, and

[0988] - a second recombination recognition sequence,

[0989] wherein the first to the third recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid match the first to the third recombination recognition sequences on the integrated exogenous nucleotide sequence,

[0990] wherein the 5' terminal portion and the 3' terminal portion of the expression cassette encoding one second selection marker when taken together form a functional expression cassette for said one second selection marker;

[0991] c) Introduction

[0992] i) is introduced simultaneously with the first deoxyribonucleic acid and the second deoxyribonucleic acid of b); or

[0993] ii) subsequently introduced

[0994] Cre recombinase mRNA,

[0995] wherein the Cre recombinase recognizes the recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid; (and optionally wherein the recombinase performs two recombinase-mediated cassette exchanges;)

[0996] as well as

[0997] d) selecting cells that express the second selection marker and secrete the polypeptide,

[0998] This produces recombinant mammalian cells that contain the deoxyribonucleic acid encoding the polypeptide and secrete the polypeptide.

[0999] Another aspect of the present invention is the use of Cre recombinase mRNA for increasing the number of recombinant mammalian cells comprising (exactly one copy of) a (heterologous and / or transgenic) deoxyribonucleic acid encoding a (heterologous) polypeptide of interest stably integrated into the genome of said cells at a single site by targeted integration, and in one embodiment, the recombinant cells also secrete the polypeptide of interest into the culture medium when cultured in the culture medium.

[1000] In one embodiment according to all aspects and embodiments of the present invention, the mammalian cell and / or the introduced Cre recombinase mRNA does not have a Cre recombinase encoding deoxyribonucleic acid.

[1001] In one embodiment according to all aspects and embodiments of the present invention, the Cre recombinase mRNA is isolated Cre recombinase mRNA.

[1002] In one embodiment according to all aspects and embodiments of the present invention, the Cre mRNA encodes a polypeptide having the amino acid sequence of SEQ ID NO: 20.

[1003] In one embodiment according to all aspects and embodiments of the present invention, Cre mRNA encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 20, and further comprises a nuclear localization sequence at the N-terminus or C-terminus or at both termini. In one embodiment, Cre mRNA encodes a polypeptide having the amino acid sequence of SEQ ID NO: 20, and further comprises, independently of each other, one to five nuclear localization sequences at the N-terminus or C-terminus or at both termini.

[1004] In one embodiment according to all aspects and embodiments of the present invention, the Cre mRNA comprises the nucleotide sequence of SEQ ID NO: 21 or a codon usage optimized variant thereof. In one embodiment of all aspects, the Cre mRNA comprises the nucleotide sequence of SEQ ID NO: 21 or a codon usage optimized variant thereof and further comprises an additional nucleic acid encoding a nuclear localization sequence at its 5' end or 3' end or both ends. In one embodiment of all aspects, the Cre mRNA comprises the nucleotide sequence of SEQ ID NO: 21 or a codon usage optimized variant thereof and further comprises, independently of each other, one to five nucleic acids encoding a nuclear localization sequence at its 5' end or 3' end or both ends.

[1005] In one embodiment according to all aspects and embodiments of the invention, exactly one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[1006] In one embodiment according to all aspects and embodiments of the present invention, the deoxyribonucleic acid encoding the polypeptide comprises from one expression cassette to eight expression cassettes.

[1007] In one embodiment according to all aspects and embodiments of the present invention, the deoxyribonucleic acid encoding the polypeptide comprises at least 4 expression cassettes, wherein

[1008] - the first recombination recognition sequence is located 5' of the 5'most (i.e. first) expression cassette,

[1009] - the second recombination recognition sequence is located 3' to the expression cassette closest to the 3' end (i.e. the last expression cassette), and

[1010] -The third recombination recognition sequence is located at

[1011] - between the first recombination recognition sequence and the second recombination recognition sequence, and

[1012] - between two of the expression cassettes,

[1013] and

[1014] All recombination recognition sequences are different.

[1015] In one embodiment according to all aspects and embodiments of the present invention, the third recombination recognition sequence is located between the second expression cassette and the third expression cassette, or between the third expression cassette and the fourth expression cassette, or between the fourth expression cassette and the fifth expression cassette.

[1016] In one embodiment according to all aspects and embodiments of the invention the deoxyribonucleic acid encoding the polypeptide comprises an additional expression cassette encoding a selectable marker.

[1017] In one embodiment according to all aspects and embodiments of the present invention, the deoxyribonucleic acid encoding the polypeptide comprises an additional expression cassette encoding a selection marker, and the expression cassette encoding the selection marker is located partially 5' and partially 3' to the third recombination recognition sequence, wherein the 5' part of the expression cassette comprises a promoter and a start codon, and the 3' part of the expression cassette comprises the coding sequence without the start codon and a poly A signal, wherein the start codon is operably linked to the coding sequence.

[1018] In one embodiment according to all aspects and embodiments of the present invention, the expression cassette encoding the selection marker is located relative to the third recombination recognition sequence.

[1019] i) located at 5', or

[1020] ii) located 3', or

[1021] iii) partially located 5' and partially located 3'.

[1022] In one embodiment according to all aspects and embodiments of the invention, the polypeptide is selected from the group of polypeptides consisting of a bivalent monospecific antibody, a bivalent bispecific antibody, a bivalent bispecific antibody comprising at least one domain swap and a trivalent bispecific antibody comprising at least one domain swap.

[1023] In one embodiment according to all aspects and embodiments of the present invention, the polypeptide is a heterotetrameric polypeptide comprising

[1024] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1025] a second heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1026] - a first light chain comprising, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[1027] - a second light chain, which comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1028] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[1029] In one embodiment according to all aspects and embodiments of the present invention, the polypeptide is a heterotetrameric polypeptide comprising

[1030] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[1031] a second heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1032] - a first light chain comprising, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[1033] - a second light chain, which comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1034] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[1035] In one embodiment according to all aspects and embodiments of the present invention, the polypeptide is a heterotetrameric polypeptide comprising

[1036] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1037] a second heavy chain, which comprises, from N-terminus to C-terminus, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1038] - a first light chain comprising, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[1039] - a second light chain, which comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1040] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[1041] In one embodiment according to all aspects and embodiments of the present invention, the polypeptide is a heterotetrameric polypeptide comprising

[1042] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1043] a second heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[1044] - a first light chain comprising, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[1045] - a second light chain, which comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1046] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[1047] In one embodiment according to all aspects and embodiments of the present invention, the polypeptide is a heteromultimeric polypeptide comprising

[1048] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain and a first light chain variable domain,

[1049] a second heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, and a second heavy chain variable domain, and

[1050] - a first light chain comprising, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1051] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[1052] In one embodiment according to all aspects and embodiments of the present invention, the polypeptide is a heterotetrameric polypeptide comprising

[1053] a first heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, a peptide linker, a second heavy chain variable domain and a CL domain,

[1054] a second heavy chain, which comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1055] - a first light chain comprising, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[1056] - a second light chain, which comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1057] wherein the second heavy chain variable domain and the first light chain variable domain form a first binding site, and the first heavy chain variable domain and the second light chain variable domain form a second binding site.

[1058] In one embodiment according to all aspects and embodiments of the present invention, the polypeptide is a therapeutic antibody. In a preferred embodiment, the therapeutic antibody is a bispecific (therapeutic) antibody. In one embodiment, the bispecific (therapeutic) antibody is a TCB.

[1059] In one embodiment of all aspects and embodiments, the polypeptide is a bispecific (therapeutic) antibody (TCB) comprising

[1060] - a first Fab fragment and a second Fab fragment, wherein each binding site of the first Fab fragment and the second Fab fragment specifically binds to a second antigen,

[1061] a third Fab fragment, wherein the binding site of the third Fab fragment specifically binds to the first antigen, and wherein the third Fab fragment comprises a domain crossover such that the variable light chain domain (VL) and the variable heavy chain domain (VH) are replaced with each other, and

[1062] an Fc region comprising a first Fc region polypeptide and a second Fc region polypeptide,

[1063] wherein the first Fab fragment and the second Fab fragment each comprise a heavy chain fragment and a full-length light chain,

[1064] wherein the C-terminus of the heavy chain fragment of the first Fab fragment is fused to the N-terminus of the first Fc region polypeptide,

[1065] The C-terminus of the heavy chain fragment of the second Fab fragment is fused to the N-terminus of the variable light chain domain of the third Fab fragment, and the C-terminus of the heavy chain constant domain 1 of the third Fab fragment is fused to the N-terminus of the second Fc region polypeptide.

[1066] In one embodiment according to all aspects and embodiments of the present invention, the polypeptide is an anti-CD3 / CD20 bispecific antibody. In one embodiment, the anti-CD3 / CD20 bispecific antibody is a TCB with CD20 as the second antigen. In one embodiment, the bispecific anti-CD3 / CD20 antibody is RG6026.

[1067] Embodiments of all the foregoing aspects and embodiments:

[1068] In one embodiment of all the aforementioned aspects and embodiments, the expression cassette encoding the one second selection marker is located partially 5' and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises the coding sequence of the one second selection marker without a start codon and a poly A signal.

[1069] In one embodiment of all of the aforementioned aspects and embodiments, the 5' terminal portion of the expression cassette encoding the one second selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by the expression cassette (i.e., positioned downstream of the expression cassette) and the start codon is flanked downstream by a third recombination recognition sequence (i.e., positioned upstream of the third recombination recognition sequence); and the 3' terminal portion of the expression cassette encoding the one second selection marker comprises a coding sequence encoding the one second selection marker lacking a start codon, which coding sequence is flanked upstream by the third recombination recognition sequence and downstream by the expression cassette.

[1070] In one embodiment of all of the aforementioned aspects and embodiments, the start codon is a translation start codon. In one embodiment, the start codon is ATG.

[1071] In one embodiment of all of the foregoing aspects and embodiments, the first deoxyribonucleic acid is integrated into a first vector and the second deoxyribonucleic acid is integrated into a second vector.

[1072] In one embodiment of all the aforementioned aspects and embodiments, each of the expression cassettes comprises, in the 5' to 3' direction, a promoter, a coding sequence and a polyadenylation signal sequence, optionally followed by a terminator sequence.

[1073] In one embodiment of all of the foregoing aspects and embodiments,

[1074] Each expression cassette for an antibody chain comprises, in the 5' to 3' direction, a promoter, the nucleic acid encoding the antibody chain and a polyadenylation signal sequence, and optionally a terminator sequence,

[1075] and

[1076] Each expression cassette encoding the selectable marker comprises, in the 5' to 3' direction, a promoter, the nucleic acid encoding the selectable marker and a polyadenylation signal sequence, and optionally a terminator sequence.

[1077] In one embodiment of all of the aforementioned aspects and embodiments, the promoter is human CMV promoter with or without intron A, the polyadenylation signal sequence is a bGH poly A site, and the terminator is an hGT terminator.

[1078] The terminator sequence prevents the production of very long RNA transcripts by RNA polymerase II, which are read through to the next expression cassette in the deoxyribonucleic acid according to the invention and used in the method according to the invention. That is, the expression of the target structural gene is controlled by its own promoter.

[1079] Therefore, efficient transcription termination is achieved by the combination of a polyadenylation signal and a terminator sequence. That is, the presence of a double termination signal prevents readthrough by RNA polymerase II. The terminator sequence initiates complex disassembly and promotes the dissociation of RNA polymerase from the DNA template.

[1080] In one embodiment of all of the aforementioned aspects and embodiments, for the expression cassette other than the selection marker, the promoter is the human CMV promoter with intron A, the polyadenylation signal sequence is the bGH polyadenylation signal sequence, and the terminator is the hGT terminator, wherein for the expression cassette of the selection marker, the promoter is the SV40 promoter, and the polyadenylation signal sequence is the SV40 polyadenylation signal sequence and the terminator is not present.

[1081] In one embodiment of all of the foregoing aspects and embodiments, the mammalian cell is a CHO cell. In one embodiment, the CHO cell is a CHO-K1 cell.

[1082] In one embodiment of all of the foregoing aspects and embodiments, the antibody is a therapeutic antibody.

[1083] In one embodiment of all of the aforementioned aspects and embodiments, neither the first light chain nor the second light chain of the trivalent bispecific antibody is a common light chain or a universal light chain.

[1084] In one embodiment of all the aforementioned aspects and embodiments, the second heavy chain variable domain and the first light chain variable domain form a first binding site, and the first heavy chain variable domain and the second light chain variable domain form a second binding site.

[1085] In a preferred embodiment of all the aforementioned aspects and embodiments, exactly two deoxyribonucleic acids are contained or introduced.

[1086] The individual expression cassettes in the deoxyribonucleic acid according to the present invention are arranged sequentially. The distance between the end of one expression cassette and the start of the subsequent expression cassette is only a few nucleotides, which is required by the cloning process, i.e. the result of the cloning process.

[1087] In one embodiment of all of the foregoing aspects and embodiments, two immediately subsequent expression cassettes are separated by at most 100 bps (i.e., at most 100 base pairs (bps) from the end of the poly A signal sequence or terminator sequence to the start of the subsequent promoter element, respectively). In one embodiment, two immediately subsequent expression cassettes are separated by at most 50 bps. In a preferred embodiment, two immediately subsequent expression cassettes are separated by at most 30 bps. DETAILED DESCRIPTION

[1088] The present invention is based at least in part on the discovery that the use of a defined and specific expression cassette organization format for the expression of trivalent bispecific antibodies, which are complex molecules comprising different polypeptides, i.e., heteromultimers, results in efficient expression and production of the trivalent bispecific antibodies in mammalian cells, such as CHO cells.

[1089] The present invention is based, at least in part, on the discovery that dual recombinase-mediated cassette exchange (RMCE) can be used to generate recombinant mammalian cells, such as recombinant CHO cells, in which a defined and specific expression cassette sequence has been integrated into the genome, which in turn leads to efficient expression and production of trivalent bispecific antibodies. This integration is achieved by targeted integration at a specific site in the mammalian cell genome. As a result, it is possible to control the expression ratio of the different polypeptides of the heteromultimeric trivalent bispecific antibody relative to each other. Thus, efficient expression, correct assembly, and successful secretion of correctly folded and assembled trivalent bispecific antibodies are achieved with high expression yields.

[1090] The present invention is based, at least in part, on the discovery that the use of a defined and specific expression cassette organization format for the expression of trivalent antibodies (e.g., TCBs), which are complex molecules comprising different polypeptides, i.e., heteromultimers, results in efficient expression and production of the trivalent, bispecific antibodies in mammalian cells, such as CHO cells.

[1091] The present invention is based, at least in part, on the discovery that dual recombinase-mediated cassette exchange (RMCE) can be used to generate recombinant mammalian cells, such as recombinant CHO cells, in which a defined and specific expression cassette sequence has been integrated into the genome, which in turn leads to efficient expression and production of trivalent antibodies (e.g., TCBs). This integration is achieved by targeted integration at a specific site in the mammalian cell genome. Thus, it is possible to control the expression ratio of the different polypeptides of a heteromultimeric trivalent antibody (e.g., TCB) relative to each other. Thus, efficient expression, correct assembly, and successful secretion of correctly folded and assembled trivalent antibodies (e.g., TCBs) are achieved with high expression yields.

[1092] The present invention is based at least in part on the discovery that the use of a defined and specific expression cassette organization format for the expression of trivalent bispecific antibodies results in efficient expression and production of the bivalent bispecific antibodies, which are complex molecules comprising different polypeptides, i.e., heteromultimers, in mammalian cells, such as CHO cells.

[1093] The present invention is based, at least in part, on the discovery that dual recombinase-mediated cassette exchange (RMCE) can be used to generate recombinant mammalian cells, such as recombinant CHO cells, in which a defined and specific expression cassette sequence has been integrated into the genome, which in turn leads to efficient expression and production of bivalent bispecific antibodies. This integration is achieved by targeted integration at a specific site in the mammalian cell genome. As a result, it is possible to control the expression ratio of the different polypeptides of the heteromultimeric bivalent bispecific antibody relative to each other. Thus, efficient expression, correct assembly, and successful secretion of correctly folded and assembled bivalent bispecific antibodies are achieved with high expression yields.

[1094] The present invention is based, at least in part, on the discovery that the number of clones obtained by targeted integration can be improved if Cre mRNA is used as the sole source of Cre recombinase, for example, compared to the use of Cre DNA (Cre plasmid). More specifically, it has been found that after a selection period, the absolute number of clones in a pool of recombinant cells generated by Cre mRNA is higher than the number of clones in a pool of recombinant cells generated by Cre plasmid (see Examples 10 and 11). Figure 2 、 3 and 4). Thus, by using CRE mRNA instead of CRE plasmid, a recombinant cell library with greater size and heterogeneity was generated. Without being bound by this theory, it is hypothesized that this increases the likelihood of identifying recombinant cell clones with high titers and good product quality. Furthermore, the increase in the number of recombinant cell clones from the CRE mRNA-generated library compared to the CRE plasmid-generated library is stable.

