Double-stage DNA amplification cascade circulation system and its application

Abstract

The present invention discloses a double-stage amplified DNA cascade circulation system and its application, which constructs a precise imaging system through CAR+CHA+HCR. The target is calculated by the "CAR" combination chain to determine whether to release miR-21, thereby achieving accurate detection of cancer cells. The amplification system consists of a "CHA+HCR" double cycle, where CHA consists of hairpin probes H1 and H2. When miR-21 is present, the CHA cycle is opened, and the formed H1 and H2 duplexes open the HCR cycle, thereby displaying a fluorescent signal. The HCR cycle consists of H3, H 3free The two cycles each perform their own functions and complement each other, ultimately forming a large CHA+HCR system, which further enhances the fluorescence signal.

Description

Technical Field

[0001] The present invention belongs to the technical field of cancer detection, and in particular relates to a double-stage amplification system and its application. Background Art

[0002] Cancer has rapidly become the leading cause of death worldwide, surpassing stroke and coronary heart disease in mortality. According to the 2020 Cancer Statistics, an estimated 19.3 million new cases and 10 million cancer deaths were reported worldwide in 2020. (Cancer Statistics 2020) With an estimated 10 million deaths and 19.3 million new diagnoses worldwide in 2020, cancer remains a significant, yet unmet, burden on global healthcare. However, accurate diagnosis and subsequent effective therapeutic intervention can significantly reduce cancer mortality. Accurate identification of cancer cells is essential for cancer diagnosis, enabling timely treatment and significantly improving patient survival. Recent research in cancer detection has focused on imaging cancer cell-associated biomarkers, which may be cell surface proteins, intracellular gene content, or proteins. However, major challenges in ensuring accurate cancer detection include the low abundance of biomarkers in cancer cells and their nonspecific expression in cancer cells. Due to the low abundance of biomarkers, one-to-one signaling strategies often fail to produce clear images, leading to false-negative results and off-target side effects.

[0003] Since the discovery of miRNAs in Caenorhabditis elegans in 1993, over 2,000 miRNAs have been identified in humans. These miRNAs are believed to act as post-transcriptional regulators, participating in the regulation of over 30% of protein-coding genes. Molecularly, miRNAs inhibit protein synthesis by attenuating gene expression, inducing ribonucleic acid (RNA) cleavage, and translational repression, primarily through the RNA interference (RNAi) pathway, where they base-pair to the 3'-untranslated region (UTR) of target mRNAs. miRNAs are involved in regulating diverse pathways involved in biological processes such as early development, cell differentiation, proliferation, apoptosis, developmental timing, and hematopoiesis. Their expression patterns are regulated both temporally and spatially, and aberrant miRNA expression is closely associated with various human diseases, including lipid metabolism disorders and cancer initiation, progression, metastasis, and treatment resistance. Therefore, miRNAs are considered to be clinically valuable potential diagnostic and prognostic biomarkers and promising drug and gene therapy targets. Sensitive and selective detection of microRNA expression levels is crucial for the early diagnosis, staging, and monitoring of cancer. In particular, in situ visualization of the subcellular location and distribution of specific miRNAs with high spatial resolution is of great value for understanding the biological functions of miRNAs, discovering drug targets, and facilitating personalized treatment. However, accurate analysis of cancer-associated miRNAs remains challenging due to their small size, sequence homology among family members, and low abundance in total RNA samples. Apparently, due to the extreme complexity within cells, truly efficient in situ imaging of miRNAs in living cells remains unexplored.

[0004] Significant efforts have been made to improve the sensitivity of in situ fluorescence imaging of low-abundance biomarkers in cancer cells through isothermal amplification based on DNA cascade circuits, such as catalytic hairpin assembly (CHA), entropy-driven catalysis (EDC), and hybridization chain reaction (HCR). These amplification methods perform one-to-many signal output, allowing a single target molecule to activate multiple signal molecules through programmed DNA assembly or DNA chain growth polymerization reactions, paving the way for enzyme-free signal amplification using only a few artificially programmable DNA sequences.

