A RAW 264.7 cell line with stable overexpression of SRSF3, its preparation method and application

Efficient SRSF3 overexpression was achieved in the RAW 264.7 cell line by lentiviral vector transfection method, solving the problems of poor transfection effect and cell damage, and having significant inhibitory effect on inflammation.

CN115927190BActive Publication Date: 2025-06-27SHANDONG FIRST MEDICAL UNIV & SHANDONG ACADEMY OF MEDICAL SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210503386.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-10
Publication Date
2025-06-27
Estimated Expiration
2042-05-10

AI Technical Summary

Technical Problem

In the prior art, SRSF3 transfection has poor effect, the DNA transferred to cells has a short half-life, and the cells are damaged during transfection, especially in the RAW 264.7 cell line.

Method used

By lentiviral vector transfection method, a RAW 264.7 cell line stably overexpressing SRSF3 was constructed and obtained. A three-plasmid expression system was formed using the Lenti-Flag-hyg-SRSF3 plasmid, psPAX2 and pMD2.G packaging vector. 293T cells were transfected, and lentivirus was collected and concentrated. Then RAW 264.7 macrophages were transfected, and cell lines stably overexpressing SRSF3 were screened.

Benefits of technology

It has achieved efficient and reliable overexpression of SRSF3 in the RAW 264.7 cell line, which improves transfection efficiency, and has less impaired cell health, which has the effect of inhibiting inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115927190B_ABST
    Figure CN115927190B_ABST
Patent Text Reader

Abstract

The present invention discloses a RAW 264.7 cell line stably overexpressing SRSF3, a preparation method thereof and an application thereof, belonging to the technical field of biomedicine. The present invention constructs a Lenti-Flag-hyg-SRSF3 plasmid overexpressing SRSF3, which forms a three-plasmid expression system with the psPAX2 and pMD2.G packaging vectors, co-transfects 293T cells, collects lentivirus, and then transfects RAW 264.7 macrophages with the lentivirus to obtain a stable cell line overexpressing the SRSF3 gene. The stable cell line overexpressing the SRSF3 gene is detected with a fluorescent antibody against Flag, and an LPS-induced inflammation model is used. Through Western Blot and qPCR detection, the stable cell line overexpressing SRSF3 can inhibit autophagy and reduce the expression level of inflammatory factors, and has the development and application prospects of inhibiting inflammation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a RAW264.7 cell line stably overexpressing SRSF3, a preparation method thereof, and applications thereof. Background Art

[0002] Serine / arginine-rich splicing factor 3 (SRSF3) is a serine / arginine (S / R) repeat-rich protein. SRSF3 shares similar domain structures: an RNA recognition motif (RRM) at the amino terminus and an arginine / serine-rich domain (RS) containing highly phosphorylated serine and arginine repeats at the carboxyl terminus. SRSF3 plays a crucial role in the assembly of the RNA spliceosome and in the regulation of alternative splicing. Through alternative splicing, SRSF3 influences various aspects of cell biology, including proliferation, differentiation, cell cycle, metabolism, apoptosis, migration, invasion, and angiogenesis.

[0003] People hope to express target genes in mammalian cells. Currently, three major types of viral expression vectors are used: adenoviral expression vectors, retroviral expression vectors, and lentiviral expression vectors. Retroviral vectors can only infect dividing cells and have limited capacity. Adenoviruses generally cannot integrate into chromosomes, and can only cause transient infection. Lentiviral vectors are gene therapy vectors developed based on HIV-1 (human immunodeficiency virus type 1). Unlike conventional retroviral vectors, they have the ability to interfere with both dividing and non-dividing cells. Lentiviruses also have significant advantages, such as being able to accommodate large exogenous gene fragments and allowing for long-term expression.

[0004] RAW 264.7 cells are mouse mononuclear macrophages derived from BALB / c mice induced with Abelson murine leukemia virus. Due to their small size, transient SRSF3 transfection using liposomes is inefficient. The short half-life of the DNA transferred into the cells often damages the cells during transfection. RAW 264.7 cells have strong adherence and pseudopodia production, but previous studies have shown low siRNA transfection efficiency. Currently, there are few reports on lentiviral vector transfection of RAW 264.7 cells, and further research is needed to determine how to efficiently and reliably transfect RAW 264.7 cells.

[0005] In addition, different transfection genes have different transfection effects on macrophages and also have different effects on the functions of macrophages. Summary of the Invention

[0006] In response to the problems in the prior art such as poor SRSF3 transfection effect, short half-life of DNA transferred into cells, and cell damage during transfection, the present invention provides a RAW 264.7 cell line and application that stably overexpresses SRSF3, which has high transfection efficiency.

[0007] As a first aspect of the present invention, a RAW 264.7 cell line stably overexpressing SRSF3 is provided, which is obtained by a lentiviral vector transfection method, and the nucleotide sequence of SRSF3 is shown in SEQ ID NO.1.

[0008] The RAW 264.7 cell line stably overexpressing SRSF3 has an effect of inhibiting inflammation.

[0009] As a second aspect of the present invention, there is provided a method for preparing the RAW 264.7 cell line stably overexpressing SRSF3, comprising the following steps:

[0010] Step 1: Construct a Lenti-Flag-hyg-SRSF3 plasmid that overexpresses SRSF3;

[0011] Step 2: The Lenti-Flag-hyg-SRSF3 plasmid constructed in step 1 was co-transfected into 293T cells with the psPAX2 and pMD2.G packaging vectors to form a three-plasmid expression system, and the lentivirus was collected and concentrated;

[0012] Step 3: Transfect RAW 264.7 macrophages with lentivirus to obtain a stable cell line overexpressing the SRSF3 gene.

[0013] Preferably, in step 1, a Lenti-Flag-hyg-SRSF3 target plasmid is prepared using the Lenti-Flag-hyg vector shown in SEQ ID NO. 4 and the SRSF3 gene. The SRSF3 gene is amplified by PCR, electrophoresed, and recovered. The recovered SRSF3 gene band and the Lenti-Flag-hyg vector are then double-digested, electrophoresed again, recovered, and then ligated using a ligase.

[0014] Preferably, in step 1, the SRSF3 gene is amplified using primers shown in SEQ ID NOs. 2 to 3 in the sequence listing to obtain a PCR amplification product.