[1095] I. Definition

[1096] Methods and techniques that can be used to practice the present invention are described, for example, in Ausubel, FM (ed.), Current Protocols in Molecular Biology, Vols. I to III (1997); Glover, ND and Hames, BD (eds.), DNA Cloning: A Practical Approach, Vols. I and II (1985), Oxford University Press; Freshney, RI (ed.), Animal Cell Culture a practical approach, IRL Press Limited (1986); Watson, JD et al., Recombinant DNA, 2nd ed., CHS L Press (1992); Winnacker, EL, From Genes to Clones; NY, VCH Publishers (1987); Celis, J. (ed.), Cell Biology, 2nd ed., Academic Press (1998); Freshney, RI, Culture of Animal Cells: A Manual of Basic Technique, 2nd ed., Alan R. Liss, Inc., NY (1987).

[1097] Derivatives of nucleic acids can be generated using recombinant DNA technology. Such derivatives can be modified, for example, by substitution, alteration, exchange, deletion or insertion at a single or several nucleotide positions. Modification or derivatization can be performed, for example, by means of site-directed mutagenesis. Such modifications can be easily performed by those skilled in the art (see, for example, Sambrook, J. et al., Molecular Cloning: A laboratory manual (1999) Cold Spring Harbor Laboratory Press, New York, USA; Hames, BD and Higgins, SG, Nucleic acid hybridization apractical approach (1985) IRL Press, Oxford, England).

[1098] It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth. Similarly, the terms "a," "one," and "at least one" are used interchangeably herein. It should also be noted that the terms "comprising," "including," and "having" are used interchangeably.

[1099] The term "about" means a range of + / - 20% of the numerical value that follows. In one embodiment, the term "about" means a range of + / - 10% of the numerical value that follows. In one embodiment, the term "about" means a range of + / - 5% of the numerical value that follows.

[1100] The term "Cre recombinase" refers to a tyrosine recombinase that catalyzes site-specific recombinase using a topoisomerase I-like mechanism between LoxP sites. This enzyme has a molecular weight of approximately 38 kDa and consists of 343 amino acid residues. It is a member of the integrase family. The amino acid sequence of Cre recombinase is:

[1101] MSNLLTVHQN LPALPVDATS DEVRKNLMDM FRDRQAFSEH TWKMLLSVCR SWAAWCKLNNRKWFPAEPED VRDYLLYLQA RGLAVKTIQQ HLGQLNMLHR RSGLPRPSDS NAVSLVMRRI RKENVDAGERAKQALAFERT DFDQVRSLME NSDRCQDIRN LAFLGIAYNT LLRIAEIARI RVKDISRTDG GRMLIHIGRTKTLVSTAGVE KALSLGVTKL VERWISVSGV ADDPNNYLFC RVRKNGVAAP SATSQLSTRA LEGIFEATHRLIYGAKDDSG QRYLAWSGHS ARVGAARDMA RAGVSIPEIM QAGGWTNVNI VMNYIRNLDS ETGAMVRLLEDGD

[1102] (SEQ ID NO: 20)

[1103] Cre mRNA contains the following sequence:

[1104] AUGAGCAACC UGCUGACCGU GCACCAGAAC CUGCCCGCCC UGCCCGUGGA CGCCACCAGCGACGAGGUGA GGAAGAACCU GAUGGACAUG UUCAGGGACA GGCAGGCCUU CAGCGAGCAC ACCUGGAAGAUGCUGCUGAG CGUGUGCAGGAGCUGGGCCG CCUGGUGCAA GCUGAACAAC AGGAAGUGGU UCCCCGCCGAGCCCGAGGAC GUGAGGGACU ACCUGCUGUA CCUGCAGGCC AGGGGCCUGG CCGUGAAGAC CAUCCAGCAGCACCUGGGCC AGCUGAACAU GCUGCACAGG AGGAGCGGCC UGCCCAGGCC CAGCGACAGC AACGCCGUGAGCCUGGUGAU GAGGAGGAUC AGGAAGGAGA ACGUGGACGC CGGCGAGAGG GCCAAGCAGG CCCUGGCCUUCGAGAGGACC GACUUCGACC AGGUGAGGAG CCUGAUGGAG AACAGCGACA GGUGCCAGGA CAUCAGGAACCUGGCCUUCC UGGGCAUCGC CUACAACACC CUGCUGAGGA UCGCCGAGAU CGCCAGGAUC AGGGUGAAGGACAUCAGCAG GACCGACGGC GGCAGGAUGC UGAUCCACAU CGGCAGGACC AAGACCCUGG UGAGCACCGCCGGCGUGGAG AAGGCCCUGA GCCUGGGCGU GACCAAGCUG GUGGAGAGGU GGAUCAGCGU GAGCGGCGUGGCCGACGACC CCAACAACUA CCUGUUCUGC AGGGUGAGGA AGAACGGCGU GGCCGCCCCC AGCGCCACCAGCCAGCUGAG CACCAGGGCC CUGGAGGGCA UCUUCGAGGC CACCCACAGG CUGAUCUACG GCGCCAAGGACGACAGCGGC CAGAGGUACC UGGCCUGGAG CGGCCACAGC GCCAGGGUGG GCGCCGCCAG GGACAUGGCCAGGGCCGGCG UGAGCAUCCCCGAGAUCAUG CAGGCCGGCG GCUGGACCAA CGUGAACAUC GUGAUGAACUACAUCAGGAA CCUGGACAGC GAGACCGGCG CCAUGGUGAG GCUGCUGGAG GACGGCGAC

[1105] (SEQ ID NO:21)

[1106] or codon-optimized variants thereof.

[1107] The term "comprising" also encompasses the term "consisting of".

[1108] The term "CD20-TCB" as used herein refers to a TCB targeting CD20 (CD20-TCB; RG6026; an anti-CD3 / CD20 antibody in TCB format) that has a long half-life and high potency, which is achieved by high-affinity bivalent binding to CD20 and a head-to-tail orientation of the B and T cell binding domains in a previously characterized 2:1 TCB molecule format (see, e.g., Bacac, M. et al. Clin. Cancer Res. 22 (2016) 3286-3297; Bacac, M. et al. Oncoimmunology 5 (2016) e1203498).

[1109] The term "mammalian cell comprising an exogenous nucleotide sequence" encompasses cells into which one or more exogenous nucleic acids (including progeny of such cells) have been introduced and which are intended to form a starting point for further genetic modification. Thus, the term "mammalian cell comprising an exogenous nucleotide sequence" encompasses cells comprising an exogenous nucleotide sequence integrated at a single site within the locus of the mammalian cell genome, wherein the exogenous nucleotide sequence comprises at least a first recombination recognition sequence and a second recombination recognition sequence (these recombinase recognition sequences are different) flanking at least one first selection marker. In one embodiment, the mammalian cell comprising an exogenous nucleotide sequence is a cell comprising an exogenous nucleotide sequence integrated at a single site within the locus of the host cell genome, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanking at least one first selection marker, and a third recombination recognition sequence between the first and second recombination recognition sequences, and all recombination recognition sequences are different.

[1110] As used herein, the term "nuclear localization sequence" refers to an amino acid sequence comprising multiple copies of the positively charged amino acid residues arginine and / or lysine. Polypeptides comprising such sequences are recognized by cells for import into the nucleus. Exemplary nuclear localization sequences are PKKKRKV (SEQ ID NO: 33; SV40 large T antigen), KR[PAATKKAGQA]KKKK (SEQ ID NO: 34, SV40 nucleoplasmic protein), MSRRRKANPTKLSENAKKLAKEVEN (SEQ ID NO: 35; Caenorhabditis elegans EGL-13), PAAKRVKLD (SEQ ID NO: 36, human c-myc), and KLKIKRPVK (SEQ ID NO: 37, Escherichia coli terminal utilization substance protein). Other nuclear localization sequences can be readily identified by those skilled in the art.

[1111] As used herein, the term "recombinant cell" refers to a cell that has been genetically modified to express a polypeptide of interest and can be used to produce the polypeptide of interest on any scale. For example, a "mammalian cell comprising an exogenous nucleotide sequence" that has undergone recombinase-mediated cassette exchange (RMCE) such that the coding sequence for the polypeptide of interest has been introduced into the genome of the host cell is a "recombinant cell." Although such a cell is still capable of undergoing further RMCE reactions, it is undesirable to do so.

[1112] The term "LoxP site" refers to a nucleotide sequence with a length of 34 bp, which consists of two palindromic 13 bp sequences at the ends (ATAACTTCGTATA (SEQ ID NO: 22) and TATACGAAGTTAT (SEQ ID NO: 23) respectively) and a central 8 bp core (asymmetric) spacer sequence. The core spacer sequence determines the orientation of the LoxP site. Depending on the relative orientation and position of the LoxP sites relative to each other, the inserted DNA is either excised (LoxP sites facing the same direction) or inverted (LoxP sites facing opposite directions). The term "floxed" refers to a DNA sequence located between two LoxP sites. If there are two floxed sequences, i.e., the target floxed sequence in the genome and the floxed sequence in the donor nucleic acid, these two sequences can be exchanged with each other. This is called "recombinase-mediated cassette exchange".

[1113] Exemplary LoxP sites are shown in the table below:

[1114] name core SEQ ID NO: wild type ATGTATGC 24 L3 AAGTCTCC 25 2L GCATACAT 26 LoxFas TACCTTTC 27 lox 511 ATGTATAC 28 lox 5171 ATGTGTAC 29 lox 2272 AAGTATCC 30 M2 AGAAACCA 31 M3 TAATACCA 32

[1115] Both "mammalian cells comprising an exogenous nucleotide sequence" and "recombinant cells" are "transformed cells." The term encompasses the primary transformed cell and progeny derived therefrom, regardless of the number of passages. For example, progeny may not be identical to the nucleic acid content of the parent cell but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are encompassed.

[1116] An "isolated" composition is one that has been separated from the components of its natural environment. In some embodiments, the composition is purified to a purity greater than 95% or 99%, as determined by, for example, electrophoresis (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis, CE-SDS) or chromatography (e.g., size exclusion chromatography or ion exchange or reversed-phase HPLC). For a review of methods for assessing, for example, antibody purity, see Flatman, S. et al., J. Chrom. B 848 (2007) 79-87.

[1117] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[1118] An "isolated" polypeptide or antibody is one that has been separated from a component of its natural environment.

[1119] The term "integration site" refers to a nucleic acid sequence within a cell's genome into which an exogenous nucleotide sequence has been inserted. In certain embodiments, the integration site is between two adjacent nucleotides in the cell's genome. In certain embodiments, the integration site comprises a stretch of nucleotide sequence. In certain embodiments, the integration site is located within a specific locus in the genome of a mammalian cell. In certain embodiments, the integration site is within an endogenous gene in the mammalian cell.

[1120] As used herein, the terms "vector" or "plasmid" (used interchangeably) refer to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures, as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[1121] The term "binding to" refers to the binding of a binding site to its target, such as the binding of an antibody binding site comprising an antibody heavy chain variable domain and an antibody light chain variable domain to a corresponding antigen. Such binding can be achieved using, for example, Assay (GE Healthcare, Uppsala, Sweden). That is, the term "binding (to an antigen)" means that the antibody binds to its antigen in an in vitro assay. In one embodiment, binding is determined in a binding assay in which the antibody is bound to a surface and the binding of the antigen to the antibody is measured by surface plasmon resonance (SPR). Binding means, for example, binding affinity (K D ) is 10 -8 M or less, in some embodiments 10 -13 M to 10 -8 M, in some embodiments, is 10 -13 M to 10 -9 M. The term "binding" also includes the term "specific binding".

[1122] For example, in In one possible embodiment of the assay, the antigen is bound to a surface and the binding of the antibody (ie, its binding site) is measured by surface plasmon resonance (SPR). The affinity of the binding is expressed in terms of k a (association constant: rate constant for association to form a complex), k d (dissociation constant: rate constant for complex dissociation) and K D (k d / k a Alternatively, the binding signal of the SPR sensorgram can be directly compared with the response signal of a reference in terms of resonance signal height and dissociation behavior.

[1123] The term "binding site" refers to any protein entity that exhibits binding specificity for a target. This can be, for example, a receptor, a receptor ligand, an anticalin, an affibody, an antibody, etc. Thus, as used herein, the term "binding site" refers to a polypeptide that can specifically bind to or can be specifically bound by a second polypeptide.

[1124] As used herein, the term "selective marker" refers to a gene that allows specific selection or exclusion of cells carrying the gene in the presence of a corresponding selective agent. For example, but not limited to, a selective marker can allow positive selection of host cells transformed with the selective marker gene in the presence of a corresponding selective agent (selective culture conditions); untransformed host cells will not be able to grow or survive under these selective culture conditions. Selective markers can be positive, negative, or bifunctional. Positive selection markers can allow selection of cells carrying the marker, while negative selection markers can allow selective elimination of cells carrying the marker. Selective markers can confer resistance to drugs, or compensate for metabolic or catabolism defects in host cells. In prokaryotic cells, genes that confer resistance to ampicillin, tetracycline, kanamycin, or chloramphenicol, as well as other genes, can be used. Resistance genes that can be used as selectable markers in eukaryotic cells include, but are not limited to, genes for aminoglycoside phosphotransferases (APHs) (e.g., hygromycin phosphotransferase (HYG), neomycin, and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthetase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, Zeocin, and mycophenolic acid. Additional marker genes are described in WO 92 / 08796 and WO 94 / 28143.

[1125] In addition to facilitating selection in the presence of a corresponding selective agent, a selectable marker may alternatively be a molecule not normally present in the cell, such as green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire. Cells expressing such a molecule can be distinguished from cells not containing the gene, for example, by detecting fluorescence emitted by the encoded polypeptide or the absence of such fluorescence, respectively.

[1126] As used herein, the term "operably connected" refers to the juxtaposition of two or more components, wherein the relationship of these components allows them to play a role in an expected manner. For example, if a promoter and / or enhancer are used to regulate the transcription of a coding sequence, the promoter and / or enhancer are operably connected to the coding sequence. In certain embodiments, the DNA sequence of "operably connected" is connected and adjacent on a single chromosome. In certain embodiments, for example, when two protein coding regions (such as a secretory leader and a polypeptide) must be joined, these sequences are connected, adjacent, and in the same reading frame. In certain embodiments, the promoter that is operably connected is located upstream of the coding sequence and can be adjacent to the coding sequence. In certain embodiments, for example, about the enhancer sequence that regulates the expression of the coding sequence, these two components can be operably connected, but are not adjacent. If an enhancer increases the transcription of a coding sequence, the enhancer is operably connected to the coding sequence. The enhancer that is operably connected can be located upstream, inside, or downstream of the coding sequence and can be located at a position quite far away from the promoter of the coding sequence. Operable linkage can be accomplished by recombination methods known in the art (e.g., using PCR methods and / or by connecting at convenient restriction sites). If there are no convenient restriction sites, synthetic oligonucleotide adapters or linkers can be used according to conventional practice. An internal ribosome entry site (IRES) is operably linked to an open reading frame (ORF) if it allows translation of the ORF to be initiated at an internal position independent of the 5' end.

[1127] As used herein, the term "flanking" refers to a first nucleotide sequence located at the 5' end or the 3' end or both ends of a second nucleotide sequence. The flanking nucleotide sequence can be adjacent to the second nucleotide sequence or at a defined distance therefrom. The length of the flanking nucleotide sequence is not specifically limited. For example, the flanking sequence can have a few base pairs or several thousand base pairs.

[1128] As used herein, the term "exogenous" refers to a nucleotide sequence that is not derived from a specific cell, but is introduced into the cell by a DNA delivery method (e.g., by a transfection method, an electroporation method, or a transformation method). Therefore, an exogenous nucleotide sequence is an artificial sequence, wherein the artificiality can be derived from, for example, a combination of subsequences from different sources (e.g., a combination of a recombinase recognition sequence with an SV40 promoter and a coding sequence for a green fluorescent protein is an artificial nucleic acid) or from a sequence (e.g., a sequence that only encodes the extracellular domain or cDNA of a membrane-bound receptor) or a partial deletion, or a nuclear base mutation. The term "endogenous" refers to a nucleotide sequence derived from a cell. An "exogenous" nucleotide sequence can have an "endogenous" counterpart with the same base composition, but wherein the "exogenous" sequence is, for example, introduced into a cell via recombinant DNA technology.

[1129] Antibody

[1130] General information on the nucleotide sequences of human immunoglobulin light and heavy chains is given in: Kabat, EA et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991).