[0005] Cloning, microarrays, and quantitative reverse transcription real-time polymerase chain reaction (qRT-PCR) are widely used for the identification and quantification of miRNAs. However, these methods often suffer from limited sensitivity, cross-hybridization, error-prone amplification, and the lack of effective internal controls due to the difficulty in designing short miRNA primers. In addition, they are not suitable for biosensing applications under mild physiological conditions, especially intracellular imaging. Other techniques such as colorimetry, fluorescence, chemiluminescence, surface-enhanced Raman spectroscopy, electrochemical measurements, and mass spectrometry are also frequently developed. Nanoparticle-based analysis and deep sequencing have also been used for miRNA detection.

[0006] In 2021, Wang Kemin's research group constructed a hand-in-hand molecular probe for the visualization of TK1 mRNA and the simultaneous killing of cancer cells. By combining chemotherapy and gene silencing, hand-in-hand DNA tile assembly was achieved on the cell surface to improve the therapeutic effect of cancer cells. First, four single-stranded DNA strands were designed to construct a tile motif (pH-Apt-TM), which is rich in GC bases and provides a site for doxorubicin (Dox) insertion. A self-quenching molecular beacon (MB) was designed on pH-Apt-TM, which contains a 17-base recognition sequence for TK1 mRNA and an aptamer targeting MCF-7 cells. PH-induced polymerization is the formation of a complete intermolecular i-motif by two split i-motif DNAs. At neutral pH, pH-Apt-TM exists as a monomer and exhibits universal cell recognition and internalization. However, upon encountering the target cell, the cell can aggregate pH-Apt-TM on the cell surface through the interaction between the target protein and the aptamer. Simultaneously, due to the acidic extracellular pH, the two split i-motif fragments tend to form a complete intermolecular i-motif structure, causing pH-Apt-TM to aggregate, resulting in increased size, increased affinity, and enhanced cell membrane permeability. Furthermore, the resulting macromolecule is internalized into the cell. The MB on the macromolecular bioprobe hybridizes with the target mRNA through the formation of a stable double bond. The opening of the MB leads to the recovery of the fluorescent dye, demonstrating specific imaging of the mRNA and concomitant gene silencing due to hybridization.

[0007] Despite this, existing cancer detection methods have many problems:

[0008] (1) The target concentration is low and the signal is difficult to detect.

[0009] (2) Single target easily leads to false positive

[0010] (3) Targets that are overexpressed in cancer cells are also expressed at low levels in normal cells. This means that there is no absolute absence of the target being detected.

[0011] Here, we developed a "calculation-release" DNA logic (CAR)-gated dual-amplification DNA cascade loop that meets this critical criterion for precise cancer cell identification. The new system consists of a dual-amplification DNA cascade circuit (termed CHA-HCR), a CAR logic gate, and MnO2 nanocarriers. The CHA-HCR circuit, a one-to-many signal amplification element, consists of two functional modules: the CHA amplification circuit and the HCR amplification circuit. The "calculation-release" (CAR) DNA logic gate is designed to dynamically calculate and compare the relative concentrations of two biomarkers and then decide whether to release the target miR-21 to activate the CHA-HCR circuit. MnO2 nanoflowers are used to deliver the CAR logic gate and CHA-HCR circuit, promote fusion with biological membranes, and release the DNA probe in the presence of intracellular glutathione (GSH) for intelligent sensing and cancer identification. Summary of the Invention

[0012] In view of this, the present invention aims to propose a dual-stage amplified DNA cascade circulation system for tumor-targeted detection of cancer cells, so as to solve the problems of poor accuracy, poor effect and low signal of traditional chemical detection methods.

[0013] In order to achieve the above object, the present invention adopts the following technical solutions:

[0014] A dual-stage amplification DNA cascade circulation system includes a CHA-HCR dual-amplification DNA cascade circuit and a MnO2 nanocarrier. The MnO2 nanocarrier is used to load and deliver the CHA-HCR dual-amplification DNA cascade circuit into cells, promote fusion with biological membranes, and release CHA-HCR probes in the presence of intracellular glutathione (GSH) for intelligent sensing and cancer recognition.

[0015] Under the action of miR-21, the CHA-HCR dual amplification DNA cascade circuit is triggered to achieve multiple fluorescent groups luminescence.

