Primer probe combination, kit, method and application for gastric cancer-related gene methylation detection
Through the primer probe combination and fluorescent PCR technology for gastric cancer-related gene methylation detection, the problem of non-invasive and simple early screening of gastric cancer in the existing technology has been solved, non-invasive and simple early screening of gastric cancer has been realized, and the coverage and accuracy of screening have been improved.
Patent Information
- Application Number
- CN202211733993.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-23
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2042-12-23
AI Technical Summary
Existing technologies lack a simple and easy-to-implement method to determine whether large-scale gastroscopy screening is needed, resulting in the inability to carry out large-scale early screening for gastric cancer. In addition, endoscopic tissue biopsy is invasive and costly, and medical resources are limited.
A primer-probe combination for detecting methylation of gastric cancer-related genes is provided, including primer probes for RNF180, SEPTIN9, DACT2, SDC2, NKD2 and ACTB genes. Sulfite conversion and fluorescence PCR detection are performed on peripheral blood samples to determine whether the genes are methylated, and combined with CT value analysis to determine whether further gastroscopy is needed.
It has achieved non-invasive and simple early screening for gastric cancer, avoided unnecessary large gastroscopy examinations through peripheral blood testing, improved the coverage and accuracy of screening, and reduced medical costs.
Smart Images

Figure CN115961047B_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to the field of biomedicine, and in particular to primer-probe combinations, kits, methods, and applications for detecting methylation of gastric cancer-related genes. Background Art
[0002] Globally, there are over 950,000 new cases of gastric cancer and over 720,000 deaths annually. In China, gastric cancer is one of the most common malignant tumors, with the fourth highest incidence rate among malignant tumors. In 2015, there were 679,100 new cases of gastric cancer in my country, and 498,000 deaths from the disease.
[0003] Gastric cancer in my country ranks among the highest in both incidence and mortality among all cancer types, resulting in a high incidence and poor prognosis. Studies have shown that the prognosis of gastric cancer is closely linked to the timing of diagnosis and treatment. The five-year survival rate for early-stage gastric cancer is 84% to 99%, while the five-year survival rate for advanced gastric cancer, even with surgical treatment, remains below 30%. The diagnostic criteria for early gastric cancer require lesions infiltrating the mucosa or submucosa, regardless of lymph node metastasis. Eighty percent of early gastric cancers are asymptomatic, making them easily overlooked. Risk factors for gastric cancer include those over 40 years of age, a family history of gastric cancer, Helicobacter pylori infection, chronic gastric problems, a preference for pickled, smoked, or grilled foods, smoking and alcohol abuse, high stress levels, and an irregular lifestyle. Preventive screening is recommended for these individuals.
[0004] Currently, the gold standard for diagnosing early gastric cancer remains endoscopic biopsy. However, large-scale gastric cancer screening is not yet feasible in my country, and ideal biochemical or biological marker tests are lacking for screening or general screening of gastric cancer. Although endoscopic biopsy has high sensitivity and specificity, it is invasive, expensive, and limited in some regions due to medical resources, making it unsuitable for large-scale population screening. Therefore, a simple, easy-to-implement method is urgently needed to determine whether large-scale gastroscopy screening is necessary. Summary of the Invention
[0005] (1) Purpose of the invention
[0006] In view of the above problems, in order to determine whether a large gastroscopy screening is needed through simple and easy-to-implement means, the present disclosure provides the following technical solutions.
[0007] (2) Technical solution
[0008] In a first aspect of the disclosed embodiments, a primer-probe combination is provided for detecting methylation of gastric cancer-related genes, wherein the related genes include: RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, NKD2 gene and internal reference gene ACTB gene;
[0009] The primer pair sequences for detecting the RNF180 gene are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe sequence for detecting the RNF18 gene is shown in SEQ ID NO.3;
[0010] The primer pair sequences for detecting the SEPTIN9 gene are shown in SEQ ID NO. 4 and SEQ ID NO. 5, and the probe sequence for detecting the SEPTIN9 gene is shown in SEQ ID NO. 6;
[0011] The primer pair sequences for detecting the DACT2 gene are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe sequence for detecting the DACT2 gene is shown in SEQ ID NO.9;
[0012] The primer pair sequences for detecting the SDC2 gene are shown in SEQ ID NO. 10 and SEQ ID NO. 11, and the probe sequence for detecting the SDC2 gene is shown in SEQ ID NO. 12;
[0013] The primer pair sequences for detecting the NKD2 gene are shown in SEQ ID NO. 13 and SEQ ID NO. 14, and the probe sequence for detecting the NKD2 gene is shown in SEQ ID NO. 15;
[0014] The primer pair sequences for detecting the ACTB gene are shown in SEQ ID NO. 16 and SEQ ID NO. 17, and the probe sequence for detecting the ACTB gene is shown in SEQ ID NO. 18.
