Nucleic acid molecules for CRISPR cascade nucleic acid detection system and their applications

Abstract

The present application relates to nucleic acid molecules for CRISPR cascade nucleic acid detection system and application, and relates to the field of biological detection. The nucleic acid molecules comprise a polymerase binding leading region with a DNA polymerase binding site, a trigger nuclease cleavage region with a trans-cleavage endonuclease binding cleavage site, and an exonuclease polymerization blocking region with a modified 3' end; after the trigger nuclease cleavage region is cleaved, the polymerase binding leading region and the exonuclease polymerization blocking region are connected, the DNA polymerase bound to the polymerase binding leading region can extend the exonuclease polymerization blocking region from the 5' end to the 3' end, and a target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system is synthesized. The CRISPR cascade nucleic acid detection system constructed by using the nucleic acid molecules can realize two-stage cyclic amplification reaction, and improve the reporting speed, reporting intensity and reporting sensitivity of the CRISPR reporter system.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological detection, in particular to nucleic acid molecules for CRISPR cascade nucleic acid detection system and applications. BACKGROUND

[0002] Nucleic acid in vitro amplification technology is an important technology in the field of molecular biology and biological analysis, which can be used for qualitative and quantitative analysis and detection of trace nucleic acid. It plays an important role in various fields related to clinical medicine, laboratory medicine, molecular biology, genomics and food safety, and is an important test method indispensable for the development of life science. With the increasing demand for biological technology in clinical and on-site detection, more and more researchers have focused their attention on the research of new nucleic acid in vitro amplification technology. Polymerase chain reaction (PCR) is the most widely used nucleic acid in vitro amplification technology at present due to its strong specificity, high sensitivity and other advantages. Various fluorescent quantitative PCR methods based on PCR reaction use fluorescent probes integrated into the amplification reaction to reflect the yield of nucleic acid in the system in real time or finally through the intensity or time resolution of fluorescence, which is the most widely used and stable nucleic acid detection method with the highest degree of industrialization at present.

[0003] Although PCR technology has been applied in various fields of molecular biology, the technology needs to realize nucleic acid amplification through multiple cycles of temperature rise and fall, so that a thermal cycler is an indispensable device. However, due to the high requirement of thermal cycler on temperature rise and fall speed, large volume, high price and delicate maintenance, it has been obviously limited in the promotion and on-site detection of grassroots which need rapid results. Therefore, different isothermal and low-temperature amplification technologies have emerged one after another. These technologies have single reaction temperature and are not restricted by thermal cycler, which are gradually making up for the on-site application scenarios that PCR cannot cover.

[0004] Whether PCR or isothermal amplification technology, is based on the enzymatic nucleic acid replication technology of nucleic acid double-stranded base pairing, and its specificity is ensured by the principle of primer base pairing while replicating. Due to its high specificity and sensitivity, it plays an important role in the industrialization of molecular testing. However, with the expansion of its application, its methodological defects have gradually limited its further market expansion. Due to the stability of the nucleic acid replication product and the high sensitivity of the replication methodology, the gradually accumulated specific DNA replication product can significantly affect the stability of the test. In order to stably obtain the test results, various methods have been established in the industry, and the most effective ones currently include the incorporation of uracil deoxyribonucleotides so that the replication product can be degraded by uracil glycosylase; strict zoning and air flow control of laboratory construction and operation, and designation of strict operation procedures to prevent the spread and backflow pollution of replication product aerosols; In addition, the replication reaction is packaged into a sealed reaction chamber for unified processing, but the accumulation of replication products has not been completely solved.

[0005] Since the discovery of the trans-splicing activity in the CRISPR system, the development and iteration of rapid on-site detection methods based on CRISPR have been triggered. However, the current CRISPR detection system still relies on various isothermal amplification methods to obtain sufficient product quantity before performing CRISPR detection due to the need for a certain template concentration to trigger the reaction, and most of the isothermal amplification-CRISPR-based detection systems reported in the industry still cannot solve the problem of mutual interference between the amplification system and the CRISPR system, and require the product to be transferred after amplification to the subsequent detection system. Although some reports can be optimized to a certain extent, its stability is still a big challenge. In this way, both from the convenience of use and from the perspective of the above-mentioned pollution, the current method limits its wide application. SUMMARY

[0006] In view of the above technical problems, the present application provides a nucleic acid molecule for a CRISPR cascade nucleic acid detection system, which is highly stable and structured. The CRISPR cascade nucleic acid detection system constructed using the nucleic acid molecule can realize two-stage cyclic amplification reaction, can improve the reporting speed, reporting strength and reporting sensitivity of the CRISPR reporting system without using nucleic acid template chain amplification method, and can be used as a nucleic acid testing means alone without causing accumulation of nucleic acid replication products.

[0007] The present application provides a nucleic acid molecule for a CRISPR cascade nucleic acid detection system, which comprises a polymerase binding leader region, a trigger nuclease cleavage region and an exonuclease polymerase blocking region.

[0008] The polymerase binding leader region has a DNA polymerase binding site, the trigger nuclease cleavage region is a single-stranded nucleic acid sequence having a trans-endonuclease binding cleavage site, and the 3' end of the exopolymerization blocking region is modified to avoid nonspecific exopolymerization reactions;

[0009] After the trigger nuclease cleavage region is cleaved, the polymerase binding leader region and the exo-polymerization blocking region are connected, and the DNA polymerase bound to the polymerase binding leader region can extend the exo-polymerization blocking region from the 5' end to the 3' end to synthesize a target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system.

[0010] During the research process, the inventors found that the CRISPR system that can be used for rapid on-site detection utilizes the cis-recognition and trans-cleavage effects of CRISPR. When the CRISPR-sgRNA complex recognizes a sequence homologous to the sgRNA target, it activates the trans-cleavage activity for signal reporting. The reaction itself does not involve the amplification of the nucleic acid template, but it has the specificity of sgRNA and the high response ability of trans-cleavage activity. It is an ideal signal recognition and reporting system that can replace nucleic acid amplification. However, if it only relies on trans-cleavage activity for reporting, the efficiency of the trans-cleavage reaction activated when the currently reported Cas enzyme family forms a cis-cleavage complex is basically around 10 fluorescent probe molecules / second, and at 10 7 The following templates will take more than 10 hours to reach the signal reporting level.

[0011] Therefore, the inventors constructed the above-mentioned nucleic acid molecule, in which the polymerase binding leader region in the nucleic acid molecule is provided for DNA polymerase to bind, and when the trans-nuclease cuts the trigger nuclease cleavage region, the DNA polymerase can undergo an extension reaction along the 5'-3' direction to synthesize the target sequence, which can be recognized by the reporter sgRNA of the CRISPR reporter system; the trigger nuclease cleavage region in the nucleic acid molecule has a site for the action of the trans-nuclease, which can act when Cas12 or Cas13 is activated by the target nucleic acid to be tested; the exo-polymerization blocking region in the nucleic acid molecule does not have a complete or correct target sequence for recognition by the reporter sgRNA of the CRISPR reporter system when the DNA polymerase does not extend, so that the trans-cleavage activity of the reporter Cas enzyme will not be activated.