[0016] The CHA-HCR dual amplification DNA cascade circuit is a one-to-many signal amplification element, consisting of two functional modules: a CHA amplification circuit and an HCR amplification circuit. The CHA amplification circuit includes hairpin chains H1 and H2, and the HCR amplification circuit includes hairpin chains H3 and H4. The specific sequence is as follows:

[0017] H1 SEQ ID NO:1: 5'-CA GAC TG A TGT TGA T AC CGA TTC GCA A TCA ACA TCAGTC TG A TAA GCT A-3',

[0018] H2 SEQ ID NO:2: 5'-CGC TTC TAC ACT A CC GAT TCG CAA TCA CA GAC TGA TGTTGA T TGC GAA TCG GT AT CAA CAT-3',

[0019] H3 SEQ ID NO:3: 5'-TTG CGA ATC GGT AGT GTA GAA GCG CTC CAT CGC TTC TACACT TCC GAT-3',

[0020] H4 SEQ ID NO:4: 5'-CGCTTCTACACTTCCGATTCGCAATTTT TTT TTTTATCGGAAGTGTAGAAGCGATGGAG-3',

[0021] The 3' end and 5' end of the hairpin chain H3 are labeled with a fluorescent group and a quenching group, respectively.

[0022] Furthermore, the dual-stage amplification DNA cascade circulation system also includes a CAR logic gate, which is loaded on the MnO2 nanocarrier and forms a CAR-CHA-HCR with the CHA-HCR. The CAR logic gate is used to analyze the content of miR-21 and miR-892b. When miR-21 is highly expressed and miR-892b is lowly expressed, miR-21 is released, and under the action of miR-21, the CHA-HCR dual amplification DNA cascade circuit is triggered to achieve multiple fluorescent group luminescence. The CAR logic gate includes a LOCK chain, a CL1 chain, and a CL2 chain. The CL1 chain and the CL2 chain respectively base pair with part of the LOCK chain to form the CAR logic gate. The specific sequence is as follows:

[0023] LOCK SEQ ID NO:5': 5'-TCA ACA TCA GTC TG A TAA GCT AT CTA CCC AGA AAGGAG CCA GTG-3',

[0024] CL1 SEQ ID NO:6: 5'-CA GAC TGA TGT TGA-3',

[0025] CL2 SEQ ID NO:7: 5'-T TCT GGG TAG AT AGC TTA T-3'.

[0026] The activity of CHA-HCR is initially inhibited, resulting in the formation of five hairpin-shaped monomers (H1, H2, H3, H4, and H5). H3, acting as the signaling chain, is labeled with a TAMRA fluorophore and a BHQ quencher at its 3' and 5' ends, respectively. Due to fluorescence resonance energy transfer (FRET), it initially exhibits quenched TAMRA fluorescence. We selected miR-21 and miR-892b as the two inputs, with miR-892b serving as the dynamic threshold and miR-21 as the target. In positive cancer cells, the intracellular concentration of miR-21 is much higher than that of miR-892b. These inputs allow the CAR logic gate to perform computations and, accordingly, decide to release free miR-21 as the output. Free miR-21 then hybridizes with H1, initiating the CHA circuit between H1 and H2 and generating a large number of H1-H2 hybrids. The resulting H1-H2 hybrid further binds to the exposed trigger sequence, operating the HCR circuit between H3, H4, and H5, ultimately leaving a long DNA nanowire that pulls TAMRA away from BHQ, leading to a burst of increased fluorescence. A free miR-21 target can activate the dual-amplified CHA-HCR circuit, causing multiple TAMRA fluorophores to emit light, achieving a one-to-many signal output.

[0027] In negative cancer cells, overexpressed miR-892b will replace CL1 in CAR to form a miR-892b / CL2 / lock combination. This combination will capture miR-21 in the cell. Once captured, miR-21 cannot participate in the above cycle, thereby avoiding the generation of false positive signals.

[0028] Therefore, the CAR logic gate is designed to dynamically calculate and compare the relative concentrations of two biomarkers (miR-21 and miR-892b), and then decide whether to release the target miR-21 to activate the CHA-HCR circuit to avoid the generation of false positive signals.

