A DSF quenching enzyme derived from Acinetobacter tankii and its encoding gene and application

Abstract

The present invention discloses a DSF quenching enzyme derived from Acinetobacter tankii and its encoding gene and application. The present invention belongs to the technical field of biotechnology and enzyme application, and specifically relates to a DSF quenching enzyme derived from Acinetobacter tankii and its encoding gene and application. The DSF quenching enzyme FadDD1 recombinant protein is as follows: A1) a protein having an amino acid sequence as shown in sequence 2; A2) a protein having an amino acid sequence as shown in the 1-558th of sequence 4; A3) a protein having more than 80% identity and the same function as the protein shown in A1) or A2) obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) or A2); A4) a fusion protein obtained by connecting a protein tag at one end of A1) or A2). After heterologous expression of the encoding gene FadDD1 in Escherichia coli, the disease resistance of the host zebrafish to pathogenic bacteria mediated by the QS signal molecule DSF can be significantly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of biotechnology and enzyme application, and specifically relates to a DSF quenching enzyme derived from Acinetobacter tankii and a coding gene and application thereof. Background Art

[0002] Plesiomonas is a facultative anaerobic, Gram-negative short rod that moves with polar flagella. Plesiomonas is widely distributed in soil and water. It can not only cause gastroenteritis in humans, but also cause extraintestinal infections such as sepsis and meningitis in humans. It can also infect dogs, red-crested ducks, etc. and cause intestinal diseases. It is a common and important foodborne pathogen that is common in humans and animals. Fish are a common host of Shigella-like Plesiomonas. The bacteria are pathogenic to many aquatic animals. There have been reports of deaths of Nile tilapia, hybrid sturgeon, giant salamander, black carp, eel, spotted forktail, etc. infected with Shigella-like Plesiomonas. The main clinical symptoms of diseased fish are bleeding and ulceration on the body surface, scale shedding, fin ulceration, intestinal bleeding, and a small amount of ascites. Studies have shown that the increase of Plesiomonas can cause intestinal inflammation and affect the health of fish. Therefore, researching and developing a pollution-free, residue-free, and drug-resistant method to reduce the abundance of Pseudomonas is an important way to achieve antibiotic-free regulation of fish intestinal flora.

[0003] In recent years, more and more applications have been made to prevent and control animal and plant diseases by interfering with and blocking the quorum sensing communication system of pathogens, namely the quorum quenching (QQ) mechanism, through strategies such as signal molecule analogs, signal molecule degrading enzymes, and signal receptor activators / inhibitors. DSF (Diffusible signal factor) is a new type of quorum sensing signal molecule found and identified in Xanthomonas, Xyllela fastidiosa, Stenotrophomonas maltophilia, Burkholderia, Pseudomonas aeruginosa, and many marine bacteria in recent years. Studies have found that interfering with the DSF signal molecule of pathogens can affect the motility, biofilm, and extracellular enzyme activity of pathogenic cells, and significantly reduce the pathogenicity of pathogens. Therefore, the enzyme has the application value of developing and preparing enzyme preparations for in vitro degradation of DSF family signal molecules. The DSF quenching enzymes currently developed are mainly for plant disease prevention and control, but there are still few reports on disease prevention and control in aquatic animals. Therefore, there is an urgent need to develop a method to quickly and effectively degrade the quorum sensing signal molecule DSF, thereby significantly reducing the harm of DSF-mediated pathogenic bacteria to aquatic animals. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to quickly and effectively degrade the quorum sensing signal molecule DSF, thereby significantly reducing the harm of DSF-mediated pathogenic bacteria to aquatic animals and achieving antibiotic-free regulation of fish intestinal flora.

[0005] In order to solve the above technical problems, the present invention first provides a protein.

[0006] The protein provided by the present invention may be A1) or A2) or A3) or A4):

[0007] A1) a protein with an amino acid sequence as shown in SEQ ID No. 2;

[0008] A2) a protein whose amino acid sequence is positions 1 to 558 of SEQ ID No. 4;

[0009] A3) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein of A1) or A2) and having 80% or more identity with the protein of A1) or A2) and having the same function;

[0010] A4) A fusion protein obtained by connecting a protein tag to one end of A1) or A2).

