A mutant of adeno-associated virus suitable for specific infection of rat hepatocytes

Abstract

The present invention relates to the packaging and screening of viral vectors, and in particular to the packaging and screening of AAV mutants, specifically an adeno-associated virus mutant suitable for specific infection of rat hepatocytes. By constructing an AAV9 peptide mutation library, a new AAV9 mutant with 7 amino acids inserted is obtained through screening and verification. The mutant can effectively infect BRL cells under an MOI of 1E+5, achieving an infection effect higher than that of the natural AAV9 serotype MOI of 1E+5. The AAV9-BRL04 obtained through screening has the best effect. Under the same MOI conditions, the infection positive rate is significantly improved compared with the control AAV9 serotype. The multiple is statistically 8 times as high as detected by luciferase (RLU) value, which effectively reduces the amount of AAV-infected cells used, saves experimental costs, and makes it feasible to conduct gene therapy-related mechanism research in rat hepatocytes.

Description

Technical Field

[0001] The present invention relates to the packaging and screening of viral vectors, and in particular to the packaging and screening of AAV mutants, specifically an adeno-associated virus mutant suitable for specific infection of rat hepatocytes. Background Art

[0002] Adeno-associated virus (AAV) is a small, non-enveloped, icosahedral virus. It is the simplest single-stranded DNA defective virus discovered to date and requires a helper virus (usually adenovirus or herpes virus) for viral packaging. Due to its safety, broad host cell range (dividing and non-dividing cells), low immunogenicity, and prolonged expression of exogenous genes in vivo, it is considered one of the most promising gene transfer vectors and is widely used in gene therapy and vaccine research worldwide. Different AAV serotypes have different cell affinities.

[0003] Usually, the expression of adeno-associated virus in vivo can only be detected 3 to 4 weeks after injection. The experimental cycle is long, and the cost of rats and breeding space is high. Therefore, rat hepatocytes can be selected as an in vitro model for screening and early mechanism testing to conduct relevant functional studies. The expression time can be shortened from 3 to 4 weeks in vivo to 3 days, and the cost is greatly reduced. It can also provide a powerful tool for the study of the mechanism of liver changes and development and the development of liver gene therapy drugs.

[0004] However, the efficiency of existing AAV viruses in infecting this cell line is relatively low. For example, AAV 9 has a low infection efficiency in rat hepatocytes (BRL) and a high MOI (multiplicity of infection). At an MOI of 1E+5, only a small number of cells can be infected. This limits the use of AAV viruses in in vitro testing and results in a large amount of AAV required for in vitro testing. Therefore, we designed and constructed an AAV9 peptide mutation library. Through library screening, we obtained AAV mutants that can efficiently infect the BRL cell line, improving the infection efficiency of existing AAV serotypes to meet their application in BRL cells. Summary of the Invention

[0005] In response to the deficiencies in the prior art, the present invention designed and constructed an AAV9 peptide mutation library, and obtained AAV serotype mutants that can efficiently infect BRL cell lines through library screening, so as to meet the application of BRL cell lines for in vitro research.

[0006] The present invention discloses an AAV9 serotype capsid protein mutant into which a heterologous peptide is inserted;

[0007] The heterologous peptide is a polypeptide having an amino acid sequence of LRLNTAV (SEQ ID NO: 12);

[0008] The heterologous peptide is inserted between amino acids 588 and 589 of the AAV9 serotype capsid protein.

[0009] The present invention discloses a nucleic acid molecule encoding the AAV9 serotype capsid protein mutant.

[0010] The present invention discloses a nucleic acid vector operably connected to the nucleic acid molecule.

[0011] The invention discloses a host cell containing the nucleic acid vector.

[0012] The present invention discloses a composition or a kit containing the above-mentioned AAV9 serotype capsid protein mutant, a nucleic acid molecule or a nucleic acid vector.

[0013] The present invention discloses the use of the above-mentioned AAV9 serotype capsid protein mutant, nucleic acid molecule or nucleic acid vector for infecting BRL cells, and the use belongs to non-diagnostic and therapeutic purposes.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] This technical solution constructs an AAV9 peptide mutation library, and after screening and verification, obtains a new AAV9 mutant with 7 amino acids inserted. The mutant can effectively infect BRL cells at MOI=1E+5, achieving a higher infection effect than the natural AAV9 serotype MOI=1E+5. The AAV9-BRL04 obtained after screening has the best effect. Under the same MOI conditions, the infection positivity rate is significantly improved compared with the control AAV9 serotype. The luciferase (RLU) value detection statistics show that the multiple is 8 times, which effectively reduces the use of AAV-infected cells, saves experimental costs, and makes it feasible to conduct gene therapy-related mechanism research in rat cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the expression diagram of pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA in Example 1;

[0017] Figure 2 This is the map of pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA-WPRE in Example 1;

[0018] Figure 3Flowchart for AAV9 library construction and screening;

[0019] Figure 4 This is a fluorescence image of BRL cells infected with different serotypes in Example 2;

[0020] Figure 5 This is a graph of the firefly luciferase values ​​(RLU) of BRL cells infected with different serotypes in Example 2. DETAILED DESCRIPTION

[0021] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.