[0029] During the HCR amplification process, the exposed base portion of the H1-H2 duplex will open the H3 hairpin probe, H3 will be opened, BHQ2 will be away from the TAMRA fluorescent group, and fluorescence will be restored. The exposed H3 toe domain will open H4, and the opened H4 will open the hairpin-type H3, forming a signal amplification through HCR. In order to avoid the mutual influence of the fluorescent group and the quenching group between two adjacent H3s due to their close distance, H4 in the hairpin chain contains a repeated T base sequence. In order to further improve the fluorescence intensity, the hairpin chain H is added to the HCR amplifier circuit. 3free The HCR amplification circuit includes hairpin chains H3, H4 and hairpin chain H 3free ,

[0030] H 3freeSEQ ID NO:8: 5'-TTG CGA ATC GGT AGT GTA GAA GCG CTC CAT CGC TTCTAC ACT TCC GAT-3'.

[0031] Therefore, only when miR-21 is highly expressed and miR-892b is lowly expressed does free miR-21 escape from the logic gate lock and activate the CHA-HCR circuit, resulting in enhanced fluorescence for precise identification of cancer cells. These CAR logic-gated CHA-HCR circuits, CAR-CHA-HCR, have enhanced input computational power, improving cancer imaging accuracy relative to ungated CHA-HCR circuits. CAR-CHA-HCR has been shown to be expressed in normal, breast, and liver cancer cells. These designs provide a path for high-precision cancer imaging by leveraging the intelligent gating capabilities of CAR logic gates, the high signal amplification capabilities of CHA-HCR circuits, and the programmable input response of CAR-CHA-HCR. This intelligent system has the potential to perform more complex tasks and possess these unique capabilities.

[0032] The dual-stage amplified DNA cascade circulation system is used in the detection of miR-21 for non-therapeutic purposes.

[0033] The application of the dual-stage amplified DNA cascade circulation system in the detection of miR-21 for non-therapeutic purposes, the specific detection method is:

[0034] (1) After annealing, H1, H2, H3, H 3free and H4 probes were added with Tris-HCl buffer solution to obtain a CHA-HCR probe solution, and then MnO2 was added to obtain a CHA-HCR probe solution containing MnO2;

[0035] (2) The cells were seeded in a cell culture dish, and then a CHA-HCR probe solution containing MnO2 and a DMEM culture medium containing 10% fetal bovine serum were added. After incubation for a period of time, the cells were imaged using a laser confocal microscope. If there was a clear fluorescent signal, it was confirmed that miR-21 was present.

[0036] The application of the dual-stage amplified DNA cascade circulation system in the detection of miR-21 for non-therapeutic purposes, the specific detection method is:

[0037] (1) The annealed CL1, CL2, and lock chains were dissolved in a Tris-HCl buffer solution in equal proportions. The CL1 and CL2 chains were partially base-paired with the lock chain to obtain a CAR logic gate. MnO2 was then added to obtain a CAR probe solution containing MnO2.

[0038] (2) The cells were seeded in a cell culture dish, and then a CAR probe solution containing MnO2 and a DMEM medium containing 10% fetal bovine serum were added and incubated for a period of time;

[0039] (3) Then add H1, H2, H3, H 3free After sufficient reaction, the cells were imaged using a laser confocal microscope. If there was a clear fluorescent signal, it proved that miR-21 was highly expressed.

[0040] The present invention adopts fluorescence imaging technology, synthesizes MnO2 with good endocytosis effect as a carrier, uses DNA chains as targeting ligands for controllable self-assembly, and prepares a new dual amplification system. Cancer cells are accurately detected by collecting fluorescence spectral signals, thereby achieving accurate detection of characteristic molecules in tumor cells.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] (1) A smart dual-amplification CAR-CHA-HCR cascade circuit was developed for precise cancer imaging. The sensing system uses a dual-amplification signal circuit (CHA-HCR) assisted by catalytic hairpin assembly (CHA) and hybridization chain reaction (HCR) to improve sensitivity.

[0043] (2) Computer-and-release (CAR) DNA logic gates were introduced to analyze endogenous miRNAs miR-21 and miR-892b to autonomously regulate the activation of CHA-HCR.

[0044] (3) The CAR-CHA-HCR circuit we designed can intelligently detect miR-21 and automatically output fluorescent signals for precise cancer imaging. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagram of the principle of the dual amplification system of the present invention.

