A method for rapid detection of heat-resistant enzyme-producing pseudomonas in raw milk based on LAMP-LFD
By designing specific primers based on the LAMP-LFD method and combining them with lateral flow test strips, the problem of rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk was solved, achieving efficient and simple detection results, which are suitable for dairy product quality control.
Patent Information
- Application Number
- CN202211345765.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-31
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2042-10-31
AI Technical Summary
Existing technologies make it difficult to quickly and easily detect thermostable enzyme-producing Pseudomonas aeruginosa in raw milk, leading to a shortened shelf life of dairy products. Furthermore, traditional methods are cumbersome and unsuitable for on-site testing.
Using a LAMP-LFD-based method, specific LAMP primers were designed and combined with lateral flow test strips or agarose gel electrophoresis to achieve rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa. Visual detection was achieved using biotin-labeled primers and fluorescein isothiocyanate-labeled probes.
It achieves highly sensitive, specific, and rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk, with results available within 1 hour. It is suitable for on-site testing in dairy farms and simplifies the operation process.
Smart Images

Figure CN115747311B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of food safety testing technology, specifically relating to a method for rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD. Background Technology
[0002] Dairy products are rich in various proteins, fats, vitamins, and minerals essential for the human body. Milk fat, in particular, is mostly short-chain and medium-chain fatty acids, which are easily absorbed, making them increasingly popular with consumers. As my country's consumption of dairy products increases, so does research on raw milk. Raw milk, as the main raw material for dairy products, directly impacts product quality and safety. With the application of cold chain logistics in the dairy industry, the growth of thermophilic bacteria is inhibited, while cold-resistant bacteria continue to grow, becoming the dominant bacterial group in raw milk. These bacteria are widely present in all stages of dairy processing and production, potentially posing a risk to raw milk. Studies have shown that the abundance of cold-resistant Pseudomonas aeruginosa increases rapidly in raw milk transported for more than 48 hours. Furthermore, Pseudomonas aeruginosa possesses a conserved aprX gene, with over 80% of Pseudomonas aeruginosa carrying this gene locus. This gene expresses extracellular proteases, which are heat-resistant proteases belonging to the serum lysozyme family. Some of these extracellular proteases secreted by Pseudomonas aeruginosa remain after pasteurization and ultra-high temperature (UHT) sterilization; even after treatment at 130°C for 1 minute, the enzyme residue rate remains at 42.55%. These residual enzymes can lead to the hydrolysis of proteins and fats in milk during later storage, thus shortening the shelf life of dairy products. Therefore, monitoring and controlling heat-resistant enzyme-producing Pseudomonas aeruginosa in raw milk is crucial for ensuring the safety of dairy products.
[0003] In recent years, with the continuous development of molecular biology, although the bacterial culture-based counting method in GB4789.2-2016 is still a commonly used method for bacterial detection, its long cycle and cumbersome operation make it difficult to meet the needs of real-time and rapid on-site detection in dairy product production. Research on pathogenic microorganisms mainly focuses on rapid detection technologies such as polymerase chain reaction (PCR), enzyme-linked immunosorbent assay (ELISA), and loop-mediated isothermal amplification (LAMP). PCR technology has developed rapidly and is considered an accurate and reliable detection method, but its detection limit is not very high, and the amplification results need to be observed by electrophoresis. Real-time quantitative PCR (RT-PCR) is widely used due to its high sensitivity and ability to quantitatively determine the number of microorganisms; however, this technology requires cumbersome temperature changes, and operators need certain training, making on-site detection in rudimentary environments such as pastures impractical. LAMP detection uses four specific primers designed for six specific regions of the target gene, thus LAMP detection has higher specificity, and the amplification reaction can be completed in twenty minutes under the action of BstDNA polymerase. LAMP amplification products can be measured using various methods, such as agarose gel electrophoresis or post-reaction turbidity measurement. Furthermore, the results can be visually observed by adding fluorescent dyes. Currently, LAMP-based detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk is not widely used. Summary of the Invention
[0004] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.
[0005] Another objective of this invention is to provide a method for rapid detection of thermostable protease-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD. This invention designs a set of specific LAMP primers for thermostable protease-producing Pseudomonas aeruginosa and establishes an efficient and rapid detection method, which is crucial for strengthening the quality control of dairy products.