[0015] Preferably, in step 1, the obtained PCR amplification product is mixed with loading buffer and then added to the gel wells of agarose gel, the buffer system is 1×TAE buffer, and electrophoresis is performed at a constant voltage of 120V for 30 minutes; the gel is cut and recovered under ultraviolet irradiation; DNA is recovered using ordinary agarose gel; the vector and the target fragment are double-enzyme digested at the same time, electrophoresed again and recovered using agarose gel to obtain the recovered products of SRSF3 and Lenti-Flag-hyg vectors, respectively; finally, the target fragment is ligated to the vector plasmid using T4 DNA ligase.

[0016] Furthermore, in step 1, the conditions for ligation using T4 DNA ligase are as follows: the recovered Lenti-Flag-hyg vector and SRSF3 are added to an EP tube, followed by 1 μL of T4 DNA Ligase, 2 μL of 10× buffer, and ddH2O to a total of 20 μL. Refrigerate at 4°C overnight.

[0017] Furthermore, in step 1, the mass ratio of SRSF3 to Lenti-Flag-hyg vector is 10:3 to 10:10, preferably 10:3.

[0018] Preferably, step one further comprises transforming the ligation product of the SRSF3 gene and the Lenti-Flag-hyg vector into competent cells DH5α for expression, and then extracting the Lenti-Flag-hyg-SRSF3 target plasmid.

[0019] Furthermore, in step 1, the PCR reaction system is:

[0020] Reagents 20 μL reaction system 2×Pfu MasterMix(Dye) 10 Forward Primer 1 Reverse Primer 1 Template DNA 0.5 <![CDATA[ddH2O]]> up to 20

[0021] PCR reaction conditions are:

[0022] step temperature time Pre-denaturation 94℃ 2min transsexual 94℃ 30s annealing 50-62℃ 30s extend 72℃ 60s Final extension 72℃ 5min

[0023] Denaturation, annealing, and extension were performed for 30 cycles.

[0024] Preferably, in step 2, the mass ratio of Lenti-Flag-hyg-SRSF3 target plasmid, psPAX2, and pMD2.G is (2-6):4:2.

[0025] More preferably, in step 2, the mass ratio of Lenti-Flag-hyg-SRSF3 target plasmid, psPAX2, and pMD2.G is 4:4:2.

[0026] Preferably, in step 3, after infecting RAW 264.7 cells with the lentivirus, hygromycin B is added for screening to obtain a RAW 264.7 cell line that stably overexpresses SRSF3.

[0027] As a third aspect of the present invention, it provides the use of the RAW 264.7 cell line that stably overexpresses SRSF3 in the preparation of anti-inflammatory drugs.

[0028] In one embodiment, the present invention constructs a Lenti-Flag-SRSF3-hyg expression vector that overexpresses SRSF3, constitutes a three-plasmid expression system with psPAX2 and pMD2.G packaging vectors, co-transfects 293T cells, collects lentivirus, and transfects RAW 264.7 macrophages with the lentivirus to obtain a stable cell line overexpressing the SRSF3 gene. After screening the stable cell line, immunofluorescence detection shows that the anti-Flag fluorescence of the experimental group is positive, which facilitates subsequent expression detection.

[0029] In the embodiments, the present invention uses anti-Flag fluorescent antibodies to detect stably transfected cell lines overexpressing the SRSF3 gene, and LPS-induced inflammation models. Western Blot and qPCR detection show that stably transfected cell lines overexpressing SRSF3 can reduce the expression level of inflammatory factors by inhibiting autophagy, and have development and application prospects for inhibiting inflammation.

[0030] Macrophages are key players in the pathogenesis of many chronic inflammatory and autoimmune diseases, including rheumatoid arthritis (RA), experimental autoimmune encephalitis (EAE), multiple sclerosis (MS), autoimmune hepatitis, Crohn's disease, and inflammatory bowel disease (IBD). Inflammatory cytokines released by macrophages, such as IL-1 and IL-6, are important mediators and drivers of these diseases. Overexpression of inflammatory cytokines in macrophages can reduce their expression, thereby alleviating or treating related inflammatory diseases.

[0031] Autophagy is a metabolic process that is an important part of maintaining homeostasis in the body. The regulation of autophagy has become a research direction in the clinical treatment of many diseases, including neurodegenerative diseases, cardiovascular diseases, tumors, etc. For example, when autophagy inhibitors (such as 3-MA, wortmannin, chloroquine and HCQ, etc.) are given, transplanted tumors become more sensitive to radiotherapy and chemotherapy. Therefore, autophagy inhibitors are very useful for the clinical treatment of tumors and can be used as a separate intervention therapy. Therefore, inhibiting autophagy by overexpressing SRSF3 in macrophages also has potential application value in the treatment of tumors.

[0032] As a fourth aspect of the present invention, it is to provide the use of the RAW 264.7 cell line that stably overexpresses SRSF3 in the preparation of autophagy inhibitor drugs.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] 1. The present invention constructs a RAW 264.7 macrophage stable cell line, overcoming the problems of difficult transfection and low transfection efficiency of RAW 264.7 cells. The present invention uses a lentiviral vector to prepare RAW 264.7 cells that stably overexpress SRSF3, and further detects the functional changes of the macrophage cell line overexpressing SRSF3;

[0035] 2. The RAW 264.7 cell line stably overexpressing SRSF3 provided by the present invention has the effect of inhibiting inflammation, providing a new composition component and method for the clinical preparation of anti-inflammatory drugs;

[0036] 3. The preparation method of the RAW 264.7 cell system stably overexpressing SRSF3 provided by the present invention has a high lentiviral titer. In one embodiment, the lentiviral titer is determined based on the expression level of the flag fluorescent protein in 293T cells, and the lentiviral titer is measured to be 10 9 ;

[0037] 4. The preparation method of the RAW 264.7 cell system stably overexpressing SRSF3 provided by the present invention has a high transfection efficiency. In one embodiment, the transfection efficiency can reach 80% when the concentrated virus solution is used to infect RAW 264.7 cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0039] Figure 1 The PCR amplification results of the SRSF3 gene, where 1 represents the PCR amplification result, showing the appearance of a 495 bp SRSF3 band; M represents the standard molecular weight marker, 500 bp indicates the size of the corresponding marker band, and the comparison with the marker determines that the target band of 495 bp is obtained.