[1131] The term "heavy chain" is used herein in its original meaning, i.e., to refer to the two larger polypeptide chains of the four polypeptide chains that form an antibody (see, e.g., Edelman, GM and Gally JA, J. Exp. Med. 116 (1962) 207-227). The term "larger" in this context may refer to any of molecular weight, length, and number of amino acids. The term "heavy chain" is independent of the sequence and number of individual antibody domains present therein. It is assigned solely based on the molecular weight of the corresponding polypeptide.

[1132] The term "light chain" is used herein in its original meaning, i.e., to refer to the smaller of the four polypeptide chains that form an antibody (see, e.g., Edelman, GM and Gally JA, J. Exp. Med. 116 (1962) 207-227). The term "smaller" in this context may refer to any of molecular weight, length, and number of amino acids. The term "light chain" is independent of the sequence and number of individual antibody domains present therein. It is assigned solely based on the molecular weight of the corresponding polypeptide.

[1133] As used herein, the amino acid positions of all constant regions and domains of heavy and light chains are numbered according to the Kabat numbering system described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991), and are referred to herein as "numbered according to Kabat." Specifically, the Kabat numbering system of Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991) (see pp. 647-660) is used for the light chain constant domains, CL, of the kappa and lambda isotypes, and the Kabat EU index numbering system of Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991) (see pp. 661-723) is used for the constant heavy chain domains (CH1, hinge, CH2, and CH3, which are further classified herein by being referred to in this context as "numbering according to the EU index as Kabat").

[1134] The term "antibody" herein is used in the broadest sense and encompasses various antibody structures including, but not limited to, full-length antibodies, monoclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody-antibody fragment fusions, and combinations thereof.

[1135] The term "natural antibody" refers to a naturally occurring immunoglobulin molecule with different structures. For example, a natural IgG antibody is a heterotetrameric glycoprotein of approximately 150,000 daltons, consisting of two identical light chains and two identical heavy chains bonded together by disulfide bonding. From N-terminus to C-terminus, each heavy chain has a heavy chain variable region (VH), followed by three heavy chain constant domains (CH1, CH2, and CH3), whereby a hinge region is positioned between the first heavy chain constant domain and the second heavy chain constant domain. Similarly, from N-terminus to C-terminus, each light chain has a light chain variable region (VL), followed by a light chain constant domain (CL). The light chain of an antibody can be classified into one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of its constant domain.

[1136] The term "full-length antibody" refers to an antibody having a structure that is substantially similar to that of a natural antibody. A full-length antibody comprises two or more full-length antibody light chains and two heavy chains, each full-length antibody light chain comprising a variable region and a constant domain in the N-terminal to C-terminal direction, and each heavy chain comprising a variable region, a first constant domain, a hinge region, a second constant domain, and a third constant domain in the N-terminal to C-terminal direction. In contrast to natural antibodies, a full-length antibody may comprise additional immunoglobulin domains, for example, one or more additional scFvs, or heavy or light chain Fab fragments, or scFab conjugated to one or more ends of different chains of the full-length antibody, but only one fragment is conjugated to each end. These conjugates are also encompassed by the term full-length antibody.

[1137] The term "antibody binding site" refers to a pair of heavy chain variable domains and light chain variable domains. In order to ensure correct binding to the antigen, these variable domains are homologous variable domains, i.e., they belong to the same family. The antibody binding site comprises at least three HVRs (e.g., in the case of VHH) or three to six HVRs (e.g., in the case of naturally occurring, conventional antibodies with VH / VL pairs). Generally, the amino acid residues of the antibody responsible for antigen binding form the binding site. These residues are generally contained in a pair of antibody heavy chain variable domains and corresponding antibody light chain variable domains. The antigen binding site of an antibody comprises amino acid residues from "hypervariable regions" or "HVRs." "Framework" or "FR" regions are those variable domain regions other than the hypervariable region residues defined herein. Therefore, the light chain variable domains and heavy chain variable domains of an antibody comprise regions FR1, HVR1, FR2, HVR2, FR3, HVR3, and FR4 from N-terminus to C-terminus. In particular, the HVR3 region of the heavy chain variable domain is the region that is most conducive to antigen binding and defines antibody binding specificity. "Functional binding site" is capable of binding to its target. In one embodiment of a binding assay, the term "specific binding" refers to the binding of a binding site to its target in an in vitro assay. This binding assay can be any assay that detects a binding event. For example, an assay in which an antibody is bound to a surface and the binding of an antigen to an antibody are assayed by surface plasmon resonance (SPR). Alternatively, a bridge ELISA can be used.

[1138] As used herein, the term "hypervariable region" or "HVR" refers to each of the following: regions of an antibody variable domain comprising stretches of amino acid residues that are hypervariable in sequence ("complementarity determining regions" or "CDRs") and / or form structurally defined loops ("hypervariable loops") and / or contain antigen contact residues ("antigen contact points"). Typically, an antibody comprises six HVRs; three in the heavy chain variable domain VH (H1, H2, H3) and three in the light chain variable domain VL (L1, L2, L3).

[1139] HVR includes

[1140] (a) Hypervariable loops present at amino acid residues 26-32 (L1), 50-52 (L2), 91-96 (L3), 26-32 (H1), 53-55 (H2), and 96-101 (H3) (Chothia, C and Lesk, AM, J. Mol. Biol. 196 (1987) 901-917);

[1141] (b) CDRs present at amino acid residues 24-34 (L1), 50-56 (L2), 89-97 (L3), 31-35b (H1), 50-65 (H2), and 95-102 (H3) (Kabat, EA et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991), NIH Publication 91-3242);

[1142] (c) antigenic contact points present at amino acid residues 27c-36 (L1), 46-55 (L2), 89-96 (L3), 30-35b (H1), 47-58 (H2), and 93-101 (H3) (MacCallum et al., J. Mol. Biol. 262:732-745 (1996)); and

[1143] (d) a combination of (a), (b) and / or (c), comprising amino acid residues 46-56 (L2), 47-56 (L2), 48-56 (L2), 49-56 (L2), 26-35 (H1), 26-35b (H1), 49-65 (H2), 93-102 (H3) and 94-102 (H3).

[1144] Unless otherwise indicated, HVR residues and other residues in the variable domain (e.g., FR residues) are numbered herein according to Kabat et al., supra.

[1145] The "class" of an antibody refers to the type of constant domain or constant region (preferably an Fc region) possessed by the antibody's heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and some of them can be further divided into subclasses (isotypes), for example, IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.

[1146] The term "heavy chain constant region" refers to an immunoglobulin heavy chain region comprising a constant domain, i.e., for natural immunoglobulin CH1 domain, hinge region, CH2 domain, and CH3 domain, or for the first constant domain, hinge region, second constant domain, and third constant domain of a full-length immunoglobulin. In one embodiment, the human IgG heavy chain constant region extends from Ala118 to the carboxyl terminus of the heavy chain (numbered according to the Kabat EU index). However, the C-terminal lysine (Lys447) of the constant region may be present or absent (numbered according to the Kabat EU index). The term "constant region" refers to a dimer comprising two heavy chain constant regions, which may be covalently linked to each other by hinge region cysteine ​​residues to form an interchain disulfide bond.

[1147] The term "heavy chain Fc region" refers to the C-terminal region of an immunoglobulin heavy chain, which comprises at least a portion of a hinge region (middle hinge region and lower hinge region), a second constant domain (e.g., a CH2 domain), and a third constant domain (e.g., a CH3 domain). In one embodiment, the human IgG heavy chain Fc region extends from Asp221 or from Cys226 or from Pro230 to the carboxyl terminus of the heavy chain (numbered according to the Kabat EU index). Therefore, the Fc region is smaller than the constant region but is consistent with it in the C-terminal portion. However, the C-terminal lysine (Lys447) in the heavy chain Fc region may be present or absent (numbered according to the Kabat EU index). The term "Fc region" refers to a dimer comprising two heavy chain Fc regions, which may be covalently linked to each other by hinge region cysteine ​​residues to form an interchain disulfide bond.

[1148] The constant region of an antibody, more specifically the Fc region (and the constant region as well), is directly involved in complement activation, C1q binding, C3 activation, and Fc receptor binding. While the effect of an antibody on the complement system depends on certain conditions, binding to C1q is caused by a defined binding site in the Fc region. Such binding sites are known in the prior art and are described, for example, by Lukas, TJ et al., J. Immunol. 127 (1981) 2555-2560; Brunhouse, R. and Cebra, JJ, Mol. Immunol. 16 (1979) 907-917; Burton, DR et al., Nature 288 (1980) 338-344; Thommesen, JE et al., Mol. Immunol. 37 (2000) 995-1004; Idusogie, EE et al., J. Immunol. 164 (2000) 4178-4184; Hezareh, M. et al., J. Virol. 75 (2001) 12161-12168; Morgan, A. et al., Immunology 86 (1995) 319-324; and EP 0 307 434. Such binding sites are, for example, L234, L235, D270, N297, E318, K320, K322, P331 and P329 (numbered according to the Kabat EU index). Antibodies of the IgG1, IgG2 and IgG3 subclasses typically exhibit complement activation, C1q binding and C3 activation, while IgG4 does not activate the complement system, does not bind C1q and does not activate C3. The term "Fc region of an antibody" is well known to those skilled in the art and is defined based on the cleavage of an antibody by papain.

[1149] The term "monoclonal antibody" as used herein refers to an antibody obtained from a substantially homogeneous antibody population, that is, except for possible variant antibodies (for example, containing naturally occurring mutations or produced during the production of monoclonal antibody preparations, such variants are generally presented in small amounts), the individual antibodies comprising the population are identical and / or bind identical epi-positions. Contrary to the polyclonal antibody preparations typically comprising different antibodies for different determinants (epi-positions), each monoclonal antibody in the monoclonal antibody preparation is directed to a single determinant on the antigen. Therefore, the modifier "monoclonal" represents that the characteristic of an antibody is obtained from a substantially homogeneous antibody population, and should not be construed as requiring antibody production by any ad hoc method. For example, monoclonal antibodies can be prepared by a variety of techniques, including but not limited to hybridoma methods, recombinant DNA methods, phage display methods, and methods utilizing transgenic animals comprising all or part of human immunoglobulin loci.

[1150] The term "valent" as used in this application indicates the presence of a specified number of binding sites in an antibody. Thus, the terms "bivalent," "tetravalent," and "hexavalent" indicate the presence of two binding sites, four binding sites, and six binding sites, respectively, in an antibody.

[1151] "Monospecific antibody" refers to an antibody with a single binding specificity, i.e., it specifically binds to one antigen. Monospecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab'2)), or combinations thereof (e.g., full-length antibodies plus additional scFv or Fab fragments). Monospecific antibodies need not be monovalent, i.e., a monospecific antibody may contain more than one binding site that specifically binds to one antigen. For example, natural antibodies are monospecific but bivalent.

[1152] "Multispecific antibody" means having binding specificity for at least two different epitopes or two different antigens on the same antigen. Multispecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2 bispecific antibodies) or combinations thereof (e.g., full-length antibodies plus additional scFv or Fab fragments). Multispecific antibodies are at least bivalent, i.e., contain two antigen-binding sites. Furthermore, multispecific antibodies are at least bispecific. Therefore, bivalent bispecific antibodies are the simplest form of multispecific antibodies. Engineered antibodies with two, three or more (e.g., four) functional antigen-binding sites have also been reported (e.g., see US 2002 / 0004587 A1).

[1153] In certain embodiments, the antibody is a multispecific antibody, such as at least a bispecific antibody. A multispecific antibody is a monoclonal antibody that has binding specificities for at least two antigens or epitopes. In certain embodiments, one of the binding specificities is for a first antigen, while the other is for a different second antigen. In certain embodiments, a multispecific antibody can bind to two different epitopes of the same antigen. Multispecific antibodies can also be used to localize cytotoxic agents to cells expressing the antigens.

[1154] Techniques for making multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs of different specificities (see Milstein, C. and Cuello, AC, Nature 305 (1983) 537-540, WO 93 / 08829, and Traunecker, A. et al., EMBO J. 10 (1991) 3655-3659) and "knob-in-hole" engineering (see, e.g., US 5,731,168). Multispecific antibodies can also be prepared by the following methods: engineering electrostatic manipulation effects to prepare antibody Fc heterodimeric molecules (WO 2009 / 089004); cross-linking two or more antibodies or fragments (see, for example, US 4,676,980, and Brennan, M. et al., Science 229 (1985) 81-83); using leucine zippers to produce bispecific antibodies (see, for example, Kostelny, SA et al., J. Immunol. 148 (1992) 1547-1553); using specific technologies to prepare bispecific antibody fragments (see, for example, Holliger, P. et al., Proc. Natl. Acad. Sci. USA 90 (1993) 6444-6448); using single-chain Fv (scFv) dimers (Gruber, M. et al., J. Immunol. 152 (1994) 5368-5374); and preparing trispecific antibodies as described in Tutt, A. et al., J. Immunol. 147 (1991) 60-69.

[1155] The antibody or fragment may also be a multispecific antibody as described in WO 2009 / 080251, WO 2009 / 080252, WO 2009 / 080253, WO 2009 / 080254, WO 2010 / 112193, WO 2010 / 115589, WO 2010 / 136172, WO 2010 / 145792 or WO 2010 / 145793.

[1156] The antibody or fragment thereof may also be a multispecific antibody as disclosed in WO 2012 / 163520.

[1157] Bispecific antibodies are generally antibody molecules that specifically bind to two different, non-overlapping epitopes on the same antigen or to two epitopes on different antigens.

[1158] The term "non-overlapping" in this context means that the amino acid residues comprised in the first paratope of the bispecific Fab are not comprised in the second paratope, and the amino acids comprised in the second paratope of the bispecific Fab are not comprised in the first paratope.

[1159] The "knob-in-hole" dimerization module and its use in antibody engineering is described in Carter P., Ridgway JBB, Presta LG: Immunotechnology, Volume 2, Number 1, February 1996, pp. 73-73(1).

[1160] The CH3 domain in an antibody heavy chain can be altered using the "knob-into-hole" technique, which is described in detail with several examples in, for example, WO 96 / 027011, Ridgway, JB et al., Protein Eng. 9 (1996) 617-621, and Merchant, AM et al., Nat. Biotechnol. 16 (1998) 677-681. In this approach, the interaction surfaces of the two CH3 domains are altered to increase heterodimerization of the two CH3 domains, thereby increasing heterodimerization of the polypeptides containing them. One of the two CH3 domains (of the two heavy chains) can be a "knob" and the other a "hole." The introduction of disulfide bridges further stabilizes the heterodimer (Merchant, AM et al., Nature Biotech. 16 (1998) 677-681; Atwell, S. et al., J. Mol. Biol. 270 (1997) 26-35) and increases the yield.

[1161] The mutation T366W in the CH3 domain (of the antibody heavy chain) is denoted as a "knob mutation" or "mutated knob," and the mutations T366S, L368A, and Y407V in the CH3 domain (of the antibody heavy chain) are denoted as "hole mutations" or "mutated hole" (numbering according to the Kabat EU index). Additional interchain disulfide bridges between the CH3 domains can also be used by introducing the S354C mutation into the CH3 domain of the heavy chain with a "knob mutation" (denoted as "knob-cys-mutation" or "mutated knob-cys") or by introducing the Y349C mutation into the CH3 domain of the heavy chain with a "hole mutation" (denoted as "hole-cys-mutation" or "mutated hole-cys") (numbering according to the Kabat EU index) (Merchant, AM et al., Nature Biotech. 16 (1998) 677-681).

[1162] As used herein, the term "domain crossing" means that in an antibody heavy chain VH-CH1 fragment and its corresponding cognate antibody light chain pair, i.e. in an antibody Fab (fragment antigen binding), the domain sequence deviates from the sequence in a native antibody in that at least one heavy chain domain is replaced by its corresponding light chain domain, or vice versa. There are three general types of domain crossings: (i) crossings of CHI and CL domains, which results from domain crossings in the light chain to produce a VL-CHI domain sequence, and from domain crossings in the heavy chain fragment to produce a VH-CL domain sequence (or a full-length antibody heavy chain having a VH-CL-hinge-CH2-CH3 domain sequence); (ii) domain crossings of VH and VL domains, which results from domain crossings in the light chain to produce a VH-CL domain sequence, and from domain crossings in the heavy chain fragment to produce a VL-CHI domain sequence; and (iii) domain crossings of a complete light chain (VL-CL) and a complete VH-CH1 heavy chain fragment ("Fab crossings"), which results from domain crossings to produce a light chain having a VH-CHI domain sequence, and from domain crossings to produce a heavy chain fragment having a VL-CL domain sequence (all of the aforementioned domain sequences are presented in the N-terminal to C-terminal direction).