[0015] In a second aspect of the embodiments of the present disclosure, a kit for detecting methylation of gastric cancer-related genes is provided, comprising the above-mentioned primer-probe combination for detecting methylation of gastric cancer-related genes.
[0016] In some possible implementations, the above kit further includes: a PCR premix and a Taq DNA polymerase amplification system.
[0017] A third aspect of the present disclosure provides a method for detecting methylation of gastric cancer-related genes, comprising the following steps:
[0018] S1. Collect and separate venous blood to obtain plasma, extract free gene fragments of RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, and NKD2 gene from the plasma, and set aside;
[0019] S2. Performing sulfite conversion on the extracted free RNF180, SEPTIN9, DACT2, SDC2, and NKD2 gene fragments, designing a fluorescent PCR reaction system comprising the above primer-probe combination, and performing gene amplification on the sulfite-converted free RNF180, SEPTIN9, DACT2, SDC2, and NKD2 gene fragments using the above fluorescent PCR reaction system;
[0020] S3. Compare and analyze the CT value of the gene amplification result obtained in step S2 with the critical value. When the CT value is less than or equal to the critical value, it is positive, indicating that the collected plasma contains at least one of the methylated RNF18 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene and NKD2 gene.
[0021] In some possible embodiments, the above-mentioned collection and separation of venous blood to obtain plasma includes:
[0022] Collect venous blood;
[0023] The venous blood was centrifuged twice to obtain plasma.
[0024] In some possible embodiments, when performing gene amplification in step S2, the FAM fluorescence channel is selected for the RNF180 gene, the JOE fluorescence channel is selected for the SEPTIN9 gene, the FAM fluorescence channel is selected for the DACT2 gene, the JOE fluorescence channel is selected for the SDC2 gene, the Texas Red fluorescence channel is selected for the NKD2 gene, and the CY5 fluorescence channel is selected for the ACTB gene.
[0025] In some possible embodiments, the conditions for gene amplification in step S2 are 95°C, 300s, pre-denaturation; 95°C, 15s, denaturation; 55°C, 35s, and 45 cycles of annealing, extension, and fluorescence detection.
[0026] In some possible implementations, step S3 includes:
[0027] When the Ct value of the internal reference gene ACTB gene is ≤30, the Ct value of the RNF18 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the RNF18 gene is methylated;
[0028] When the Ct value of the SEPTIN9 gene is ≤32 and there is an "S" amplification curve, it indicates that the test result is positive and the SEPTIN9 gene is methylated;
[0029] When the Ct value of the DACT2 gene is ≤35 and there is an “S” amplification curve, it indicates that the test result is positive and the DACT2 gene is methylated;
[0030] When the Ct value of the SDC2 gene is ≤32 and there is an "S" amplification curve, it indicates that the test result is positive and the SDC2 gene is methylated;
[0031] When the Ct value of the NKD2 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the NKD2 gene is methylated.
[0032] In some possible embodiments, when the Ct value of the internal reference gene ACTB gene is greater than 30 or no amplification occurs, it indicates that the gene amplification result is invalid.
[0033] In a fourth aspect of the embodiments of the present disclosure, a primer-probe combination for detecting methylation of gastric cancer-related genes is provided, wherein the above-mentioned related genes include: RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, and NKD2 gene.