[0040] Figure 2 The figure shows the results of anti-Flag fluorescent antibody detection of SRSF3-overexpressing stably transfected cell lines. The control group represents normal cells, and the experimental group represents SRSF3-overexpressing stably transfected cells. DAPI is the nuclear staining image, Flag-SRSF3 is the anti-Flag fluorescent antibody staining image, and Merged is a combination of the two images.

[0041] Figure 3 The figure shows the statistical graph of LC3 expression level detected by qPCR.

[0042] Figure 4 This is a statistical chart of the expression levels of IL-1 and IL-6 detected by qPCR.

[0043] Figure 5 Western Blot detection of LC3 expression level and statistical graph. DETAILED DESCRIPTION

[0044] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0045] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0046] Reagents and consumables used in the examples and their sources:

[0047] TaqDNA ligase: Takara;

[0048] BamH I: Takara Corporation;

[0049] EcoR I: Takara Corporation;

[0050] PEI transfection reagent: Biohub;

[0051] Pfu MasterMix: Kangwei Century Company; HiFiScript RTMaster Mix: Kangwei Century Company;

[0052] Plasmid miniprep kit: Kangwei Century Company; DH5α: Kangwei Century Company;

[0053] Ordinary agarose gel recovery kit: Tiangen Biochemical Technology Co., Ltd.;

[0054] Hygromycin B: MCE Company;

[0055] LPS: Sigma;

[0056] qPCR ChamQ SYBR qPCR Master Mix: Novozymes;

[0057] LC3: cell signaling technology;

[0058] β-actin: Bio-techne;

[0059] ECL: Biyuntian Company;

[0060] Lentiviral Concentration Kit; Jiman Biotechnology.

[0061] The psPAX2 and pMD2.G packaging vectors were purchased from Addgene, USA.

[0062] Example 1: A method for preparing a RAW 264.7 cell line stably overexpressing SRSF3, comprising the following steps:

[0063] (1) Plasmid construction

[0064] 1. SRSF3 primer design

[0065] Enter the SRSF3 gene name in NCBI, click Primer-Blast, enter the SRSF3 gene sequence, and select the most appropriate primer sequence based on base length and GC ratio.

[0066] Primer sequences:

[0067] SRSF3-F: CGGGATCCATGCATCGTGATTCCTGTCCAT (SEQ ID NO. 2 in the sequence listing);

[0068] SRSF3-R: CAGAATTCTTTCCTTTCATTTGACCTA (SEQ ID NO. 3 in the sequence listing).

[0069] 2. PCR amplification

[0070] Template: Full-length human gene cDNA

[0071] PCR reaction system:

[0072]

[0073]

[0074] PCR reaction conditions

[0075] step temperature time Pre-denaturation 94℃ 2min transsexual 94℃ 30s annealing 50-62℃ 30s extend 72℃ 60s Final extension 72℃ 5min

[0076] Denaturation, annealing, and extension were performed for 30 cycles.

[0077] 3. PCR product electrophoresis

[0078] 20 μL of PCR product was mixed with loading buffer and added to the wells of agarose gel. The buffer system was 1×TAE buffer. Electrophoresis was performed at a constant voltage of 120 V for 30 min. Figure 1 shown.

[0079] The rubber was cut and recovered under UV irradiation.

[0080] 4. DNA recovery using ordinary agarose gel

[0081] Refer to the instructions of the ordinary agarose gel recovery kit (Tiangen Biochemical Technology Co., Ltd.) for operation. The operation method is:

[0082] (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CA2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0083] (2) Cut the single target DNA band obtained in step 3 from the agarose gel, place it in a clean centrifuge tube, and weigh it. Add an equal volume of PN solution to the gel (if the gel weighs 0.1 g, its volume can be considered as 100 μL, then add 100 μL of PN solution) and place it in a 50°C water bath. During this time, gently turn the centrifuge tube upside down to ensure that the gel is fully dissolved. If there are still undissolved gel pieces, continue to place them for a few minutes or add more sol solution until the gel is completely dissolved.

[0084] (3) The solution obtained in the previous step was added to an adsorption column CA2 (the adsorption column was placed in a collection tube), left at room temperature for 2 min, centrifuged at 12000 rpm for 60 s, the waste liquid in the collection tube was discarded, and the adsorption column CA2 was placed in the collection tube.

[0085] (4) Add 600 μL of rinse solution PW to the adsorption column CA2, centrifuge at 12000 rpm for 1 min, pour out the waste liquid in the collection tube, and place the adsorption column CA2 in the collection tube.

[0086] (5) Repeat step (4).

[0087] (6) Place the adsorption column CA2 back into the collection tube and centrifuge at 12,000 rpm for 2 minutes to remove as much of the rinse solution as possible. Leave the adsorption column CA2 at room temperature for several minutes to dry thoroughly to prevent residual rinse solution from affecting the next step of the experiment.

[0088] (7) Place the adsorption column CA2 in a clean centrifuge tube, add 30 μL of EB eluent to the middle of the adsorption membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 2 minutes to collect the DNA solution.

[0089] 5. Recover the amplified product by enzyme digestion and digest the Lenti-Flag-hyg vector

[0090] 5.1 Preparation of Lenti-Flag-hyg vector:

[0091] The Lenti-Flag-hyg vector shown in SEQ ID NO. 4 in the sequence listing was used.

[0092] 5.2 Enzyme digestion of target fragment

[0093]

[0094] Place 30 μL of the target band recovered in step 4 into an EP tube. Add 1.5 μL of BamHI, 1.5 μL of EcoRI, and 5 μL of 10× K Buffer to the tube, and make up to 50 μL with ddH2O. Incubate in a PCR instrument at 37°C for 1 hour. The product is the SRSF3 gene with sticky ends.

[0095] 5.3 Enzyme digestion of Lenti-Flag-hyg vector

[0096]

[0097] Place 2 μg of Lenti-Flag-hyg vector into an EP tube. Add 2 μL of BamHI, 2 μL of EcoRI, and 3 μL of 10× K buffer. Make up to 30 μL with ddH2O. Incubate in a PCR machine at 37°C. The product is the Lenti-Flag-hyg vector with sticky ends.