[0006] Therefore, the technical solution provided by this invention is as follows:
[0007] A method for rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD includes the following steps:
[0008] Step 1: Extract bacterial genome from raw milk;
[0009] Step 2: Using the bacterial genome from Step 1 as a template, a loop-mediated isothermal amplification reaction is performed with a set of outer primers as shown in SEQ ID NO:1 and SEQ ID NO:2 and a set of inner primers as shown in SEQ ID NO:3 and SEQ ID NO:4.
[0010] Step 3: Detect the amplification products from Step 2 using lateral flow test strips, agarose gel electrophoresis, or by adding SYBR Green I dye to the amplification products. If the reaction is positive, or there are amplification bands as expected, or there is fluorescence, then the raw milk is considered to contain thermostable enzyme-producing Pseudomonas.
[0011] Preferably, in the method for rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD, when using lateral flow test strips, the 5' end of the upstream inner primer FIP (as shown in SEQ ID NO:3) is labeled with biotin, and the 5' end of the probe L1 (as shown in SEQ ID NO:20) is labeled with fluorescein isothiocyanate.
[0012] The loop-mediated isothermal amplification reaction was performed using a set of outer primers as shown in SEQ ID NO:1 and SEQ ID NO:2 and a set of biotin-labeled inner primers as shown in SEQ ID NO:3 and SEQ ID NO:4. After the reaction was completed, a probe L1 labeled with fluorescein isothiocyanate was added to the reaction system for hybridization.
[0013] The diluted hybridization reaction solution is added to the sample well of the lateral flow test strip for detection.
[0014] Preferably, in the method for rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD, in step two, the specific amplification system of the loop-mediated isothermal amplification reaction includes: 100 mM Mg 2+ , 1.0-2.0μl.
[0015] Preferably, in the method for rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD, the amplification system of the loop-mediated isothermal amplification reaction further includes: 3-4 μl of dNTPs at a concentration of 10 mM.
[0016] Preferably, in the method for rapid detection of thermostable enzyme-producing Pseudomonas in raw milk based on LAMP-LFD, the amplification conditions of the loop-mediated isothermal amplification reaction are carried out sequentially as follows: 25℃ for 5 min, 63℃ for 40 min, and 80℃ for 10 min.
[0017] Preferably, in the method for rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD, the loop-mediated isothermal amplification reaction is carried out in a water bath.
[0018] A LAMP primer set for rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD includes the following primers:
[0019] For example, upstream outer primer F3 as shown in SEQ ID NO:1
[0020] Downstream outer primer B3, as shown in SEQ ID NO:2
[0021] As shown in SEQ ID NO:3, the upstream inner primer FIP,
[0022] The downstream inner primer BIP is shown in SEQ ID NO:4.
[0023] A rapid detection kit for thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD, the kit comprising the LAMP primers described above.
[0024] Preferably, in the LAMP-LFD-based rapid detection kit for thermostable enzyme-producing Pseudomonas aeruginosa in raw milk, the kit further includes: probe L1 as shown in SEQ ID NO:20, wherein the 5' end of the upstream inner primer FIP as shown in SEQ ID NO:3 is labeled with biotin, and the 5' end of probe L1 as shown in SEQ ID NO:20 is labeled with fluorescein isothiocyanate.
[0025] This invention has at least the following advantages:
[0026] Compared with traditional culture methods, the LAMP method of this invention has high sensitivity, strong specificity, rapid detection, and simple operation. It can quickly detect Pseudomonas aeruginosa producing heat-resistant protease in raw milk in just 1 hour in a regular water bath. The results can be observed by lateral flow test strip LFD, agarose gel electrophoresis, or SYBR Green I dye. It can be used for online monitoring and on-site detection of Pseudomonas aeruginosa producing heat-resistant protease in raw milk. Especially when using lateral flow test strip LFD detection, the results can be quickly detected by adding biotin-labeled LAMP primers and probes to the test strip, allowing for visual detection of raw milk in farms.
[0027] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description
[0028] Figure 1 This is an agarose gel electrophoresis image of LAMP primer screening using the genome of Pseudomonas azotoformans as a template in one embodiment of the present invention. Note: 1-4 represent primer sets P2, P3, P4, and P1, respectively.