[0034] (3) Beneficial effects
[0035] Compared with the prior art, the embodiments of the present disclosure have the following beneficial effects:
[0036] In suspected cases, the disclosed gastric cancer gene methylation test is first performed. Positive results indicate the need for further gastroscopy. Negative results indicate that the intestinal symptoms are not caused by cancer and are low risk, so gastroscopy can be avoided. Thus, by using the disclosed primer-probe combination during testing, unnecessary large gastroscopy can be avoided. The entire process can be simply performed by in vitro testing of peripheral blood, which is non-invasive and easy to perform. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.
[0038] Figure 1 This is the positive map of RNF18 gene methylation;
[0039] Figure 2 This is the SEPTIN9 gene methylation-positive map;
[0040] Figure 3 This is the DACT2 gene methylation-positive map;
[0041] Figure 4 This is the SDC2 gene methylation-positive map;
[0042] Figure 5This is a positive image of NKD2 gene methylation. DETAILED DESCRIPTION
[0043] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are only for the purpose of illustrating the present disclosure and are not intended to limit the scope of the present disclosure. The examples provided below can serve as a guide for further improvements by those of ordinary skill in the art and do not constitute a limitation of the present disclosure in any way.
[0044] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0045] In a first aspect of the disclosed embodiments, a primer-probe combination is provided for detecting methylation of gastric cancer-related genes, wherein the related genes include: RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, NKD2 gene and internal reference gene ACTB gene;
[0046] The primer pair sequences for detecting the RNF180 gene are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe sequence for detecting the RNF18 gene is shown in SEQ ID NO.3;
[0047] The primer pair sequences for detecting the SEPTIN9 gene are shown in SEQ ID NO. 4 and SEQ ID NO. 5, and the probe sequence for detecting the SEPTIN9 gene is shown in SEQ ID NO. 6;
[0048] The primer pair sequences for detecting the DACT2 gene are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe sequence for detecting the DACT2 gene is shown in SEQ ID NO.9;
[0049] The primer pair sequences for detecting the SDC2 gene are shown in SEQ ID NO. 10 and SEQ ID NO. 11, and the probe sequence for detecting the SDC2 gene is shown in SEQ ID NO. 12;
[0050] The primer pair sequences for detecting the NKD2 gene are shown in SEQ ID NO. 13 and SEQ ID NO. 14, and the probe sequence for detecting the NKD2 gene is shown in SEQ ID NO. 15;
[0051] The primer pair sequences for detecting the ACTB gene are shown in SEQ ID NO. 16 and SEQ ID NO. 17, and the probe sequence for detecting the ACTB gene is shown in SEQ ID NO. 18.
[0052] SEQ ID Gene Primer probe (5'-3') No.1 RNF180-F GTTTTTCGTTTCGTCGAATC NO.2 RNF180-R CTATATCCACGTCCCGAAAC NO.3 RNF180-P FAM-CGTCGTCGGAGTCGTAG-MGB NO.4 Septin9-F TCGGTCGGTGTATTTTAGAC NO.5 Septin9-R TCATAATACCTCCGTAACCG No. 6 Septin9-P JOE-TATCGGTTTAGGATTAGC-MGB No.7 DACT2-F TCGATTTTCGTTAGGGGAAC No.8 DACT2-R GCTCCGCCGTACGTAAATAT No. 9 DACT2-P FAM-TGTAGGTTAGATTAGTGTTG-MGB No. 10 SDC2-F CGTAGTTATAGCGCGGAGTC No. 11 SDC2-R CGAACTCCCCTAAACGACT No. 12 SDC2-P JOE-CGGCGTTTATTGGTTT-MGB No. 13 NKD2-F TTTTATAGGTGGTCGGGTC No. 14 NKD2-R GACTCCCTCTAAACGCGT No. 15 NKD2-P Texas Red-ATCGTTGGTGGGGTT-MGB No. 16 ACTB-F TTAGCGCGTACGTAGTTAGC No. 17 ACTB-R ACAACCGACGAAATCTTTATC No. 18 ACTB-P CY5-ATTAGCGCGTACGCGT-MGB