[1163] As used herein, the term "replacement of one another" with respect to the corresponding heavy and light chain domains refers to the aforementioned domain intersection. Thus, when the CH1 domain and the CL domain are "replaced with one another," this refers to the domain intersection mentioned under item (i) and the resulting heavy and light chain domain sequences. Thus, when VH and VL are "replaced with one another," this refers to the domain intersection mentioned in item (ii); and when the CH1 and CL domains are "replaced with one another" and the VH and VL domains are "replaced with one another," this refers to the domain intersection mentioned in item (iii). For example, bispecific antibodies comprising domain intersections are reported in WO 2009 / 080251, WO 2009 / 080252, WO 2009 / 080253, WO 2009 / 080254, and Schaefer, W. et al., Proc. Natl. Acad. Sci USA 108 (2011) 11187-11192. Such antibodies are often called CrossMab.

[1164] In one embodiment, the multispecific antibody further comprises at least one Fab fragment comprising a domain intersection of a CH1 domain and a CL domain as described in item (i) above, or a domain intersection of a VH domain and a VL domain as described in item (ii) above, or a domain intersection of a VH-CH1 domain and a VL-VL domain as described in item (iii) above. In the case of a multispecific antibody having domain intersections, Fabs that specifically bind to the same antigen are constructed to have the same domain sequence. Therefore, when a multispecific antibody comprises more than one Fab having domain intersections, the Fabs specifically bind to the same antigen.

[1165] A "humanized" antibody refers to an antibody comprising amino acid residues from non-human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody will comprise substantially all of at least one variable domain, typically two variable domains, wherein all or substantially all of the HVRs (e.g., CDRs) correspond to the HVRs of a non-human antibody, and all or substantially all of the FRs correspond to the FRs of a human antibody. A humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of an antibody, e.g., a non-human antibody, refers to an antibody that has been humanized.

[1166] As used herein, the term "recombinant antibody" refers to all antibodies (chimeric, humanized, and human) prepared, expressed, created, or isolated by recombinant means, such as recombinant cells. This includes antibodies isolated from recombinant cells, such as NSO, HEK, BHK, or CHO cells.

[1167] As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody, which includes a portion of an intact antibody that binds to an antigen, and the antigen binds to the intact antibody, i.e., a functional fragment. Examples of antibody fragments include, but are not limited to, Fv; Fab; Fab'; Fab'-SH; F(ab')2; bispecific Fab, diabodies, linear antibodies, and single-chain antibody molecules (e.g., scFv or scFab).

[1168] As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody, which includes a portion of an intact antibody that binds to an antigen, and the antigen binds to the intact antibody, i.e., a functional fragment. Examples of antibody fragments include, but are not limited to, Fv; Fab; Fab'; Fab'-SH; F(ab')2; bispecific Fab, diabodies, linear antibodies, and single-chain antibody molecules (e.g., scFv or scFab).

[1169] II. Compositions and Methods

[1170] Generally speaking, for the recombinant large-scale production of a polypeptide of interest (such as a therapeutic polypeptide), cells that stably express and secrete the polypeptide are required. Such cells are referred to as "recombinant cells" or "recombinant production cells," and the process for producing such cells is referred to as "cell line development." In the first step of the cell line development process, suitable host cells (such as CHO cells) are transfected with a nucleic acid sequence suitable for expressing the polypeptide of interest. In the second step, cells that stably express the polypeptide of interest are selected based on the co-expression of a selection marker co-transfected with the nucleic acid encoding the polypeptide of interest.

[1171] The nucleic acid encoding the polypeptide (i.e., the coding sequence) is called a structural gene. This structural gene is a simple message, and its expression requires additional regulatory elements. Therefore, the structural gene is usually integrated into an expression cassette. The minimum regulatory elements required for the expression cassette to work in mammalian cells are a promoter that works in the mammalian cell, which is located upstream of the structural gene, i.e., 5', and a polyadenylation signal sequence that works in the mammalian cell, which is located downstream of the structural gene, i.e., 3'. The promoter, structural gene, and polyadenylation signal sequence are arranged in an operably linked form.

[1172] In the case where the polypeptide of interest is a heteromultimeric polypeptide composed of different (monomeric) polypeptides, not only a single expression cassette is required, but multiple expression cassettes that differ in the structural genes contained, that is, at least one expression cassette is required for each of the different (monomeric) polypeptides of the heteromultimeric polypeptide. For example, a full-length antibody is a heteromultimeric polypeptide comprising two copies of a light chain and two copies of a heavy chain. Therefore, a full-length antibody is composed of two different polypeptides. Therefore, the expression of a full-length antibody requires two expression cassettes, one for the light chain and the other for the heavy chain. For example, if the full-length antibody is a bispecific antibody, that is, the antibody comprises two different binding sites that specifically bind to two different antigens, then the light chain and heavy chain are also different from each other. Therefore, this bispecific full-length antibody is composed of four different polypeptides and requires four expression cassettes.

[1173] The expression cassette for the polypeptide of interest is then incorporated into a so-called "expression vector." An "expression vector" is a nucleic acid that provides all the necessary elements for amplification of the vector in bacterial cells and expression of the contained structural gene in mammalian cells. Typically, an expression vector comprises a prokaryotic plasmid propagation unit, such as that for E. coli, which contains an origin of replication and a prokaryotic selection marker, as well as a eukaryotic selection marker, and the expression cassette required for expression of the structural gene of interest. An "expression vector" is a transport vehicle used to introduce the expression cassette into mammalian cells.

[1174] As outlined in the previous paragraph, the more complex the polypeptide to be expressed, the greater the number of different expression cassettes required. Inherently, as the number of expression cassettes increases, the size of the nucleic acid integrated into the host cell genome also increases. The size of the expression vector also increases accordingly. However, the practical upper limit of vector size is in the range of approximately 15 kbp; beyond this range, handling and processing efficiency decreases significantly. This problem can be addressed by using two or more expression vectors. Therefore, the expression cassettes can be split between different expression vectors, with each expression vector containing only some of the expression cassettes.

[1175] Conventional cell line development (CLD) relies on random integration (RI) of vectors carrying a polypeptide of interest (SOI) expression cassette. Generally speaking, if a vector is transfected via a random method, several vectors or fragments thereof integrate into the genome of the cell. Therefore, the RI-based transfection process is unpredictable.

[1176] Therefore, by solving the size problem when splitting the expression cassette between different expression vectors, a new problem arises, which is the random number of integrated expression cassettes and their spatial distribution.

[1177] Generally speaking, the more that the expression cassette that is used to express structural gene is integrated into the genome of cell, the higher the amount of the polypeptide of corresponding expression just becomes.Except the quantity of the expression cassette that integrates, the site and locus of integration also have an impact on expression output.For example, if the expression cassette is integrated in the site with low transcriptional activity in the cell genome, only a small amount of coded polypeptide is expressed.But, if identical expression cassette is integrated in the site with high transcriptional activity in the cell genome, a large amount of coded polypeptide is expressed.

[1178] Such expression differences do not cause problems as long as the expression cassettes for the different polypeptides of the heterologous multimeric polypeptide are all integrated at the same frequency at a locus with comparable transcriptional activity. In this case, all polypeptides of the multimeric polypeptide are expressed in the same amount and the multimeric polypeptide will be assembled correctly.

[1179] However, this scenario is unlikely and cannot be guaranteed for molecules composed of more than two polypeptides. For example, WO 2018 / 162517 discloses that, using RI, a high degree of variation in expression yield and product quality was observed, depending on i) the expression cassette sequence and ii) the distribution of the expression cassettes between different expression vectors. Without being bound by this theory, this observation is due to the fact that different expression cassettes from different expression vectors integrate at different loci in the cell at different frequencies, resulting in differential expression of different polypeptides of the heteromultimeric polypeptide, i.e., expression at inappropriately different ratios. As a result, some monomeric polypeptides are present in higher amounts, while others are present in lower amounts. This imbalance between the monomers of the heteromultimeric polypeptide leads to incomplete assembly, misassembly, and a reduced secretion rate. All of the aforementioned scenarios will result in lower expression yields of correctly folded heteromultimeric polypeptides and a higher proportion of product-related byproducts.

[1180] Unlike conventional RI CLD, targeted integration (TI) CLD introduces a transgene comprising different expression cassettes at a predetermined "hotspot" in the cell genome. Furthermore, this introduction utilizes a defined ratio of expression cassettes. Thus, without being bound by theory, all different polypeptides of a heteromultimeric polypeptide are expressed at the same (or at least comparable and only slightly different) rates and in appropriate ratios. Consequently, the amount of correctly assembled heteromultimeric polypeptides should be increased and the proportion of product-related byproducts should be reduced.

[1181] In addition, given the limited copy number and defined integration site, recombinant cells obtained by TI should have better stability than those obtained by RI. Furthermore, because the selectable marker is used only to select cells with appropriate TI and not for cells with high levels of transgene expression, less mutagenic markers can be used to minimize the generation of sequence variants (SVs), which are due in part to the mutagenicity of selective agents such as methotrexate (MTX) or methionine sulfoximine (MSX).

[1182] II.a Transgenes and methods according to the invention

[1183] Trivalent bispecific antibodies:

[1184] However, it has now been found that the sequence of the expression cassette in the transgene used in TI (ie the organization of the expression cassette) has a profound influence on the expression of trivalent bispecific antibodies.

[1185] The present invention uses a specific expression cassette organization format with a defined number and sequence of individual expression cassettes. This results in high expression yields and good product quality of trivalent bispecific antibodies expressed in mammalian cells.

[1186] To confirm the integration of the transgene into the expression cassette sequence according to the present invention, the TI method was used. The present invention provides a novel method for generating recombinant mammalian cells expressing trivalent bispecific antibodies using a dual-plasmid recombinase-mediated cassette exchange (RMCE) reaction. The improvement lies in the defined integration at the same locus within a defined sequence, and the resulting high expression of the trivalent bispecific antibody and reduced formation of product-related byproducts.

[1187] The presently disclosed subject matter not only provides methods for generating recombinant mammalian cells for stable large-scale production of trivalent, bispecific antibodies, but also provides recombinant mammalian cells with high production yields of trivalent, bispecific antibodies and with favorable by-product profiles.

[1188] The two-plasmid RMCE strategy used here allows the insertion of multiple expression cassettes into the same TI locus.

[1189] This article describes a recombinant mammalian cell that expresses a trivalent, bispecific antibody. Trivalent, bispecific antibodies are heteromultimeric polypeptides that are non-natively expressed by the mammalian cell. More specifically, trivalent, bispecific antibodies are heterodimeric proteins composed of four polypeptides: two distinct heavy chains and two distinct light chains. To achieve expression of the trivalent, bispecific antibody, a recombinant nucleic acid containing multiple distinct expression cassettes in specific and defined sequences is integrated into the genome of the mammalian cell.

[1190] Also reported herein is a method for producing recombinant mammalian cells expressing a trivalent bispecific antibody, and a method for producing a trivalent bispecific antibody using the recombinant mammalian cells.

[1191] The present invention is based at least in part on the discovery that the sequences of the different expression cassettes required for expression of heteromultimeric trivalent bispecific antibodies, ie, the organization of the expression cassettes, influence the expression yield of the trivalent bispecific antibody when integrated into the genome of a mammalian cell.

[1192] The present invention is based, at least in part, on the discovery that dual recombinase-mediated cassette exchange (RMCE) can be used to generate recombinant mammalian cells, such as recombinant CHO cells, in which a defined and specific expression cassette sequence has been integrated into the genome, which in turn leads to efficient expression and production of trivalent bispecific antibodies. This integration is achieved by targeted integration at a specific site in the mammalian cell genome. Thus, it is possible to control the expression ratio of the different polypeptides of the heteromultimeric antibody relative to each other. Thus, efficient expression, correct assembly, and successful secretion of correctly folded and assembled trivalent bispecific antibodies are achieved with high expression yields.

[1193] Since the trivalent bispecific antibody is a heterologous 4-mer, its expression requires at least four different expression cassettes: the first for expressing the first heavy chain, the second for expressing the second heavy chain, the third for expressing the first light chain and the fourth for expressing the second light chain. In addition, an additional expression cassette for a positive selection marker can be included.

[1194] To examine the impact of expression cassette organization on TI host productivity, RMCE libraries were generated by transfecting two plasmids (front and back vectors) containing different numbers and organizations of expression cassettes for the individual chains of a trivalent bispecific antibody with an additional Fab fragment with domain crossing / swap. After selection, recovery, and verification of RMCE by flow cytometry, the library productivity was evaluated in a 14-day fed-batch production trial.

[1195] The effect of the antibody chain expression cassette organization on the expression of different trivalent bispecific antibodies with additional Fab fragments with domain swaps, all with different target specificities, was evaluated.

[1196] Generally, it is assumed in the art that transient protein expression profiles are predictive of stable expression profiles (see, e.g., Diepenbruck, C., et al. Mol. Biotechnol. 54 (2013) 497-503; Rajendra, Y., et al., Biotechnol. Prog. 33 (2017) 469-477).

[1197] For one BS antibody (BS-1), the following transient transfection results have been obtained (vectors containing only the indicated expression cassettes; vector ratios: l = vector containing one light chain expression cassette; l+h = vector containing one light chain expression cassette and one heavy chain expression cassette with a hole mutation; xl+k = vector containing one light chain expression cassette with a domain swap and one heavy chain expression cassette with a knob mutation; xl = vector containing one light chain expression cassette with a domain swap):

[1198]

[1199]

[1200] l = light chain; h = heavy chain with hole mutation; xl = light chain with domain swap; k = heavy chain with knob mutation

[1201] For the first and three additional BS antibodies, the following stable, targeted integration results were obtained:

[1202]

[1203] 1 k k xl xl h xl l l 0.8 63 0.50 1 k k xl xl h h l l 0.8 63 0.50 1 k k xl xl h l l - 0.6 61 0.37 1 k xl xl - h xl l l 0.75 46.5 0.35 1 k xl xl - h h l l 0.75 46.5 0.35 1 k xl xl - h l l - 0.7 44.5 0.31

[1204] 2 k k xl xl h xl l l 1 74.5 0.75 2 k k xl xl h l l - 1 73.5 0.74 2 k xl xl - h l l - 1 53 0.53

[1205] 3 k k xl xl h l l - 1.36 83 1.13 3 k k xl xl h xl l l 1 90 0.90 3 k xl xl - h l l - 0.95 70.5 0.67

[1206] 4 k l l - h l - - 0.9 76 0.37 4 k l l - h l l - 0.8 65 0.30

[1207] MP = main product, eff.titer = effective titer = titer multiplied by percentage of main product

[1208] It can be seen that the results obtained in transient transfection are unpredictable when switching from transient, random integration to stable, targeted integration. This can be seen from the combination k:h:l:xl = 2:1:2:3, which is the most suitable for stable transfection, and only the third is the most suitable for transient transfection.

[1209] Antibody BS-1 is an anti-human Abeta / human transferrin receptor trivalent bispecific antibody (SEQ ID NOs: 12 to 15). Antibody BS-3 is an anti-human CD20 / human transferrin receptor trivalent bispecific antibody (SEQ ID NOs: 16 to 19).

[1210] This part of the invention is summarized as follows.

[1211] An independent aspect of the present invention is a method for producing a trivalent bispecific antibody, comprising the following steps:

[1212] a) culturing mammalian cells comprising deoxyribonucleic acid encoding the trivalent bispecific antibody, and

[1213] b) recovering the trivalent bispecific antibody from the cells or culture medium,

[1214] wherein the deoxyribonucleic acid encoding the trivalent bispecific antibody is stably integrated into the genome of the mammalian cell and comprises in the 5' to 3' direction

[1215] - a first expression cassette encoding a first heavy chain,

[1216] - a second expression cassette encoding the first heavy chain,

[1217] - a third expression cassette encoding the first light chain,

[1218] - a fourth expression cassette encoding the first light chain,

[1219] - a fifth expression cassette encoding the second heavy chain,

[1220] - a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain, and

[1221] - a seventh expression cassette encoding the second light chain.

[1222] Stable integration of the trivalent, bispecific antibody encoding deoxyribonucleic acid into the genome of a mammalian cell can be achieved by any method known to those skilled in the art, as long as the specific expression cassette sequence is maintained.

[1223] An independent aspect of the present invention is a deoxyribonucleic acid encoding a trivalent bispecific antibody comprising in the 5' to 3' direction

[1224] - a first expression cassette encoding a first heavy chain,

[1225] - a second expression cassette encoding the first heavy chain,

[1226] - a third expression cassette encoding the first light chain,

[1227] - a fourth expression cassette encoding the first light chain,

[1228] - a fifth expression cassette encoding the second heavy chain,

[1229] - a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain, and

[1230] - a seventh expression cassette encoding the second light chain.

[1231] An independent aspect of the present invention is the use of a deoxyribonucleic acid comprising in the 5' to 3' direction a trivalent bispecific antibody for expressing in a mammalian cell

[1232] - a first expression cassette encoding a first heavy chain,

[1233] - a second expression cassette encoding the first heavy chain,

[1234] - a third expression cassette encoding the first light chain,

[1235] - a fourth expression cassette encoding the first light chain,

[1236] - a fifth expression cassette encoding the second heavy chain,

[1237] - a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain, and

[1238] - a seventh expression cassette encoding the second light chain.

