Primer of molecular marker closely linked with pod length gene of phaseolus vulgaris and breeding method thereof
By constructing a common bean germplasm population and using KASP markers to detect pod length genotypes, the problems of environmental dependence and limited application of SNP markers in traditional breeding for pod length trait selection were solved, achieving efficient and accurate pod length trait screening and accelerating the breeding process.
Patent Information
- Application Number
- CN202210669297.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-14
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2042-06-14
AI Technical Summary
In traditional breeding, the accuracy of selecting the pod length trait of common beans based on the pod length phenotype is greatly affected by the environment, which is time-consuming and labor-intensive. Furthermore, the application of existing SNP markers is limited, making it difficult to efficiently select genotypes.
A common bean germplasm population was constructed, and the SNP site Pv_0026128, which is closely linked to the pod length gene, was identified through genome-wide association analysis. This site was then converted into a KASP marker, and specific primers were designed to determine the genotype. The pod length trait was then detected using the KASP reaction.
It enables efficient and accurate screening of pod length traits, improves breeding efficiency, shortens the breeding process, saves manpower and resources, and provides new support for genetic improvement technology.
Smart Images

Figure CN115927693B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomolecular technology and relates to primers for molecular markers tightly linked to the pod length gene in common bean and their selection methods. Background Technology
[0002] Common bean (Phaseolus vulgaris L.) (2n=2x=22) belongs to the tribe Phasoleae (Trib.Phasoleae DC.) and the genus Phaseolus L. in the family Fabaceae. It is one of the most important legume crops worldwide. Common beans are self-pollinating diploids with a genome size of approximately 600 Mb. Wild common beans originated in the Americas, and after long-term domestication and geographical isolation, two diversity centers were formed in the Andes and Central America. Cultivated common beans mainly include two types: dry beans, which are used as food or feed, and snap beans, which are used as vegetables. Common beans were introduced to my country around the 15th century. They are also known as string beans, sword beans, spring equinox beans, plum beans, kidney beans, and jade beans. They are not only an important edible legume in my country but also a widely cultivated important legume vegetable. According to statistics from the Food and Agriculture Organization of the United Nations in 2020, the planting area of grain-grade common beans in my country was approximately 742,100 hectares, accounting for about one-fifth of the global total production of grain-grade common beans, while the planting area of vegetable-grade common beans was approximately 666,100 hectares (https: / / www.fao.org / faostat / zh / #data / QI).
[0003] Common beans are primarily consumed for their tender pods. Pod length is not only an important agronomical trait but also a crucial yield trait. Therefore, breeding long-pod varieties has always been a key objective in common bean breeding. Pod length is a typical quantitative trait, controlled by multiple genes and greatly influenced by the environment. Traditional breeding methods, which select for long pods based on the pod length phenotype, suffer from accuracy highly dependent on environmental factors and are time-consuming and labor-intensive. In contrast, marker-assisted selection based on genotype selection can effectively improve selection efficiency, significantly reduce fieldwork, and shorten the breeding process.