[0053] Among them, RNF180 (ring finger protein 180) is a tumor suppressor. Methylation of the RNF180 promoter in gastric cancer tissue can lead to low or no RNF180 expression, promoting the progression and proliferation of gastric cancer cells through multiple signaling pathways, including HGF, CCR-7, MMP-2, and VEGF. Septin9 is a member of the Septin gene family, which consists of at least 13 genes that encode conserved GTPase domains that can bind to cytoskeleton-related proteins and are associated with cell division and tumorigenesis. Plasma samples from gastric cancer patients characteristically show elevated levels of methylated RNF180 and Septin9 genes. Syndecan 2 (SDC2) is involved in tumor cell activation, angiogenesis, invasion, and metastasis. SDC2 belongs to the transforming growth factor-β pathway, closely associated with immune surveillance and cell proliferation, invasion, and metastasis. In colorectal cancer, SDC2 primarily regulates the interaction between cells and the tumor microenvironment, activating matrix metalloproteinases and degrading the extracellular matrix. It also participates in biological processes such as the mesenchymal-epithelial transition, promoting tumor cell proliferation and metastasis. SDC2 gene methylation is closely associated with gastric cancer. The MethHC database shows that the methylation level of the SDC2 gene promoter is significantly higher in gastric cancer tissue than in normal tissue, making it a potential biomarker for gastric cancer screening and has promising application prospects. DACT (Homosapiens dapper, antagonist of beta-catenin), also known as frodo or dapper, is a family of genes that negatively regulate the Wnt / β-catenin signaling pathway. DACT2 is a member of the Dapper family and is located on human chromosome 6q27. Studies have hypothesized that DACT2's mechanism of action is to promote the degradation of ALK5 via the lysosomal pathway, thereby regulating cell membrane receptors and thereby modulating TGF-β signaling. Reduced expression of DACT2 in human lung and liver cancers may be related to aberrant methylation of its promoter region. DACT2 promoter methylation is specific to gastric cancer and, compared with methylation in normal stomach, has the potential to serve as an early-stage biomarker for gastric cancer surveillance. NKD2 is located at the 5P15.3 locus on chromosome 5, a site frequently associated with loss of heterozygosity in colorectal and gastric cancers. NKD2 methylation may be a marker for poor prognosis and docetaxel resistance in gastric cancer. NKD2 expression in gastric cancer is regulated by promoter methylation, and it may inhibit gastric cancer metastasis by regulating the expression of SOX18 and its downstream genes.
[0054] This primer-probe combination selects TaqMan-MGB probe. The MGB probe includes a non-fluorescent quencher group (NFQ), which greatly eliminates the background fluorescence produced by traditional quenchers, improves the signal-to-noise ratio, and thus improves the test sensitivity. In addition, the MGB (minor groove binder) molecule binds to the minor groove of the DNA helix, improves hybridization stability by stabilizing the MGB probe / template, increases the Tm value, and enables probes as short as 13 bases to obtain high mismatch discrimination capabilities.
[0055] In a second aspect of the embodiments of the present disclosure, a kit for detecting methylation of gastric cancer-related genes is provided, comprising the above-mentioned primer-probe combination for detecting methylation of gastric cancer-related genes.
[0056] In some embodiments, the above kit further comprises: a PCR premix and a Taq DNA polymerase amplification system.
[0057] Furthermore, the above-mentioned kit also includes a positive quality control product, a negative quality control product and a blank quality control product.
[0058] In some embodiments, as an example, the components of the kit are as follows:
[0059]
[0060] The Methylight PCR Mix reagent preparation table is as follows:
[0061]
[0062] The reagent configuration table for 2.5*RNF180 / Septin9 Methylight PCR Mix is as follows:
[0063] Serial number Components Reaction system (μl) 1 Nucleotide SEQ01 (10 μM) 1 2 Nucleotide SEQ02 (10 μM) 1 3 Nucleotide SEQ03 (10 μM) 1.5 4 Nucleotide SEQ04 (10 μM) 1 5 Nucleotide SEQ05 (10 μM) 1 6 Nucleotide SEQ06 (10 μM) 1 7 Nucleotide SEQ16 (10 μM) 1 8 Nucleotide SEQ17 (10 μM) 1 9 Nucleotide SEQ18 (10 μM) 1.5 10 Methylight PCR Mix 10
[0064] The reagent configuration table for 2.5*DACT2 / SDC2 / NKD2 Methylight PCR Mix is as follows:
[0065]
[0066] The above kit is stored at -20±5℃ and has a shelf life of 12 months; the shelf life after opening is 6 months; it is valid after 3 repeated freeze-thaw cycles.