[0046] Figure 2 Schematic diagram of the principle of the CHA-HCR dual amplification cycle amplification system.

[0047] Figure 3 Comparison chart of fluorescence detection of CHA single amplification and CHA-HCR dual amplification signals.

[0048] Figure 4 This is the electrophoresis diagram of the CHA-HCR dual amplification cycle amplification system.

[0049] Figure 5 This is the fluorescence detection diagram of the CHA-HCR dual amplification cycle amplification system.

[0050] Figure 6 A comparison chart of the specific selection of CHA-HCR probe for the target miR-21.

[0051] Figure 7 Schematic diagram of the CAR structure principle.

[0052] Figure 8 Electrophoresis diagram to verify the effect of CAR in capturing miR-21.

[0053] Figure 9 Schematic diagram of the effect of miR-892b concentration (miR-21 concentration is fixed) on the fluorescence of CAR+CHA+HCR.

[0054] Figure 10 Imaging a cell for a "YES" logic gate.

[0055] Figure 11 Cellular imaging of the "INHIBIT" logic gate. DETAILED DESCRIPTION

[0056] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0057] The present invention will be described in detail below with reference to the embodiments and accompanying drawings.

[0058] Example 1

[0059] 1. Design the dual amplification system sequence. The specific sequence information is shown in Table 1. The sequences were prepared and provided by Shanghai Sangon Biotechnology Co., Ltd.

[0060] 2. Preparation of Tis-HCl buffer

[0061] Accurately weigh 0.121g of tris(hydroxymethyl)aminomethane, 0.0476g of MgCl2, and 0.7455g of KCl. Dissolve them in deionized water. Adjust the pH of the solution to 7.4 with dilute hydrochloric acid (HCl). Finally, make up to 50mL with deionized water. Mix thoroughly to obtain a Tris-HCl buffer solution. Refrigerate at 4°C until ready to use.

[0062] 3. DNA pretreatment

[0063] Dilute the dry powdered DNA to 10 μM with secondary water, aliquot, and store at -4°C until needed. Dilute the DNA to 1 μM with Tris-HCl buffer (Tris-HCl: 20 mM, KCl: 200 mM, MgCl2: 10 mM, pH = 7.4), anneal at 95°C in the dark for 10 minutes, and then cool to room temperature to form a hairpin structure.

[0064]

[0065] 4. Assembly of CHA+HCR Cyclic Amplification System

[0066] The annealed H1 (200nM), H2 (200nM), H3 (150nM), H 3free The H4 (150 nM) and H5 (150 nM) probes were mixed together in a 200 μL centrifuge tube. Tris-HCl buffer solution was added, and the target miR-21 was added to obtain a cyclic amplification system.

[0067] H1,H2,H3,H 3free The sequences of the five H4 hairpin probes are shown in Table 1. The H3 hairpin probe is labeled with a TAMRA fluorophore at the 3' and a BHQ2 quencher at the 5' end, respectively. Due to the close proximity of the two groups, the TAMRA fluorophore is quenched by BHQ2. Through a dual cycle of CHA and HCR, TAMRA fluorescence is restored, achieving dual signal amplification.

[0068] like Figure 2 As shown in the figure, when the target miR-21 is present, the H1 hairpin is opened, and the exposed toe domain opens the H2 hairpin. Since the number of complementary bases of H1-H2 is greater than that of H1-miR-21, an H1-H2 duplex is formed, and miR-21 is replaced and participates in the next round of circulation, which is the CHA cycle, thereby forming multiple H1-H2 duplexes. The exposed base portion of the H1-H2 duplex will open the H3 hairpin probe, H3 is opened, BHQ2 is away from the TAMRA fluorescent group, and fluorescence is restored. The exposed H3 toe domain will open H4, and the opened H4 will open the hairpin-type H3 or H 3free , signal amplification is formed through HCR.

[0069] In order to verify the feasibility of the constructed CHA+HCR probe, miR-21 was mixed with the CHA+HCR probe for fluorescence testing, as shown in Figure 2. Figure 5 As shown in Figure 3, the fluorescence signal was significantly restored after the addition of the target miR-21. Figure 5 B shows that the reaction is basically completed within 20 minutes. Figure 5E and F show that in the range of 0-10 nm, the fluorescence signal further enhanced with the increase of miR-21 concentration, and the TAMRA fluorescence intensity was linearly related to the target miR-21 concentration in the range of 0.001 to 4.0 nM (F = 150.7 + 265.7x, where F and x are the fluorescence intensity of the CHA-HCR loop and the concentration of miR-21, respectively), with a correlation coefficient R2 of 0.9941.