[0011] The protein is FadDD1.

[0012] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0013] In the above protein, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0014] The gene encodes the protein, and the gene is selected from any one of the following:

[0015] 1) The coding sequence is the DNA molecule shown in SEQ ID No. 1;

[0016] 2) The coding sequence is a DNA molecule having positions 1 to 1674 of SEQ ID No. 3;

[0017] 3) A DNA molecule that has 80% or more identity with the DNA molecule defined in 1) or 2) and encodes the protein.

[0018] The protein is derived from Acinetobacter tandoii.

[0019] The biological material related to the above protein, which may be any one of the following B1) to B12):

[0020] B1) a nucleic acid molecule encoding the protein according to claim 1;

[0021] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0022] B3) a recombinant vector containing the nucleic acid molecule described in B1);

[0023] B4) a recombinant vector containing the expression cassette described in B2);

[0024] B5) a recombinant microorganism containing the nucleic acid molecule described in B1);

[0025] B6) a recombinant microorganism containing the expression cassette described in B2);

[0026] B7) a recombinant microorganism containing the recombinant vector described in B3);

[0027] B8) a recombinant microorganism containing the recombinant vector described in B4);

[0028] B9) a transgenic animal cell line containing the nucleic acid molecule described in B1);

[0029] B10) a transgenic animal cell line containing the expression cassette described in B2);

[0030] B11) a transgenic animal cell line containing the recombinant vector described in B3);

[0031] B12) A transgenic animal cell line containing the recombinant vector described in B4).

[0032] The present invention also provides a method for preparing the above protein, which comprises the step of expressing the coding gene of the protein in an organism to obtain the protein.

[0033] In the above method, the step of expressing the protein encoding gene in an organism comprises introducing the protein encoding gene into a recipient microorganism to obtain a recombinant microorganism expressing the protein, and culturing the recombinant microorganism to express the protein.

[0034] In the above method, the protein encoding gene may be the gene shown in 1) or 2) or 3) below:

[0035] 1) The coding sequence is the DNA molecule shown in SEQ ID No. 1;

[0036] 2) The coding sequence is a DNA molecule of No. 1-1674 of SEQ ID No. 3;

[0037] 3) A DNA molecule that has 80% or more identity with the DNA molecule defined in 1) or 2) and encodes the protein.

[0038] The gene encoding the protein is the FadDD1 gene.

[0039] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0040] A person skilled in the art can easily mutate the nucleotide sequence encoding the protein FadDD1 of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the protein FadDD1 isolated by the present invention are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein FadDD1 and have the function of the protein FadDD1.

[0041] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0042] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0043] Herein, the 80% or more identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The present invention also provides a biocontrol agent for controlling diseases mediated by DSF, the biocontrol agent containing the above protein.

[0044] The present invention also provides the use of the above recombinant protein, the above biological material or the method in any of the following:

[0045] 1) Application in the preparation of drugs for improving the disease resistance of aquatic animals,

[0046] 2) Application in the preparation of products for resisting diseases in aquatic animals,

[0047] 3) Application in the preparation of products for degrading quorum sensing signal molecule DSF or / and DSF analogs.

[0048] In the above application, the disease is a disease caused by pathogenic bacteria mediated by the quorum sensing signal molecule DSF.

[0049] The present invention provides a DSF degrading enzyme encoding gene FadDD1 and its application. The present invention cloned a new gene responsible for fatty acid degradation-DSF degrading enzyme encoding gene FadDD1 from Acinetobacter tandoii DD15. After heterologous expression of the encoding gene FadDD1 in Escherichia coli, the host zebrafish can significantly improve the disease resistance to pathogenic bacteria mediated by the QS signal molecule DSF.