[0004] With the release of the bean genome and the rapid development of genome sequencing technology, single nucleotide polymorphism (SNP) markers have gradually become the mainstream markers in bean genetic research due to their large number and rich polymorphism. For example, Song et al. (2015) identified 992,682 SNPs after sequencing 17 bean germplasms, and developed a high-quality chip BARCBean6K_3BeadChip containing 5,398 SNPs based on this. Wu et al. (2020) identified 4,811,097 high-quality SNPs by resequencing 683 bean germplasms. Although this massive amount of SNP information provides a powerful tool for bean genetic and breeding research, its application in ordinary breeding units is limited because of the high cost of chips, the inability to flexibly replace anchored SNPs, and the high cost and poor reproducibility of SNP identification between different materials when using SNP markers for genotyping. Kompetitive allele-specific PCR (KASP) technology has gradually become an ideal method for personalized research using SNP markers due to its flexibility in selecting the number of SNPs and the population size. For example, Hurtado-Gonzales et al. (2017) converted SNPs on the BARCBean6K_3BeadChip chip into KASP markers for the fine mapping of the pod-length gene in common bean. In addition, KASP markers have been widely used for genetic diversity analysis in crops such as cowpea and bottle gourd. Summary of the Invention
[0005] In view of this, the purpose of this invention is to provide molecular markers and primers closely linked to the pod length gene in common bean, and to provide a method for pod length-assisted breeding using these markers. This method first uses genome-wide association analysis to obtain SNPs closely linked to the pod length gene, then converts the SNPs into KASP markers for verification, and uses these markers to amplify the material to be identified. Based on the genotype, favorable allelic variations in pod length are determined, thereby providing new technical support for the genetic improvement of the pod length trait in common bean.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] 1. This invention first constructed a population of 88 common bean germplasm accessions, including 62 local varieties and 26 cultivars. Phenotypic and genotypic identification of this population was then performed: Referring to the "Specifications and Data Standards for the Description of Common Bean Germplasm Resources," 10 plants were randomly selected from each accession for agronomical trait survey of pod length. At least 10 fresh pods at commercial maturity were taken from each accession during the pod length survey, and the pod length was precisely measured using a ruler. The average value was used as the identification result, ultimately obtaining the phenotypic data for pod length. To determine the genotype of the population, Illumina resequencing was performed on the 88 accessions, and high-quality SNPs were screened for population structure analysis. Then, GWAS analysis of pod length was performed using Tassel 5.0, and SNPs with a LOD value ≥ 3.5 were defined as SNPs significantly associated with the pod length trait. This invention discovered that the marker Pv_0026128 at position 19213953bp on chromosome 1 is significantly associated with pod length, indicating that this marker is closely linked to the gene controlling pod length. By using this marker to amplify the material to be identified, it can be determined whether the sample carries the favorable allelic variation controlling young pod length based on its genotype.
[0008] 2. KASP-specific and universal primers were designed for the SNP site Pv_0026128. A KASP primer for amplifying a marker closely linked to the common bean pod length gene was also developed. The primer sequences are as follows:
[0009] Pv_0026128KASP primers:
[0010] Pv_0026128Primer1:
[0011] 5'-GAAGGTGACCAAGTTCATGCTAGTTGCTTCAACCTGGAGC-3';
[0012] Pv_0026128Primer2:
[0013] 5'-GAAGGTCGGAGTCAACGGATTAGTTGCTTCAACCTGGAGT-3';
[0014] Pv_0026128Primer1 and Pv_0026128Primer2 are two specific primers, each linked to a different fluorescent sequence;
[0015] Pv_0026128Primer_Common:
[0016] 5'-TAAGTAATTGTTATCGCTTGCTGACCT-3'.
[0017] Furthermore, Pv_0026128Primer1 is linked to the FAM group, and Pv_0026128Primer2 is linked to the HEX group.
[0018] 3. The application of the KASP primers, reagents or kits containing KASP primers described in the above technical solutions in the detection of the long pod gene in common bean.
[0019] 4. A method for breeding common bean varieties with different pod lengths using KASP primers, molecular markers tightly linked to the common bean pod length gene, the method specifically including the following steps:
[0020] S1. Extract genomic DNA from common bean plant samples;
[0021] S2. Using genomic DNA from common bean plant samples as a template, KASP reaction detection was performed using KASP primers Pv_0026128.
[0022] S3. Read the fluorescence signal detected by the KASP reaction. If the genomic DNA of the bean sample shows a FAM signal, it can be determined that the sample carries the long pod phenotype; if the genomic DNA of the bean sample shows a HEX signal, it can be determined that the sample carries the short pod phenotype.
[0023] Furthermore, in the method of breeding different pod-length bean varieties, Primer1 is connected to the FAM group and Primer2 is connected to the HEX group.
[0024] Furthermore, in the method for breeding different pod-length bean varieties, the KASP reaction detection also includes the 2X KASP Mastermix reagent.