[0098] 6. Electrophoresis the digested SRSF3 gene and Lenti-Flag-hyg vector obtained in step 5 simultaneously under the same electrophoresis conditions as in step 3;

[0099] 7. Agarose gel recovery was performed in the same manner as in step 4 to obtain the recovery products of SRSF3 and Lenti-Flag-hyg vectors, respectively.

[0100] 8. T4 DNA ligase ligation

[0101]

[0102] Take 10 μL of the recovered product from step 7 (200 ng) and 3 μL of Lenti-Flag-hyg vector (60 ng) and add them to an EP tube. Then add 1 μL of T4 DNA Ligase, 2 μL of 10× buffer, and ddH2O to make up to 20 μL. Refrigerate at 4°C overnight.

[0103] In one embodiment, SRSF3 and Lenti-Flag-hyg vector addition ratios of 10:2 and 10:10 were tried.

[0104] Results: When the ratio of SRSF3 to vector was 10:3, the conversion rate was 50% with no false-positive colonies. When the ratio was 10:2, the conversion rate was 0.00%, and when the ratio was 10:10, the conversion rate was 100.00%, but it resulted in an increase in false-positive colonies.

[0105] 9. Conversion

[0106] Steps

[0107] (1) Take 50 μL of competent cells DH5α (Kangwei Century Company) and place them in an ice bath.

[0108] (2) After the competent cells have thawed, add the target DNA (the T4 DNA ligase ligation product obtained in step 8) to the competent cell suspension and gently pipette to mix. Place on ice for 30 minutes.

[0109] (3) Heat shock at 42°C for 45 seconds, quickly transfer the centrifuge tube to an ice bath, and let it stand on ice for 3 minutes.

[0110] (4) Add 450 μL of sterile LB medium (without antibiotics) to each centrifuge tube, mix well, and place in a 37-°C shaker at 150 rpm for 45 min to allow the bacteria to recover.

[0111] (5) Take an appropriate amount of transformed competent cells and add them to LB solid agar medium containing the corresponding antibiotics. Use a sterile spreading rod to spread the cells evenly. Place the plate at 37°C until the liquid is absorbed, invert the plate, and culture at 37°C for 12-16 hours.

[0112] 10. Pick and shake the fungi

[0113] (1) Pick a single colony and place it in a test tube. Fill each tube with 6 mL of LB medium and add 1.5 μL of ampicillin per mL of medium.

[0114] (2) Shake at 220 rpm / h for 14 h.

[0115] 11. Plasmid extraction

[0116] (1) Take all the overnight cultured bacterial solution obtained in step 10, add it to a centrifuge tube, centrifuge at 13000 rpm for 30 seconds to collect the bacteria, and discard all the supernatant as much as possible.

[0117] (2) Add 250 μL of Buffer P1 to the centrifuge tube containing the bacterial pellet and mix thoroughly using a pipette or vortex oscillator to suspend the bacterial pellet.

[0118] (3) Add 250 μL of Buffer P2 to the centrifuge tube and gently invert the tube 8-10 times to fully lyse the cells. Let stand at room temperature for 5 minutes. The solution should become clear and viscous.

[0119] Note: Mix gently, avoiding violent shaking to avoid disrupting the genomic DNA and causing genomic DNA fragments to be mixed with the extracted plasmid. If the solution does not become clear, it indicates that the bacterial load may be too large and incomplete lysis. Reduce the bacterial load.

[0120] (4) Add 250 μL of Buffer E3 to the centrifuge tube and immediately mix by inverting the tube 8-10 times. A white flocculent precipitate will appear. Let it stand at room temperature for 5 minutes. Centrifuge at 13,000 rpm for 5 minutes, aspirate the supernatant, add it to a filter column (Endo-Remover FM), centrifuge at 13,000 rpm for 1 minute, and collect the filtrate in a centrifuge tube.

[0121] (5) Add 225 μL of isopropanol to the filtrate and mix thoroughly by inverting the tube.

[0122] (6) Column equilibration: Add 200 μL of Buffer PS to the spin column (Spin Columns DM) placed in the collection tube, centrifuge at 13,000 rpm for 1 min, discard the waste liquid in the collection tube, and place the spin column back into the collection tube.

[0123] (7) Transfer the mixed solution of the filtrate and isopropanol in step 5 to the equilibrated adsorption column (which has been loaded into the collection tube).

[0124] (8) Centrifuge at 13000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0125] (9) Add 750 μL of Buffer PW to the adsorption column (please check whether anhydrous ethanol has been added first), centrifuge at 13,000 rpm for 1 min, and discard the waste liquid in the collection tube.

[0126] (10) Place the adsorption column back into the collection tube and centrifuge at 13,000 rpm for 1 min.

[0127] Note: The purpose of this step is to remove the residual ethanol in the adsorption column. The residual ethanol will affect the subsequent enzymatic reactions (enzyme digestion, PCR, etc.).

[0128] (11) Place the adsorption column in a new collection tube. Add 50 μL Endo-Free Buffer EB to the middle of the adsorption membrane. Incubate at room temperature for 3 minutes. Centrifuge at 13,000 rpm for 2 minutes. Collect the plasmid solution into a centrifuge tube. Take 1 μL of the solution to measure the plasmid concentration, label it with the concentration and date, and store it at -20°C.

[0129] Obtain Lenti-Flag-hyg-SRSF3 plasmid.

[0130] 12. Plasmid identification: Take 8 μL of plasmid and send it for sequencing.

[0131] (2) Packaging lentivirus

[0132] 1. 293T cells were plated one day in advance.

[0133] 2. Observe the growth status and density of cells and PEI transfection under a microscope.

[0134] Specific steps: mark EP tubes A liquid and B liquid, add 125 μL of opti culture medium and plasmid plasmid including the Lenti-Flag-hyg-SRSF3 target plasmid obtained in step (1) and psPAX2:pMD2.G packaging vector (Lenti-Flag-hyg-SRSF3:psPAX2:pMD2.G) to liquid A, add 125 μL of opti culture medium and PEI to liquid B, dilute the plasmid with opti, and dilute PEI with an equal volume of opti. After incubation at room temperature for 5 minutes, add the liquid in tube B to tube A, mix quickly, let it stand at room temperature for 15 minutes, and then add it to the culture dish.