[0022] Example 1. Construction of AAV97-mer random peptide insertion library:

[0023] The library consists of the following vectors:

[0024] Library shuttle vector: pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA, such as Figure 1-2 shown.

[0025] Example 2, AAV9 library construction and screening process:

[0026] By constructing a random mutation library of AAV9 peptides, new AAV9 mutants with 7 amino acids inserted were screened, such as Figure 3 shown.

[0027] 1. Mutant library preparation

[0028] 1.1 Chemically synthesize the following two fragments of AAV9-7mer-NNS:

[0029] 5'CCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSGCACAGGCGCAG 3'(S EQ ID NO:1);

[0030] 5'CGGTCTGCGCCTGTGCSNNSNNSNNSNNSNSNSNNTTTGGGCACTCTG 3'(SE Q ID NO:2);

[0031] where NNS stands for random number sequence.

[0032] 1.2 Add 10 μL of each of the synthesized AAV9-7mer-NNS forward and reverse strand primers (final primer concentration 10 mM) and anneal to obtain the AAV9-7mer-NNS template. The annealing program is: 95°C for 5 min; 95°C for 1 min; 92°C for 1 min; and 4°C for 60 min. During the second and third steps, decrease the temperature by 3°C each cycle for a total of 25 cycles.

[0033] 1.3 Plasmid pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40 polyA (its structure and insertion site are as follows Figure 2 The enzyme digestion system (50 μL) was shown in Table 1.

[0034] Table 1

[0035]

[0036]

[0037] After enzyme digestion at 55°C for 4 h, electrophoresis was performed on 1% agarose gel. Large fragments were cut out with a blade under ultraviolet light and recovered and purified.

[0038] 1.4 Ligate the purified digestion product obtained in step 1.3 with the AAV9-7mer-NNS nucleotide sequence obtained in step 1.2 using T4 DNA ligase. Use Takara's T4 DNA ligase in a 10 μL reaction mixture as shown in Table 2. Incubate overnight at 4°C.

[0039] Table 2

[0040]

[0041] 1.5 Add 10 μL of enzyme-linked product to 50 μL of library-specific electroporation competent cells (purchased from Lucigen), mix well, and transfer to a pre-cooled electrode cup. Use a Bio-Rad electroporator for electroporation. After electroporation, add 1 mL of SOC liquid culture medium preheated at 37°C. Then, after resuscitation at 37°C for 1 hour, centrifuge and coat.

[0042] 1.6 Repeat steps 1.4-1.5 until the number of clones reaches 5 × 10 11 .

[0043] 2. Library virus packaging and screening

[0044] 2.1 AAV mutant library virus packaging: 1.5×10 7293 AAV packaging cells were seeded into 15 cm cell culture dishes and cultured for 18-24 hours. Transfection was initiated when the cells adhered. The pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40 polyA–insertion expression vector library containing the AAV9-7mer-NNS insert, packaging plasmids, and helper plasmids were transfected into the 293 AAV cells using PEI transfection reagent. 72 hours after transfection, the proportion of AAV-293 cells harboring the vector library was counted under a fluorescence microscope to determine viral packaging efficiency. After viral packaging was complete, the cells were repeatedly pipetted to completely detach from the culture dish and the entire cell sample was collected.

[0045] 2.2 Virus purification: The collected cell samples were repeatedly frozen and thawed at -80°C and 37°C, centrifuged, and the cell supernatant was collected. Cell debris was removed using a 0.45 μm PVDF filter. Subsequently, the collected recombinant AAV virus was purified using an AAV purification kit to obtain the recombinant AAV virus.

[0046] 2.3 Determination of recombinant AAV virus titer: 20 μL of concentrated virus solution was added with 1 μL of RNase-free DNase, mixed, and incubated at 37°C for 30 min. Centrifuged at 10,000 rpm for 10 min. 20 μL of supernatant was added with 80 μL of dilution buffer to another sterile tube, mixed, and reacted in a 100°C metal bath for 10 min. Cooled naturally to room temperature, 3 μL of proteinase K was added, and the tube was incubated at 37°C for 60 min. The tube was reacted in a 100°C metal bath for 10 min, and then cooled to room temperature. The above sample was diluted and used as a template for determination of recombinant AAV virus titer using real-time quantitative PCR. The qPCR reaction system and reaction conditions were: 95°C for 10 min, 95°C for 30 s, and 60°C for 30 s, for 35 cycles.