[0050] Collection Instructions

[0051] Bacterial species: Acinetobacter tansoni

[0052] Latin name: Acinetobacter tandoii

[0053] Strain ID: DD15

[0054] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0055] Abbreviation of depository institution: CGMCC

[0056] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0057] Date of deposit: June 9, 2022

[0058] CGMCC Registration Number: CGMCC No.25032 BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 The SDS-PAGE analysis results of FadDD1 protein. 1 is the whole cell protein after induction of recombinant bacteria; 2 is the supernatant protein after the recombinant bacteria were broken; 3 is the purified FadDD1 protein, with a molecular weight of about 60 kDa (close to the predicted molecular weight); M: protein marker.

[0060] Figure 2 The results of the effect of quenching enzyme FadDD1 on the growth and biofilm formation of Shigella-like bacteria are shown in Figure 1. A is the growth result, and B is the biofilm result.

[0061] Figure 3 The results of laser confocal microscopy observation of the effect of quenching enzyme FadDD1 on the growth and biofilm formation of Shigella-like bacteria. A is the control group (PBS), and B is the treatment group with FadDD1 added at a final concentration of 5 μg / mL.

[0062] Figure 4 This is a graph showing the effect of the quenching enzyme FadDD1 on the gene expression of the quorum sensing system of Shigella-like bacteria.

[0063] Figure 5 This is a graph showing the effect of the quenching enzyme FadDD1 on the gene expression of Shigella-like virulence factors.

[0064] Figure 6 This is a graph showing the effect of immersion quenching enzyme FadDD1 on zebrafish's resistance to Shigella-like bacteria infection. DETAILED DESCRIPTION

[0065] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0066] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0067] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0068] The strain DD15 in the embodiment of the present invention has been deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on June 9, 2022, with the registration number of the collection center: CGMCC No. 25032, and the classification name is Acinetobacter tandoii. The deposit address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101.

[0069] The Shigella-like Pleistomonas CB5 in the embodiment of the present invention has been recorded in Wang A, Zhang Z, Ding Q, et al. Intestinal Cetobacterium and acetate modify glucose homeostasis via parasympathetic activation in zebrafish [J]. Gut Microbes, 2021, 13(1): 1-15. The public can obtain the biological material from the Feed Research Institute of the Chinese Academy of Agricultural Sciences. The biological material is only used to repeat the experiments of the present invention and cannot be used for other purposes.

[0070] The sequence table involved in the following examples is shown in Table 1.

[0071] Table 1. Sequences involved in the present invention

[0072]

[0073]

[0074]

[0075] Example 1. Acquisition of FadDD1 target fragment

[0076] Through the whole genome sequencing analysis results of Acinetobacter tansoni DD15, genes related to DSF degradation were found in the genome information of DD15. These genes were compared with the rpfB gene by BLAST, among which the gene FadDD1 related to fatty acid degradation had 53% homology with the rpfB sequence. The FadDD1 gene and its sequence were determined by analysis. The sequence of the FadDD1 gene is shown in SEQ ID No.1 in the sequence list, with a total length of 1677bp and a GC% content of 41%. The protein size encoded by it is 61.7kDa, and the amino acid sequence is shown in SEQ ID No.2 in the sequence list.

[0077] Example 2. Expression and purification of FadDD1

[0078] 1. Construction of recombinant E. coli BL21 / pET-28a-FadDD1

[0079] Using the genome of Acinetobacter tankii DD15 as a template, primers were designed for PCR amplification, FadDD1-F: AACTTTAAGAAGGAGATATA CCATGaaaagatttggttcgctgaatacc; FadDD1-R: GATCTCAGTGGTGGTGGTGGTGGTGGTGtgcgctcttacgcaagtctttacgt. Then the vector pET-28a(+) was linearized using the NcoI and XhoI recognition sites, and the amplified DNA fragment of FadDD1 was connected to the expression vector pET-28a(+) by homologous recombination to obtain the recombinant plasmid pET-28a-FadDD1. The recombinant plasmid was transformed into Escherichia coli BL21 by heat shock transformation to obtain the recombinant bacteria E.coliBL21 / pET-28a-FadDD1.