[0070] The feasibility of the CHA+HCR probe was further verified by electrophoresis. Figure 4 As shown, lane 1 represents the H1, H2 hairpin structure, and lane 2 represents the successful formation of H1-H2 duplex in the presence of miR-21. Lane 3 represents H3, H 3free , H4 hairpin structure, lane 4 represents H1, H2, H3, H 3free When H1, H2, H3, H4 are present at the same time, no reaction will occur automatically without miR-21. Lane 5 represents H1, H2, H3, H 3free , H4 and miR-21 formed a step-like strip pattern, proving that the CHA-HCR cycle was successfully stimulated in the presence of miR-21.

[0071] In order to verify that the two-round signal amplification of CHA and HCR makes the detection more sensitive, the experiment was conducted by annealing H1 (200nM), H2 (200nM) and H3 (150nM) and mixing them in a buffer solution to construct a probe (referred to as the comparison probe). Among them, the 5' end of H3 was labeled with a TAMRA fluorescent group. miR-21 was added to the comparison probe and CHA+HCR probe respectively, and fluorescence testing was performed. Figure 3 As shown, the two-stage amplification reaction of CHA+HCR can further increase the fluorescence signal.

[0072] In this example, the specificity of the CHA+HCR probe was tested. We selected several common interfering molecules in cells, miR-16, miR-141, and miR-26a, and designed several DNA chains that differed from the target miR-21 by 1, 2, or 3 bases, respectively, and named them M1, M2, and M3. The specificity of these chains was tested. The experimental results are shown in Figure 2. Figure 6 As shown, the fluorescence recovery in these interfering substances is not significantly different from the background, with only the DNA strand with a single base mutation showing some interference. However, when the target miR-21 is added, the fluorescence signal is significantly restored, demonstrating the excellent specificity of our assay for miR-21.

[0073] 5. Assembly of the CAR+CHA+HCR cyclic amplification system.

[0074] However, a small amount of miR-21 also exists in normal cells, and excessive signal amplification can easily produce false positive signals. Therefore, we designed an "inhibit" logic gate. That is, we designed a CAR (CL1+CL2+Lock) chain. When overexpressed in cancer cells, miR-892b will replace CL1 in the CAR to form a miR-892b / CL2 / lock combination. This combination will capture miR-21 in the cell. Once captured, miR-21 cannot participate in the above cycle, thereby avoiding the generation of false positive signals. Figure 1 and 7 shown.

[0075] Anneal CL1 and CL2 with the lock chain in equal proportions (Tris-HCl as the dissolving solution) at 95°C for 5 minutes, then at 37°C for 30 minutes, and the CAR is assembled. Add miR-21 and miR-892b to the assembled CAR and react at 37°C for 1 hour. This process is the process of CAR capturing miR-21. Then add H1 (200nM), H2 (200nM), H3 (150nM), H 3free (150 nM), H4 (150 nM) were reacted at 37°C for 2 h.

[0076] Native PAGE gel electrophoresis confirmed the construction of logic gates, such as Figure 8 Lane 1 is CAR (CL1 / CL2 / lock), where you can clearly see the successful combination of the three chains. Lane 2 is H1+H2+H3+H 3free +H4 5 hairpin probes, lane 3 is CAR+H1+H2+H3+H 3free +H4, lane 4 is CAR+H1+H2+H3+H 3free Lane 5 is miR-892b+CAR+H1+H2+H3+H 3free +H4, no new bands were found in lane 5, proving that the presence of miR-892b alone would not trigger a double cycle amplification reaction. Lane 6 is miR-892b+CAR+H1+H2+H3+H 3free +H4, compared with lane 4, it was found that the presence of miR-892b inhibited the cyclic amplification reaction. That is, when miR-892b was present, CL1 / CL2 / lock successfully captured miR-21, preventing miR-21 from participating in the cyclic amplification reaction. We then used fluorescence spectroscopy to further verify this ( Figure 9 ), when miR-21 and miR-892b were present at the same time, the fluorescence signal was basically not restored, but when only miR-21 was present, the fluorescence signal was significantly restored, which proved the feasibility of the logic gate we designed.