[0012] In one embodiment, the trigger nuclease cleavage region can be cleaved by the Cas enzyme of the CRISPR trigger system, and the targeting domain of the trigger sgRNA in the CRISPR trigger system is complementary to the target nucleic acid to be detected.

[0013] In one embodiment, the polymerase binding leader region is selected from the following sequences:

[0014] CCTCCTCGTCGACGAGGAGG (SEQ ID NO: 18)

[0015] GCAAACACCGCGGTGTTTGC (SEQ ID NO: 19)

[0016] AATCCCAATCCCATGGGATTGGGATT (SEQ ID NO: 20).

[0017] In one embodiment, the trigger nuclease cleavage region is selected from the following sequences: TTTTTTT, TTTTTTTTTT, GACTTTTTTTTTGTT (SEQ ID NO: 21), or CGTTAGGGTTAGGGTTAGGG (SEQ ID NO: 22).

[0018] The nucleic acid molecule constructed by using the above-mentioned polymerase binding leader region and trigger nuclease cleavage region has a good cascade amplification effect.

[0019] In one embodiment, when the trigger nuclease cleavage region is TTTTTTT, the 4th base T from the 5' end to the 3' end is modified to dU;

[0020] When the trigger nuclease cleavage region is TTTTTTTTTT, the 3rd base T from the 5' end to the 3' end is modified to dU;

[0021] When the trigger nuclease cleavage region is GACTTTTTTTTTGTT (SEQ ID NO: 21), the 6th base T from the 5' end to the 3' end is modified to dU.

[0022] In one embodiment, the trigger nuclease cleavage region is GACTTTTTTTTTGTT (SEQ ID NO: 21), the 6th base T from the 5' end to the 3' end is modified to dU, and the polymerase binding leader region is GCAAACACCGCGGTGTTTGC (SEQ ID NO: 19).

[0023] The nucleic acid molecule constructed by using the above-mentioned specific polymerase binding leader region and trigger nuclease cleavage region has a more optimal cascade amplification effect.

[0024] In one embodiment, the sequence length of the exonuclease blocking region is ≤15 nt.

[0025] The exonuclease blocking region with the above-mentioned length can not produce background fluorescence.

[0026] In one embodiment, the exonuclease blocking region is selected from the following sequences:

[0027] CGCAGCACATCCC (SEQ ID NO: 6)

[0028] CGCAGCACATCCCTT (SEQ ID NO: 7).

[0029] In one embodiment, the 3' end of the exonuclease-resistant blocked region has a modification selected from the group consisting of: a ddNTP modification, an invert-dT modification, and a C3-spacer modification.

[0030] With the above modification, the 3' end of the exonuclease-resistant blocked region can be blocked from polymerization activity.

[0031] In one embodiment, the 5' end of the exonuclease-resistant blocked region further comprises a linker region, the linker region is used to have a predetermined distance between the target sequence and the DNA polymerase binding site.

[0032] The above linker region allows the reporter sgRNA to bind to the target sequence without being hindered by steric hindrance.

[0033] In one embodiment, the linker region has a length of 5 ± 2 bp.

[0034] In one embodiment, the linker region is selected from the group consisting of: AAGGA, GTAGGA, and TTAG. In one embodiment, the nucleic acid molecule further comprises a template precursor sequence, the template precursor sequence comprises a first region sequence and a second region sequence, the first region sequence is complementary to the exonuclease-resistant blocked region, and the second region sequence is a template for the extension of the exonuclease-resistant blocked region.

[0035] When the DNA polymerase in the CRISPR cascade nucleic acid detection system is a template-dependent polymerase, the above template precursor sequence provides a template for the DNA polymerase, so that after the DNA polymerase extends to generate a complementary strand, a target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system is formed.

[0036] In one embodiment, the second region sequence of the template precursor region has a thio modification.

[0037] With the above modification, the activated trigger sgRNA can be cut off.

[0038] The application also provides a CRISPR cascade nucleic acid detection system, comprising: a trigger sgRNA, a trigger Cas enzyme, a DNA polymerase, a reporter sgRNA, a reporter Cas enzyme, a reporter probe, and a nucleic acid molecule; the target domain of the trigger sgRNA is complementary to the target nucleic acid to be detected, and the reporter probe has a cleavage site for the reporter Cas enzyme.

[0039] The detection system uses a specific nuclease shared with the Cas enzyme to cascade another reporter system with similar reaction constants, thereby amplifying the next level of cis or trans cleavage activity, improving the reaction speed of the entire system close to the signal reporting speed of nucleic acid amplification, and achieving the goal of detection by a simple temperature under the premise of nucleic acid template replication, similar to biochemical and immunological detection reaction devices or platforms, becoming a low-cost, easy-to-operate, high-sensitivity detection method.

[0040] In one embodiment, when the DNA polymerase is a non-template-dependent polymerase, the nucleic acid molecule is selected from the nucleic acid molecules not including the template precursor sequence; when the DNA polymerase is a template-dependent polymerase, the nucleic acid molecule is selected from the nucleic acid molecules including the template precursor sequence.

[0041] When the DNA polymerase is a non-template-dependent polymerase, the nucleic acid molecule does not need a template precursor sequence; when the DNA polymerase is a template-dependent polymerase, the nucleic acid molecule needs a template precursor sequence.

[0042] In one embodiment, the DNA polymerase includes at least one of the following enzymes: T4 DNA polymerase, Bca DNA polymerase, T7 DNA polymerase, type I DNA polymerase, Phi29 DNA polymerase, or terminal transferase.

[0043] The DNA polymerase has 3'-5' exonuclease activity and strand displacement activity.

[0044] In one embodiment, the DNA polymerase includes Klenow Fragment.

[0045] The Klenow Fragment is a large fragment of type I DNA polymerase.

[0046] In one embodiment, the DNA polymerase is selected from: T4 DNA polymerase, Bca DNA polymerase, T7 DNA polymerase, type I DNA polymerase, and Phi29 DNA polymerase, and the polymerase binds to a double-stranded leading region; the DNA polymerase is selected from: terminal transferase, and the polymerase binds to a single-stranded leading region.

[0047] In one embodiment, the DNA polymerase is a combination of T4 DNA polymerase and Bca DNA polymerase, or a type I DNA polymerase.

[0048] The combination of the above DNA polymerases or a single enzyme has better 3'-5' exonuclease activity and strand displacement activity.