[0029] Figure 2This is an agarose gel electrophoresis image of the specific detection of the LAMP primers described in one embodiment of the present invention. Note: M is DNA 2K Marker, 1 and 12 are negative controls, 2 is azotobacter, 11 is fluorescent Pseudomonas, 3-10 are Pseudomonas rondosum, Pseudomonas fragilis, Pseudomonas psychrophilus, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas proteoglycinus, Pseudomonas lactis, and Pseudomonas aeruginosa, respectively; 13-19 are Streptococcus mutans, Enterococcus faecalis, Staphylococcus aureus, Marine psychrophilic bacillus, Escherichia coli, Acinetobacter lophiae, and Serratia liquefaction, respectively.
[0030] Figure 3 This is a SYBR Green I staining result of the specific detection of the LAMP primers described in one embodiment of the present invention. Note: 1-10 are respectively *Pseudomonas aeruginosa*, *Pseudomonas fluorescens*, *Pseudomonas rondosum*, *Pseudomonas fragilis*, *Pseudomonas psychotropica*, *Pseudomonas aeruginosa*, *Pseudomonas putida*, *Pseudomonas proteoglycans*, *Pseudomonas lactis*, and *Pseudomonas chloris*.
[0031] Figure 4 This is an agarose gel electrophoresis image of the sensitivity detection of the LAMP primers described in one embodiment of the present invention.
[0032] Figure 5 This is a graph showing the detection results of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk using the LAMP method described in one embodiment of the present invention. Note: Raw milk samples 1-6 are 10... -5 10 -4 10 -3 10 -2 10 -1 10 0 CFU / ml, 7 is the negative control.
[0033] Figure 6 This is a graph showing the detection results of a lateral flow test strip for the *Pseudomonas ammoniagenic* group in one embodiment of the present invention. Note: 1 is the blank control, and the total colony counts corresponding to 2-8 are 4.02 × 10⁻⁸. 9 4.02×10 8 4.02×10 6 4.02×10 5 4.02×10 2 4.02×10 1 4.02×10 0 CFU / mL. Detailed Implementation
[0034] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.
[0035] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not imply the presence or addition of one or more other elements or combinations thereof.
[0036] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.
[0037] This invention provides a rapid detection method for thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD, and explores the following aspects, including:
[0038] 1. Primer screening process:
[0039] 2. Optimization of LAMP reaction conditions and reaction components
[0040] This includes Bst DNA polymerase, 10×ThermoPol Buffer, dNTPs, and Mg. 2+ Optimization of reaction time and reaction temperature.
[0041] 3. Evaluation of the specificity of LAMP for the detection of thermostable protease-producing Pseudomonas aeruginosa.
[0042] 4. Determination of the detection limit of LAMP for thermostable protease-producing Pseudomonas aeruginosa.
[0043] The present invention provides a method for rapid detection of thermostable enzyme-producing Pseudomonas aeruginosa in raw milk based on LAMP-LFD, comprising the following steps:
[0044] 1. Based on metagenomic sequencing technology, the top 10 Pseudomonas species with the highest abundance in raw milk were screened.
[0045] 2. After treatment at 105℃ for 5 seconds, the residual rate of protease in Pseudomonas was determined.
[0046] 3. One pair of outer primers (F3, B3) and one pair of inner primers (FIP, BIP) were selected for the aprX gene of Pseudomonas species with high protease residue rates.
[0047] Upstream outer primer F3: TCTCCGGGTTCAGCCAATT (SEQ ID NO:1)
[0048] Downstream outer primer B3: CGTAGCCTGCACCGGTAC (SEQ ID NO:2)
[0049] Upstream inner primer FIP: CGTTGGCAACATCCGCCCAGCAACACCCAGCAGAAAGCA (SEQ ID NO:3)
[0050] Downstream inner primer BIP: GGCGGTGACGGCCACATGACGGGCAGGTAAGCGAAG (SEQ ID NO:4)
[0051] 4. Bacterial genome extraction can be performed using a bacterial genome extraction kit.
[0052] 5. Establishment of a LAMP method for detecting the genome of thermostable protease-producing Pseudomonas aeruginosa. This includes 0.8 μl of Bst DNA polymerase 8000 U / ml (NEW ENGLAND BioLabs); and 10× ThermoPol Buffer (contains 2 mM Mg). 2+ ), 2.5μl; dNTPs (10mM), 3-4μl; Mg 2+ (100mM), 1-2 μl; DNA template, 1.0 μl; ddH2O to bring the total to 25 μl. React sequentially at 25℃ for 5 min, 63℃ for 40 min, and 80℃ for 10 min.
