A mutated subgroup a avian leukosis virus receptor gene and its use in resisting subgroup a avian leukosis virus infection
By using CRISPR/Cas9 technology to mutate or delete key amino acid sites in the Tva gene, a DF-1 cell line resistant to ALV-A infection was constructed. This solved the problem of the lack of effective prevention and control of ALV-A infection in existing technologies, and achieved effective resistance to ALV-A and reduced the risk of transfection plasmid insertion.
Patent Information
- Application Number
- CN202210114184.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-01-30
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2042-01-30
AI Technical Summary
There is a lack of effective vaccines and treatments to control ALV-A infection in chicken flocks. The main approach is to eliminate and cull infected animals. Furthermore, existing gene editing technologies carry the risk of transfection plasmids randomly inserting into the host genome.
By using CRISPR/Cas9 technology to mutate or delete key amino acid sites L55 and W69 of the Tva gene, a DF-1 cell line resistant to ALV-A infection was constructed. The Tva gene-edited cell line r-Tva was obtained by screening using flow cytometry, reducing the risk of random insertion of transfected plasmids into the host genome.
A successful DF-1 cell line resistant to ALV-A infection was constructed, reducing the risk of random insertion of transfected plasmids into the host genome, achieving effective resistance to ALV-A, and providing a basis for prevention and control in gene-edited chickens.
Smart Images

Figure HDA0003495718150000011 
Figure HDA0003495718150000012 
Figure HDA0003495718150000021
Abstract
Description
Technical Field
[0001] This invention relates to a mutated A subgroup avian leukosis virus receptor gene (Tva) and its application in combating A subgroup avian leukosis virus (ALV-A) infection. This invention belongs to the field of biotechnology. Background Technology
[0002] Avian leukosis (AL) is a general term for various neoplastic diseases in birds caused by avian leukosis virus (ALV) and avian sarcoma virus (RSV). Based on differences in host range, viral envelope genes, and serological cross-reactivity, ALV is currently classified into 10 subgroups, AJ. In recent years, a new ALV subgroup has emerged in my country, designated as subgroup K (Cui N, Su S, Chen Z, et al. Genomic sequence analysis and biological characteristics of a rescued clone of avian leukosis virus strain JS11C1, isolated from indigenous chickens[J]. J Gen Virol, 2014, 95(Pt 11):2512-2522.). ALV-A is second only to ALV-J in hazard, and its host populations are relatively wide-ranging, with laying hens being the primary host. ALV-A infection has also been found in broilers, commercial chickens, broiler hybrids, and some local breeds.
[0003] ALV belongs to the genus Alpha Retrovirus and has the typical genomic structure of avian retroviruses. It is an enveloped RNA virus. The first and crucial step in enveloped virus infection of host cells is the binding of envelope glycoproteins to receptor proteins on the host cell surface. For ALV, due to differences in envelope proteins, different subtypes of ALV use different surface proteins as receptors to infect host cells. However, the specific amino acid interactions between the envelope proteins and receptor molecules of all ALV subtypes are a crucial step in establishing infection. Tva is the cellular receptor for ALV-A and contains a domain called LDL-A, which is a key functional domain mediating viral entry. The key amino acids L55 and W69 for Tva-mediated ALV-A infection are located in this LDL-A domain. As a homolog of human CD320, Tva is one of the cellular receptor molecules for TC-mediated Cbl (vitamin B12) uptake; therefore, Tva is essential for chicken growth.
[0004] CRISPR / Cas gene editing technology, as a new generation of gene editing technology, can achieve "precise" gene editing. CRISPR / Cas9 technology has been successfully applied in chickens, and studies have used CRISPR / Cas9 technology to achieve specific gene editing events in chicken somatic cells, the immortalized fibroblast cell line DF-1 cells, and primordial germ cells.
[0005] Therefore, this invention aims to lay the foundation for further constructing gene-edited chickens resistant to ALV-A by using CRISPR / Cas9 technology to mutate or delete key amino acid sites that mediate ALV-A invasion through Tva. Summary of the Invention
[0006] One of the objectives of this invention is to provide a mutated A subgroup avian leukosis virus (ALV-A) receptor gene (Tva) and its application in combating A subgroup avian leukosis virus infection;
[0007] The second objective of this invention is to provide a method for constructing a DF-1 cell line resistant to A subgroup avian leukosis virus infection using the above-mentioned mutated A subgroup avian leukosis virus receptor gene (Tva).