[1239] An independent aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent bispecific antibody integrated into the genome of the cell, wherein the deoxyribonucleic acid encodes the trivalent bispecific antibody and comprises in the 5' to 3' direction

[1240] - a first expression cassette encoding a first heavy chain,

[1241] - a second expression cassette encoding the first heavy chain,

[1242] - a third expression cassette encoding the first light chain,

[1243] - a fourth expression cassette encoding the first light chain,

[1244] - a fifth expression cassette encoding the second heavy chain,

[1245] - a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain, and

[1246] - a seventh expression cassette encoding the second light chain.

[1247] An independent aspect of the present invention is a composition comprising two deoxyribonucleic acids, which in turn comprise three different recombination recognition sequences and four expression cassettes, wherein

[1248] - the first deoxyribonucleic acid comprises in the 5' to 3' direction

[1249] - a first recombination recognition sequence,

[1250] - a first expression cassette encoding a first heavy chain,

[1251] - a second expression cassette encoding the first heavy chain,

[1252] - a third expression cassette encoding the first light chain,

[1253] - a fourth expression cassette encoding the first light chain, and

[1254] - a first copy of the third recombination recognition sequence,

[1255] and

[1256] - the second deoxyribonucleic acid comprises in the 5' to 3' direction

[1257] - a second copy of the third recombination recognition sequence,

[1258] - a fifth expression cassette encoding the second heavy chain,

[1259] - a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain,

[1260] - a seventh expression cassette encoding the second light chain, and

[1261] - a second recombination recognition sequence.

[1262] An independent aspect of the present invention is a method for producing a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent bispecific antibody and secreting the trivalent bispecific antibody, the method comprising the steps of:

[1263] a) providing a mammalian cell comprising an exogenous nucleotide sequence integrated at a single site within a locus of the genome of the mammalian cell, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all of the recombination recognition sequences are different;

[1264] b) introducing into the cell provided in a) a composition of two deoxyribonucleic acids, said two deoxyribonucleic acids comprising three different recombination recognition sequences and at least seven expression cassettes, wherein

[1265] - the first deoxyribonucleic acid comprises in the 5' to 3' direction

[1266] - a first recombination recognition sequence,

[1267] - a first expression cassette encoding a first heavy chain,

[1268] - a second expression cassette encoding the first heavy chain,

[1269] - a third expression cassette encoding the first light chain,

[1270] - a fourth expression cassette encoding the first light chain, and

[1271] - a first copy of the third recombination recognition sequence,

[1272] and

[1273] - the second deoxyribonucleic acid comprises in the 5' to 3' direction

[1274] - a second copy of the third recombination recognition sequence,

[1275] - a fifth expression cassette encoding the second heavy chain,

[1276] - a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain,

[1277] - a seventh expression cassette encoding the second light chain, and

[1278] - a second recombination recognition sequence,

[1279] wherein the first to the third recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid match the first to the third recombination recognition sequences on the integrated exogenous nucleotide sequence,

[1280] wherein the 5' terminal portion and the 3' terminal portion of the expression cassette encoding one second selection marker when taken together form a functional expression cassette for said one second selection marker;

[1281] c) Introduction

[1282] i) the first deoxyribonucleic acid and the second deoxyribonucleic acid of b) are introduced simultaneously,

[1283] or

[1284] ii) subsequently introduced

[1285] one or more recombinases,

[1286] wherein the one or more recombinases recognize the recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid; (and optionally wherein the one or more recombinases perform two recombinase-mediated cassette exchanges;)

[1287] as well as

[1288] d) selecting cells that express the second selection marker and secrete the trivalent bispecific antibody,

[1289] This generates recombinant mammalian cells that contain deoxyribonucleic acid encoding the trivalent bispecific antibody and secrete the trivalent bispecific antibody.

[1290] In one embodiment of all independent aspects and all dependent embodiments of the invention, exactly one copy of the deoxyribonucleic acid encoding the trivalent, bispecific antibody is stably integrated into a single locus in the genome of the mammalian cell by targeted integration.

[1291] In one embodiment of all independent aspects and all dependent embodiments of the invention, exactly one copy of the deoxyribonucleic acid encoding the trivalent, bispecific antibody is stably integrated into a single locus in the genome of a mammalian cell by a single or double recombinase-mediated cassette exchange reaction.

[1292] In one embodiment of all independent aspects and all dependent embodiments of the invention the deoxyribonucleic acid comprises, after the seven expression cassettes, an eighth expression cassette encoding a second light chain.

[1293] In one embodiment of all independent aspects and all dependent embodiments of the invention, the first heavy chain comprises the mutation T366W (numbering according to Kabat) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (numbering according to Kabat) in the CH3 domain.

[1294] In one embodiment of all independent aspects and all dependent embodiments of the invention, one of the heavy chains further comprises the mutation S354C and the respective other heavy chain comprises the mutation Y349C (numbering according to Kabat).

[1295] In one embodiment of all independent aspects and all dependent embodiments of the invention the first heavy chain is an extended heavy chain comprising an additional domain-swapped Fab fragment VH-VL or CH1-CL.

[1296] In one embodiment of all independent aspects and all dependent embodiments of the invention the first light chain is a domain swapped light chain VH-VL or CH1-CL.

[1297] In one embodiment of all independent aspects and all dependent embodiments of the present invention,

[1298] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, a peptide linker, a second heavy chain variable domain and a CL domain,

[1299] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1300] - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[1301] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1302] wherein the second heavy chain variable domain and the first light chain variable domain form a first binding site, and the first heavy chain variable domain and the second light chain variable domain form a second binding site.

[1303] In one embodiment of all independent aspects of the invention and all dependent embodiments, the first heavy chain comprises the amino acid sequence of SEQ ID NO: 12, the second heavy chain comprises the amino acid sequence of SEQ ID NO: 13, the first light chain comprises the amino acid sequence of SEQ ID NO: 14, and the second light chain comprises the amino acid sequence of SEQ ID NO: 15, and the first binding site specifically binds to human transferrin receptor, and the second binding site specifically binds to human Abeta polypeptide.

[1304] In one embodiment of all independent aspects and all dependent embodiments of the invention, the first heavy chain comprises the amino acid sequence of SEQ ID NO: 16, the second heavy chain comprises the amino acid sequence of SEQ ID NO: 17, the first light chain comprises the amino acid sequence of SEQ ID NO: 18, and the second light chain comprises the amino acid sequence of SEQ ID NO: 19, and the first binding site specifically binds to human transferrin receptor, and the second binding site specifically binds to human CD20 polypeptide.

[1305] In one embodiment of all independent aspects and all dependent embodiments of the invention, exactly one copy of the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[1306] In one embodiment of all independent aspects and of all dependent embodiments of the invention the deoxyribonucleic acid encoding the trivalent bispecific antibody comprises an additional expression cassette encoding a selectable marker.

[1307] In one embodiment of all independent aspects and all dependent embodiments of the invention, the expression cassette encoding the selectable marker is located partially 5' to the third recombination recognition sequence and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises a coding sequence without a start codon and a poly A signal, wherein the start codon is operably linked to the coding sequence.

[1308] In one embodiment of all independent aspects and all dependent embodiments of the invention, the 5' portion of the expression cassette encoding the selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by the fourth expression cassette and the start codon is flanked downstream by the third recombination recognition sequence; and the 3' portion of the expression cassette encoding the selection marker comprises a nucleic acid encoding the selection marker lacking a start codon and is flanked upstream by the third recombination recognition sequence and downstream by the fifth expression cassette, wherein the start codon is operably linked to the coding sequence.

[1309] In one embodiment of all independent aspects and all dependent embodiments of the present invention,

[1310] Each expression cassette for an antibody chain comprises, in the 5' to 3' direction, a promoter, the nucleic acid encoding the antibody chain and a polyadenylation signal sequence, and optionally a terminator sequence,

[1311] and

[1312] Each expression cassette encoding the selectable marker comprises, in the 5' to 3' direction, a promoter, the nucleic acid encoding the selectable marker and a polyadenylation signal sequence, and optionally a terminator sequence.

[1313] In one embodiment of all independent aspects and all dependent embodiments of the invention, for the expression cassette other than the selection marker, the promoter is the human CMV promoter with intron A, the polyadenylation signal sequence is the bGH polyadenylation signal sequence, and the terminator is the hGT terminator, wherein for the expression cassette of the selection marker, the promoter is the SV40 promoter, the polyadenylation signal sequence is the SV40 polyadenylation signal sequence and the terminator is not present.

[1314] The terminator sequence prevents the production of very long RNA transcripts by RNA polymerase II, which are read through to the next expression cassette in the deoxyribonucleic acid according to the invention and used in the method according to the invention. That is, the expression of the target structural gene is controlled by its own promoter.

[1315] Therefore, efficient transcription termination is achieved by the combination of a polyadenylation signal and a terminator sequence. That is, the presence of a double termination signal prevents readthrough by RNA polymerase II. The terminator sequence initiates complex disassembly and promotes the dissociation of RNA polymerase from the DNA template.

[1316] In one embodiment of all independent aspects and all dependent embodiments of the invention, the mammalian cell is a CHO cell.

[1317] In one embodiment of all independent aspects and of all dependent embodiments of the invention, all cassettes are arranged unidirectionally.

[1318] In one embodiment of all independent aspects and all dependent embodiments of the invention, the expression cassette encoding the selectable marker is located partially 5' to the third recombination recognition sequence and partially 3' to the third recombination recognition sequence, wherein the 5' part of the expression cassette comprises a promoter and a start codon, and the 3' part of the expression cassette comprises the coding sequence without a start codon and a poly A signal.

[1319] In one embodiment of all independent aspects and all dependent embodiments of the invention, the 5' portion of the expression cassette encoding the selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by a fourth expression cassette (i.e. positioned downstream of the fourth expression cassette) and the start codon is flanked downstream by a third recombination recognition sequence (i.e. positioned upstream of the third recombination recognition sequence); and the 3' portion of the expression cassette encoding the selection marker comprises a nucleic acid encoding a selection marker lacking a start codon operably linked to a polyadenylation sequence and flanked upstream by a third recombination recognition sequence and downstream by a fifth expression cassette.

[1320] In one embodiment of all independent aspects and all dependent embodiments of the invention, the start codon is a translation start codon. In one embodiment, the start codon is ATG.

[1321] In one embodiment of all independent aspects and all dependent embodiments of the invention, the first deoxyribonucleic acid is integrated into a first vector and the second deoxyribonucleic acid is integrated into a second vector.

[1322] In one embodiment of all independent aspects and all dependent embodiments of the invention, each of the expression cassettes comprises in 5' to 3' direction a promoter, a coding sequence and a polyadenylation signal sequence, optionally followed by a terminator sequence, all operably linked to each other.

[1323] In one embodiment of all independent aspects and all dependent embodiments of the present invention, the mammalian cell is a CHO cell. In one embodiment, the CHO cell is a CHO-K1 cell.

[1324] In one embodiment of all independent aspects and all dependent embodiments of the present invention, the recombinase recognition sequences are L3, 2L, and LoxFas. In one embodiment, L3 has the sequence of SEQ ID NO: 01, 2L has the sequence of SEQ ID NO: 02, and LoxFas has the sequence of SEQ ID NO: 03. In one embodiment, the first recombinase recognition sequence is L3, the second recombinase recognition sequence is 2L, and the third recombinase recognition sequence is LoxFas.

[1325] In one embodiment of all independent aspects and all dependent embodiments of the invention, the promoter is the human CMV promoter with intron A, the polyadenylation signal sequence is the bGH poly A site, and the terminator sequence is the hGT terminator.

[1326] In one embodiment of all independent aspects and all dependent embodiments of the invention, except for the expression cassette for the selection marker, the promoter is the human CMV promoter with intron A, the polyadenylation signal sequence is the bGH poly A site, and the terminator sequence is the hGT terminator, wherein for the expression cassette for the selection marker, the promoter is the SV40 promoter, the polyadenylation signal sequence is the SV40 poly A site and the terminator sequence is not present.

[1327] In one embodiment of all independent aspects and all dependent embodiments of the invention, the human CMV promoter has the sequence of SEQ ID NO: 04. In one embodiment, the human CMV promoter has the sequence of SEQ ID NO: 06.

[1328] In one embodiment of all independent aspects and all dependent embodiments of the invention the bGH polyadenylation signal sequence is SEQ ID NO:08.

[1329] In one embodiment of all independent aspects and all dependent embodiments of the invention, the hGT promoter has the sequence SEQ ID NO: 09.

[1330] In one embodiment of all independent aspects and all dependent embodiments of the invention, the SV40 promoter has the sequence SEQ ID NO:10.

[1331] In one embodiment of all independent aspects and all dependent embodiments of the invention, the SV40 polyadenylation signal sequence is SEQ ID NO: 07.

[1332] In one embodiment of all aspects and embodiments, the trivalent bispecific antibody is an anti-TfR / CD20 bispecific antibody. Such antibodies are reported in WO 2017 / 055542, which is incorporated herein by reference in its entirety.

[1333] In one embodiment of all aspects and embodiments, the trivalent bispecific antibody is an anti-TfR / Aβ bispecific antibody. Such antibodies are reported in WO 2017 / 055540, which is incorporated herein by reference in its entirety.

[1334] Bispecific trivalent antibodies:

[1335] However, it has now been discovered that the sequence of the expression cassette in the transgene used in TI (ie, the expression cassette organization) has a profound effect on trivalent antibodies (eg, TCBs).

[1336] The present invention uses a specific expression cassette organization format with a defined number and sequence of individual expression cassettes. This results in high expression yields and good product quality of trivalent antibodies (eg, TCB) expressed in mammalian cells.

[1337] To confirm the integration of the transgene into the expression cassette sequence according to the present invention, the TI method was used. The present invention provides a novel method for producing recombinant mammalian cells expressing trivalent antibodies (e.g., TCB) using a dual-plasmid recombinase-mediated cassette exchange (RMCE) reaction. The improvement lies in the defined integration at the same locus within a defined sequence, and the resulting high expression of the trivalent antibody (e.g., TCB) and reduced formation of product-related byproducts.

[1338] The presently disclosed subject matter not only provides methods for generating recombinant mammalian cells for stable large-scale production of trivalent antibodies (e.g., TCBs), but also provides recombinant mammalian cells having high production yields of trivalent antibodies (e.g., TCBs) with favorable by-product profiles.

[1339] The two-plasmid RMCE strategy used here allows the insertion of multiple expression cassettes into the same TI locus.

[1340] This article reports a recombinant mammalian cell expressing a trivalent antibody (e.g., TCB). The trivalent antibody (e.g., TCB) is a heteromultimeric polypeptide that is non-naturally expressed by mammalian cells. More specifically, the trivalent antibody (e.g., TCB) is a heterodimeric protein composed of four polypeptides: a first light chain and a second light chain and a first heavy chain and a second heavy chain. In order to achieve expression of the trivalent antibody (e.g., TCB), a recombinant nucleic acid containing multiple different expression cassettes in a specific and defined sequence has been integrated into the genome of the mammalian cell.

[1341] Also reported herein is a method for producing a recombinant mammalian cell expressing a trivalent antibody (eg, TCB), and a method for producing a trivalent antibody (eg, TCB) using the recombinant mammalian cell.

[1342] The present invention is based at least in part on the discovery that the sequences of the different expression cassettes required for expression of heteromultimeric trivalent antibodies (e.g., TCBs), i.e., the organization of the expression cassettes, affect the expression yield of the trivalent antibodies (e.g., TCBs) when integrated into the genome of mammalian cells.

[1343] The present invention is based, at least in part, on the discovery that dual recombinase-mediated cassette exchange (RMCE) can be used to generate recombinant mammalian cells, such as recombinant CHO cells, in which a defined and specific expression cassette sequence has been integrated into the genome, which in turn results in the efficient expression and production of trivalent antibodies (e.g., TCBs). This integration is achieved by targeted integration at a specific site in the mammalian cell genome. Thus, it is possible to control the expression ratio of the different polypeptides of a heteromultimeric polypeptide relative to each other. Thus, efficient expression, correct assembly, and successful secretion of correctly folded and assembled trivalent antibodies (e.g., TCBs) are achieved at high expression yields.

[1344] Since trivalent antibodies (e.g., TCBs) are hetero-4-mers, their expression requires at least four different expression cassettes: a first for expressing the first light chain, a second for expressing the second light chain, a third for expressing the first heavy chain, and a fourth for expressing the second heavy chain. In addition, one or more additional expression cassettes for positive selection markers may be included.