[0053] 6. The reaction results can be obtained by agarose gel electrophoresis. Negative results show no band, while positive results show a band. Alternatively, adding 1 μl of SYBR Green dye will result in no fluorescence for negative results and fluorescence for positive results. Furthermore, if the sample is positive, the total bacterial count must be greater than 5.8 × 10⁻⁶. 1 CFU / ml.
[0054] To enable those skilled in the art to better understand the technical solution of the present invention, the following embodiments are provided for detailed description:
[0055] Example 1
[0056] I. Primer screening process:
[0057] 1. Based on metagenomic sequencing technology, the top 10 Pseudomonas species with the highest abundance in raw milk were screened.
[0058] 2. After treatment at 135℃ for 5 seconds, the residual rate of protease in Pseudomonas was determined.
[0059] 3. Using primers aprX-F (5’-AAATCGATAGCTTCAGCCAT-3’ SEQ ID NO:17) and aprX-R (5’-TTGAGGTTGATCTTCTGGTT-3’ SEQ ID NO:18), the genomic DNA of Pseudomonas azotoformans with a relatively high protease residual rate was amplified for the aprX gene sequence, and the result is as follows SEQ ID NO:19: GTCCTACACCGTGGACCAGGCAGCGACCCAGCTGCTGCGGGATGGTGCTGCGTACCGGGACTTTGATGGTAACGGCAAGATCGATCTGACCTACACCTTCCTCACCTCGGCTACCCAGAGCACCATGAACAAACATGGCATCTCCGGGTTCAGCCAATTCAACACCCAGCAGAAAGCACAGGCCGCACTGGCCATGCAATCCTGGGCGGATGTTGCCAACGTGACCTTTACCGAAAAGGCTTCCGGCGGTGACGGCCACATGACCTTCGGCAACTACAGCAGCGGCCAGGACGGCGCCGCGGCCTTCGCTTACCTGCCCGGTACCGGTGCAGGCTACGACGGCACTTCGTGGTACCTGACCAACAATAGCTACACGCCGAACAAGACCCCGGACCTGAACAACTATGGCCGGCAGACCCTGACCCACGAAATCGGCCACACCCTGGGCCTGGCTCACCCTGGCGACTACAACGCCGGGAACGGCAACCCGACCTATAACGACGCAACCTATGGACAGGACACGCGTGGCTATAGCCTCATGAGTTACTGGAGCGAGAGCAACACCAACCAGAACTTCAGCAAGGGCGGCGTCGAGGCTTACGCTTCCGGCCCGCTGATCGACGATATCGCCGCGATCCAGAAGCTCTACGGTGCCAACCTCAACACCCGCGCCACCGACACCACCTACGGGTTCAACTCCAACACCGGGCGTGATTTCCTCAGCGCCAGCTCCAATGCTGACAAGC。
[0060] 4. Submit the aprX gene sequence of Pseudomonas azotoformans to PrimerExplorer V5 software and complete the design of outer primers F3 and B3, and inner primers FIP and BIP. The primer design includes 4 sets.