[0049] In one embodiment, the trigger Cas enzyme is selected from a Cas12 enzyme or a Cas13 enzyme, and the reporter Cas enzyme is selected from a Cas12 enzyme or a Cas13 enzyme.

[0050] In one embodiment, the trigger Cas enzyme and the reporter Cas enzyme are both Cas12b.

[0051] The present application also provides a CRISPR cascade nucleic acid detection method, which is realized by the CRISPR cascade nucleic acid detection system, and the detection method comprises the following steps:

[0052] First-stage cyclic amplification: after the trigger sgRNA recognizes the target nucleic acid to be detected, the trans-cleavage activity of the Cas enzyme is activated to cut the trigger nuclease cutting region, so that the DNA polymerase combined with the polymerase binding leader region is activated, and the exonuclease polymerase blocking region is extended under the action of the DNA polymerase to synthesize a target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system;

[0053] Second-stage cyclic amplification: the reporter sgRNA and the reporter Cas enzyme are reacted with the above-synthesized target sequence, the trans-cleavage activity of the reporter Cas enzyme is activated to trans-cut the reporter probe, the signal generated by the reporter probe is collected, and the detection result is obtained.

[0054] After the target nucleic acid to be detected is recognized by the trigger sgRNA, the above nucleic acid molecule synthesizes a target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system through the first-stage cyclic amplification step, and the target sequence can be continuously generated through the first-stage cyclic amplification step, and the reaction speed depends on the trans-cleavage speed of the trigger Cas enzyme and the synthesis speed of the DNA polymerase; then in the second-stage cyclic amplification step, the target sequence forms a Cas secondary amplification complex with the reporter sgRNA and the reporter Cas enzyme to trans-cut the reporter probe, and after the target sequence forms the Cas secondary amplification complex with the reporter sgRNA and the reporter Cas enzyme, the target sequence does not disappear, but continuously produces the activity of cutting the reporter probe with the reporter sgRNA and the reporter Cas enzyme to form the second-stage cyclic amplification.

[0055] In one of the embodiments, the target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system is a double-stranded structure recognized in cis by the Cas-gRNA.

[0056] Compared with the prior art, the present application has the following beneficial effects:

[0057] The nucleic acid molecule for the CRISPR cascade nucleic acid detection system and the application thereof, the polymerase in the nucleic acid molecule binds to the leading region for DNA polymerase binding, in the case of the trigger nuclease cleavage region being cut by the trans-cleaving endonuclease, the DNA polymerase can occur extension reaction in the 5'-3' direction, and the target sequence can be recognized by the reporter sgRNA of the CRISPR reporter system; the trigger nuclease cleavage region in the nucleic acid molecule has a site for the trans-cleaving endonuclease to act, and can act in the case of Cas12 or Cas13 being activated by the target nucleic acid to be detected; the exonuclease polymerase blocking region in the nucleic acid molecule has no complete or correct target sequence for the reporter sgRNA of the CRISPR reporter system to recognize in the case of the DNA polymerase not occurring extension, so that the trans-cleavage activity of the reporter Cas enzyme is not activated. The CRISPR cascade nucleic acid detection system constructed by using the nucleic acid molecule can realize two-stage cyclic amplification reaction, can improve the reporting speed, reporting strength and reporting sensitivity of the CRISPR reporter system under the premise of not using nucleic acid template chain amplification method, and can neither lead to accumulation of nucleic acid replication products nor be used as a nucleic acid testing means alone. BRIEF DESCRIPTION OF DRAWINGS

[0058] Figure 1 It is the flow chart of the first-stage cyclic amplification and the second-stage cyclic amplification in Example 1.

[0059] Figure 2 It is the FAM fluorescence value slope column chart of the nucleic acid molecule (SDAP) containing different exonuclease polymerase blocking region (blocker) lengths in Example 2.

[0060] Figure 3 It is the FAM fluorescence value slope column chart of the nucleic acid molecule (SDAP) with different modified template precursor sequences (Precursor) in Example 2.

[0061] Figure 4 It is the FAM fluorescence value slope column chart of the nucleic acid molecule (SDAP) with different 3' end modified exonuclease polymerase blocking region (blocker) in Example 2.

[0062] Figure 5 It is the FAM fluorescence value slope column chart of the DNA polymerase (Pol) in different combinations in Example 2.

[0063] Figure 6 FAM fluorescence value slope ratio column chart of the nucleic acid molecules (SDAP) containing different PB-Trigger in Example 2 relative to the FAM fluorescence value slope of NTC;

[0064] Figure 7 The fluorescence value slope column chart of the CRISPR cascade nucleic acid detection system constructed by the nucleic acid molecule (SDAP) rTP-15-15 in Example 3 using the nucleic acid molecule (SDAP) optimized in Example 2, and the conventional Cas12b detection system, and the fluorescence value slope column chart of the conventional Cas12b detection system for detecting HPV18. DETAILED DESCRIPTION

[0065] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the accompanying drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application herein are only for the purpose of describing the specific embodiments and are not intended to limit the present application.

[0067] Example 1

[0068] A CRISPR cascade nucleic acid detection system.

[0069] The above system can realize cascade reaction, and in the case that Cas12 or Cas13 recognizes the target nucleic acid to be detected, the trans-cleavage activity of Cas enzyme is triggered to activate, and the product generated by the endonuclease activity is used to generate the target sequence by the polymerization reaction of DNA polymerase, and the cutting reaction of another trans-nucleic endonuclease is coupled. And the above progressive cascade reaction is realized by a nucleic acid molecule.

[0070] I. Construction of the above nucleic acid molecule

[0071] The nucleic acid molecule integrates the following regions:

[0072] 1. Triggering nuclease cleavage region, single-stranded nucleic acid structure region as the first level trans-nucleic endonuclease action site, for Cas12 or Cas13 to be activated in the case of target nucleic acid (Trigger);

[0073] 2. A polymerase binding leader region, as a leader region for the binding of a second level polymerase, for the binding of a DNA polymerase (PB), the PB region can be single stranded or double stranded, depending on the applicable polymerase. In the case of the cleavage of the Trigger region by the trans-acting endonuclease in the upper level, the polymerase will undergo an extension reaction in the 5'-3' direction, synthesizing a new sequence;

[0074] 3. An exonuclease blocking region, as a region (blocker) for blocking exonuclease and polymerase activity, in the case of no extension of the polymerase, there is no complete or correct target sequence (TS) for the recognition of the third level Cas12-gRNA, and the corresponding two levels of reaction 1, 2 do not occur, and the third level reaction will not be triggered;

[0075] 4. A template precursor sequence, as a precursor region for the extension of the polymerase, after the extension of the polymerase to generate a complementary strand, a target sequence (TS) of a double-stranded structure recognized by the Cas12-gRNA in cis is generated, triggering the third level of trans-cleavage amplification effect of the cascade, if a non-template-dependent polymerase is used, such as a terminal transferase or an X family polymerase, the template precursor sequence is not necessary.