[1345] In one example, to examine the effect of expression cassette organization on productivity in a TI host, an RMCE pool was generated by transfecting two plasmids (front vector and back vector) containing different numbers and organization of single chains of a trivalent antibody in TCB format. After selection, recovery, and verification of RMCE by flow cytometry, the productivity of the pool was evaluated in a 14-day fed-batch production trial. For specific vector organization formats, an increase in titer was observed compared to the reference pool.

[1346] The effect of the organization of the antibody chain expression cassettes on the expression of five different TCBs was evaluated. TCB 1 to TCB 5 all have different targeting specificities. TCB 3 was tested with four different anti-CD3 binding sites.

[1347] For TCB-1, the following results have been obtained; the reference histology is shaded grey, k = heavy chain with knob mutation; h = heavy chain with hole mutation; l = light chain; xl = light chain with domain swap:

[1348]

[1349] MP = main product, eff.titer = effective titer = titer multiplied by percentage of main product

[1350] This part of the invention is summarized as follows.

[1351] According to an independent aspect of the present invention there is a method for producing a trivalent antibody, the method comprising the steps of:

[1352] a) culturing mammalian cells comprising deoxyribonucleic acid encoding the trivalent antibody, and

[1353] b) recovering the trivalent antibody from the cells or culture medium,

[1354] wherein the deoxyribonucleic acid encoding the trivalent antibody is stably integrated into the genome of the mammalian cell and comprises in the 5' to 3' direction (1)

[1356] - a first expression cassette encoding a first heavy chain,

[1357] - a second expression cassette encoding the first light chain,

[1358] - a third expression cassette encoding the first light chain,

[1359] - a fourth expression cassette encoding the second heavy chain, and

[1360] - a fifth expression cassette encoding the second light chain,

[1361] or (2)

[1362] - a first expression cassette encoding a first heavy chain,

[1363] - a second expression cassette encoding the first light chain,

[1364] - a third expression cassette encoding the first light chain,

[1365] - a fourth expression cassette encoding the second heavy chain,

[1366] - a fifth expression cassette encoding the second light chain,

[1367] - a sixth expression cassette encoding the second light chain,

[1368] or (3)

[1369] - a first expression cassette encoding a first heavy chain,

[1370] - a second expression cassette encoding a second heavy chain,

[1371] - a third expression cassette encoding the first light chain,

[1372] - a fourth expression cassette encoding the second light chain,

[1373] - a fifth expression cassette encoding the second light chain,

[1374] or (4)

[1375] - a first expression cassette encoding a first heavy chain,

[1376] - a second expression cassette encoding a second heavy chain,

[1377] - a third expression cassette encoding the first light chain,

[1378] - a fourth expression cassette encoding the second light chain,

[1379] - a fifth expression cassette encoding the first heavy chain,

[1380] - a sixth expression cassette encoding the second light chain,

[1381] or (5)

[1382] - a first expression cassette encoding a first heavy chain,

[1383] - a second expression cassette encoding a second heavy chain,

[1384] - a third expression cassette encoding the first light chain,

[1385] - a fourth expression cassette encoding the second light chain,

[1386] - a fifth expression cassette encoding the second heavy chain,

[1387] - a sixth expression cassette encoding the second light chain,

[1388] - a seventh expression cassette encoding the second light chain,

[1389] or (6)

[1390] - a first expression cassette encoding a first light chain,

[1391] - a second expression cassette encoding the first light chain,

[1392] - a third expression cassette encoding the first heavy chain,

[1393] - a fourth expression cassette encoding the second heavy chain,

[1394] - a fifth expression cassette encoding the second light chain,

[1395] - a sixth expression cassette encoding the second light chain.

[1396] Stable integration of the trivalent antibody encoding deoxyribonucleic acid into the genome of a mammalian cell can be achieved by any method known to those skilled in the art, as long as the specific expression cassette sequence is maintained.

[1397] According to an independent aspect of the present invention, there is a deoxyribonucleic acid encoding a trivalent antibody, the deoxyribonucleic acid comprising in the 5' to 3' direction (1)

[1399] - a first expression cassette encoding a first heavy chain,

[1400] - a second expression cassette encoding the first light chain,

[1401] - a third expression cassette encoding the first light chain,

[1402] - a fourth expression cassette encoding the second heavy chain, and

[1403] - a fifth expression cassette encoding the second light chain,

[1404] or (2)

[1405] - a first expression cassette encoding a first heavy chain,

[1406] - a second expression cassette encoding the first light chain,

[1407] - a third expression cassette encoding the first light chain,

[1408] - a fourth expression cassette encoding the second heavy chain,

[1409] - a fifth expression cassette encoding the second light chain,

[1410] - a sixth expression cassette encoding the second light chain,

[1411] or (3)

[1412] - a first expression cassette encoding a first heavy chain,

[1413] - a second expression cassette encoding a second heavy chain,

[1414] - a third expression cassette encoding the first light chain,

[1415] - a fourth expression cassette encoding the second light chain,

[1416] - a fifth expression cassette encoding the second light chain,

[1417] or (4)

[1418] - a first expression cassette encoding a first heavy chain,

[1419] - a second expression cassette encoding a second heavy chain,

[1420] - a third expression cassette encoding the first light chain,

[1421] - a fourth expression cassette encoding the second light chain,

[1422] - a fifth expression cassette encoding the first heavy chain,

[1423] - a sixth expression cassette encoding the second light chain,

[1424] or (5)

[1425] - a first expression cassette encoding a first heavy chain,

[1426] - a second expression cassette encoding a second heavy chain,

[1427] - a third expression cassette encoding the first light chain,

[1428] - a fourth expression cassette encoding the second light chain,

[1429] - a fifth expression cassette encoding the second heavy chain,

[1430] - a sixth expression cassette encoding the second light chain,

[1431] - a seventh expression cassette encoding the second light chain,

[1432] or (6)

[1433] - a first expression cassette encoding a first light chain,

[1434] - a second expression cassette encoding the first light chain,

[1435] - a third expression cassette encoding the first heavy chain,

[1436] - a fourth expression cassette encoding the second heavy chain,

[1437] - a fifth expression cassette encoding the second light chain,

[1438] - a sixth expression cassette encoding the second light chain.

[1439] An independent aspect of the present invention is the use of a deoxyribonucleic acid comprising in the 5' to 3' direction a trivalent antibody for expressing in a mammalian cell. (1)

[1441] - a first expression cassette encoding a first heavy chain,

[1442] - a second expression cassette encoding the first light chain,

[1443] - a third expression cassette encoding the first light chain,

[1444] - a fourth expression cassette encoding the second heavy chain, and

[1445] - a fifth expression cassette encoding the second light chain,

[1446] or (2)

[1447] - a first expression cassette encoding a first heavy chain,

[1448] - a second expression cassette encoding the first light chain,

[1449] - a third expression cassette encoding the first light chain,

[1450] - a fourth expression cassette encoding the second heavy chain,

[1451] - a fifth expression cassette encoding the second light chain,

[1452] - a sixth expression cassette encoding the second light chain,

[1453] or (3)

[1454] - a first expression cassette encoding a first heavy chain,

[1455] - a second expression cassette encoding a second heavy chain,

[1456] - a third expression cassette encoding the first light chain,

[1457] - a fourth expression cassette encoding the second light chain,

[1458] - a fifth expression cassette encoding the second light chain,

[1459] or (4)

[1460] - a first expression cassette encoding a first heavy chain,

[1461] - a second expression cassette encoding a second heavy chain,

[1462] - a third expression cassette encoding the first light chain,

[1463] - a fourth expression cassette encoding the second light chain,

[1464] - a fifth expression cassette encoding the first heavy chain,

[1465] - a sixth expression cassette encoding the second light chain,

[1466] or (5)

[1467] - a first expression cassette encoding a first heavy chain,

[1468] - a second expression cassette encoding a second heavy chain,

[1469] - a third expression cassette encoding the first light chain,

[1470] - a fourth expression cassette encoding the second light chain,

[1471] - a fifth expression cassette encoding the second heavy chain,

[1472] - a sixth expression cassette encoding the second light chain,

[1473] - a seventh expression cassette encoding the second light chain,

[1474] or (6)

[1475] - a first expression cassette encoding a first light chain,

[1476] - a second expression cassette encoding the first light chain,

[1477] - a third expression cassette encoding the first heavy chain,

[1478] - a fourth expression cassette encoding the second heavy chain,

[1479] - a fifth expression cassette encoding the second light chain,

[1480] - a sixth expression cassette encoding the second light chain.

[1481] According to an independent aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent antibody integrated into the genome of the cell.

[1482] Which antibody is encoded by the DNA in the 5' to 3' direction? (1)

[1484] - a first expression cassette encoding a first heavy chain,

[1485] - a second expression cassette encoding the first light chain,

[1486] - a third expression cassette encoding the first light chain,

[1487] - a fourth expression cassette encoding the second heavy chain, and

[1488] - a fifth expression cassette encoding the second light chain,

[1489] or (2)

[1490] - a first expression cassette encoding a first heavy chain,

[1491] - a second expression cassette encoding the first light chain,

[1492] - a third expression cassette encoding the first light chain,

[1493] - a fourth expression cassette encoding the second heavy chain,

[1494] - a fifth expression cassette encoding the second light chain,

[1495] - a sixth expression cassette encoding the second light chain,

[1496] or (3)

[1497] - a first expression cassette encoding a first heavy chain,

[1498] - a second expression cassette encoding a second heavy chain,

[1499] - a third expression cassette encoding the first light chain,

[1500] - a fourth expression cassette encoding the second light chain,

[1501] - a fifth expression cassette encoding the second light chain,

[1502] or (4)

[1503] - a first expression cassette encoding a first heavy chain,

[1504] - a second expression cassette encoding a second heavy chain,

[1505] - a third expression cassette encoding the first light chain,

[1506] - a fourth expression cassette encoding the second light chain,

[1507] - a fifth expression cassette encoding the first heavy chain,

[1508] - a sixth expression cassette encoding the second light chain,

[1509] or (5)

[1510] - a first expression cassette encoding a first heavy chain,

[1511] - a second expression cassette encoding a second heavy chain,

[1512] - a third expression cassette encoding the first light chain,

[1513] - a fourth expression cassette encoding the second light chain,

[1514] - a fifth expression cassette encoding the second heavy chain,

[1515] - a sixth expression cassette encoding the second light chain,

[1516] - a seventh expression cassette encoding the second light chain,

[1517] or (6)

[1518] - a first expression cassette encoding a first light chain,

[1519] - a second expression cassette encoding the first light chain,

[1520] - a third expression cassette encoding the first heavy chain,

[1521] - a fourth expression cassette encoding the second heavy chain,

[1522] - a fifth expression cassette encoding the second light chain,

[1523] - a sixth expression cassette encoding the second light chain.

[1524] An independent aspect of the present invention is a composition comprising two deoxyribonucleic acids, which further comprises three different recombination recognition sequences and five to seven expression cassettes, wherein

[1525] - the first deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[1527] - a first recombination recognition sequence,

[1528] - a first expression cassette encoding a first heavy chain,

[1529] - a second expression cassette encoding the first light chain,

[1530] - a third expression cassette encoding the first light chain, and

[1531] - a first copy of the third recombination recognition sequence,

[1532] or (2)

[1533] - a first recombination recognition sequence,

[1534] - a first expression cassette encoding a first heavy chain,

[1535] - a second expression cassette encoding the first light chain,

[1536] - a third expression cassette encoding the first light chain, and

[1537] - a first copy of the third recombination recognition sequence,

[1538] or (3)

[1539] - a first recombination recognition sequence,

[1540] - a first expression cassette encoding a first heavy chain,

[1541] - a second expression cassette encoding a second heavy chain,

[1542] - a third expression cassette encoding the first light chain,

[1543] - a fourth expression cassette encoding the second light chain, and

[1544] - a first copy of the third recombination recognition sequence,

[1545] or (4)

[1546] - a first recombination recognition sequence,

[1547] - a first expression cassette encoding a first heavy chain,

[1548] - a second expression cassette encoding a second heavy chain,

[1549] - a third expression cassette encoding the first light chain,

[1550] - a fourth expression cassette encoding the second light chain, and

[1551] - a first copy of the third recombination recognition sequence,

[1552] or (5)

[1553] - a first recombination recognition sequence,

[1554] - a first expression cassette encoding a first heavy chain,

[1555] - a second expression cassette encoding a second heavy chain,

[1556] - a third expression cassette encoding the first light chain,

[1557] - a fourth expression cassette encoding the second light chain, and

[1558] - a first copy of the third recombination recognition sequence,

[1559] or (6)

[1560] - a first recombination recognition sequence,

[1561] - a first expression cassette encoding a first light chain,

[1562] - a second expression cassette encoding the first light chain,

[1563] - a third expression cassette encoding the first heavy chain, and

[1564] - a first copy of the third recombination recognition sequence,

[1565] and

[1566] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[1568] - a second copy of the third recombination recognition sequence,

[1569] - a fourth expression cassette encoding the second heavy chain,

[1570] - a fifth expression cassette encoding the second light chain, and

[1571] - a second recombination recognition sequence,

[1572] or (2)

[1573] - a second copy of the third recombination recognition sequence,

[1574] - a fourth expression cassette encoding the second heavy chain,

[1575] - a fifth expression cassette encoding the second light chain,

[1576] - a sixth expression cassette encoding the second light chain, and

[1577] - a second recombination recognition sequence,

[1578] or (3)

[1579] - a second copy of the third recombination recognition sequence,

[1580] - a fifth expression cassette encoding the second light chain, and

[1581] - a second recombination recognition sequence,

[1582] or (4)

[1583] - a second copy of the third recombination recognition sequence,

[1584] - a fifth expression cassette encoding the first heavy chain,

[1585] - a sixth expression cassette encoding the second light chain, and

[1586] - a second recombination recognition sequence,

[1587] or (5)

[1588] - a second copy of the third recombination recognition sequence,

[1589] - a fifth expression cassette encoding the second heavy chain,

[1590] - a sixth expression cassette encoding the second light chain,

[1591] - a seventh expression cassette encoding the second light chain, and

[1592] - a second recombination recognition sequence,

[1593] or (6)

[1594] - a second copy of the third recombination recognition sequence,

[1595] - a fourth expression cassette encoding the second heavy chain,

[1596] - a fifth expression cassette encoding the second light chain,

[1597] - a sixth expression cassette encoding the second light chain, and

[1598] - a second recombination recognition sequence.

[1599] In one embodiment, the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (1); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (2); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (3); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (4); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (5); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (6).