[0008] To achieve the above objectives, the present invention employs the following technical means:
[0009] A mutated A subgroup A avian leukosis virus (ALV-A) receptor gene (Tva) is disclosed, wherein the 55th and 69th amino acid sites of the Tva protein encoded by the mutated A subgroup A avian leukosis virus (ALV-A) receptor gene (Tva) are mutated or deleted.
[0010] The inventors of this invention discovered that amino acids L55 and W69 of Tva are key amino acid sites for mediating ALV-A invasion. Therefore, any mutation or deletion of these two amino acid sites will prevent Tva from acting as an ALV-A receptor to mediate ALV-A infection. Thus, any mutated Tva gene obtained by mutating or deleting these two sites should fall within the protection scope of this invention.
[0011] For more specific illustration, in one particular embodiment of the present invention, the nucleotide sequence of the mutated A subgroup avian leukosis virus (ALV-A) receptor gene (Tva) is shown in SEQ ID NO.1.
[0012] Furthermore, this invention also proposes the application of the mutated subgroup A avian leukosis virus receptor gene (Tva) in studying the function of the Tva gene and in preparing biomaterials resistant to subgroup A avian leukosis virus through gene editing.
[0013] Preferably, the biological material is a cell line resistant to A subgroup A avian leukosis virus infection.
[0014] Preferably, the cell line is the DF-1 cell line.
[0015] Furthermore, this invention also proposes a method for constructing a DF-1 cell line resistant to A subgroup avian leukosis virus infection. The method utilizes the CRISPR / Cas9 method and flow cytometry screening to mutate or delete amino acid positions 55 and 69 of the Tva protein encoded by the A subgroup avian leukosis virus receptor gene (Tva).
[0016] Preferably, the nucleotide sequence of the mutated A subgroup avian leukosis virus receptor gene (Tva) is shown in SEQ ID NO.1.
[0017] More preferably, the method includes the following steps:
[0018] (1) Construction of Tva-sgRNA knockout plasmid
[0019] A Tva knockout guide RNA sequence was synthesized and inserted into the pMD-18T vector to construct the Tva-sgRNA knockout plasmid, wherein the guide RNA sequence is shown in SEQ ID NO.2;
[0020] (2) Synthesis of ssODN sequence
[0021] The ssODN sequence shown in SEQ ID NO.3 was synthesized, and the L55 and W69 amino acids encoded by the original Tva gene were expressed by mutation.
[0022] (3) Construction and screening of r-Tva cell lines
[0023] pCas9-GFP plasmid, Tva-sgRNA plasmid and ssOND were co-transfected into DF-1 cells. After 48 h of culture, cells with GFP fluorescence were screened using a flow cytometer. Positive cells were inoculated into 96-well plates. After 7 days, the single-clonal cell lines were observed under an optical microscope and the culture was expanded.
[0024] (4) Identification of cell lines
[0025] The genome of the monoclonal cell line was extracted using a genome extraction kit. A sequence upstream and downstream of the mutation site was selected as primers for PCR amplification. The amplified products were sequenced and analyzed. The replacement sequence was successfully inserted into the Tva gene, indicating that the DF-1 cell line resistant to A subgroup A avian leukosis virus infection was successfully obtained.
[0026] Preferably, the primer sequence described in step (4) is:
[0027] Tva-CX-F:gttctttggcgcagtgctc;
[0028] Tva-CX-R:cgctgcagctgagctttatg.
[0029] The DF-1 cell line resistant to A subgroup A avian leukosis virus infection constructed according to the method is also within the scope of protection of this invention.
[0030] Compared with the prior art, the beneficial effects of the present invention are:
[0031] ALV infection rates remain high in breeding flocks in my country. For diseases like avian leukosis, for which there are currently no vaccines or effective treatments, the main control measures rely on eradication and culling of infected animals, requiring significant manpower and resources. However, the development of CRISPR / Cas9 gene editing technology has brought new opportunities for the control of avian leukosis. By editing the genes of essential host factors required for viral infection of host cells, a natural barrier against ALV infection can be established. However, some receptor molecules involved in maintaining normal cellular physiological functions cannot be directly knocked out. Therefore, gene editing technology that constructs mutations at key amino acid sites of receptors in vitro is crucial for creating gene-edited animals.