[0076] The nucleic acid molecule integrated with the trigger nuclease cleavage region, the polymerase binding leader region, and the exonuclease blocking region is referred to as Switched Deblocked cascAde Precursor (SDAP) in this embodiment.

[0077] II. Constructing a CRISPR cascade nucleic acid detection system.

[0078] The above-mentioned CRISPR cascade nucleic acid detection system comprises:

[0079] 1. A Switched Deblocked cascAde Precursor (SDAP) composed of an oligonucleotide chain, i.e. the above-mentioned nucleic acid molecule;

[0080] 2. A Trigger Cas-trigger crRNA (sgRNA) complex (Primary complex), comprising a trigger sgRNA and a trigger Cas enzyme;

[0081] 3. A DNA polymerase (Pol) containing 3'-5' exonuclease and strand displacement activity, or containing non-template-dependent continuous polymerization activity;

[0082] 4. A Reporter Cas-reporter crRNA complex (Subsequent complex), comprising a reporter sgRNA and a reporter Cas enzyme;

[0083] 5. A reporter probe (Rp-Probe).

[0084] The nucleic acid molecule (SDAP) that plays a key role in the cascade is composed of a single-stranded exposed trigger nuclease cleavage region (Trigger) for the action of the trans-cleavage activity, a polymerase binding leader region (PB), an exonuclease blocker, a template precursor sequence, and other non-functional regions.

[0085] In the normal case, the nucleic acid molecule is highly stable in structure, and in the absence of the target nucleic acid to be detected that can be recognized by the trigger sgRNA, the Trigger Cas-trigger crRNA (sgRNA) complex, the DNA polymerase, and the Reporter Cas-reporter crRNA complex are blocked by the exonuclease blocker, and the target sequence (TS sequence) is not synthesized or released, and the anti-exonuclease modification of the exonuclease blocker and the template precursor sequence also blocks the action of nonspecific nucleases.

[0086] When the trigger sgRNA recognizes the target nucleic acid to be detected, the trans-cleavage activity is opened, the trans-cleavage activity of the trigger Cas enzyme is activated, the trigger nuclease cleavage region is cleaved, and an open gap is released, and after the DNA polymerase binds, the exonuclease blocker is pushed away by the 5'-3' polymerization activity, and the complete double-stranded target sequence (TS sequence) is released / synthesized. The target sequence (TS sequence) can be continuously generated through this cycle, and the reaction speed depends on the trans-cleavage speed of the Trigger Cas-trigger crRNA (sgRNA) complex binding to the target nucleic acid to be detected and the synthesis speed of the polymerase, forming a first-stage cycle amplification.

[0087] The newly generated target sequence (TS sequence) is designed to form a Cas secondary amplification complex with the Reporter Cas-reporter crRNA complex, and to perform trans-cleavage on the reporter probe. After the target sequence (TS sequence) is generated, it forms a complex with the Reporter Cas-reporter crRNA complex, and does not disappear, but continuously produces activity of the Reporter Cas-reporter crRNA complex to cut the reporter probe, triggering a second-stage cycle amplification.

[0088] The above-mentioned first-stage cycle amplification and second-stage cycle amplification are as shown in Figure 1 .

[0089] Example 2

[0090] Optimization of the structure of the nucleic acid molecule (SDAP).

[0091] I. Determination of the length of the exonuclease- resistant blocker.

[0092] SDAPs containing different lengths of exonuclease-resistant blockers were designed and tested for their activation of Cas12b.

[0093] Different rTP sequences are shown in the following table.

[0094] Table 1 Different rTP sequences

[0095]

[0096]

[0097] The sgRNA-REC sequence in the above table is an RNA sequence, where T is the letter specification in the WIPO Sequence List, and is actually uracil U.

[0098] The exonuclease-resistant blocker of rTP-13 is: CGCAGCACATCCC (SEQ ID NO: 6);

[0099] The exonuclease-resistant blocker of rTP-15 is: CGCAGCACATCCCTT (SEQ ID NO: 7);

[0100] The exonuclease-resistant blocker of rTP-17 is: CGCAGCACATCCCTTTC (SEQ ID NO: 8);

[0101] The exonuclease-resistant blocker of rTP-20 is: CGCAGCACATCCCTTTCTCA (SEQ ID NO: 9).

[0102] The above primers were synthesized by Shengong Biotechnology Co., Ltd. rTP-13, rTP-15, rTP-17, and rTP-20 were dissolved in OBA buffer (10 mM Tris, 50 mM NaCl, 1 mM EDTA, pH 8.0) to 100 μM, denatured at 95 °C for 2 minutes, and then annealed on ice. Before use, they were diluted to the corresponding concentration with OBA Buffer for standby; sgRNA-REC and Rp-Probe were dissolved in nuclease-free water to 300 ng / μL and 100 μM, respectively, and stored. Before use, they were diluted to the corresponding concentration with nuclease-free water for standby;

[0103] The Cas12b reaction system is as follows:

[0104] 5uL CutSmart buffer, 2ng / ul cas12b protein, 2ng / ul sgRNA-REC, 0.2uM Rp-Probe and 0.2uM of rTP-13, rTP-15, rTP-17 or rTP-20, with no SDAP added as NTC control, total reaction volume 50uL. In 7500 instrument (ABI), 42C reaction for 40 minutes, FAM fluorescence was collected every minute. The slope of FAM fluorescence value from 15th minute to 25th minute minus NTC was calculated, and the column chart was drawn as shown in Figure 2 .

[0105] It can be known from Figure 2 that the length of the exonuclease blocking region is 15nt or less, which can not produce background fluorescence.

[0106] II. Modification of the template precursor sequence (Precursor).

[0107] Because the template precursor sequence (Precursor) has a partially exposed DNA single strand, it is easy to be cut by the activated Primary complex, so the inventors made a thio modification to the exposed DNA single strand to avoid being cut by the activated Primary complex. The designed sequence is rTP-15-FQ, rTP-15-BHQ.

[0108] 5'-TTTTTTGAGAAAGGGATGTGCTGCGTCCTTCCTCCTCGTCGACGAGGAGGTTTATTTAAGGACGCAGCACATCCCTT-3'(SEQ ID NO:2).

[0109] rTP-15-FQ is based on the sequence shown in SEQ ID NO:2, with Hex modification added at the 5' end, thio modification added on the first 10 bases at the 5' end, and BHQ2 modification added at the 3' end; the sequence is specifically: HexT*T*T*T*T*T*G*A*G*A*AAGGGATGTGCTGCGTCCTTCCTCCTCGTCGACGAGGAGGTTTATTTAAGGACGCAGCACATCCCTT-BHQ2(* represents thio modification).