[0080] The FadDD1 gene (DNA molecule whose nucleotide sequence is SEQ ID No. 3, DNA molecule encoding the protein whose amino acid sequence is SEQ ID No. 4) was constructed into the NcoI and XhoI recognition sites of the pET-28a(+) vector (Shanghai Biotech Co., Ltd.) to obtain a recombinant expression vector of the FadDD1 gene, named pET-28a-Fad DD1.

[0081] pET-28a-FadDD1 is a recombinant vector obtained by replacing the fragment between the restriction endonuclease NcoI recognition site and the restriction endonuclease XhoI recognition site of the pET-28a(+) vector with the FadDD1 gene having the nucleotide sequence of positions 1-1674 of SEQ ID No.1, and keeping the other nucleotide sequences on the pET-28a(+) vector unchanged. pET-28a-FadDD1 expresses a recombinant protein having the amino acid sequence of SEQ ID No.4.

[0082] 2. Expression of FadDD1 recombinant protein

[0083] Preparation of recombinant bacterial cell culture medium: Inoculate the recombinant E. coli BL21 / pET-28a-FadDD1 into 20 mL LB culture medium (containing 50 μg / mL kanamycin) and culture at 37°C with shaking overnight to obtain overnight culture medium. Take 500 μL of overnight culture medium and inoculate it into 50 mL LB culture medium (containing 50 μg / mL kanamycin) and culture at 37°C with shaking for about 3 h (OD 600nmThe cell culture medium was centrifuged at 12,000 rpm for 5 min (centrifugal radius 6 cm) to collect the cell precipitate. The cell precipitate was resuspended in 0.1 mol / L PBS buffer (pH 8.0), ultrasonically disrupted, and centrifuged at 4°C, 12,000 rpm for 10 min (centrifugal radius 6 cm) to collect the supernatant.

[0084] 3. Purification of FadDD1 recombinant protein

[0085] Add 1 mL of activated Ni-NTA Agarose (QIAGEN, Cat. NO. 30210) washed with rinsing buffer (20 mM Tris-Cl, 150 mM NaCl, 20 mM imidazole, pH = 8.0) to the supernatant in step 2, and bind at 4°C for 2 h. Place the column with the filter at 4°C and balance it with rinsing buffer for 3 column volumes, add the supernatant and the beads mixture, and then rinse the beads bound with proteins with 2 column volumes of rinsing buffer. Finally, elute the protein with elution buffer (20 mM Tris-Cl, 200 mM NaCl, 250 mM imidazole, pH = 8.0), and collect the eluate. 0.01 M PBS (pH = 7.4) was used as the dialysate, and the collected eluate was dialyzed in the dialysate at 4°C overnight (about 24 hours), and then concentrated using PEG8000. The collected concentrate was the recombinant protein FadDD1, also known as the quenching enzyme FadDD1.

[0086] The purified protein was analyzed by 8% polyacrylamide gel electrophoresis. The results showed that the size of the purified recombinant protein FadDD1 was approximately 60 kDa ( Figure 1 ), the size of which is consistent with that predicted by the amino acid sequence.

[0087] Example 3: Effect of the recombinant protein FadDD1 on the biofilm of Pleistomonas shigellae

[0088] 1. Crystal violet staining to observe the effect of FadDD1 protein on biofilm formation of Shigella CB5

[0089] 1) Construction of Shigella-like biofilm model

[0090] The Shigella-like bacteria CB5 (screened from zebrafish intestinal contents) stored at -80°C were taken out and streaked on LB solid plates. They were cultured at 37°C for 24 h. A single colony was picked up with an inoculation loop the next day and inoculated into LB liquid culture medium. The culture was cultured at 37°C and 180 rpm overnight. The OD 600Centrifuge the cultured bacterial suspension at 5000rpm and 4℃ for 10min, discard the supernatant, and then resuspend the centrifuged CB5 bacteria in fresh LB liquid medium, centrifuge at 5000rpm and 4℃ for 10min, discard the supernatant, and repeat 3 times. Dilute the CB5 bacterial suspension with fresh DMEM medium to OD 600 =0.05(bacterial OD 600 =0.5, equivalent to 1×10 8 CFU / mL).