[0135] In one embodiment, transfection is performed with a Lenti-Flag-hyg-SRSF3:psPAX2:pMD2.G mass ratio of 1:2:1;

[0136] In another embodiment, transfection is performed at a mass ratio of 2:2:1 for Lenti-Flag-hyg-SRSF3:psPAX2:pMD2.G;

[0137] In another embodiment, transfection is performed at a Lenti-Flag-hyg-SRSF3:psPAX2:pMD2.G mass ratio of 3:2:1.

[0138] 3. Replace the complete culture medium 8-10 hours after transfection. At this time, viruses have already appeared in the cell supernatant, so safety precautions should be taken.

[0139] 4. Observe the transfection efficiency 36 hours after transfection, collect the cell supernatant, put it into a sterile test tube, cover it tightly and store it in a refrigerator at 4°C. At the same time, add new complete culture medium to the cells with a pipette and continue culturing.

[0140] 5. After 60 h, the cell supernatant was collected again and the supernatant containing the virus was stored at 4°C.

[0141] 6. Mix the collected viruses together and filter them through a 0.45 μm filter membrane to concentrate the lentivirus.

[0142] (3) Lentivirus Concentration

[0143] 1. After successful lentiviral packaging, collect the lentiviral supernatant and filter it through a 0.45 μm filter to remove cells and debris.

[0144] 2. Mix the lentiviral supernatant (4 parts) and 5× lentiviral concentrate (1 part) in a ratio of 4:1, place at 4°C overnight, and mix every 30 minutes for a total of 3 times.

[0145] 3. Centrifuge at 4000g for 25 minutes at 4°C.

[0146] 4. Carefully remove the supernatant without shaking the tube violently. A white precipitate is usually visible (sometimes the precipitate is not visible).

[0147] 5. Add an appropriate volume (1 / 100-1 / 10 of the original supernatant volume) of DMEM or PBS, and use a pipette to carefully pipette and resuspend the precipitate.

[0148] 6. Resuspend the liquid and measure the lentivirus titer.

[0149] (IV) Lentiviral titer determination

[0150] Determine the viral titer (TU / mL) of the lentivirus based on the expression level of the flag fluorescent protein in 293T cells. The specific steps are as follows:

[0151] 1. Place the round cell slide into a 96-well plate, treat it with poly-lysine, and air-dry it under UV irradiation. Then, plate 293T cells into the 96-well plate and perform cell transfection when the cell density reaches more than 50%.

[0152] 2. Virus dilution and transfection: Perform serial dilutions in EP tubes. Prepare six 1.5 mL EP tubes, add 450 μL of complete culture medium to each tube, add 50 μL of the virus stock solution to the first tube, mix thoroughly, then pipette 50 μL into the second tube and mix thoroughly. Repeat this process for six dilutions. Add 100 μL of the diluted virus solution to each well of cells, and perform three replicates for each dilution.

[0153] 3. Fluorescence counting and titer calculation

[0154] 48 hours after transfection, discard the culture medium and fix with 4% paraformaldehyde. Aspirate the fixative and rinse three times with PBS for 5 minutes each time, and incubate with PBS containing 0.3% TritonX-100 (PBST) for 10 minutes. Discard the PBST and rinse three times with PBS for 5 minutes each time. Add 2% BSA to block at room temperature for 30 minutes. Add anti-flag primary antibody and incubate at 4°C overnight. Aspirate the primary antibody, rinse three times with PBS for 5 minutes each time, add fluorescent secondary antibody, and incubate at room temperature for 2 hours. This step and subsequent steps must be protected from light. Aspirate the secondary antibody, rinse three times with PBS for 5 minutes each time. Add a drop of DAPI to the slide, turn the cell slide upside down on the slide, and seal the slide.

[0155] Count the fluorescent cells using a fluorescence microscope. Count the last two fluorescent cells on the slide where fluorescence was observed, calculate the sum of the totals in the three replicate wells, and calculate the average, assuming these are A (the average number of fluorescent cells in the second-to-last well where fluorescence was observed) and B (the average number of fluorescent cells in the first-to-last well where fluorescence was observed).

[0156] Lentiviral virus titer calculation formula:

[0157] Virus titer (TU / mL) = (A+B×10)×1000 / 2 / A well virus volume (μL),

[0158] MOI value = virus titer (TU / mL) × virus volume (mL) / number of cells,

[0159] After calculation, the virus titer is 10 9 , MOI value is 72.46.

[0160] (V) Establishment of a stable cell line overexpressing SRSF3

[0161] 1. In a 6-well plate, set up a negative control group and a positive experimental group. After the density of RAW 264.7 cells reached 80%, virus infection was performed.

[0162] 2. Thaw the virus slowly on ice, slowly add the virus solution to the RAW264.7 cells in the positive control group, and mix gently. The RAW 264.7 cells in the negative control group are not treated. Wipe the working surface of the safety biological cabinet with 10% 84 disinfectant and alcohol, and handle the pipette tip and EP tube containing the virus.

[0163] 3. 24 hours after infection, replace the culture medium containing serum.

[0164] 4. After 48 hours, add hygromycin B (1 μg / mL) for screening. Observe the status of cells in the negative control group and the positive experimental group 6 hours after the first addition of hygromycin B. All cells in the negative control group died after 48 hours. After each plating, wait for the cells to adhere to the wall and add drugs for screening. Treat the cells 24 hours after adding drugs. The screening process lasts for 2-4 weeks. After screening the stable transfected cell lines, immunofluorescence detection is performed. The transfection efficiency is as follows: Figure 2 The control group represents normal cells, and the experimental group represents cells stably overexpressing SRSF3. DAPI represents nuclear staining, Flag-SRSF3 represents anti-Flag fluorescent antibody staining, and Merged represents a combination of the two images. The results show that anti-Flag fluorescence was negative in the control group and positive in the experimental group.

[0165] Each well of cells was infected with 5 μL of concentrated virus solution, and the transfection efficiency was calculated.