[0061] P1: Upstream outer primer F3: CCGGACCTGAACAACTATGG (SEQ ID NO:1)
[0062] Downstream inner primer B3: GCTGAGTTCTGGTTGGTGT (SEQ ID NO:2)
[0063] Upstream inner primer FIP: CGTTGTAGTCGCCAGGGTGAGCAGACCCTGACCCACGAAAT (SEQ ID NO:3)
[0064] Downstream inner primer BIP: GGAACGGCAACCCGACCTGCTCCAGTAACTCATGAGGC (SEQ ID NO:4)
[0065] P2: Upstream primer F3: TCTCCGGGTTCAGCCAATT (SEQ ID NO:5)
[0066] Downstream inner primer B3: CGTACTAGCCTGCACCGGTAC (SEQ ID NO:6)
[0067] Upstream inner primer FIP: CGTTGGCAACATCCGCCCAGCAACACCCAGCAGAAAGCA (SEQ ID NO:7)
[0068] Downstream inner primer BIP: GGCGGTGACGGCCACATGACGGGCAGGTAAGCGAAG (SEQ ID NO:8)
[0069] P3: Upstream primer F3: AACGCAACCCGACCTA (SEQ ID NO: 9)
[0070] Downstream inner primer B3: TGGCGCGGGTGTTGAG (SEQ ID NO:10)
[0071] Upstream inner primer FIP: TGGTTGGTGTTGCTCTCGCTCCTAACGACGCAACCTATGGAC (SEQ ID NO:11)
[0072] Downstream inner primer BIP: GAACTTCAGCAAGGGCGGCGCGTAGAGCTTCTGGATCGC (SEQ ID NO:12)
[0073] P4: Upstream primer F3: TGGACCAGGCAGCGAC (SEQ ID NO:13)
[0074] Downstream inner primer B3: TCCGCCCAGGATTGCA (SEQ ID NO:14)
[0075] Upstream inner primer FIP: CCGAGGTGAGGAAGGTGTAGGTGGGATGGTGCTGCGTAC (SEQ ID NO:15)
[0076] Downstream inner primer BIP: AACAAACATGGCATCTCCGGGTAGTGCGGCCTGTGCTTTC (SEQ ID NO:16)
[0077] 5. LAMP primers were screened using the genome of *Pseudomonas aeruginosa* as a template, and the results are as follows: Figure 1 The results show that 1-4 represent primer sets P2, P3, P4, P1, and P3 respectively, indicating no amplification; primer sets P2 and P4 showed poor amplification; and primer set P1 showed the best amplification. Therefore, primer set P1 was selected to optimize the LAMP reaction conditions.
[0078] Example 2
[0079] Specific detection of azotobacter and fluorescein-producing Pseudomonas aeruginosa in raw milk that produce heat-stable proteases
[0080] 1. Download the first 20 aprX genes of *Pseudomonas azotocinae* and *Pseudomonas fluorescens* using NCBI, and submit these sequences to MEGA software for multiple sequence alignment analysis.
[0081] 2. Select one set of LAMP primers below: 2 outer primers (F3 and B3) and 2 inner primers (FIP and BIP).
[0082] Upstream outer primer F3: CCGGACCTGAACAACTATGG (SEQ ID NO:1)
[0083] Downstream inner primer B3: GCTGAGTTCTGGTTGGTGT (SEQ ID NO:2)
[0084] Upstream inner primer FIP: CGTTGTAGTCGCCAGGGTGAGCAGACCCTGACCCACGAAAT (SEQ ID NO:3)
[0085] Downstream inner primer BIP: GGAACGGCAACCCGACCTGCTCCAGTAACTCATGAGGC (SEQ ID NO:4)
[0086] 3. Azotobacterium, Pseudomonas fluorescens, and common contaminants in raw milk, including 8 strains of Pseudomonas (Rotavirus, Pseudomonas fragilis, Pseudomonas psychrophilus, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas protease, Pseudomonas lactis, Pseudomonas aeruginosa) and 7 strains of non-Pseudomonas (Streptococcus mutans, Enterococcus faecalis, Staphylococcus aureus, Psychrophilic bacillus, Escherichia coli, Acinetobacter, Serratia liquefaction), were activated by culturing at 28°C and 180 rpm for 24 hours, and DNA was extracted using a bacterial genome extraction kit.
[0087] 4. Add the genome as a template to the reaction system and incubate at 25℃ for 5 min, 63℃ for 40 min, and 80℃ for 10 min. The reaction system includes 0.8 μl of Bst DNA polymerase 8000 U / ml (NEW ENGLAND BioLabs); and 10×ThermoPol Buffer (contains 2 mM Mg). 2+ ), 2.5μl; dNTPs (10mM), 3μl; Mg 2+ (100mM), 2μl; DNA template, 1.0μl; ddH2O to bring the total to 25μl.
[0088] 5. Add 1 μl of 6× DNA loading buffer to 5 μl of the reaction solution and perform electrophoresis on a 2% agarose gel at 100V for 40 min. Alternatively, add 1 μl of SYBR Green I to 5 μl of the reaction solution. The results showed that only *Pseudomonas aeruginosa* and *Pseudomonas fluorescens* exhibited amplification bands or fluorescence; other common contaminating bacteria did not show amplification bands or fluorescence. This indicates that the designed primers are highly specific for *Pseudomonas aeruginosa* and *Pseudomonas fluorescens*, and are not affected by contamination from other bacteria. Figure 2 and Figure 3 As shown.