[0025] Furthermore, in the method for breeding different pod-length bean varieties, the PCR system for KASP reaction detection is: DNA 0.8 μl, 2x KASP Master mix 0.8 μl.
[0026] Furthermore, in the method for breeding different pod-length bean varieties, the PCR reaction program for KASP reaction detection is as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds, gradient annealing at 61-55℃ for 60 seconds, with the annealing temperature decreasing by 0.6℃ in each cycle, extension at 55℃ for 60 seconds, for 10 cycles; then denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, extension for 60 seconds, for 26 cycles.
[0027] The beneficial effects of this invention are as follows:
[0028] (1) This invention provides an SNP site Pv_0026128 that is closely linked to the pod length gene of common bean. The SNP is converted into a KASP marker for verification, and the marker is used to amplify the material to be identified. Based on its genotype, the favorable allelic variation of the pod length of the sample is determined, thereby providing new technical support for the genetic improvement of the pod length trait of common bean.
[0029] (2) The molecular markers and primers provided by this invention can be used for assisted screening of different pod length traits, enabling high-throughput detection in a short time, greatly saving manpower and resources, and providing sufficient marker resources for the genetic diversity analysis, gene mapping, and future molecular breeding of common beans. Compared with traditional phenotypic selection, the selection results are more accurate, facilitating the rapid screening of common bean varieties or lines with long pod traits, thereby increasing common bean yield. The combination with the KASP breeding method also greatly improves breeding efficiency, thereby accelerating the common bean breeding process. Attached Figure Description
[0030] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:
[0031] Figure 1 KASP marker typing diagram for genes associated with the Pv_0026128 marker site.
[0032] Figure 2 Plot of pod length allelic variation for the Pv_0026128 marker site.
[0033] Figure 3 Photos comparing the different genotypes and pod lengths of various common bean varieties. Detailed Implementation
[0034] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0035] Unless otherwise specified, the experimental methods used in the following examples are generally performed under conventional conditions or as recommended by the manufacturer.
[0036] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0037] Example 1:
[0038] First, a population of 88 common bean germplasm accessions was constructed, including 62 local varieties and 26 cultivated varieties. Table 1 shows the relevant information for the 88 common bean germplasm accessions.
[0039] Table 1. Common bean germplasm population
[0040]
[0041]
[0042]
[0043] A completely randomized block design was adopted with two replicates. Each material was planted in two rows per replicate. A-frame trellises were used to guide the plants to climb. The width of the ridges including the furrows was 1.5m, the plant spacing was 40cm, the row spacing was 75cm, and 12 plants were planted per material. Field fertilizer and water management were kept consistent with production.
[0044] Phenotypic and genotypic identification of this population was conducted: Following the "Specifications and Data Standards for Description of Common Bean Germplasm Resources," 10 plants were randomly selected from each material for agronomical trait survey of pod length. At least 10 fresh pods at commercial maturity were collected from each material during the pod length survey, and the pod length was precisely measured using a ruler. The average value was used as the identification result, ultimately obtaining the phenotypic data for pod length. To determine the genotype of the population, Illumina resequencing was performed on 88 materials, generating approximately 6GB of data per material, representing about 10 times the genome coverage. 603,910 high-quality SNPs were identified for population structure analysis. GWAS analysis of pod length was then performed using Tassel 5.0, and SNPs with a LOD value ≥ 3.5 were defined as loci significantly associated with pod length. This invention discovered that the molecular marker Pv_0026128, located at position 19213953 bp on chromosome 1 of Phaseolus vulgaris v2.1 (https: / / phytozome-next.jgi.doe.gov / info / Pvulgaris_v2_1) in the common bean genome, is significantly associated with pod length. This indicates that the marker is tightly linked to the gene controlling pod length. Using this marker to amplify the material to be identified, the genotype can be used to determine whether the sample carries the favorable allelic variant controlling young pod length. The sequence of the molecular marker Pv_0026128 containing this SNP site is: GTGTTTTCATCTCAGTTCAATACATCAAGCAAAGTTGCTTCAACCTGGAG[C / T]CCACTTCCAAATCCGACCAAGGTCAGCAAGCGATAACAATTACTTATAAA.