[0067] A third aspect of the present disclosure provides a method for detecting methylation of gastric cancer-related genes, comprising the following steps:
[0068] S1. Collect and separate venous blood to obtain plasma, extract free gene fragments of RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, and NKD2 gene from the plasma, and set aside;
[0069] S2. Performing sulfite conversion on the extracted free gene fragments of the RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, and NKD2 gene, designing a fluorescent PCR reaction system comprising the primer-probe combination of claim 1, and performing gene amplification on the gene fragments of the free RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, and NKD2 gene after sulfite conversion using the fluorescent PCR reaction system;
[0070] S3. Compare and analyze the CT value of the gene amplification result obtained in step S2 with the critical value. When the CT value is less than or equal to the critical value, it is positive, indicating that the collected plasma contains at least one of the methylated RNF18 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene and NKD2 gene.
[0071] In some possible embodiments, the above-mentioned collection and separation of venous blood to obtain plasma includes:
[0072] Collect venous blood;
[0073] The venous blood was centrifuged twice to obtain plasma.
[0074] In some possible embodiments, when performing gene amplification in step S2, the FAM fluorescence channel is selected for the RNF180 gene, the JOE fluorescence channel is selected for the SEPTIN9 gene, the FAM fluorescence channel is selected for the DACT2 gene, the JOE fluorescence channel is selected for the SDC2 gene, the Texas Red fluorescence channel is selected for the NKD2 gene, and the CY5 fluorescence channel is selected for the ACTB gene.
[0075] In some possible embodiments, the conditions for gene amplification in step S2 are 95°C, 300s, pre-denaturation; 95°C, 15s, denaturation; 55°C, 35s, and 45 cycles of annealing, extension, and fluorescence detection.
[0076] In some possible implementations, step S3 includes:
[0077] When the Ct value of the internal reference gene ACTB gene is ≤30, the Ct value of the RNF18 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the RNF18 gene is methylated;
[0078] When the Ct value of the SEPTIN9 gene is ≤32 and there is an "S" amplification curve, it indicates that the test result is positive and the SEPTIN9 gene is methylated;
[0079] When the Ct value of the DACT2 gene is ≤35 and there is an “S” amplification curve, it indicates that the test result is positive and the DACT2 gene is methylated;
[0080] When the Ct value of the SDC2 gene is ≤32 and there is an "S" amplification curve, it indicates that the test result is positive and the SDC2 gene is methylated;
[0081] When the Ct value of the NKD2 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the NKD2 gene is methylated.
[0082] In some possible embodiments, when the Ct value of the internal reference gene ACTB gene is greater than 30 or no amplification occurs, it indicates that the gene amplification result is invalid.
[0083] In a fourth aspect of the embodiments of the present disclosure, a primer-probe combination for detecting methylation of gastric cancer-related genes is provided, wherein the above-mentioned related genes include: RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, and NKD2 gene.
[0084] The following specific examples illustrate the gastric cancer-related gene methylation detection method provided by the present disclosure. 1 Example 1: Sample collection and pretreatment
[0085] 1. Sample collection:
[0086] Use K2EDTA or cell-free nucleic acid collection tubes to collect 10 mL of blood. The blood sample should be processed immediately. K2EDTA tubes should be stored at 2-8°C for no more than 24 hours before plasma preparation. Do not freeze the blood sample. Cell-free nucleic acid collection tubes can be stored at 15-25°C for no more than 72 hours before plasma preparation. Do not freeze the blood sample.
[0087] 2. Preparation and storage of plasma:
[0088] Place the blood collection tube in a centrifuge and centrifuge at 1350±150rcf for 12 minutes (do not use the brake function of the centrifuge to prevent damage to the blood cell layer); remove the blood collection tube from the centrifuge and use a new disposable pipette to transfer the plasma to a 15mL polypropylene conical-bottom centrifuge tube, and centrifuge again at 1350±150rcf for 12 minutes. Use a new disposable pipette or serological pipette to add 3.5mL of plasma to a new centrifuge tube and label the sample number. Plasma samples can be used for testing immediately or stored at 2℃-8℃ (no more than 24 hours), samples can be stored at -15 to -25℃ for one month, and samples can be stored below -70℃ for six months. Refer to the centrifuge operating manual to convert rpm to rcf.