[1600] An independent aspect of the present invention is a method for producing a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a trivalent antibody and secreting the trivalent antibody, the method comprising the steps of:

[1601] a) providing a mammalian cell comprising an exogenous nucleotide sequence integrated at a single site within a locus of the genome of the mammalian cell, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all of the recombination recognition sequences are different;

[1602] b) introducing into the cell provided in a) a composition of two deoxyribonucleic acids, said two deoxyribonucleic acids comprising three different recombination recognition sequences and five to seven expression cassettes, wherein

[1603] - the first deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[1605] - a first recombination recognition sequence,

[1606] - a first expression cassette encoding a first heavy chain,

[1607] - a second expression cassette encoding the first light chain,

[1608] - a third expression cassette encoding the first light chain, and

[1609] - a first copy of the third recombination recognition sequence,

[1610] or (2)

[1611] - a first recombination recognition sequence,

[1612] - a first expression cassette encoding a first heavy chain,

[1613] - a second expression cassette encoding the first light chain,

[1614] - a third expression cassette encoding the first light chain, and

[1615] - a first copy of the third recombination recognition sequence,

[1616] or (3)

[1617] - a first recombination recognition sequence,

[1618] - a first expression cassette encoding a first heavy chain,

[1619] - a second expression cassette encoding a second heavy chain,

[1620] - a third expression cassette encoding the first light chain,

[1621] - a fourth expression cassette encoding the second light chain, and

[1622] - a first copy of the third recombination recognition sequence,

[1623] or (4)

[1624] - a first recombination recognition sequence,

[1625] - a first expression cassette encoding a first heavy chain,

[1626] - a second expression cassette encoding a second heavy chain,

[1627] - a third expression cassette encoding the first light chain,

[1628] - a fourth expression cassette encoding the second light chain, and

[1629] - a first copy of the third recombination recognition sequence,

[1630] or (5)

[1631] - a first recombination recognition sequence,

[1632] - a first expression cassette encoding a first heavy chain,

[1633] - a second expression cassette encoding a second heavy chain,

[1634] - a third expression cassette encoding the first light chain,

[1635] - a fourth expression cassette encoding the second light chain, and

[1636] - a first copy of the third recombination recognition sequence,

[1637] or (6)

[1638] - a first recombination recognition sequence,

[1639] - a first expression cassette encoding a first light chain,

[1640] - a second expression cassette encoding the first light chain,

[1641] - a third expression cassette encoding the first heavy chain, and

[1642] - a first copy of the third recombination recognition sequence,

[1643] and

[1644] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[1646] - a second copy of the third recombination recognition sequence,

[1647] - a fourth expression cassette encoding the second heavy chain,

[1648] - a fifth expression cassette encoding the second light chain, and

[1649] - a second recombination recognition sequence,

[1650] or (2)

[1651] - a second copy of the third recombination recognition sequence,

[1652] - a fourth expression cassette encoding the second heavy chain,

[1653] - a fifth expression cassette encoding the second light chain,

[1654] - a sixth expression cassette encoding the second light chain, and

[1655] - a second recombination recognition sequence,

[1656] or (3)

[1657] - a second copy of the third recombination recognition sequence,

[1658] - a fifth expression cassette encoding the second light chain, and

[1659] - a second recombination recognition sequence,

[1660] or (4)

[1661] - a second copy of the third recombination recognition sequence,

[1662] - a fifth expression cassette encoding the first heavy chain,

[1663] - a sixth expression cassette encoding the second light chain, and

[1664] - a second recombination recognition sequence,

[1665] or (5)

[1666] - a second copy of the third recombination recognition sequence,

[1667] - a fifth expression cassette encoding the second heavy chain,

[1668] - a sixth expression cassette encoding the second light chain,

[1669] - a seventh expression cassette encoding the second light chain, and

[1670] - a second recombination recognition sequence,

[1671] or (6)

[1672] - a second copy of the third recombination recognition sequence,

[1673] - a fourth expression cassette encoding the second heavy chain,

[1674] - a fifth expression cassette encoding the second light chain,

[1675] - a sixth expression cassette encoding the second light chain, and

[1676] - a second recombination recognition sequence,

[1677] wherein the first to the third recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid match the first to the third recombination recognition sequences on the integrated exogenous nucleotide sequence,

[1678] wherein the 5' terminal portion and the 3' terminal portion of the expression cassette encoding one second selection marker when taken together form a functional expression cassette for said one second selection marker;

[1679] c) Introduction

[1680] i) the first deoxyribonucleic acid and the second deoxyribonucleic acid of b) are introduced simultaneously,

[1681] or

[1682] ii) subsequently introduced

[1683] one or more recombinases,

[1684] wherein the one or more recombinases recognize the recombination recognition sequences of the first deoxyribonucleic acid and the second deoxyribonucleic acid; (and optionally wherein the one or more recombinases perform two recombinase-mediated cassette exchanges;)

[1685] as well as

[1686] d) selecting cells that express the second selection marker and secrete the trivalent antibody,

[1687] Thereby, recombinant mammalian cells are generated that contain deoxyribonucleic acid encoding the trivalent antibody and secrete the trivalent antibody.

[1688] In one embodiment, the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (1); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (2); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (3); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (4); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (5); or the first deoxyribonucleic acid and the second deoxyribonucleic acid both comprise an organizational form according to (6).

[1689] In one embodiment of all independent aspects and all dependent embodiments of the invention, the deoxyribonucleic acid encoding the trivalent, bispecific antibody is stably integrated into a single locus in the genome of the mammalian cell by targeted integration.

[1690] In one embodiment of all independent aspects and all dependent embodiments of the invention, the deoxyribonucleic acid encoding the trivalent, bispecific antibody is stably integrated into a single locus in the genome of a mammalian cell by a single or double recombinase mediated cassette exchange reaction.

[1691] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the first heavy chain comprises the mutation T366W in the CH3 domain (numbering according to Kabat) and the second heavy chain comprises the mutations T366S, L368A and Y407V in the CH3 domain (numbering according to Kabat), or vice versa.

[1692] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, one of the heavy chains further comprises the mutation S354C and the respective other heavy chain comprises the mutation Y349C (according to Kabat numbering).

[1693] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention the first heavy chain is an extended heavy chain comprising an additional domain-swapped Fab fragment.

[1694] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the first light chain is a domain swapped light chain VH-VL or CH1-CL.

[1695] In one dependent embodiment of each independent aspect and all dependent embodiments according to the present invention,

[1696] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a first light chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1697] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1698] - the first light chain comprises, from N-terminus to C-terminus, a second heavy chain variable domain and a CL domain, and

[1699] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1700] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[1701] In one dependent embodiment of each independent aspect and all dependent embodiments according to the present invention,

[1702] - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a second heavy chain variable domain, a CL domain, a hinge region, a CH2 domain and a CH3 domain,

[1703] - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain,

[1704] - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and

[1705] - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain,

[1706] wherein the first heavy chain variable domain and the second light chain variable domain form a first binding site, and the second heavy chain variable domain and the first light chain variable domain form a second binding site.

[1707] In a dependent embodiment according to each independent aspect and all dependent embodiments of the present invention, the deoxyribonucleic acid is stably integrated into the genome of the mammalian cell at a single site or locus.

[1708] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the deoxyribonucleic acid encoding the trivalent antibody comprises an additional expression cassette encoding a selectable marker.

[1709] In a dependent embodiment of each independent aspect and all dependent embodiments of the present invention, an expression cassette encoding a selectable marker is located partially 5' to the third recombination recognition sequence and partially 3' to the third recombination recognition sequence, wherein the 5' portion of the expression cassette comprises a promoter and a start codon, and the 3' portion of the expression cassette comprises a coding sequence without a start codon and a poly A signal, wherein the start codon is operably linked to the coding sequence.

[1710] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the 5' portion of the expression cassette encoding the selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by the third expression cassette and the start codon is flanked downstream by a third recombination recognition sequence; and the 3' portion of the expression cassette encoding the selection marker comprises a nucleic acid encoding a selection marker lacking a start codon and is flanked upstream by the third recombination recognition sequence and downstream by the fourth expression cassette, wherein the start codon is operably linked to the coding sequence.

[1711] In one dependent embodiment of each independent aspect and all dependent embodiments according to the present invention,

[1712] Each expression cassette for an antibody chain comprises, in the 5' to 3' direction, a promoter, the nucleic acid encoding the antibody chain and a polyadenylation signal sequence, and optionally a terminator sequence,

[1713] and

[1714] Each expression cassette encoding the selectable marker comprises, in the 5' to 3' direction, a promoter, the nucleic acid encoding the selectable marker and a polyadenylation signal sequence, and optionally a terminator sequence.

[1715] In a dependent embodiment of each independent aspect and all dependent embodiments according to the invention, for the expression cassette other than the selection marker, the promoter is the human CMV promoter with intron A, the polyadenylation signal sequence is the bGH polyadenylation signal sequence, and the terminator is the hGT terminator, wherein for the expression cassette of the selection marker, the promoter is the SV40 promoter, the polyadenylation signal sequence is the SV40 polyadenylation signal sequence and the terminator is not present.

[1716] In a dependent embodiment according to each independent aspect and all dependent embodiments of the present invention, the mammalian cell is a CHO cell.

[1717] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, if the organizational form has the expression cassette encoding the first heavy chain as the first expression cassette in the 5' to 3' direction, all cassettes are arranged unidirectionally.

[1718] In a dependent embodiment of each independent aspect and all dependent embodiments of the present invention, if the organizational form in the 5' to 3' direction is a first expression cassette encoding a first light chain, a second expression cassette encoding a first light chain, a third expression cassette encoding a first heavy chain, a fourth expression cassette encoding a second heavy chain, a fifth expression cassette encoding a second light chain, and a sixth expression cassette encoding a second light chain, the first expression cassette to the third expression cassette are arranged unidirectionally, and the fourth expression cassette to the sixth expression cassette are arranged unidirectionally, such that the first expression cassette to the third expression cassette are arranged in the opposite direction of the fourth expression cassette to the sixth expression cassette.

[1719] In a dependent embodiment of each independent aspect and all dependent embodiments of the present invention, the expression cassette encoding the selection marker is located partially 5' to the third recombination recognition sequence and partially 3' to the third recombination recognition sequence, wherein the 5' part of the expression cassette comprises a promoter and a start codon, and the 3' part of the expression cassette comprises the coding sequence without a start codon and a poly A signal.

[1720] In a dependent embodiment of each independent aspect and all dependent embodiments of the invention, the 5' portion of the expression cassette encoding the selection marker comprises a promoter sequence operably linked to a start codon, whereby the promoter sequence is flanked upstream by a second expression cassette (i.e., positioned downstream of the second expression cassette) and the start codon is flanked downstream by a third recombination recognition sequence (i.e., positioned upstream of the third recombination recognition sequence); and the 3' portion of the expression cassette encoding the selection marker comprises a nucleic acid encoding the selection marker lacking a start codon operably linked to a polyadenylation sequence and flanked upstream by a third recombination recognition sequence and downstream by a third expression cassette.

[1721] In a dependent embodiment according to each independent aspect and all dependent embodiments of the present invention, the start codon is a translation start codon. In one embodiment, the start codon is ATG.

[1722] In a dependent embodiment according to each independent aspect and all dependent embodiments of the present invention, the first deoxyribonucleic acid is integrated into a first vector and the second deoxyribonucleic acid is integrated into a second vector.

[1723] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, each of the expression cassettes comprises in 5' to 3' direction a promoter, a coding sequence and a polyadenylation signal sequence, optionally followed by a terminator sequence, all operably linked to each other.

[1724] In one dependent embodiment of each independent aspect and all dependent embodiments of the present invention, the mammalian cell is a CHO cell. In one embodiment, the CHO cell is a CHO-K1 cell.

[1725] In a dependent embodiment of each independent aspect and all dependent embodiments of the present invention, the recombinase recognition sequences are L3, 2L, and LoxFas. In one embodiment, L3 has the sequence of SEQ ID NO: 01, 2L has the sequence of SEQ ID NO: 02, and LoxFas has the sequence of SEQ ID NO: 03. In one embodiment, the first recombinase recognition sequence is L3, the second recombinase recognition sequence is 2L, and the third recombinase recognition sequence is LoxFas.

[1726] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the promoter is a human CMV promoter with intron A, the polyadenylation signal sequence is a bGH poly A site, and the terminator sequence is an hGT terminator.

[1727] In a dependent embodiment of each independent aspect and all dependent embodiments according to the invention, except for the expression cassette for the selection marker, the promoter is a human CMV promoter with intron A, the polyadenylation signal sequence is a bGH poly A site, and the terminator sequence is an hGT terminator, wherein for the expression cassette for the selection marker, the promoter is an SV40 promoter, the polyadenylation signal sequence is an SV40 poly A site and the terminator sequence is not present.

[1728] In one dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the human CMV promoter has the sequence SEQ ID NO: 04. In one embodiment, the human CMV promoter has the sequence SEQ ID NO: 06.

[1729] In a dependent embodiment according to each independent aspect and all dependent embodiments of the present invention, the bGH polyadenylation signal sequence is SEQ ID NO:08.

[1730] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the hGT terminator has the sequence SEQ ID NO:09.

[1731] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the SV40 promoter has the sequence SEQ ID NO:10.

[1732] In a dependent embodiment according to each independent aspect and all dependent embodiments of the invention, the SV40 polyadenylation signal sequence is SEQ ID NO:07.

[1733] In one embodiment according to all aspects and embodiments of the invention the trivalent antibody is a therapeutic antibody.

[1734] In one embodiment according to all aspects and embodiments of the present invention, a trivalent bispecific (therapeutic) antibody (TCB) comprises

[1735] - a first Fab fragment and a second Fab fragment, wherein each binding site of the first Fab fragment and the second Fab fragment specifically binds to a second antigen,

[1736] a third Fab fragment, wherein the binding site of the third Fab fragment specifically binds to the first antigen, and wherein the third Fab fragment comprises a domain crossover such that the variable light chain domain (VL) and the variable heavy chain domain (VH) are replaced with each other, and

[1737] an Fc region comprising a first Fc region polypeptide and a second Fc region polypeptide,

[1738] wherein the first Fab fragment and the second Fab fragment each comprise a heavy chain fragment and a full-length light chain,

[1739] wherein the C-terminus of the heavy chain fragment of the first Fab fragment is fused to the N-terminus of the first Fc region polypeptide,

[1740] The C-terminus of the heavy chain fragment of the second Fab fragment is fused to the N-terminus of the variable light chain domain of the third Fab fragment, and the C-terminus of the heavy chain constant domain 1 of the third Fab fragment is fused to the N-terminus of the second Fc region polypeptide.

[1741] In one embodiment according to all aspects and embodiments of the present invention, the trivalent antibody is an anti-CD3 / CD20 bispecific antibody. In one embodiment, the anti-CD3 / CD20 bispecific antibody is a TCB with CD20 as the second antigen. In one embodiment, the bispecific anti-CD3 / CD20 antibody is RG6026. Such antibodies are described in WO 2016 / 020309, which is incorporated herein by reference in its entirety.

[1742] In one embodiment according to all aspects and embodiments of the present invention, the trivalent antibody is an anti-CD3 / CEA bispecific antibody. In one embodiment, the anti-CD3 / CEA bispecific antibody is a TCB with CEA as the second antigen. In one embodiment, the bispecific anti-CD3 / CEA antibody is RO6958688 or RG7802 or cibisatamab. Such antibodies are reported in WO2017 / 055389, which is incorporated herein by reference in its entirety.

[1743] Bivalent bispecific antibodies with domain swapping:

[1744] However, it has now been found that the sequence of the expression cassette in the transgene used in TI (ie the organization of the expression cassette) has a profound influence on the expression of bivalent bispecific antibodies.

[1745] The present invention uses a specific expression cassette organization format with a defined number and sequence of individual expression cassettes. This results in high expression yields and good product quality of bivalent bispecific antibodies expressed in mammalian cells.

[1746] To confirm the integration of the transgene into the expression cassette sequence according to the present invention, the TI method was used. The present invention provides a novel method for generating recombinant mammalian cells expressing bivalent bispecific antibodies using a dual-plasmid recombinase-mediated cassette exchange (RMCE) reaction. The improvement lies in the defined integration at the same locus within a defined sequence, and the resulting high expression of the bivalent bispecific antibody and reduced formation of product-related byproducts.

[1747] The presently disclosed subject matter not only provides methods for generating recombinant mammalian cells for stable large-scale production of bivalent, bispecific antibodies, but also provides recombinant mammalian cells with high production yields of bivalent, bispecific antibodies and with favorable by-product profiles.

[1748] The two-plasmid RMCE strategy used here allows the insertion of multiple expression cassettes into the same TI locus.

[1749] This article describes a recombinant mammalian cell that expresses a bivalent, bispecific antibody. The bivalent, bispecific antibody is a heteromultimeric polypeptide that is non-natively expressed by the mammalian cell. More specifically, the bivalent, bispecific antibody is a heteromultimeric protein composed of four polypeptides: a first antibody heavy chain, a second antibody heavy chain, a first antibody light chain, and a second antibody light chain. To achieve expression of the bivalent, bispecific antibody, a recombinant nucleic acid comprising different expression cassettes in specific and defined sequences is integrated into the genome of the mammalian cell.

[1750] Also reported herein is a method for producing a recombinant mammalian cell expressing a bivalent, bispecific antibody, and a method for producing a bivalent, bispecific antibody using the recombinant mammalian cell.

[1751] The present invention is based at least in part on the discovery that the sequences of the different expression cassettes required for the expression of heteromultimeric bivalent bispecific antibodies, ie, the organization of the expression cassettes, influence the expression yield of the bivalent bispecific antibodies when integrated into the genome of mammalian cells.

[1752] The present invention is based, at least in part, on the discovery that dual recombinase-mediated cassette exchange (RMCE) can be used to generate recombinant mammalian cells, such as recombinant CHO cells, in which a defined and specific expression cassette sequence has been integrated into the genome, which in turn leads to efficient expression and production of bivalent bispecific antibodies. This integration is achieved by targeted integration at a specific site in the mammalian cell genome. Thus, it is possible to control the expression ratio of the different polypeptides of the heteromultimeric antibody relative to each other. Thus, efficient expression, correct assembly, and successful secretion of correctly folded and assembled bivalent bispecific antibodies are achieved with high expression yields.

[1753] Since the bivalent bispecific antibody is a heterologous 4-mer, its expression requires at least four different expression cassettes: the first for expressing the first antibody heavy chain, the second for expressing the second antibody heavy chain, the third for expressing the first antibody light chain, and the fourth for expressing the second antibody light chain. In addition, one or more additional expression cassettes for positive selection markers can be included.

[1754] For a bivalent bispecific antibody with domain crossing / swapping, the following transient transfection results have been obtained (vectors containing only the indicated expression cassettes; l+h = vector containing one expression cassette for the light chain and one expression cassette for the heavy chain with a hole mutation; xl+k = vector containing one expression cassette for the light chain with domain swap and one expression cassette for the heavy chain with a knob mutation; xl+h = vector containing one expression cassette for the light chain with domain swap and one expression cassette for the heavy chain with a hole mutation; l+k = vector containing one expression cassette for the light chain and one expression cassette for the heavy chain with a knob mutation):

[1755]

[1756] 1 1 1 - - 15 93 13.95 1 - - 1 1 10 92 9.2

[1757] l = light chain; h = heavy chain with hole mutation; xl = light chain with domain swap; k = heavy chain with knob mutation

[1758] From the results obtained by transient transfection, it can be seen that the sequences and combinations of the four expression cassettes resulted in different expression yields and product qualities.