[0089] Example 3: Sensitivity detection of thermostable protease-producing Pseudomonas aeruginosa in pure bacterial culture.
[0090] 1. Azotobacter azotobacter was activated by culturing at 28℃ and 180r / min for 24 hours. The bacterial solution was diluted 10 times to 9 gradients. The genomes of the bacterial solutions at different concentrations were extracted using a bacterial genome extraction kit and counted using MPC solid plates.
[0091] 2. Different concentrations of genomic DNA were added to the reaction system as templates, and amplification reactions were performed at 25℃ for 5 min, 63℃ for 40 min, and 80℃ for 10 min. The reaction system included 0.8 μl of Bst DNA polymerase 8000 U / ml (NEW ENGLAND BioLabs); and 10× ThermoPol Buffer (contains 2 mM Mg). 2+ ), 2.5μl; dNTPs (10mM), 3.5μl; Mg 2+ (100mM), 1.5μl; DNA template, 1.0μl; ddH2O to bring the total to 25μl.
[0092] 3. Take 5 μL of the reaction solution and add 1 μL of 6× DNA loading buffer. Perform electrophoresis on a 2% agarose gel at 100V for 40 min. When the bacterial concentration is 5.8 × 10⁻⁶, the reaction solution is ready. 1 Amplification results were still available even at CFU / ml, as shown in the following figure. Figure 4 As shown.
[0093] Example 4: Calculation of the sensitivity for detecting heat-resistant protease-producing Pseudomonas aeruginosa in raw milk.
[0094] 1. Two batches of raw milk were collected from a large-scale ranch in Hebei Province. The raw milk was diluted into 6 gradients by multiples of 10. The genomes of the raw milk at different concentrations were extracted using a bacterial genome extraction kit and counted using MPC solid plates.
[0095] 2. Different concentrations of genomic DNA were added to the reaction system as templates, and amplification reactions were performed at 25℃ for 5 min, 63℃ for 40 min, and 80℃ for 10 min. The reaction system included 0.8 μl of Bst DNA polymerase 8000 U / ml (NEW ENGLAND BioLabs); and 10× ThermoPol Buffer (contains 2 mM Mg). 2+ ), 2.5μl; dNTPs (10mM), 4μl; Mg 2+ (100mM), 1μl; DNA template, 1.0μl; ddH2O to bring the total to 25μl.
[0096] 3. Take 5 μl of the reaction solution and add 1 μl of 6× DNA loading buffer. Perform electrophoresis on a 2% agarose gel at 100V for 40 min. The results are as follows: Figure 5 As shown, one batch of raw milk failed to reach the detection limit, indicating that the bacterial concentration in this batch of raw milk was below the detection limit of 5.8 × 10⁻⁶. 1 CFU / ml, another batch of raw milk was only at a concentration of 10. 0An amplification band was observed at CFU / ml, but no amplification was observed at other concentrations, indicating that the bacterial concentration in this batch of raw milk was 5.8 × 10⁻⁶. 1 CFU / ml.
[0097] Example 5: Visual Detection of LAMP Combined with Lateral Flow Detection Strip (LDF)
[0098] 1. Based on the base sequence between the upstream and downstream outer primers of primer set P1, two sets of probes were designed using Primer5 software, such as L1: GACTACAACGCCGGGAACGGCAA (SEQ ID NO:20) and L2: GTTGCCAACGTGACCTTTACCG (SEQ ID NO:21).
[0099] 2. The upstream inner primer FIP of primer set P1 was labeled with biotin at its 5' end; the probes L1 and L2 were labeled with fluorescein isothiocyanate (FITC) at their 5' ends; the downstream inner primer BIP, upstream outer primer F3, and downstream outer primer of primer set P1 were not modified. The primer set of P1 was sent to Beijing Liuhe BGI Genomics Co., Ltd. for synthesis.
[0100] 3. Using the genome of *Pseudomonas ammoniagenicus* as a template and sterile water as a blank control, LAMP amplification was performed according to the conditions in Case 2. Without terminating the enzyme activity reaction, 2 μL of 10 μmol / L FITC-labeled probes L1 and L2 were added to the reaction system, and hybridization was continued for 5 min.
[0101] 4. Take 10-20 μL of the amplification product and dilute it 2-5 times in a centrifuge tube, then mix well.