[0089] 3. Sample volume: 3.5 mL.
[0090] Example 2: Reagent Preparation
[0091] 1. Remove the PCR reaction solution from the kit, thaw it at room temperature, and after it is fully thawed, gently shake to mix it and perform a brief centrifugation for later use.
[0092] 2. According to the number of samples to be tested (n), aliquot 20 μl of PCR reaction solution into each reaction.
[0093] Example 3: Sample processing
[0094] 1. Plasma thawing
[0095] If the plasma sample is frozen, place it at room temperature (15-30°C) and thaw for about 30 minutes. The above samples must be lysed within 60 minutes of thawing.
[0096] 2. Nucleic acid extraction and sulfite conversion
[0097] Refer to the instructions of the purchased commercial kit to operate the nucleic acid extraction or purification kit for plasma free nucleic acid extraction and nucleic acid sulfite conversion.
[0098] If the treated DNA cannot be used immediately, it can be stored at 2 to 8 degrees for 24 hours, or at -25 to -15 degrees for 72 hours.
[0099] Example 4: Adding Samples
[0100] Add the sample DNA to each PCR reaction tube. Add 30 μL of DNA to each PCR reaction. Securely cap the tube and centrifuge briefly at low speed. Note: The sealed PCR plate can be stored at 2-8°C for up to 4 hours.
[0101]
[0102] Example 5: PCR amplification
[0103] 1. Sample Setup: Set the sample ID according to the sample type. The 96-well sample placement layout for the PCR instrument is shown in the table below. In the table, PC represents the positive control, NC represents the negative control, NTC represents the no template control, and S represents the test sample.
[0104]
[0105]
[0106] 2. Fluorescence channel selection: select the FAM fluorescence channel for the RNF180 gene, the JOE fluorescence channel for the SEPTIN9 gene, the FAM fluorescence channel for the DACT2 gene, the JOE fluorescence channel for the SDC2 gene, the Texas Red fluorescence channel for the NKD2 gene, and the CY5 fluorescence channel for the ACTB gene; set the Passive Reference fluorescence to none.
[0107] 3. Reaction conditions (reaction volume set to 50 μL):
[0108]
[0109] 4. Save the file and run the program.
[0110] Example 6. Result Analysis
[0111] After the reaction is completed, the results are automatically saved and analyzed using the instrument software. The Start, End, and Threshold values of the Baseline are adjusted according to the analyzed image (users can adjust the Start value between 2 and 8 and the End value between 10 and 20 based on actual conditions. The fluorescence threshold (Threshold) is set so that the threshold line just exceeds the highest point of the amplification curve (irregular noise line) of the negative quality control product, and the Ct value is displayed as undet). Click Analyze to automatically obtain the analysis results.
[0112] Example 7. Result judgment criteria.
[0113] Interpret PCR reaction results according to the table below. If the internal control ACTB gene indicates sufficient DNA was added to a single reaction (ACTB Ct values are shown in the table below), the results for RNF18, SEPTIN9, DACT2, SDC2, and NKD2 genes are considered the results of this PCR reaction. If the ACTB Ct value is greater than the threshold value set in the table, the PCR reaction is considered "invalid."
[0114]
[0115]
[0116] 1) If the Ct value of the internal reference gene ACTB is ≤30, the Ct value of the RNF18 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the RNF18 gene is methylated; if the Ct value of the SEPTIN9 gene is ≤32 and there is an "S" amplification curve, it indicates that the test result is positive and the SEPTIN9 gene is methylated; if the Ct value of the DACT2 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the DACT2 gene is methylated; if the Ct value of the SDC2 gene is ≤32 and there is an "S" amplification curve, it indicates that the test result is positive and the SDC2 gene is methylated; if the Ct value of the NKD2 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the NKD2 gene is methylated; if any one of these is positive, the test result is methylation positive;
[0117] 2) If the Ct value of the internal reference gene is greater than 30 or no amplification occurs, the experiment is invalid, indicating that the added DNA contains PCR inhibitors. The DNA needs to be re-extracted and tested after sulfite treatment.