[0166] The transfection efficiency of different ratios is summarized in the following table:

[0167]

[0168] Example 2: Establishment of an Inflammation Model: Functional Characterization of a RAW 264.7 Cell Line Stably Overexpressing SRSF3

[0169] Lipopolysaccharide (LPS), also known as endotoxin, is a component of the outer cell wall of Gram-negative bacteria and is composed of lipids and polysaccharides. It exerts its effects by acting on TLR4 in the cell membrane of target cells. The TLR family is associated with the expression of inflammatory cytokines and plays a key role in innate immunity. Stimulating RAW 264.7 macrophages with LPS can induce an inflammatory response and release pro-inflammatory factors.

[0170] RAW 264.7 cells and stably transfected cells were plated and stimulated with LPS at a concentration of 800 ng / ml after reaching a cell density of 70%. Cells were harvested 12 hours later, and RNA was extracted for qPCR analysis of the expression of the inflammatory cytokines IL-1 and IL-6. Protein was extracted for Western blot analysis of the expression of the key autophagy gene LC3.

[0171] (1) qPCR

[0172] qPCR primers:

[0173] GAPDH-R:TTGCTGTTGAAGTCGCAGGAG;

[0174] GAPDH-F: TGTGTCCGTCGTGGATCTGA;

[0175] IL-1beta-F: GCAACTGTTCCTGAACTCAACT;

[0176] IL-1beta-R: ATCTTTTGGGGTCCGTCAACT;

[0177] IL-6-F:TCCAGTTGCCTTCTTGGGAC;

[0178] IL-6-R: GTGTAATTAAGCTCCGACTTG;

[0179] LC3-beta-F:TTATAGAGCGATACAAGGGGGAG;

[0180] LC3-beta-R:CGGCCGTCTGATTATCTTGATGAG.

[0181] method:

[0182] 1. Extract RNA and reverse transcribe

[0183] Removal of genomic DNA

[0184] 10×gDNA Remover Mix 1μL

[0185] RNA template 2μg

[0186] RNase-Free Water up to 10 μL

[0187] Add the above liquid into a 1.5 ml EP tube, incubate at 42°C for 2 min, and then place on ice for later use.

[0188] Reverse transcription reaction

[0189] 10 μL of the previous step reaction solution

[0190] 5×HiFiScript RTMaster Mix 4μL

[0191] RNase-Free Water 6μL

[0192] Add 4 μL of 5× HiFiScript RTMaster Mix and 6 μL of RNase-Free Water to the reaction mixture from the previous step. Incubate at 37°C for 15 minutes and then at 85°C for 5 seconds.

[0193] 2. qPCR

[0194] qPCR mix

[0195]

[0196] qPCR reaction

[0197] Stage 1 pre-denaturation Reps: 1 95℃ 30s

[0198] Stage 2 Reaction Cycle Reps: 40 95℃ 10s 60℃ 30s

[0199] Stage 3 melting curve Reps: 1 95℃ 15s, 60℃ 60s, 95℃ 15s

[0200] The results of LC3 mRNA level determination by qPCR are shown in Figure 3 IL-1 and IL-6 mRNA levels are shown in Figure 4 .

[0201] Figure 3 In the table, CON represents normal cells; LPS represents normal cells treated with 800 ng / ml LPS;

[0202] SRSF3+LPS represents stably transfected cells overexpressing SRSF3 treated with 800 ng / ml LPS. RNA was extracted 12 hours later and analyzed by qPCR. The results showed increased autophagy in the LPS group and decreased autophagy in the SRSF3+LPS group. ** indicates P < 0.01.

[0203] Figure 4 In the table, CON represents normal cells; LPS represents normal cells treated with 800 ng / ml LPS; and SRSF3+LPS represents stably transfected cells overexpressing SRSF3 treated with 800 ng / ml LPS. RNA was extracted 12 hours later for qPCR analysis. Figure 4 In A, the expression of IL-1 increased in the LPS group, while that decreased in the SRSF3+LPS group, inhibiting the production of inflammation. Figure 4 In Figure B, IL-6 expression increased in the LPS group, while it decreased in the SRSF3+LPS group, indicating that inflammation was suppressed. ** indicates P < 0.01.

[0204] (2) Western Blot

[0205] 1. Prepare 12% separation gel: H2O 1.6ml, 30% Acrylamide: 2ml, Tris-HCl (pH 8.8): 1.3ml, 10% SDS: 0.05ml, 10% ammonium persulfate: 0.05ml, TEMED: 0.002ml

[0206] 2. Prepare 5% stacking gel: H2O 2.1ml, 30% Acrylamide: 0.5ml, Tris-HCl (pH 8.8): 0.38ml, 10% SDS: 0.03ml, 10% ammonium persulfate: 0.03ml, TEMED: 0.003ml (add last)

[0207] 3. Sample loading: Add the prepared separation gel and stacking gel to the glass plate respectively and let them solidify.

[0208] 4. Electrophoresis: Constant voltage 80V, about 45 minutes; after each sample reaches the end of the stacking gel (a separation band appears below the marker line), adjust the voltage to 120V for about 1-2 hours.

[0209] 5. Transfer to 0.22 μm PVDF membrane, 80 V, 1.5 h.

[0210] 6. Immunoreactive primary antibody was incubated overnight at 4°C on a horizontal shaker. The membrane was washed three times with TBST solution, 5 minutes each time. Secondary antibody was incubated at room temperature for 2 hours. ECL was incubated for 2 minutes and the chemiluminescence was detected. The results of LC3 protein expression level detection are shown in Figure 2. Figure 5 A, statistical results are shown in Figure 5 B.

[0211] Figure 5 In the table, CON represents normal cells; LPS represents normal cells treated with 800 ng / ml LPS; and SRSF3+LPS represents stably transfected cells overexpressing SRSF3 treated with 800 ng / ml LPS. Proteins were extracted 12 hours later and analyzed by Western blot. Figure 5 In Figure A, β-actin is the reference gene, and LC3-I and LC3-II are the two forms of LC3 protein. The results showed that in the LPS group, LC3-I was converted to LC3-II, and LC3-II expression increased, enhancing autophagy. In the SRSF3+LPS group, the conversion of LC3-I to LC3-II was inhibited, and LC3-II expression decreased, inhibiting autophagy. Figure 5 B is a statistical graph of LC3 expression levels, showing that overexpression of SRSF3 in stably transfected cells significantly reduced LC3-II expression. * indicates P < 0.05, and ** indicates P < 0.01.