[0102] 5. Apply 30-50 μL of dilution solution to the sample well of the HybriDetct lateral flow test strip and record the detection results in the judgment area within 5 minutes. Probe L2 showed a positive result in the blank control, indicating non-specific amplification and making accurate detection impossible; probe L1 showed a negative result in the blank control but a positive result in the *Pseudomonas ammoniagenicus* group, indicating accurate detection.
[0103] 6. Combine primer set P1 and probe set L1, and perform sensitivity detection of the amplified product on the lateral flow test strip according to the above operation. The results are as follows: Figure 6 In this study, 1 represents the blank control, and the total bacterial counts for 2-8 are 4.02 × 10⁻⁸ respectively. 9 4.02×10 8 4.02×10 6 4.02×10 5 4.02×10 2 4.02×10 1 4.02×100 The results showed that the detection limit of the LAMP method combined with the lateral flow test strip was as low as 4.02 × 10⁻⁶ CFU / mL. 1 CFU / mL.
[0104] The number of modules and processing scale described herein are for the purpose of simplifying the description of the invention. Applications, modifications, and variations of the invention will be readily apparent to those skilled in the art.
[0105] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.
Claims
1. A method for rapid detection of heat resistant enzyme producing Pseudomonas in raw milk based on LAMP-LFD, characterized by, Comprising the following steps: Step one, extracting bacterial genome in raw milk; Step two, using a pair of outer primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2, a pair of inner primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4, taking the bacterial genome in step one as a template to carry out loop-mediated isothermal amplification reaction, and the loop-mediated isothermal amplification reaction is carried out in a water bath; Step three, using lateral flow test strip or agarose gel electrophoresis or adding SYBR Green I dye to the amplification product to detect the amplification product in step two, if the reaction is positive or there is an expected amplification band or fluorescence, it is considered that the raw milk contains heat-resistant enzyme producing pseudomonas; When using lateral flow test strip for detection, the 5' end of the upstream inner primer FIP as shown in SEQ ID NO: 3 is labeled with biotin, and the 5' end of the probe L1 as shown in SEQ ID NO: 20 is labeled with fluorescein isothiocyanate, Using a pair of outer primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2, a pair of inner primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4 for the loop-mediated isothermal amplification reaction, after the reaction, fluorescein isothiocyanate-labeled probe L1 is added to the reaction system, and hybridization is carried out; Dilute the reaction solution after hybridization, and add it to the sample well of the lateral flow test strip for detection.
2. The LAMP-LFD based rapid detection method of heat resistant enzyme producing Pseudomonas in raw milk as claimed in claim 1 wherein, In step two, the specific amplification system of the loop-mediated isothermal amplification reaction comprises: 100 mM Mg 2+ 1.0-2.0 μl.
3. The LAMP-LFD based rapid detection method of heat resistant enzyme producing Pseudomonas in raw milk as claimed in claim 2 wherein, The amplification system of the loop-mediated isothermal amplification reaction further comprises: 3-4 μl of dNTPs with a concentration of 10 mM.
4. The LAMP-LFD based rapid detection method of heat resistant enzyme producing Pseudomonas in raw milk as claimed in claim 1 wherein, The amplification conditions of the loop-mediated isothermal amplification reaction are as follows: 25℃ for 5 min, 63℃ for 40 min, and 80℃ for 10 min.
5. A LAMP primer set for rapid detection of heat-resistant enzyme-producing Pseudomonas in raw milk based on LAMP-LFD, characterized by, Comprising the following primers: The upstream outer primer F3 as shown in SEQ ID NO: 1, The downstream outer primer B3 as shown in SEQ ID NO: 2, The upstream inner primer FIP as shown in SEQ ID NO: 3, The downstream inner primer BIP as shown in SEQ ID NO:
4.
6. A LAMP-LFD based rapid detection kit for heat resistant enzyme producing Pseudomonas in raw milk characterized in that, The kit comprises the LAMP primers as claimed in claim 5; The probe L1 as shown in SEQ ID NO: 20, wherein the 5' end of the upstream inner primer FIP as shown in SEQ ID NO: 3 is labeled with biotin, and the 5' end of the probe L1 as shown in SEQ ID NO: 20 is labeled with fluorescein isothiocyanate.
Citation Information
Patent Citations
LAMP primer group for detecting pseudomonas fluorescens capable of producing heat-resistant protease in raw milk and application of LAMP primer group
CN113234843A