[0110] rTP-15-BHQ is based on the sequence shown in SEQ ID NO:2, with Hex modification added at the 5' end, and BHQ2 modification added at the 3' end; the sequence is specifically:

[0111] Hex TTTTTTTGAGAAAGGGATGTGCTGCGTCCTTCCTCCTCGTCGACGAGGAGGTTTATTTAAGGACGCAGCACATCCCTT-BHQ2.

[0112] The cleavage of the template precursor sequence (Precursor) was detected using the activated Primary complex, and the reaction system was as follows:

[0113] 5uL CutSmart buffer, 4ng / ul cas12b protein, 6ng / ul sgRNA-REC, 0.2uM rTP-20, and 0.2uM rTP-15-FQ or rTP-15-BHQ, and water was added to a total volume of 50uL. In the 7500 instrument (ABI), 37℃ reaction for 40 minutes, collect Hex / Vic fluorescence once a minute. Calculate the fluorescence value slope from the 15th minute to the 25th minute, as shown in Figure 3 .

[0114] It can be known from Figure 3 that the DNA single strand exposed by the template precursor sequence (Precursor) can be avoided from being cut by the activated Primary complex after using the thio modification (rTP-15-FQ).

[0115] III. 3' end modification of exonuclease blocking region (blocker).

[0116] In this cascade amplification system, the 3' end of the exonuclease blocking region (blocker) needs to be blocked so that it cannot be initiated by DNA polymerase to synthesize a complete target sequence (TS strand) to produce a higher background signal. At the same time, the 3' end of the exonuclease blocking region (blocker) also needs to be modified to resist 3'-5' exonuclease, so that the blocking group at the 3' end of the exonuclease blocking region (blocker) is not cut off, so that the polymerization blocking effect is invalid.

[0117] The means of blocking polymerization activity at the 3' end include modification of ddNTP, invert-dT modification, C3-spacer modification, etc., and the inventors have tested the effect of C3-spacer modification.

[0118] The inventors designed two nucleic acid molecules rTP-15-FQ and rTP-15-7 containing different 3' end modifications.

[0119] rTP-15-FQ is based on the sequence shown in SEQ ID NO: 2, with Hex modification added at the 5' end, thio modification added on the first 10 bases at the 5' end, and BHQ2 modification added at the 3' end.

[0120] 5’-TTTTTTGAGAAAGGGATGTGCTGCGTCCTTCCTCCTCGTCGACGAGGAGGTTTTTTTAAGGACGCAGCACATCCCTT-3’(SEQ ID NO:10).

[0121] rTP-15-7 is a sequence based on SEQ ID NO: 10, with a thio-modification added to the first 10 bases at the 5’ end, the 54th base T from the 5’ end to the 3’ end is modified to dU, and a C3-spacer modification is added at the 3’ end; the sequence is specifically: T*T*T*T*T*T*G*A*G*A*AAGGGATGTGCTGCGTCCTTCCTCCTCGTCGACGAGGAGGTTTdUTTTAAGGACGCAGCACATCCCTT / iSpC3 / / iSpC3 / C.

[0122] The reaction for detecting whether the 3’ end modification can be cut by 3-5 exonuclease is as follows:

[0123] 2.5uL CutSmart buffer, 0.5uL of dNTP, 1uL T4 DNA Polymerase, 0.5uL Bca DNA Polymerase, and 1uM of rTP-15-FQ or rTP-15-7, and water to make up the total volume to 25uL. 37°C for 30min; 75°C for 20min; hot lid 105°C in PCR instrument;

[0124] After the reaction is completed, 2.5uL CutSmart buffer, 4ng / ul cas12b protein, 6ng / ul sgRNA-REC, 2uM Rp-Probe are added to the 25uL system in the previous step, and water is added to make up the total volume to 50uL.

[0125] In the 7500 instrument, 60°C for 30min, collect FAM fluorescence once every minute. Calculate the slope of the fluorescence value from the 15th minute to the 25th minute, and draw a column chart as shown in Figure 4 .

[0126] As can be seen from Figure 4 , the C3C3 modification at the 3’ end of the exonuclease blocking region can resist the cutting of exonuclease.

[0127] Four, selection of DNA polymerase (Pol).

[0128] Different enzymes with 3'-5' exonuclease activity and strand displacement activity were screened, or combinations, combination 1: T4 DNA polymerase + Bca DNA polymerase; combination 2: T7 DNA polymerase; combination 3: T7 DNA polymerase + Bca DNA polymerase; combination 4: type I DNA polymerase; combination 5: Phi29 DNA polymerase; combination 6: Klenow Fragment (large fragment of type I DNA polymerase).

[0129] The Activator S2 of the embodiment is HPV18 genomic DNA, purchased from Guangzhou Bond Sheng Biotechnology Co., Ltd., and sgRNA-S2 is an sgRNA designed to target HPV18, the sequence of which is shown in the following table and synthesized from Jin Sirei Biotechnology Co., Ltd.

[0130] Table 2 sgRNA-S2 sequence

[0131]

[0132] The sgRNA-S2 sequence in the above table is an RNA sequence, wherein T is the letter specification in the WIPO Sequence table, and actually is uracil U.

[0133] 1. Cas12b cleavage trigger nuclease cleavage region (Trigger).

[0134] Table 3 Reaction system of Cas12b cleavage trigger nuclease cleavage region

[0135]

[0136] Reaction at 60°C for 30 min in a PCR instrument.

[0137] 2. Exonuclease strand displacement repair nucleic acid molecule (SDAP).

[0138] Table 4 Reaction system of exonuclease strand displacement repair nucleic acid molecule

[0139] Material Name Volume / μL Previous Reaction 12.5 CutSmart buffer 1.25 dNTP (10 mM each) 0.5 Different enzyme combinations X H2O Make up to 25

[0140] In the reaction system in the above table, the amount of each different enzyme combination is as follows: combination 1: T4 DNA polymerase 1 ul, Bca DNA polymerase 0.5 ul; combination 2: T7 DNA polymerase 0.5 ul; combination 3: T7 DNA polymerase 0.5 ul, Bca DNA polymerase 0.5 ul; combination 4: type I DNA polymerase 0.5 ul; combination 5: Phi29 DNA polymerase 0.5 ul; combination 6: Klenow Fragment (large fragment of type I DNA polymerase) 0.5 ul.

[0141] Group 5 was incubated at 30°C for 30 min and 75°C for 20 min in the PCR machine; other groups were incubated at 37°C for 30 min and 75°C for 20 min in the PCR machine.

[0142] 3. Amplification signal detection.