[0032] The Tva gene, acting as an ALV-A receptor, is crucial for cellular uptake of vitamin B12. Research by the inventors of this invention revealed that amino acids 55 and 69 of Tva are key amino acid sites mediating ALV-A invasion. Therefore, this invention successfully mutated or deleted amino acids 55 and 69 of Tva using CRISPR / Cas9 technology. Results showed that the Tva gene-edited cell line r-Tva can be effectively obtained using CRISPR / Cas9 technology. Inoculation results showed that the Tva gene-edited cell line r-Tva is effectively resistant to ALV-A infection. This invention lays the foundation for further development of gene-edited chickens.
[0033] Currently, the construction of DF-1 gene-edited cells mainly involves transfecting Cas9 expression plasmids containing resistance and replacing fragments. This method obtains gene-edited cell lines through drug screening, increasing the probability of random integration of exogenous resistance genes into the host genome. However, this method poses certain risks for the construction of transgenic chickens. This invention successfully screened and obtained the Tva gene-edited cell line r-Tva using flow cytometry, reducing the risk of random insertion of transfected plasmids into the host genome. Attached Figure Description
[0034] Figure 1To identify the proliferation level of the r-Tva cell line;
[0035] Figure 2 To detect the level of infection against ALV-A-GFP strain in r-Tva cell lines;
[0036] Figure 3 To detect the level of resistance to ALV-A strain infection in r-Tva cell lines. Detailed Implementation
[0037] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become clearer as a result. However, these examples are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.
[0038] Example 1: Design of the mutant A subgroup avian leukosis virus receptor gene (Tva)
[0039] The inventors of this invention discovered that amino acids 55 and 69 of Tva are key amino acid sites for mediating ALV-A invasion. The nucleotide sequence of the Tva gene before mutation is shown in SEQ ID NO.4. Any mutation or deletion of these two amino acid sites will prevent Tva from acting as an ALV-A receptor to mediate ALV-A infection. Therefore, this invention involves mutations or deletions at amino acid sites 55 and 69 of Tva.
[0040] In this specific embodiment, the nucleotide sequence of the mutated Tva gene is shown in SEQ ID NO.1.
[0041] Example 2: Construction of DF-1 cell line resistant to A subgroup A avian leukosis virus infection
[0042] 1. Materials and Methods
[0043] 1.1 Main Experimental Materials
[0044] DF-1 cells and the recombinant virus ALV-A-GFP strain expressing green fluorescent protein were preserved in our laboratory; 4A3 mouse-derived Mab was prepared in our laboratory; ALV-A (RAV-1) was isolated in our laboratory; Alexa Fluor 546 goat anti-mouse antibody was purchased from Thermo Fisher Scientific; TIANamp Genomic DNA extraction kit was purchased from TIANGEN; pMD-18T vector was purchased from TARAKA; pCas9-GFP plasmid was preserved in our laboratory.
[0045] 1.2 Carrier Construction
[0046] The Tva knockout guide RNA (gRNA) sequence (CGCTGGAGTGGCTCTGCGAC, SEQ ID NO. 2) was designed using the E-CRISP online software (http: / / www.e-crisp.org / E-CRISP / designcris / html) and inserted into the pMD-18T vector to construct the Tva-sgRNA knockout plasmid. Based on the Tva gene sequence in NCBI (https: / / www.ncbi.nlm.nih.gov / ), an ssODN (GCCGCACGATCCCCAGACCGACTGCTACCCGCTGGAGTGGAGGTGC GACGGGCATCCCGACTGCGACGATGGACGGGACGAGCTGGGCTGCGGAGC GAGCGGGAGCCCCGCGGTGCCCACCGCC, SEQ ID NO. 3) was designed to express the L55 and W69 amino acid sequences encoded by the Tva gene.
[0047] 1.3 Construction and screening of r-Tva cell lines
[0048] pCas9-GFP plasmid, Tva-sgRNA plasmid, and ssOND were co-transfected into DF-1 cells. After 48 h of culture, cells with GFP fluorescence were screened using a flow cytometry sorter. The sorted positive cells were then transferred into 96-well plates. After 7 days, the selected monoclonal cell line (r-Tva) was observed under an optical microscope and expanded. The genome of the r-Tva cell line was extracted using a genome extraction kit. The replacement sequence was amplified using Tva-CX-F (GTTCTTTGGCGCAGTGCTC) and Tva-CX-R (CGCTGCAGCTGAGCTTTATG) primers. The amplified products were recovered and sequenced for identification.