[0118] 3) If the Ct value of the internal reference gene is ≤30, the Ct value of the RNF18 gene is >35 and there is no amplification curve, it indicates that the test result is negative and the RNF18 gene is not methylated; the Ct value of the SEPTIN9 gene is >32 and there is no amplification curve, it indicates that the test result is negative and the SEPTIN9 gene is not methylated; the Ct value of the DACT2 gene is >35 and there is no amplification curve, it indicates that the test result is negative and the DACT2 gene is not methylated; the Ct value of the SDC2 gene is >32 and there is no amplification curve, it indicates that the test result is negative and the SDC2 gene is not methylated; the Ct value of the NKD2 gene is >35 and there is no amplification curve, it indicates that the test result is negative and the NKD2 gene is not methylated;
[0119] 4) If the result is negative, the risk of gastric cancer is low and regular follow-up is recommended; if the result is positive, the risk of gastric cancer is high and microscopic examination or tissue biopsy is recommended for confirmation.
[0120] Example 8: 40 cases with known clinical information were selected for sample testing. The results are as follows:
[0121]
[0122]
[0123] Gene detection results of each sample in the kit
[0124]
[0125] Gene detection results of each sample in the kit
[0126]
[0127] From the above specific examples and applications, it can be seen that the kit of the present invention was used to test a total of 40 samples, including 19 cases of gastric cancer, all of which were examined by gastroscopy. Of the 19 gastric cancer samples, 17 tested positive; of the 21 normal samples, 19 tested negative. This shows that the kit has a sensitivity of 89.47% and a specificity of 90.48%. The positive methylation patterns of each gene are shown in Figure 2. Figure 1-Figure 5 ,in, Figure 1 This is the positive map of RNF18 gene methylation; Figure 2 This is the SEPTIN9 gene methylation-positive map; Figure 3 This is the DACT2 gene methylation-positive map; Figure 4 This is the SDC2 gene methylation-positive map; Figure 5 This is a positive image of NKD2 gene methylation.
[0128] The above description is only an illustration of some preferred embodiments of the present disclosure and the technical principles used. Those skilled in the art should understand that the scope of the invention involved in the embodiments of the present disclosure is not limited to the technical solutions formed by the specific combination of the above-mentioned technical features, but should also cover other technical solutions formed by any combination of the above-mentioned technical features or their equivalent features without departing from the above-mentioned inventive concept. For example, the above-mentioned features are replaced with (but not limited to) technical features with similar functions disclosed in the embodiments of the present disclosure.
Claims
1. A primer-probe combination for detecting methylation of gastric cancer-related genes, characterized in that: The related genes include: RNF180 gene, SEPTIN9 gene, DACT2 gene, SDC2 gene, NKD2 gene and internal reference gene ACTB gene; The primer pair sequences for detecting the RNF180 gene are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe sequence for detecting the RNF18 gene is shown in SEQ ID NO.3; The primer pair sequences for detecting the SEPTIN9 gene are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe sequence for detecting the SEPTIN9 gene is shown in SEQ ID NO.6; The primer pair sequences for detecting the DACT2 gene are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe sequence for detecting the DACT2 gene is shown in SEQ ID NO.9; The primer pair sequences for detecting the SDC2 gene are shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe sequence for detecting the SDC2 gene is shown in SEQ ID NO.12; The primer pair sequences for detecting the NKD2 gene are shown in SEQ ID NO.13 and SEQ ID NO.14, and the probe sequence for detecting the NKD2 gene is shown in SEQ ID NO.15; The primer pair sequences for detecting the ACTB gene are shown in SEQ ID NO. 16 and SEQ ID NO. 17, and the probe sequence for detecting the ACTB gene is shown in SEQ ID NO.
18.
2. A kit for detecting gastric cancer-related gene methylation, characterized in that: The invention comprises the primer-probe combination for detecting methylation of gastric cancer-related genes as described in claim 1.