[0045] Example 2
[0046] KASP tag verification
[0047] KASP-specific and universal primers were designed for SNP sites. One primer for amplifying the KASP marker Pv_0026128, which is closely linked to the common bean pod length gene, is described below:
[0048] Pv_0026128KASP primers:
[0049] Pv_0026128Primer1 and Pv_0026128Primer2 are two specific primers, each linked to a different fluorescent sequence;
[0050] Pv_0026128Primer1: 5'-GAAGGTGACCAAGTTCATGCTAGTTGCTTCAACCTGGAGC-3'; The 5' end of this nucleotide is labeled with a FAM group (blue);
[0051] Pv_0026128Primer2: 5'-GAAGGTCGGAGTCAACGGATTAGTTGCTTCAACCTGGAGT-3'; The 5' end of this nucleotide is labeled with a HEX group (red);
[0052] Pv_0026128Primer_Common: 5'-TAAGTAATTGTTATCGCTTGCTGACCT-3'.
[0053] Genomic DNA was extracted from leaves of 88 bean seedlings after two weeks of growth. The DNA was extracted using the CTAB method (using a kit from Shanghai Sangon Biotech Co., Ltd., following the instructions). The genomic DNA of this population was amplified using the IntelliQube genotyping platform with primers Pv_0026128KASP. The PCR reaction volume was 1.6 μl, containing 0.8 μl of template DNA and 0.8 μl of 2x KASP Master mix. The PCR program was as follows: 94℃ pre-denaturation for 15 min, 94℃ denaturation for 20 s, gradient annealing from 61 to 55℃ for 60 s, with each cycle decreasing the annealing temperature by 0.6℃, followed by a 55℃ extension for 60 s, for 10 cycles; then 94℃ denaturation for 20 s, 55℃ annealing for 60 s, and a 60 s extension, for 26 cycles.
[0054] Fluorescence data were read and analyzed using an IntelliQube instrument. FAM excitation resulted in 485nm emission at 520nm, HEX excitation in 535nm with emission at 556nm, and ROX excitation in 575nm with emission at 610nm. The endpoint fluorescence signal (SNPLine / Araya) was read. Figure 1The image shows the KASP marker genotyping diagram for the gene associated with the Pv_0026128 marker site. If the genomic DNA of a common bean sample shows a FAM signal (red), it can be determined that the sample carries the long pod trait allelic variation CC; if the genomic DNA of a common bean sample shows a HEX signal (blue), it can be determined that the sample carries the short pod trait allelic variation TT. The average pod length and allelic genotypes of 88 common bean germplasm populations are shown in Table 1. A total of 76 materials carried the favorable allelic variation of FAM signal, with an average pod length of 16.2 cm (CC), and a total of 11 materials carried the favorable allelic variation of HEX signal, with an average pod length of 11.5 cm (TT). This indicates that screening for CC allelic variation is likely to yield materials with long pods. Figure 2 Plot of pod length allelic variation for the Pv_0026128 marker site. Figure 3 The images show the pod lengths (different genotypes) of some different varieties of common bean. (a) Material CB38 has an average pod length of 9.8 cm and carries the short pod phenotypic allelic variation TT; (b) Material CB41 has an average pod length of 10.8 cm and carries the short pod phenotypic allelic variation TT; (c) Material CB30 has an average pod length of 20.7 cm and carries the long pod phenotypic allelic variation CC; and (d) Material CB67 has an average pod length of 24.1 cm and carries the long pod phenotypic allelic variation CC.