[0212] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention. SEQUENCE LISTING <110> Shandong First Medical University (Shandong Academy of Medical Sciences) <120> A RAW 264.7 cell line stably overexpressing SRSF3, and its preparation method and application <130> 2022.05.10 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 495 <212> DNA <213> artificial synthesis <400> 1 atgcatcgtg attcctgtcc attggactgt aaggtttatg taggcaatct tggaaacaat 60 ggcaacaaga cggaattgga acgggctttt ggctactatg gaccactccg aagtgtgtgg 120 gttgctagaa acccacccgg ctttgctttt gttgaatttg aagatccccg agatgcagct 180 gatgcagtcc gagagctaga tggaagaaca ctatgtggct gccgtgtaag agtggaactg 240 tcgaatggtg aaaaaagaag tagaaatcgt ggcccacctc cctcttgggg tcgtcgccct 300 cgagatgatt atcgtaggag gagtcctcca cctcgtcgca gatctccaag aaggagaagc 360 ttctctcgca gccggagcag gtccctttct agagatagga gaagagagag atcgctgtct 420 cgggagagaa atcacaagcc gtcccgatcc ttctctaggt ctcgtagtcg atctaggtca 480 aatgaaagga aatag 495 <210> 2 <211> 30 <212> DNA <213> Synthetic <400> 2 cgggatccat gcatcgtgat tcctgtccat 30 <210> 3 <211> 27 <212> DNA <213> Synthetic <400> 3 cagaattctt tcctttcatt tgaccta 27 <210> 4 <211> 5325 <212> DNA <213> Synthetic <400> 4 acaaataggg cccccctaac gttactggcc gaagccgctt ggaataaggc cggtgtgcgt 60 ttgtctatat gttattttcc accatattgc cgtcttttgg caatgtgagg gcccggaaac 120 ctggccctgt cttcttgacg agcattccta ggggtctttc ccctctcgcc aaaggaatgc 180 aaggtctgtt gaatgtcgtg aaggaagcag ttcctctgga agcttcttga agacaaacaa 240 cgtctgtagc gaccctttgc aggcagcgga accccccacc tggcgacagg tgcctctgcg 300 gccaaaagcc acgtgtataa gatacacctg caaaggcggc acaaccccag tgccacgttg 360 tgagttggat agttgtggaa agagtcaaat ggctcacctc aagcgtattc aacaaggggc 420 tgaaggatgc ccagaaggta ccccattgta tgggatctga tctggggcct cggtgcacat 480 gctttacatg tgtttagtcg aggttaaaaa acgtctaggc cccccgaacc acggggacgt 540 ggttttcctt tgaaaaacac gatgataata tgaaaaagcc tgaactcacc gcgacgtctg 600 tcgagaagtt tctgatcgaa aagttcgaca gcgtctccga cctgatgcag ctctcggagg 660 gcgaagaatc tcgtgctttc agcttcgatg taggagggcg tggatatgtc ctgcgggtaa 720 atagctgcgc cgatggtttc tacaaagatc gttatgttta tcggcacttt gcatcggccg 780 cgctcccgat tccggaagtg cttgacattg gggagttcag cgagagcctg acctattgca 840 tctcccgccg tgcacagggt gtcacgttgc aagacctgcc tgaaaccgaa ctgcccgctg 900 ttctgcagcc ggtcgcggag gcaatggatg cgatcgctgc ggccgatctt agccagacga 960 gcgggttcgg cccattcgga ccgcaaggaa tcggtcaata cactacatgg cgtgatttca 1020 tatgcgcgat tgctgatccc catgtgtatc actggcaaac tgtgatggac gacaccgtca 1080 gtgcgtccgt cgcgcaggct ctcgatgagc tgatgctttg ggccgaggac tgccccgaag 1140 tccggcacct cgtgcacgcg gatttcggct ccaacaatgt cctgacggac aatggccgca 1200 taacagcggt cattgactgg agcgaggcga tgttcgggga ttcccaatac gaggtcgcca 1260 acatcttctt ctggaggccg tggttggctt gtatggagca gcagacgcgc tacttcgagc 1320 ggaggcatcc ggagcttgca ggatcgccgc ggctccgggc gtatatgctc cgcattggtc 1380 ttgaccaact ctatcagagc ttggttgacg gcaatttcga tgatgcagct tgggcgcagg 1440 gtcgatgcga cgcaatcgtc cgatccggag ccgggactgt ctggcgtaca caaatcgccc 1500 gcagaagcgc ggccgtctgg accgatggct gtgtagaagt actcgccgat agtggaaacc 1560 gacgccccag cactcgtccg agggcaaagg aataaacgcg tctggaacaa tcaacctctg 1620 gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta 1680 tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt 1740 ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc 1800 aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt 1860 gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg 1920 gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac 1980 aattccgtgg tgttgtcggg gaagctgacg tcctttccat ggctgctcgc ctgtgttgcc 2040 acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac 2100 cttcttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct 2160 cagacgagtc ggatctccct ttgggccgcc tccccgcctg gaattaattc tgcagtcgag 2220 acctagaaaa acatggagca atcacaagta gcaatacagc agctaccaat gctgattgtg 2280 cctggctaga agcacaagag gagggagg tgggttttcc agtcacacct caggtacctt 2340 taagaccaat gacttacaag gcagctgtag atcttagcca cttttaaaaa gaaaagaggg 2400 gactggaagg gctaattcac tcccaacgaa gacaagatat ccttgatctg tggatctacc 2460 acacacaagg ctacttccct gattagcaga actacacacc agggccaggg gtcagatatc 2520 cactgacctt tggatggtgc tacaagctag taccagttga gccagataag gtagagaagg 2580 ccaataaagg agaagaacacc agcttgttac accctgtgag cctgcatggg atggatgacc 2640 cggagagaga agtgttagag tggaggtttg acagccgcct agcatttcat cacgtggccc 2700 gagagctgca tccggagtac ttcaagaact gctgatatcg agcttgctac aagggacttt 2760 ccgctggggga ctttccaggg aggcgtggcc tgggcgggac tggggagtgg cgagccctca 2820 gatcctgcat ataagcagct gctttttgcc tgtactgggt ctctctggtt agaccagatc 2880 tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg 2940 ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc 3000 ctcagaccct tttagtcagt gtggaaaatc tctagcagtg gcgcccgaac agggacttga 3060 aagcgaaagg gaaaccagag gagctctctc gacgcaggac tcggcttgct gaagcgcgca 3120 cggcaagagg cgaggggcgg cgactggtga gtacgccaaa aattttgact agcggaggct 3180 agaaggagag agatgggtgc gagagcgtca gtattaagcg ggggagaatt agatcgcgat 3240 gggaaaaaat tcggttaagg ccaggggaa agaaaaaata taaattaaaa catatagttat 3300 gggcaagcag ggagctagaa cgattcgcag ttaatcctgg cctgttagaa acatcagaag 3360 gctgtagaca atactggga cagctacaac catcccttca gaggatca gagaactta 3420 gatcattata window gcaaccctct attgtgtgca tcaaggata gagataaag 3480 acaccaagga agctttagac agatagagg agagciaaaaaagtaag accaccgcac 3540 agcaagcggc cggccgctga tctcagacc tggagga gatatgaggg acattggag 3600 aagtgaatta tataatata aagtagtaaaattgaacca ttaggagtag caccaccaa 3660 ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag ctttgttcct 3720 tgggttcttg gggagcagcag gaagcactat gggcgcagcg tcaatgacgc tgacggtaca 3780 ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttactga gggctattga 3840 ggcgcacag catctgttgc aactcacagt ctggggcatc aagcagctcc aggcaagaat 3900 cctggctgtg gaagatacc taaggatca acagctcctg gggatttggg gttgctctgg 3960 aaaactcatt tgcaccactg ctgtgccttg gatgctagt tggagtaata aatctctgga 4020 acgatttgg attacacacga cctggatgga gtgggacaga gaatttaca attackacacag 4080 cttaatacac tccttaattg aagaatcgca aaaccagcaa gaaaagaatg aacaagaatt 4140 attggaatta gataaatggg caagtttgtg gaattggttt aacataacaa attggctgtg 4200 gtatataaaaa ttatcataa tgatataggg aggcttggta ggtttaagaa tagtttttgc 4260 tgtactttct atagtgaata gagttaggca gggatattca ccattatcgt ttcagaccca 4320 cctcccaacc ccgaggggac ccgacaggcc cgaaggaata gaagaagaag gtggagagag 4380 agacagagac agatccattc gattagtgaa cggatctcga cggtatcgcc tttaaaagaa 4440 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 4500 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttcgg gtttattaca 4560 gggacagcag agatccagtt tatcgataag cttgggagtt ccgcgttaca taacttacgg 4620 taaatggccc gcctggctga ccgcccaacg acccccgcccc attgacgtca ataatgacgt 4680 atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac 4740 ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg ccccctattg 4800 acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc ttatgggact 4860 ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt 4920 ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc 4980 ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc 5040 gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata 5100 taagcagagc tcgtttagtg aaccgtcaga tcgcctggag acgccatcca cgctgttttg 5160 acctccatag aagacaccga ctctactaga ggatctattt ccggtgaatt gaccggtgga 5220 tccactagtc cagtgtggtg gaattctgca gatatccagc acagtggcgg ccgctcgagt 5280 ctagagacta taggacgat gatgacaaat aggcccccct aacgt 5325