[0143] Table 5. Amplification signal detection reaction system

[0144] Material Name Volume / μL Previous Reaction 25 CutSmart buffer 2.5 Cas12b (100 ng / μL) 0.5 sgRNA-REC (100 ng / μL) 1.5 Rp-Probe (100 uM) 1 H20 19.5

[0145] In the 7500 instrument (ABI), the reaction was carried out at 60°C for 30 min, and the FAM fluorescence was collected once per minute. The slope of the fluorescence value from the 15th minute to the 25th minute was calculated, and the slope of the SDAP was divided by the slope value of the NTC to draw a column chart as shown in Figure 5

[0146] As can be seen from Figure 5 , Group 1 and Group 4 are better exonuclease displacement enzyme combinations, and the activity of Group 6 is slightly weaker and can be used as an alternative.

[0147] Five, sequence length of PB-Trigger region and cascade amplification effect.

[0148] 1. Design trigger nuclease cleavage region (Trigger) containing rTPs with different lengths and sequences, and detect the cascade amplification effect of nucleic acid molecules (SDAP) containing different PB-Triggers, respectively: rTP-15-7, rTP-15-9, rTP-15-15, rTP-15-7-2, rTP-P1, rTP-P2.

[0149] rTP-15-7 is based on the sequence shown in SEQ ID NO: 10, with a thio modification added to the first 10 bases at the 5' end, the 54th base T from the 5' end to the 3' end is modified to dU, and a C3-spacer modification is added at the 3' end.

[0150] 5'-TTTTTTGAGAAAGGGATGTGCTGCGTCCTACTCCTCCTCGTCGACGAGGAGGTTTTTTTTTGTAGGACGCAGCACATCCCTT-3' (SEQ ID NO: 12);

[0151] ​rTP-15-9 is based on the sequence shown in SEQ ID NO: 12, with thio-modification added to the first 10 bases at the 5’ end, the 55th base T from the 5’ end to the 3’ end is modified to dU, and a C3-spacer modification is added at the 3’ end; the sequence is specifically: T*T*T*T*T*T*G*A*G*A*AAGGGATGTGCTGCGTCCTACTCCTCCTCGTCGACGAGGAGGTTdUTTTTTTGTAGGACGCAGCACATCCCTT / iSpC3 / / iSpC3 / A.

[0152] 5’-TTTTTTGAGAAAGGGATGTGCTGCGTCCTACGCAAACACCGCGGTGTTTGCGACTTTTTTTTTGTTGTAGGACGCAGCACATCCCTT-3’ (SEQ ID NO: 13);

[0153] rTP-15-15 is based on the sequence shown in SEQ ID NO: 13, with thio-modification added to the first 10 bases at the 5’ end, the 57th base T from the 5’ end to the 3’ end is modified to dU, and a C3-spacer modification is added at the 3’ end; the sequence is specifically: T*T*T*T*T*T*G*A*G*A*AAGGGATGTGCTGCGTCCTACGCAAACACCGCGGTGTTTGCGACTTdUTTTTTTGTTGTAGGACGCAGCACATCCCTT / iSpC3 / / iSpC3 / A.

[0154] 5’-TTTTTTGAGAAAGGGATGTGCTGCGTCCTTAATCCCAATCCCATGGGATTGGGATTTTTTTTTAAGGACGCAGCACATCCCTT-3’ (SEQ ID NO: 14);

[0155] rTP-15-7-2 is based on the sequence shown in SEQ ID NO: 14, with thio-modification added to the first 10 bases at the 5’ end, the 60th base T from the 5’ end to the 3’ end is modified to dU, and a C3-spacer modification is added at the 3’ end; the sequence is specifically:

[0156] T*T*T*T*T*T*G*A*G*A*AAGGGATGTGCTGCGTCCTTAATCCCAATCCCATGGGATTGGGATTTTTdUTTTAAGGACGCAGCACATCCCTT / iSpC3 / / iSpC3 / C.

[0157] 5'-TGAGGTAGTAGGTTGTATAGTTTGACGTTAGGGTTAGGGTTAGGGTTAGCGCAGCACATCCCTT-3' (SEQ ID NO: 15);

[0158] rTP-P1 is a C3-spacer modification at the 3' end based on the sequence shown in SEQ ID NO: 15; the sequence is specifically: TGAGGTAGTAGGTTGTATAGTTTGACGTTAGGGTTAGGGTTAGGGTTAGCGCAGCACATCCCTT / iSpC3 / / iSpC3 / A.

[0159] 5'-TTTTTTGAGAAAGGGATGTGCTGCGCTAACCTCAGCTCAAACTATACAACCTACTACCTCA-3' (SEQ ID NO: 16);

[0160] rTP-P2 is a thio modification at the first 10 bases at the 5' end based on the sequence shown in SEQ ID NO: 16; the sequence is specifically:

[0161] T*T*T*T*T*T*G*A*G*A*AAGGGATGTGCTGCGCTAACCTCAGCTCAAACTATACAACCTACTACCTCA.

[0162] The polymerase binding (PB) of rTP-15-7 is: CCTCCTCGTCGACGAGGAGG (SEQ ID NO: 17);

[0163] The polymerase binding (PB) of rTP-15-9 is: CCTCCTCGTCGACGAGGAGG (SEQ ID NO: 17);

[0164] The polymerase binding (PB) of rTP-15-15 is: GCAAACACCGCGGTGTTTGC (SEQ ID NO: 18);

[0165] The polymerase binding (PB) of rTP-15-7-2 is: AATCCCAATCCCATGGGATTGGGATT (SEQ ID NO: 19);

[0166] The trigger nuclease cleavage region (Trigger) of rTP-15-7 is that the 4th base T from the 5' end to the 3' end is modified to dU based on TTTTTTT; the sequence is specifically: TTTdUTTT;

[0167] The trigger nuclease cleavage region (Trigger) of rTP-15-9 is that the 3rd base T from the 5' end to the 3' end is modified to dU based on TTTTTTTTT, and the sequence is specifically: TTdUTTTTTT;

[0168] The trigger nuclease cleavage region (Trigger) of rTP-15-15 is that the 6th base T from the 5' end to the 3' end is modified to dU based on GACTTTTTTTTTGTT (SEQ ID NO: 20), and the sequence is specifically: GACTTdUTTTTTTGTT;

[0169] The trigger nuclease cleavage region (Trigger) of rTP-15-7-2 is that the 4th base T from the 5' end to the 3' end is modified to dU based on TTTTTTT, and the sequence is specifically: TTTdUTTT;

[0170] The trigger nuclease cleavage region (Trigger) of rTP-P1 is: CGTTAGGGTTAGGGTTAGGG (SEQ ID NO: 21);

[0171] The linker region of rTP-15-7 is: AAGGA;

[0172] The linker region of rTP-15-9 is: GTAGGA;

[0173] The linker region of rTP-15-15 is: GTAGGA;

[0174] The linker region of rTP-15-7-2 is: AAGGA;

[0175] The linker region of rTP-P1 is: TTAG.