[0055] Finally, it should be noted that although the present invention has been described in detail above with general descriptions and specific embodiments, some modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Zhejiang Academy of Agricultural Sciences <120> Primers and breeding methods for molecular markers tightly linked to the pod-length gene in common bean. <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (40) <223> fluorescent group <400> 1 gaaggtgacc aagttcatgc tagttgcttc aacctggagc 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <221> modified_base <222> (40) <223> fluorescent group <400> 2 gaaggtcgga gtcaacggat tagttgcttc aacctggagt 40 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <400> 3 taagtaattg ttatcgcttg ctgacct 27 <210> 4 <211> 101 <212> DNA <213> Artificial Sequence <220> <221> allele <222> (51) <223> C / T alleles <400> 4 gtgttttcat ctcagttcaa tacatcaagc aaagttgctt caacctggag cccacttcca 60 aatccgacca aggtcagcaa gcgataacaa ttacttataa a 101
Claims
1. KASP primers for detecting molecular markers tightly linked to the bean pod length gene, characterized in that, The molecular marker, Pv_0026128, is located at 19213953 bp on chromosome 1 of the common bean genome (Phaseolus vulgaris v2.1), with a polymorphism of C / T. The KASP primers for detecting this molecular marker have the following specific sequences: Pv_0026128 KASP primers: Pv_0026128 Primer1: 5'-GAAGGTGACCAAGTTCATGCTAGTTGCTTCAACCTGGAGC-3'; Pv_0026128 Primer2: 5'-GAAGGTCGGAGTCAACGGATTAGTTGCTTCAACCTGGAGT-3'; Pv_0026128 Primer1 and Pv_0026128 Primer2 are two specific primers, each linked to a different fluorescent sequence; Pv_0026128 Primer_Common: 5'-TAAGTAATTGTTATCGCTTGCTGACCT-3'.
2. The KASP primer as described in claim 1, characterized in that, Pv_0026128 Primer1 is linked to the FAM group, and Pv_0026128 Primer2 is linked to the HEX group.
3. The use of the KASP primers as described in claim 1 or 2, or reagents or kits containing the KASP primers as described in claim 1 or 2, in the detection of the long pod gene in common bean.
4. A method for breeding different long-pod varieties of common bean using the KASP primers as described in claim 1, characterized in that, The method specifically includes the following steps: S1. Extract genomic DNA from common bean plant samples; S2. Using genomic DNA from common bean plant samples as a template, KASP reaction detection was performed using Pv_0026128 KASP primers. The Pv_0026128 KASP primers are: Pv_0026128 Primer1: 5'-GAAGGTGACCAAGTTCATGCTAGTTGCTTCAACCTGGAGC-3'; Pv_0026128 Primer2: 5'-GAAGGTCGGAGTCAACGGATTAGTTGCTTCAACCTGGAGT-3'; Pv_0026128 Primer1 and Pv_0026128 Primer2 are two specific primers, each linked to a different fluorescent group; Pv_0026128 Primer_Common: 5'-TAAGTAATTGTTATCGCTTGCTGACCT-3'; S3. Read the fluorescence signal detected by the KASP reaction. If the genomic DNA of the bean plant sample shows the fluorescent group signal of Pv_0026128Primer1, it can be determined that the sample carries the long pod phenotype; if the genomic DNA of the bean plant sample shows the fluorescent group signal of Pv_0026128Primer2, it can be determined that the sample carries the short pod phenotype.
5. The method according to claim 4, characterized in that, Primer1 is linked to the FAM group, and Primer2 is linked to the HEX group.
6. The method according to claim 5, characterized in that, The KASP reaction assay also includes the 2X KASP Master mix reagent.
7. The method according to claim 6, characterized in that, The PCR system for KASP reaction detection was: DNA 0.8 μl, 2xKASP Master mix 0.8 μl.
8. The method according to claim 7, characterized in that, The PCR reaction program for KASP reaction detection is as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds, gradient annealing at 61~55℃ for 60 seconds, with the annealing temperature decreasing by 0.6℃ per cycle, extension at 55℃ for 60 seconds, for 10 cycles; then denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, extension for 60 seconds, for 26 cycles.
Citation Information
Patent Citations
Molecular marker closely interlocked with anti-anthracnose gene locus of common beans and detection method of molecular marker
CN104313143A
Method for molecular mark assisted breeding of vigna unguiculata variety with long pod
CN108660248A