[1759] Generally, it is accepted in the art that transient protein expression profiles are predictive of stable expression profiles (see, e.g., Diepenbruck, C., et al., Mol. Biotechnol. 54 (2013) 497-503; Rajendra, Y., et al., Biotechnol. Prog. 33 (2017) 469-477).

[1760] To examine the impact of expression cassette organization on TI host productivity, a stable RMCE library was generated by transfecting two plasmids (front and back vectors) containing different numbers and organizational forms of expression cassettes for the individual chains of a bivalent bispecific antibody with domain crossing / exchange. After selection, recovery, and verification of RMCE by flow cytometry, the library productivity was evaluated in a 14-day fed-batch production trial.

[1761] The impact of the antibody chain expression cassette organization on expression yield and product quality in stably transfected cells was evaluated for six different bivalent bispecific antibodies with domain swapping. All had different target specificities. For some, the impact of different VH / VL pairs was also analyzed. The following results were obtained for these ten different antibodies.

[1762]

[1763] 1 xl k - - l h - - 1.5 86 1.29

[1764]

[1765] 2 var 1 xl h - - l k - - 2.7 85 2.28 2 var 1 l k - - xl h - - 2.8 89 2.43 2 var 2 xl h - - l k - - 2.9 87 2.52 2 var 2 l k - - xl h - - 3.1 91 2.83 2 var 3 xl h - - l k - - 2.9 82 2.34 2 var 3 l k - - xl h - - 3.2 89 2.80 2 var 4 xl h - - l k - - 2.6 80 2.06 2 var 4 l k - - xl h - - 2.7 82 2.26

[1766]

[1767] 3 var 1 xl h - - l k - - 2.1 94 1.95 3 var 1 l k - - xl h - - 2.3 87 2.02 3 var 2 xl h - - l k - - 2.3 90 2.05 3 var 2 l k - - xl h - - 2.5 91 2.26

[1768] 4 xl k - - l h - - 3.8 94 3.57 4 xl k xl - l h - - 3 90 2.7 4 xl k xl - l h l - 2.8 93 2.6 4 xl k xl - l h h - 2.6 95 2.47

[1769] 5 xl k - - l h - - 2.3 92 2.12

[1770] 6 xl h - - l k - - 1.2 72 0.86

[1771] k = heavy chain with a knob mutation; h = heavy chain with a hole mutation; l = light chain; xl = light chain with a domain swap; var = different binding site sequence

[1772] This part of the invention is summarized as follows.

[1773] An independent aspect of the present invention is a method for producing a bivalent bispecific antibody, the method comprising the steps of:

[1774] a) culturing mammalian cells comprising deoxyribonucleic acid encoding the bivalent, bispecific antibody, and

[1775] b) recovering the bivalent bispecific antibody from the cells or culture medium,

[1776] wherein the deoxyribonucleic acid encoding the bivalent bispecific antibody is stably integrated into the genome of the mammalian cell and comprises in the 5' to 3' direction (1)

[1778] - a first expression cassette encoding a first light chain,

[1779] - a second expression cassette encoding the first heavy chain,

[1780] - a third expression cassette encoding a second light chain, and

[1781] - a fourth expression cassette encoding the second heavy chain,

[1782] or (2)

[1783] - a first expression cassette encoding a first light chain,

[1784] - a second expression cassette encoding a second heavy chain,

[1785] - a third expression cassette encoding a second light chain, and

[1786] - a fourth expression cassette encoding the first heavy chain.

[1787] Optionally, wherein the first or second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding first or second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1788] Optionally wherein, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain, or vice versa.

[1789] Stable integration of the bivalent, bispecific antibody encoding deoxyribonucleic acid into the genome of a mammalian cell can be achieved by any method known to those skilled in the art, as long as the specific expression cassette sequence is maintained.

[1790] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap).

[1791] In a preferred embodiment, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain.

[1792] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1793] and

[1794] The first heavy chain comprises the mutation T366W (according to Kabat numbering) on ​​the CH3 domain, and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) on ​​the CH3 domain.

[1795] An independent aspect of the present invention is a deoxyribonucleic acid encoding a bivalent bispecific antibody, the deoxyribonucleic acid comprising in the 5' to 3' direction (1)

[1797] - a first expression cassette encoding a first light chain,

[1798] - a second expression cassette encoding the first heavy chain,

[1799] - a third expression cassette encoding a second light chain, and

[1800] - a fourth expression cassette encoding the second heavy chain,

[1801] or (2)

[1802] - a first expression cassette encoding a first light chain,

[1803] - a second expression cassette encoding a second heavy chain,

[1804] - a third expression cassette encoding a second light chain, and

[1805] - a fourth expression cassette encoding the first heavy chain.

[1806] Optionally, wherein the first or second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding first or second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1807] Optionally wherein, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain, or vice versa.

[1808] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap).

[1809] In a preferred embodiment, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain.

[1810] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1811] and

[1812] The first heavy chain comprises the mutation T366W (according to Kabat numbering) on ​​the CH3 domain, and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) on ​​the CH3 domain.

[1813] The present invention is directed to the use of a deoxyribonucleic acid for expressing a bivalent bispecific antibody in a mammalian cell. (1)

[1815] - a first expression cassette encoding a first light chain,

[1816] - a second expression cassette encoding the first heavy chain,

[1817] - a third expression cassette encoding a second light chain, and

[1818] - a fourth expression cassette encoding the second heavy chain,

[1819] or (2)

[1820] - a first expression cassette encoding a first light chain,

[1821] - a second expression cassette encoding a second heavy chain,

[1822] - a third expression cassette encoding a second light chain, and

[1823] - a fourth expression cassette encoding the first heavy chain.

[1824] Optionally, wherein the first or second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding first or second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1825] Optionally wherein, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain, or vice versa.

[1826] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap).

[1827] In a preferred embodiment, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain.

[1828] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1829] and

[1830] The first heavy chain comprises the mutation T366W (according to Kabat numbering) on ​​the CH3 domain, and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) on ​​the CH3 domain.

[1831] An independent aspect of the present invention is a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a bivalent, bispecific antibody integrated into the genome of the cell,

[1832] The deoxyribonucleic acid encoding the bivalent bispecific antibody comprises in the 5' to 3' direction (1)

[1834] - a first expression cassette encoding a first light chain,

[1835] - a second expression cassette encoding the first heavy chain,

[1836] - a third expression cassette encoding a second light chain, and

[1837] - a fourth expression cassette encoding the second heavy chain,

[1838] or (2)

[1839] - a first expression cassette encoding a first light chain,

[1840] - a second expression cassette encoding a second heavy chain,

[1841] - a third expression cassette encoding a second light chain, and

[1842] - a fourth expression cassette encoding the first heavy chain,

[1843] Optionally, wherein the first or second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding first or second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1844] Optionally wherein, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain, or vice versa.

[1845] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap).

[1846] In a preferred embodiment, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain.

[1847] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1848] and

[1849] The first heavy chain comprises the mutation T366W (according to Kabat numbering) on ​​the CH3 domain, and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) on ​​the CH3 domain.

[1850] An independent aspect of the present invention is a composition comprising two deoxyribonucleic acids, which in turn comprises three different recombination recognition sequences and four expression cassettes, wherein

[1851] - the first deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[1853] - a first recombination recognition sequence,

[1854] - a first expression cassette encoding a first light chain,

[1855] - a second expression cassette encoding the first heavy chain, and

[1856] - a first copy of the third recombination recognition sequence,

[1857] or (2)

[1858] - a first recombination recognition sequence,

[1859] - a first expression cassette encoding a first light chain,

[1860] - a second expression cassette encoding a second heavy chain, and

[1861] - a first copy of the third recombination recognition sequence,

[1862] and

[1863] - the second deoxyribonucleic acid comprises in the 5' to 3' direction (1)

[1865] - a second copy of the third recombination recognition sequence,

[1866] - a third expression cassette encoding the second light chain,

[1867] - a fourth expression cassette encoding the second heavy chain, and

[1868] - a second recombination recognition sequence,

[1869] or (2)

[1870] - a second copy of the third recombination recognition sequence,

[1871] - a third expression cassette encoding the second light chain,

[1872] - a fourth expression cassette encoding the first heavy chain, and

[1873] - a second recombination recognition sequence,

[1874] Optionally, wherein the first or second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding first or second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1875] Optionally wherein, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain, or vice versa.

[1876] In one embodiment, both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (1); or both the first deoxyribonucleic acid and the second deoxyribonucleic acid comprise an organization according to (2).

[1877] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap).

[1878] In a preferred embodiment, in case of (1) or in case of (1) and (2), the first heavy chain comprises the mutation T366W (according to Kabat numbering) in the CH3 domain and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) in the CH3 domain.

[1879] In a preferred embodiment, the second light chain is a domain-swapped light chain comprising VH-CL (VH-VL domain swap) or VL-CH1 (CH1-CL domain swap), and the corresponding second heavy chain is a corresponding domain-swapped heavy chain comprising VL-CH1-CH2-CH3 (VH-VL domain swap) or VH-CL-CH2-CH3 (CH1-CL domain swap),

[1880] and

[1881] The first heavy chain comprises the mutation T366W (according to Kabat numbering) on ​​the CH3 domain, and the second heavy chain comprises the mutations T366S, L368A and Y407V (according to Kabat numbering) on ​​the CH3 domain.

[1882] An independent aspect of the present invention is a method for producing a recombinant mammalian cell comprising a deoxyribonucleic acid encoding a bivalent bispecific antibody and secreting the bivalent bispecific antibody, the method comprising the steps of: [...

Claims

1. A method for producing a trivalent bispecific antibody, comprising the following steps: a) culturing mammalian cells comprising deoxyribonucleic acid encoding the trivalent bispecific antibody, and b) recovering the trivalent bispecific antibody from the cells or culture medium, wherein exactly one copy of the deoxyribonucleic acid encoding the trivalent bispecific antibody is stably integrated into the genome of the mammalian cell at a single site or locus and comprises in the 5' to 3' direction - a first expression cassette encoding a first heavy chain, - a second expression cassette encoding the first heavy chain, - a third expression cassette encoding the first light chain, - a fourth expression cassette encoding the first light chain, - a fifth expression cassette encoding the second heavy chain, - a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain, and - a seventh expression cassette encoding the second light chain, wherein the first heavy chain comprises the mutation T366W in the CH3 domain according to Kabat numbering, and the second heavy chain comprises the mutations T366S, L368A and Y407V in the CH3 domain according to Kabat numbering, in - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, a peptide linker, a second heavy chain variable domain and a CL domain, - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain, - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain, wherein the second heavy chain variable domain and the first light chain variable domain form a first binding site, and the first heavy chain variable domain and the second light chain variable domain form a second binding site. 2 . The method for producing a trivalent bispecific antibody according to claim 1 , wherein the deoxyribonucleic acid comprises an eighth expression cassette encoding a second light chain after the seventh expression cassette.

3. The method for producing a trivalent, bispecific antibody according to claim 1 or 2, wherein one of the heavy chains further comprises the mutation S354C according to Kabat numbering and the respective other heavy chain comprises the mutation Y349C according to Kabat numbering.

4. The method for producing a trivalent bispecific antibody according to claim 1 or 2, wherein the deoxyribonucleic acid encoding the trivalent bispecific antibody comprises an additional expression cassette encoding a selection marker, wherein said expression cassette encoding said selectable marker is flanked upstream by said fourth expression cassette and downstream by said fifth expression cassette, wherein the start codon of said expression cassette encoding said selectable marker is operably linked to a coding sequence.

5. The method for producing a trivalent bispecific antibody according to claim 4, wherein Each expression cassette for an antibody chain comprises, in the 5' to 3' direction, a promoter, nucleic acid encoding the antibody chain and a polyadenylation signal sequence, and a terminator sequence, and Each expression cassette encoding the selection marker comprises, in 5' to 3' direction, a promoter, a nucleic acid encoding the selection marker and a polyadenylation signal sequence, wherein for the expression cassette other than the selection marker, the promoter is a human CMV promoter with intron A, the polyadenylation signal sequence is a bGH polyadenylation signal sequence, and the terminator is an hGT terminator, wherein for the expression cassette of the selection marker, the promoter is an SV40 promoter, and the polyadenylation signal sequence is an SV40 polyadenylation signal sequence. The method for producing a trivalent, bispecific antibody according to claim 1 , wherein the mammalian cell is a CHO cell. The method for producing a trivalent bispecific antibody according to claim 5 , wherein the mammalian cells are CHO cells. The method for producing a trivalent bispecific antibody according to claim 1 , wherein all the cassettes are arranged in a unidirectional manner.

9. The method for producing a trivalent bispecific antibody according to claim 5, wherein all the cassettes are arranged in a unidirectional manner.

10. The method for producing a trivalent bispecific antibody according to claim 6, wherein all the cassettes are arranged in a unidirectional manner. The method for producing a trivalent bispecific antibody according to claim 7 , wherein all the cassettes are arranged in a unidirectional manner.

12. A recombinant mammalian cell comprising a deoxyribonucleic acid encoding exactly one copy of a trivalent bispecific antibody integrated into the genome of the cell at a single site or locus, wherein the deoxyribonucleic acid encoding the trivalent bispecific antibody comprises in the 5' to 3' direction - a first expression cassette encoding a first heavy chain, - a second expression cassette encoding the first heavy chain, - a third expression cassette encoding the first light chain, - a fourth expression cassette encoding the first light chain, - a fifth expression cassette encoding the second heavy chain, - a sixth expression cassette encoding the first light chain or the second heavy chain or the second light chain, and - a seventh expression cassette encoding the second light chain, wherein the first heavy chain comprises the mutation T366W in the CH3 domain according to Kabat numbering, and the second heavy chain comprises the mutations T366S, L368A and Y407V in the CH3 domain according to Kabat numbering, in - the first heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, a peptide linker, a second heavy chain variable domain and a CL domain, - the second heavy chain comprises, from N-terminus to C-terminus, a first heavy chain variable domain, a CH1 domain, a hinge region, a CH2 domain and a CH3 domain, - the first light chain comprises, from N-terminus to C-terminus, a first light chain variable domain and a CH1 domain, and - the second light chain comprises, from N-terminus to C-terminus, a second light chain variable domain and a CL domain, wherein the second heavy chain variable domain and the first light chain variable domain form a first binding site, and the first heavy chain variable domain and the second light chain variable domain form a second binding site.

13. The recombinant mammalian cell of claim 12, wherein the deoxyribonucleic acid comprises an eighth expression cassette encoding a second light chain after the seven expression cassettes.

14. The recombinant mammalian cell according to claim 12 or 13, wherein one of the heavy chains further comprises the mutation S354C according to Kabat numbering and the corresponding other heavy chain comprises the mutation Y349C according to Kabat numbering.

15. The recombinant mammalian cell according to claim 12 or 13, wherein the deoxyribonucleic acid encoding the trivalent bispecific antibody comprises an additional expression cassette encoding a selection marker, wherein said expression cassette encoding said selectable marker is flanked upstream by said fourth expression cassette and downstream by said fifth expression cassette.

16. The recombinant mammalian cell according to claim 15, wherein Each expression cassette for an antibody chain comprises, in the 5' to 3' direction, a promoter, nucleic acid encoding the antibody chain and a polyadenylation signal sequence, and a terminator sequence, and The expression cassette encoding the selection marker comprises a promoter, a nucleic acid encoding the selection marker and a polyadenylation signal sequence in the 5' to 3' direction, wherein for the expression cassette other than the selection marker, the promoter is a human CMV promoter with intron A, the polyadenylation signal sequence is a bGH polyadenylation signal sequence, and the terminator is an hGT terminator, wherein for the expression cassette of the selection marker, the promoter is an SV40 promoter, and the polyadenylation signal sequence is an SV40 polyadenylation signal sequence.

17. The recombinant mammalian cell according to claim 12 or 13, wherein the mammalian cell is a CHO cell.

18. The recombinant mammalian cell of claim 16, wherein the mammalian cell is a CHO cell.

19. The recombinant mammalian cell of claim 12 or 13, wherein all cassettes are arranged unidirectionally.

20. The recombinant mammalian cell of claim 16, wherein all cassettes are arranged unidirectionally.

21. The recombinant mammalian cell of claim 17, wherein all cassettes are arranged unidirectionally.

22. The recombinant mammalian cell of claim 18, wherein all cassettes are arranged unidirectionally.

Images