[0176] rTP-15-7, rTP-15-9, rTP-15-15, rTP-15-7-2, rTP-P1, rTP-P2 are dissolved in dry powder to 100 μM using OBA buffer (10 mM Tris, 50 mM NaCl, 1 mM EDTA, pH 8.0), rTP-15-7, rTP-15-9, rTP-15-15, rTP-15-7-2 are denatured at 95°C for 2 minutes and then annealed on ice, and before use, they are diluted to the corresponding concentration with OBA Buffer for standby; rTP-P1, rTP-P2 are mixed in equal volume, denatured at 95°C for 2 minutes and then annealed on ice.

[0177] 2. Cas12b cleavage trigger region.

[0178] Table 6 Cas12b cleavage trigger region reaction system

[0179]

[0180] Reaction at 60℃ for 30 min in PCR instrument.

[0181] 3. Exonuclease displacement repair SDAP.

[0182] Table 7 Exonuclease displacement repair SDAP reaction system

[0183] Material Name Volume / μL Previous Reaction 12.5 CutSmart buffer 1.25 dNTP (10 mM each) 0.5 T4 DNA Polymerase 1 Bca DNA Polymerase 0.5 H2O 0

[0184] Reaction at 37℃ for 30 min, 75℃ for 20 min in PCR instrument.

[0185] 4. Amplification signal detection.

[0186] Table 8 Amplification signal detection reaction system

[0187] Material Name Volume / μL Previous Reaction 25 CutSmart buffer 2.5 Cas12b (100 ng / ul) 0.5 sgRNA-REC (100 ng / ul) 1.5 Rp-Probe (100 uM) 1 H20 19.5

[0188] Reaction at 60℃ for 30 min in 7500 instrument (ABI), FAM fluorescence was collected every minute. The slope of fluorescence value from 15th minute to 25th minute was calculated, and the slope of different SDAP was divided by the slope value of NTC to draw a column chart as shown in Figure 6 .

[0189] As can be seen from Figure 6 , the ratio of rTP-15-15 is the largest, reaching 300 times. It shows that the cascade amplification reaction produced by the combination of PB-Trigger region shown by rTP-15-15 is the most significant, that is, the PB sequence is GCAAACACCGCGGTGTTTGC (SEQ ID NO: 18), and the Trigger region sequence is modified from the 6th base T from the 5' end to the 3' end to dU based on GACTTTTTTTTTGTT (SEQ ID NO: 20), and the sequence is specifically: GACTTdUTTTTTTGTT.

[0190] Example 3

[0191] Application of the nucleic acid molecule SDAP optimized in Example 2 in the detection of double-stranded DNA target.

[0192] The CRISPR cascade nucleic acid detection system constructed by the nucleic acid molecule (SDAP) optimized in Example 2 and the conventional Cas12b detection system were respectively used to detect HPV18.

[0193] I. The CRISPR cascade nucleic acid detection system constructed by the nucleic acid molecule (SDAP) optimized in Example 2 was used to detect HPV18.

[0194] The HPV18 genomic DNA was diluted into a series of gradients (500 nM, 50 nM, 5 nM, 0.5 nM), and without HPV18 genomic DNA as a negative control (NC), and the CRISPR cascade nucleic acid detection system constructed by the nucleic acid molecule (SDAP) rTP-15-15 optimized in Example 2 was used for detection, and the specific steps were as follows.

[0195] The dry powder was dissolved in OBA buffer (10 mM Tris, 50 mM NaCl, 1 mM EDTA, pH 8.0) to 100 μM, and the optimized nucleic acid molecule (SDAP) was denatured at 95°C for 2 minutes and then annealed on ice. Before use, it was diluted to the corresponding concentration with OBA Buffer for standby.

[0196] 1. The reaction system of Cas12b cutting the trigger region is shown in the following table.

[0197] Table 9 Reaction system of Cas12b cutting the trigger region

[0198]

[0199] PCR instrument, 60°C, 30 min.

[0200] 2. The reaction system of exonuclease strand displacement repair SDAP is shown in the following table.

[0201] Table 10 Reaction system of exonuclease strand displacement repair SDAP

[0202] Material Name Volume / μL Previous Reaction 12.5 CutSmart buffer 1.25 dNTP (10 mM each) 0.5 T4 DNA Polymerase 1 Bca DNA Polymerase 0.5 H2O 0

[0203] PCR instrument, 37°C, 30 min; 75°C, 20 min.

[0204] 3. Amplification signal detection.

[0205] Table 11 Amplification signal detection reaction system

[0206] Material Name Volume / μL Previous Reaction 25 CutSmart buffer 2.5 Cas12b (100 ng / ul) 0.5 sgRNA-REC (100 ng / ul) 1.5 Rp-Probe (100 uM) 1 H20 19.5

[0207] In the 7500 instrument (ABI), 60°C, 30 min, FAM fluorescence was collected once per minute. The slope of the fluorescence value from the 15th minute to the 25th minute was calculated.

[0208] II. Detection of HPV18 using a conventional Cas12b detection system

[0209] The HPV18 genomic DNA was diluted into a series of gradients (500 nM, 50 nM, 5 nM, 0.5 nM), and no HPV18 genomic DNA was added as a negative control (NC), and the conventional Cas12b detection system was used to detect HPV18.

[0210] The conventional Cas12b detection system was as follows: 5 uL CutSmart buffer, 4 ng / ul cas12b, 6 ng / ul sgRNA-S2, 1 uM Rp-Probe, and 2 uL different gradients of HPV18 genomic DNA, and the total reaction volume was 50 uL; 60℃ reaction for 30 minutes, and FAM fluorescence was collected once per minute. The fluorescence value slope from the 15th minute to the 25th minute was calculated.

[0211] The fluorescence value slope of the two methods for detecting HPV18 in this embodiment was plotted into a column chart, as shown in Figure 7 .

[0212] As can be seen from Figure 7 , compared with the conventional detection method, the method of the present application can detect 0.5 nM of the HPV18 genomic target without amplification, while the conventional detection method cannot obtain a positive signal.

[0213] In summary, at the level of the reaction ability of the structure, the amplification effect of several structures of SDAP is realized by screening, and an efficient combination of PB-Trigger-Blocker-Precursor is fixed, which can realize the recognition and reaction of Primary complex→Pol→Subsequent complex in turn;

[0214] At the level of structure optimization, the modification method of Blocker and Precursor for closing the exonuclease activity is studied, a design method of Blocker-Precursor with low background signal is given, and the type of polymerase with high efficiency is determined, which eliminates the background signal of SDAP itself and Subsequent complex in the signal amplification process of SDAP;

[0215] At the level of system reaction ability, the sensitivity of double-stranded DNA target detection is improved without relying on polymerase chain reaction.