[0077] 6. Cell culture and passaging

[0078] In this example, MCF-7, MCF-10A, and HEPG2 cells were used to verify whether our probe can accurately locate cancer cells. The three cells were seeded at a density of 6×105 cells / dish in a 25 cm 2 In a cell culture flask, a cell culture medium was prepared with DMEM medium (89%), fetal bovine serum (10%), and penicillin and streptomycin (1%), and the cells were cultured in a 37°C cell culture incubator (composed of 5% carbon dioxide and 95% air) with the prepared culture medium.

[0079] When the cells have filled 80% of the flask, they can be passaged. First, use a sterile disposable pipette to aspirate the culture medium from the flask and rinse three times with PBS. Then, add 300 μL of trypsin preheated to 37°C and digest for 2 minutes. Digestion is complete when the cells become rounded under a microscope. Remove the trypsin, add 3 mL of DMEM medium, and gently pipette the cells to evenly disperse them in the suspension. Transfer one-third of the suspension to a new flask and add an additional 3 mL of DMEM medium. This completes the cell passage.

[0080] 7. Construction of MnO2 carrier system

[0081] MnO2 was added to the CHA-HCR (or CAR) probe solution. After incubation at 37°C for 20 min, DNA was successfully adsorbed onto the MnO2 nanosheets to obtain a CHA-HCR probe (or CAR combination chain) solution containing MnO2.

[0082] 8. Fluorescence microscopy analysis in living cells

[0083] Cellular imaging of a “YES” gate constructed using a CHA-HCR circuit

[0084] To verify the function of the CHA+HCR amplification system in living cells, we performed cell imaging in living cells in vitro.

[0085] Before adding the probe, MCF-7, HEPG2 and MCF-10A cells were pre-seeded in 15 mm cell culture dishes and incubated in an incubator overnight. After rinsing with PBS solution three times, MnO2 (H1: 200 nM, H2: 200 nM, H3: 150 nM, H 3freeThe cells were incubated in a cell culture incubator for 2 hours, then the supernatant was discarded and the cells were washed three times with PBS. The cells were then imaged using a laser confocal microscope. TAMRA fluorescence was excited using a 543 nm laser with a bandpass filter set to 560–610 nm.

[0086] Cellular imaging of an "INHIBIT" logic gate constructed using a CAR+CHA-HCR circuit

[0087] To verify the function of the CAR+CHA-HCR system in living cells, we performed cell imaging in living cells in vitro.

[0088] MCF-7, HEPG2, and MCF-10A cells were pre-seeded in 15 mm cell culture dishes and incubated overnight. The cells were washed three times with PBS, and CAR (400 nM) combination chain solution containing MnO2 and 45 μL DMEM medium containing 10% fetal bovine serum were added. After incubation for 1.5 h, H1 (200 nM), H2 (200 nM), H3 (150 nM), H 3free After 2 h of reaction, the supernatant was discarded, the cells were washed three times with PBS, and then PBS was added for cell imaging under laser confocal microscopy.

[0089] like Figure 10 In the “YES” logic gate program shown, the miR-21 content in MCF-7 and HEPG2 cells is relatively high, and we can clearly see the fluorescence signal ( Figure 10 B). However, miR-21 is low expressed in MCF-10A cells, so the fluorescence signal is very weak. In the designed “INHIBIT” logic gate ( Figure 11 Because miR-892-b is highly expressed in HEPG2 cells, it prompts CAR to capture miR-21, which in turn weakens the fluorescence signal. In MCF-10A cells, however, the fluorescence signal is virtually nonexistent. This confirms the accuracy of our experiment.