Claims

1. Use of a RAW 264.7 cell line stably overexpressing SRSF3 in the preparation of anti-inflammatory drugs, characterized in that, The RAW 264.7 cell line stably overexpressing SRSF3 has a lentiviral vector, and the nucleotide sequence of SRSF3 is shown in SEQ ID NO.1; The method for preparing the RAW 264.7 cell line stably overexpressing SRSF3 includes the following steps: Step 1: Construct a Lenti-Flag-hyg-SRSF3 plasmid overexpressing SRSF3; Step 2: Combine the Lenti-Flag-hyg-SRSF3 plasmid constructed in Step 1 with the psPAX2 and pMD2.G packaging vectors to form a three-plasmid expression system, co-transfect 293T cells, collect the lentivirus and concentrate it; Step 3: Transfect the RAW 264.7 macrophages with the lentivirus collected and concentrated in Step 2 to obtain a stable cell line overexpressing the SRSF3 gene.

2. The application according to claim 1, wherein In the method for preparing the RAW 264.7 cell line stably overexpressing SRSF3, in Step 1, the Lenti-Flag-hyg-SRSF3 target plasmid is prepared from the Lenti-Flag-hyg vector shown in SEQ ID NO.4 of the sequence listing and the SRSF3 gene.

3. The application according to claim 2, wherein In Step 1, after PCR amplification, electrophoresis, and recovery of the SRSF3 gene, the recovered SRSF3 gene band and the Lenti-Flag-hyg vector are double digested, electrophoresed and recovered again, and then ligated using a ligase.

4. The application according to claim 3, wherein In Step 1, T4 DNA ligase is used for ligation, and the mass ratio of SRSF3 to the Lenti-Flag-hyg vector is 10:3 to 10:

10.

5. The application according to claim 4, characterized in that, In Step 1, it also includes transforming the ligation product of the SRSF3 gene and the Lenti-Flag-hyg vector into competent cells DH5α for expression, and then extracting the Lenti-Flag-hyg-SRSF3 target plasmid.

6. The application according to claim 5, wherein In Step 2, the mass ratio of the Lenti-Flag-hyg-SRSF3 target plasmid, psPAX2, and pMD2.G is 1 to 3:2:

1.

7. The application according to claim 6, characterized in that In Step 3, after infecting the RAW 264.7 cells with the lentivirus, hygromycin B is added for screening to obtain the RAW 264.7 cell line stably overexpressing SRSF3.

Citation Information

Patent Citations

  • Engineering-transformed macrophages and application of macrophages to septicopyemia

    CN109536454A

  • Application of macrophages in obesity treatment and blood sugar regulation

    CN113244269A