[0216] The technical features of the above-described embodiments can be combined arbitrarily, and in order to make the description concise, all possible combinations of the technical features in the above-described embodiments are not described, however, as long as the combination of the technical features does not exist contradictory, it should be considered as the scope of the present application.

[0217] The above embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A nucleic acid molecule for a CRISPR cascade nucleic acid detection system, characterized in that: The nucleic acid molecule comprises a polymerase binding leader region, a triggering nuclease cleavage region and an exo-polymerization blocking region; the triggering nuclease cleavage region is located between the polymerase binding leader region and the exo-polymerization blocking region; The polymerase binding leader region has a DNA polymerase binding site; The trigger nuclease cleavage region is a single-stranded nucleic acid sequence having a trans-acting endonuclease binding cleavage site, and the trigger nuclease cleavage region can be cleaved by the Cas enzyme of the CRISPR trigger system; The 3' end of the exopolymerization blocking region is modified to prevent non-specific exopolymerization reaction, and the sequence length of the exopolymerization blocking region is ≤15nt; After the trigger nuclease cleavage region is cleaved, the polymerase binding leader region and the exo-polymerization blocking region are connected, and the DNA polymerase bound to the polymerase binding leader region can undergo an extension reaction along the 5'-3' direction to synthesize a target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system.

2. The nucleic acid molecule according to claim 1, characterized in that The targeting domain of the trigger sgRNA in the CRISPR trigger system is complementary to the target nucleic acid to be detected.

3. The nucleic acid molecule according to claim 1, characterized in that The polymerase binding leader region is selected from the following sequences: CCTCCTCGTCGACGAGGAGG(SEQ ID NO:18) GCAAACACCGCGGTGTTTTGC(SEQ ID NO:19) AATCCCAATCCCATGGGATTGGGATT (SEQ ID NO: 20).

4. The nucleic acid molecule according to claim 1, wherein The trigger nuclease cleavage region is selected from the following sequences: TTTTTT, TTTTTTTTT, GACTTTTTTTTTGTT (SEQ ID NO: 21), or CGTTAGGGTTAG GGTTAGGG (SEQ ID NO: 22).

5. The nucleic acid molecule according to claim 4, characterized in that When the nuclease-triggered cleavage region is TTTTTTT, the fourth base T from the 5' end to the 3' end is modified to dU; When the trigger nuclease cleavage region is TTTTTTTTT, the third base T from the 5' end to the 3' end is modified to dU; When the trigger nuclease cleavage region is GACTTTTTTTTTGTT (SEQ ID NO: 21), the sixth base T from the 5' end to the 3' end is modified to dU.

6. The nucleic acid molecule according to claim 5, characterized in that The trigger nuclease cleavage region is GACTTTTTTTTTGTT (SEQ ID NO: 21), the sixth base T from the 5' end to the 3' end is modified to dU, and the polymerase binding leader region is GCAAACACCGCGGTGTTTGC (SEQ ID NO: 19).

7. The nucleic acid molecule according to claim 1, characterized in that The exopolymerization blocking region is selected from the following sequences: CGCAGCACATCCC (SEQ ID NO: 6) CGCAGCACATCCCTT (SEQ ID NO:7).

8. The nucleic acid molecule according to claim 7, characterized in that The 3' end of the exo-polymerization blocking region has the following modifications: ddNTP modification, invert-dT modification, or C3-spacer modification.

9. The nucleic acid molecule according to claim 1, characterized in that The 5' end of the exopolymerization blocking region further includes a linker region, and the linker region is used to ensure a predetermined distance between the target sequence and the DNA polymerase binding site.

10. The nucleic acid molecule according to claim 9, characterized in that The length of the linker region is 5±2 bp.

11. The nucleic acid molecule according to claim 10, characterized in that The linker region is selected from the following sequences: AAGGA, GTAGGA, or TTAG.

12. The nucleic acid molecule according to claim 1, wherein The nucleic acid molecule further comprises a template precursor sequence, which comprises a first region sequence and a second region sequence, wherein the first region sequence is complementary to the exopolymerization closed region, and the second region sequence is a template for extension of the exopolymerization closed region.

13. The nucleic acid molecule according to claim 12, characterized in that The second region sequence nucleic acid of the template precursor region sequence has a thiolation modification.

14. A CRISPR cascade nucleic acid detection system, characterized in that: include: A trigger sgRNA, a trigger Cas enzyme, a DNA polymerase, a reporter sgRNA, a reporter Cas enzyme, a reporter probe, and a nucleic acid molecule according to any one of claims 1 to 13; the targeting domain of the trigger sgRNA is complementary to the target nucleic acid to be detected, and the reporter probe has a site cut by the reporter Cas enzyme.

15. The detection system according to claim 14, characterized in that: When the DNA polymerase is a non-template-dependent polymerase, the nucleic acid molecule is selected from the nucleic acid molecule according to any one of claims 1 to 11; when the DNA polymerase is a template-dependent polymerase, the nucleic acid molecule is selected from the nucleic acid molecule according to any one of claims 12 to 13.

16. The detection system according to claim 14, characterized in that The DNA polymerase comprises at least one of the following enzymes: T4 DNA polymerase, Bca DNA polymerase, T7 DNA polymerase, type I DNA polymerase, Phi29 DNA polymerase, or terminal transferase.

17. The detection system according to claim 16, characterized in that: The DNA polymerase is selected from: T4 DNA polymerase, Bca DNA polymerase, T7 DNA polymerase, type I DNA polymerase, Phi29 DNA polymerase, and the polymerase binds to a double-stranded leader region; the DNA polymerase is selected from: terminal transferase, and the polymerase binds to a single-stranded leader region.

18. The detection system according to claim 17, characterized in that: The DNA polymerase is a combination of T4 DNA polymerase and Bca DNA polymerase, or type I DNA polymerase.

19. The detection system according to claim 14, characterized in that The triggering Cas enzyme is selected from Cas12 enzyme or Cas13 enzyme, and the reporting Cas enzyme is selected from Cas12 enzyme or Cas13 enzyme.

20. The detection system according to claim 19, characterized in that The triggering Cas enzyme and the reporting Cas enzyme are both Cas12b.

21. A synthetic method for detecting a target sequence in a sample, characterized in that: The synthesis method is achieved by the CRISPR cascade nucleic acid detection system according to any one of claims 14 to 20; The synthesis method comprises the following steps: after the triggering sgRNA recognizes the target nucleic acid to be detected, the trans-cleavage activity of the triggering Cas enzyme is activated, the triggering nuclease cleavage region is cut, the DNA polymerase activity bound to the polymerase binding leader region is activated, and the exo-polymerization blocking region is extended under the action of the DNA polymerase to synthesize a target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system.

22. The synthesis method according to claim 21, characterized in that The target sequence that can be recognized by the reporter sgRNA of the CRISPR reporter system is a double-stranded structure recognized by the Cas-gRNA in cis.

Images