[0047] 2.4 AAV virus infection of BRL (rat hepatocytes) cells:

[0048] 2.4.1 Cell plating: BRL cells were seeded into 10 cm cell dishes at a confluence of 40%, with 5 × 10 cells per dish. 6 Cells were plated onto multiple cell culture dishes.

[0049] 2.4.2 Viral infection: BRL cells were infected with the pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA–insertion expression vector library virus.

[0050] 2.5 Collect the infected cells and perform fluorescence sorting using a flow cytometer. Select cells with red fluorescence brightness in the top 5% as the target cells for screening and collection. The sorted and collected cells are plated into a cell dish and amplified before collection.

[0051] 2.6 The genome of the collected cells was extracted and amplified by PCR, and the PCR products were sequenced by high-throughput sequencing.

[0052] Amplification primers:

[0053] AAV9-F: AACTACTAACCCGGTAGCAACGG (SEQ ID NO: 3) (forward primer on vector)

[0054] AAV9-R: CGTCCGTTGAGGAATTTTGG (SEQ ID NO: 4) (reverse primer on the vector) was added to the adapter and index sequence for high-throughput sequencing using the following primers:

[0055] NGS-AAV9-F:

[0056] TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAAACTACTAACCCGGTAGCAACGG(SEQ ID NO:5)

[0057] NGS-R1:

[0058] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGCGAGTAATCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:6)

[0059] NGS-R2:

[0060] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGTCTCCGGACGTCCGTGTGAGGAATTTTGG(SEQ ID NO:7)

[0061] NGS-R3:

[0062] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGAATGAGCGCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:8)

[0063] NGS-R4:

[0064] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGGGAATCTCCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:9)

[0065] NGS-R5:

[0066] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCT AGTTCTGAATTTCCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:10)

[0067] The expected sequencing sequence is:

[0068] AACTACTAACCCGGTAGCAACGGAGTCCTATGGACAAGTGGCCACAAACCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSNNSGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGACAGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACG (SEQ ID NO: 11)

[0069] After analyzing the high-throughput sequencing results, the mutants with the highest frequency were named AAV9-BRLxx; for example, peptide 01 was named AAV9-BRL01.

[0070] 3. Screening and validation of AAV9 mutants

[0071] 3.1 Construction of AAV9 mutants

[0072] Using the natural serotype AAV9 as a vector, candidate mutant AAV9-BRLxx and other fragments were inserted at amino acids 588-589 to obtain new serotype vectors AAV9-BRLxx, etc. Based on the results of high-throughput sequencing, more than 30 mutants were constructed.

[0073] 3.2 Using the shuttle vector pAAV-CBh-mScarlet-P2A-Luc2, AAV9-BRLxx and other serotype vectors were used to package various mutant serotypes of AAV viruses.

[0074] 3.3 Use WPRE primers to determine the viral titer of the above viruses, and use test staining to confirm the expression of viral VP1, VP2, and VP3.

[0075] 3.4 Add pAAV-CBh-mScarlet-P2A-Luc2 and other AAV9-BRLxx viruses at an MOI of 1×10 5 BRL cells were infected separately, and the infection results of 4 different mutant serotype peptides were selected. The fluorescence images of the control AAV9 at 72h are shown in the figure. Figure 4 As shown in Figure 2, the infection efficiency of AAV9-BRL 04 mutant serotype virus was significantly higher than that of control AAV9. At the same time, the luciferase (RLU) value of the firefly luciferase detection cell was measured. Figure 5 The results also show that the infection efficiency of AAV9-BRL04 is higher than that of the control AAV9, with an RLU value of 8 times higher than that of the control AAV9. The AAV9-BRL04 obtained through screening was the most effective. At the same MOI, the infection positive rate was significantly increased compared to the control AAV9 serotype, with the luciferase (RLU) value test statistically showing an 8-fold increase.

Claims

1. A use of an AAV9 serotype capsid protein mutant, nucleic acid molecule, or nucleic acid vector inserted with a heterologous peptide for infecting BRL cells, wherein the use is for non-diagnostic and non-therapeutic purposes; The heterologous peptide is: a polypeptide consisting of an amino acid sequence of LRLNTAV; The mutant is a wild-type AAV9 serotype capsid protein in which the heterologous peptide is inserted between amino acids 588 and 589; The wild-type AAV9 serotype capsid protein is 736 amino acids in length; The nucleic acid molecule encodes the AAV9 serotype capsid protein mutant; The nucleic acid vector is operably linked to the nucleic acid molecule.

Images