[0049] 1.4 Detection of growth level of r-Tva cell line
[0050] r-Tva cell line and wild-type DF-1 cell line were seeded into 96-well plates. 12 hours after seeding, the growth level of the cell lines was detected using the CCK8 assay kit according to the instructions. In short, 10 μL of chromogenic solution was added to each well, and the cells were incubated at 37°C in the dark for 2 hours. The readings were then taken using a microplate reader at the 450 nm channel.
[0051] 1.5 Detection of anti-ALV-A-GFP infection level in r-Tva cell lines
[0052] r-Tva cell line and wild-type DF-1 cell line were seeded into 12-well plates and inoculated with ALV-A-GFP strain (10⁻¹²) after 16 hours. 5.2 TCID 50 100 μL / well ( / mL) was prepared, with three parallel wells for each cell type. 72 h after inoculation, the GFP fluorescence ratio was observed using an inverted fluorescence microscope to detect the proportion of r-Tva cell lines and wild-type DF-1 cell lines infected with the ALV-A-GFP strain.
[0053] 1.6 Detection of anti-ALV-A wild-type strain infection level in r-Tva cell lines
[0054] r-Tva cell line and wild-type DF-1 cell line were seeded into 12-well plates and inoculated with ALV-A (RAV-1) strain (10 μL) after 16 h. 5.5 TCID 50 / mL) / well, with 3 parallel wells per group. After 72h of inoculation, the cells were fixed with 4% paraformaldehyde. The primary antibody was 4A3 mouse MAb (1:100 dilution), and the secondary antibody was Alexa Fluor 546 goat anti-mouse antibody (1:1000 dilution). The proportion of r-Tva cell lines and wild-type DF-1 cell lines infected with ALV-A (RAV-1) strain was detected by IFA.
[0055] 2 Results
[0056] 2.1 Construction and screening of r-Tva cell lines
[0057] Using the CRISPR / Cas9 method, a substitution sequence was inserted into the Tva gene, causing it to express the L55 and W69 mutants. The genome of the r-Tva cell line was extracted, and the r-Tva cell line was amplified and identified using PCR. Using the r-Tva cell line genome as a template, primers were selected upstream and downstream of the mutation site for amplification, and the amplified products were sequenced. The substitution sequence was successfully inserted into the Tva gene, indicating that the r-Tva cell line was successfully obtained.
[0058] 2.2 Detection of proliferation level of r-Tva cell line
[0059] r-Tva cell line and wild-type DF-1 cell line were seeded into 96-well plates, respectively. Cell viability was detected using a CCK8 assay kit after 12 hours. The results are as follows: Figure 1 As shown, the results indicate that there is no difference in cell viability between the r-Tva cell line and the wild-type DF-1 cell line.
[0060] 2.3 Detection of anti-ALV-A-GFP infection level in r-Tva cell lines
[0061] r-Tva cell line and wild-type DF-1 cell line were seeded into 12-well plates, respectively. After 16 h, they were inoculated with ALV-A-GFP and ALV-B-GFP strains, respectively. The GFP fluorescence ratio was observed 72 h after inoculation. The results are as follows: Figure 2 As shown, the results indicated that, compared to wild-type DF-1 cells, the r-Tva cell line showed no GFP fluorescence after inoculation with the ALLV-A-GFP strain. This suggests that the r-Tva cell line is resistant to infection by the ALLV-A-GFP strain.