[0090] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A two-stage DNA amplification cascade circulation system, characterized in that: The device includes a CHA-HCR circuit, a MnO2 nanocarrier, and a CAR logic gate. The MnO2 nanocarrier is used to load and deliver the CHA-HCR circuit into cells, promote fusion with biological membranes, and release the CHA-HCR probe in the presence of intracellular glutathione for intelligent perception and cancer recognition. Under the action of miR-21, the CHA-HCR dual amplification DNA cascade circuit is triggered to achieve multiple fluorescent groups luminescence. The CHA-HCR circuit is a one-to-many signal amplification element, which consists of two functional modules: a CHA amplification circuit and an HCR amplification circuit. The CHA amplification circuit includes hairpin chains H1 and H2, and the HCR amplification circuit includes hairpin chains H3, H4 and hairpin chains H 3free , The CAR logic gate is loaded on the MnO2 nanocarrier and forms a CAR-CHA-HCR with CHA-HCR. The CAR logic gate is used to analyze the content of miR-21 and miR-892b. When miR-21 is highly expressed and miR-892b is lowly expressed, miR-21 is released, and under the action of miR-21, the CHA-HCR double amplification DNA cascade circuit is triggered to realize the luminescence of multiple fluorescent groups. The CAR logic gate includes the LOCK chain, the CL1 chain and the CL2 chain. The CL1 chain and the CL2 chain respectively partially base-pair with the LOCK chain to form the CAR logic gate. The specific sequence is as follows: H1 SEQ ID NO:1:5'-CA GAC TG A TGT TGA T AC CGA TTC GCA A TCA ACA TCA GTCTG A TAA GCT A-3', H2SEQ ID NO:2:5'-CGC TTC TAC ACT A CC GAT TCG CAA TCA CA GAC TGA TGT TGAT TGC GAA TCG GT AT CAA CAT-3', H3 SEQ ID NO:3:5'-TTG CGA ATC GGT AGT GTA GAA GCG CTC CAT CGC TTC TAC ACTTCC GAT -3', H4 SEQ ID NO:4:5'- CGCTTCTACACTTCCGATTCGCAATTTT TTT TTTTATCGGAAGTGTAGAAGCGATGGAG -3', H 3free SEQ ID NO:8:5'-TTG CGA ATC GGT AGT GTA GAA GCG CTC CAT CGC TTC TACACT TCC GAT-3' , LOCK SEQ ID NO:5:5'-TCA ACA TCA GTC TG A TAA GCT AT CTA CCC AGA AAG GAGCCA GTG-3', CL1 SEQ ID NO:6:5'-CA GAC TGA TGT TGA-3', CL2 SEQ ID NO:7:5'-T TCT GGG TAG AT AGC TTA T-3', The 3' end and 5' end of the hairpin chain H3 are labeled with a fluorescent group and a quenching group, respectively.

2. Use of the dual-stage amplified DNA cascade circulation system according to claim 1 in the detection of miR-21 for non-diagnostic and therapeutic purposes.

3. The use of the dual-stage amplification DNA cascade circulation system according to claim 2 in the detection of miR-21 for non-diagnostic and therapeutic purposes, characterized in that: The specific detection methods are: (1) After annealing, H1, H2, H3, H 3free and H4 probes were added with Tris-HCl buffer solution to obtain a CHA-HCR probe solution, and then MnO2 was added to obtain a CHA-HCR probe solution containing MnO2; (2) The cells were seeded in a cell culture dish, and then a CHA-HCR probe solution containing MnO2 and a DMEM culture medium containing 10% fetal bovine serum were added. After incubation for a period of time, the cells were imaged using a laser confocal microscope. If there was a clear fluorescent signal, it was proved that miR-21 was present.

4. The use of the dual-stage amplification DNA cascade circulation system according to claim 2 in the detection of miR-21 for non-diagnostic and therapeutic purposes, characterized in that: The specific detection methods are: (1) The annealed CL1, CL2, and lock chains were dissolved in Tris-HCl buffer solution in equal proportions. The CL1 and CL2 chains were partially base-paired with the lock chain to obtain a CAR logic gate. MnO2 was then added to obtain a CAR probe solution containing MnO2. (2) The cells were seeded in a cell culture dish, and then a CAR probe solution containing MnO2 and a DMEM medium containing 10% fetal bovine serum were added and incubated for a period of time; (3) Then add H1, H2, H3, H 3free After sufficient reaction, the cells were imaged using a laser confocal microscope. If there was a clear fluorescent signal, it proved that miR-21 was highly expressed.

Images