[0062] 2.4 Detection of the level of r-Tva cell line against wild-type ALV-A strain infection
[0063] r-Tva cell line and wild-type DF-1 cell line were seeded into 12-well plates, respectively. After 16 hours, they were inoculated with ALV-A wild-type virus. Indirect immunofluorescence assay was performed 72 hours after inoculation. Results are as follows: Figure 3 As shown, the results indicated that, compared with wild-type DF-1 cells, the r-Tva cell line was not infected with the wild-type ALLV-A strain (red fluorescence), indicating that the r-Tva cell line is resistant to infection by the wild-type ALLV-A strain. sequence list <110> Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Harbin Branch of China Animal Health and Epidemiology Center) <120> A mutated receptor gene for subgroup A avian leukosis virus and its application in combating subgroup A avian leukosis virus infection. <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 369 <212> DNA <213> artificial sequence <400> 1 atggtgcggttgttggagctgctggtgctgctgcgcgccgtccgcccgctgcccacccccacctccgcgcccggcaacggttctttggcgcagtgctcacccgagcagttccactgttcggagccgcacgatccccagaccgactgctacccgctggagtggaggtgcgacgggcatcccgactgcgacgatggacgggacgagctgggctgcggagcgagcgggagccccgcggtgcccaccgccggcggcacagagacttcagctgtccctgcgcctgggcgtgctctgccatccaggaaccacggccgcatgtggatgctgatcgttgcagggatctttcactgtgaggtggtaagatgggactga <210> 2 <211> 20 <212> DNA <213> artificial sequence <400> 2 cgctggagtggctctgcgac <210> 3 <211> 124 <212> DNA <213> artificial sequence <400> 3 gccgcacgatccccagaccgactgctacccgctggagtggaggtgcgacgggcatcccgactgcgacgatggacgggacgagctgggctgcggagcgagcgggagccccgcggtgcccaccgcc <210> 4 <211> 369 <212> DNA <213> Tva <400> 4 atggtgcggttgttggagctgctggtgctgctgcgcgccgtccgcccgctgcccacccccacctccgcgcccggcaacggttctttggcgcagtgctcacccgagcagttccactgttcggagccgcacgatccccagaccgactgctacccgctggagtggctctgcgacgggcatcccgactgcgacgatggacgggacgagtggggctgcggagcgagcgggagccccgcggtgcccaccgccggcggcacagagacttcagctgtccctgcgcctgggcgtgctctgccatccaggaaccacggccgcatgtggatgctgatcgttgcagggatctttcactgtgaggtggtaagatgggactga
Claims
1. A method for constructing a DF-1 cell line resistant to A subgroup A avian leukosis virus infection, characterized in that, The method includes using CRISPR / Cas9 and flow cytometry to screen for the receptor gene of subgroup A avian leukosis virus (ALEV). Tva The 55th and 69th amino acid sites of the Tva protein encoded by the gene were mutated, resulting in a mutation in the receptor gene of subgroup A avian leukosis virus (AVA). Tva The nucleotide sequence of is shown in SEQ ID NO.
1.
2. The method as described in claim 1, characterized in that, Includes the following steps: (1) Construction of Tva-sgRNA knockout plasmid synthesis Tva The guide RNA sequence was knocked out and inserted into the pMD-18T vector to construct the Tva-sgRNA knockout plasmid, wherein the guide RNA sequence is shown in SEQ ID NO.2; (2) Synthesis of ssODN sequence The synthesized ssODN sequence shown in SEQ ID NO.3 was used to transform the original... Tva Mutant expression of amino acids L55 and W69 encoded by the gene; (3) Construction and screening of r-Tva cell lines pCas9-GFP plasmid, Tva-sgRNA plasmid, and ssOND were co-transfected into DF-1 cells. After 48 h of culture, cells with GFP fluorescence were screened using a flow cytometry system. Positive cells were then inoculated into 96-well plates. After 7 days, single-clonal cell lines were observed and screened under an optical microscope and cultured on a larger scale. (4) Identification of cell lines The genome of a single-clonal cell line was extracted using a genome extraction kit. A sequence upstream and downstream of the mutation site was selected as primers for PCR amplification, and the amplified products were sequenced. The inserted replacement sequence was successfully confirmed. Tva The gene sequence indicates that the DF-1 cell line resistant to A subgroup A avian leukosis virus infection has been successfully obtained; the primer sequence is as follows: Tva-CX-F:gttctttggcgcagtgctc; Tva-CX-R:cgctgcagctgagctttatg.
3. The DF-1 cell line resistant to A subgroup A avian leukosis virus infection constructed according to the method of claim 1 or 2.
Citation Information
Patent Citations
Anti-ALV-J chicken chNHE1 gene editing cell line and construction method thereof
CN115595327A
Molecular marker for genetic resistance of chicken to infection by subgroups a and k avian leukosis virus and use thereof
US20230313319A1
Avian-specific viral vaccine vectors
WO2024161017A1
KR20230160724A