[0091] Add 100 μL of FadDD1 of different concentrations to a 24-well polypropylene plate, set up 5 concentration gradients (1 μg / mL, 2 μg / mL, 5 μg / mL, 10 μg / mL, 20 μg / mL), set up 3 replicate wells, add 100 μL PBS buffer to the control group, add 900 μL of the mixed bacterial solution to each well, and incubate at 37°C for 24 hours. Determine OD 600 Values ​​were used to record the effect of FadDD1 on the growth of Shigella-like bacteria.

[0092] 2) Crystal violet staining

[0093] The supernatant was aspirated and discarded, and then washed with sterile distilled water for 3 times. Crystal violet was diluted with sterile distilled water to a 1% concentration staining solution. 1000 μL of 0.1% crystal violet dye was added to each well, and dyed for 20 minutes. The dye solution was aspirated, and washed with sterile distilled water for 3 times, and air-dried naturally. 1000 μL of 95% ethanol was added to each well, and decolorized for 20 minutes to fully dissolve the crystal violet. The absorbance value of each well was read at a wavelength of 595 nm to obtain the quantitative results of the biofilm.

[0094] Effects of recombinant FadDD1 protein on the growth of Pseudomonas shigelloides Figure 2 As shown, by detecting OD 600 It was found that adding different concentrations of recombinant protein FadDD1 to the culture medium of Shigella-like Pleistomonas CB5 did not affect the growth of Shigella-like Pleistomonas after 24 hours of culture, further indicating that the recombinant protein FadDD1 had no obvious inhibitory effect on the growth of Shigella-like Pleistomonas ( Figure 2 At the same time, as the amount of recombinant protein FadDD1 added increased, the inhibitory ability against the biofilm of Shigella-like bacteria increased ( Figure 2 (middle B).

[0095] 2. Observation of the changes in the number of biofilms of Shigella CB5 treated with recombinant protein FadDD1 using confocal laser scanning microscopy

[0096] The specific steps are as follows:

[0097] (1) Preparation of PVC glass slides: The culture carrier of the biofilm is a 25 mm diameter round hole glass slide, which is rinsed with sterile distilled water and then immersed in a 75% ethanol solution. After natural air drying, it is placed under ultraviolet light for sterilization and then used for later use.

[0098] (2) Biofilm culture of Shigella-like Pleistomonas CB5: Pick a single colony of Shigella-like Pleistomonas CB5 and place it in 50 mL of LB liquid culture medium. Then, culture the culture medium at 37°C and 180 rpm overnight. Take the bacterial solution and measure the OD600 value. Centrifuge the culture at 5000 rpm at 4°C for 10 min, discard the supernatant, resuspend the culture with fresh LB liquid culture medium, centrifuge the culture at 5000 rpm at 4°C for 10 min, discard the supernatant, and resuspend the centrifuged bacteria with fresh LB liquid culture medium. Repeat 3 times. Dilute the bacteria to OD600 with DMEM medium. 600 =0.05 (when bacterial OD 600 =0.5, equivalent to 1×10 8 CFU / mL) for later use.

[0099] Place one glass slide in each well of a 6-well plate, add 4.5 mL of the prepared bacterial solution and 500 μL of the quenching enzyme FadDD1 (final concentration of 5 μg / mL), and place in a 37°C incubator for 24 h.

[0100] (3) Fluorescence staining: After the culture is completed, remove the supernatant and gently wash three times with 5 mL of sterile water to wash away the floating bacteria. Add 3 mL of paraformaldehyde (4%) to the 6-well plate, fix at room temperature for 15 minutes, remove the supernatant, and blow dry the surface liquid. Then add 2 mL of AO / EB stain solution to the surface of the coverslip, incubate in a dark room for 15 minutes, rinse twice with sterile distilled water, and blow dry the surface liquid. Seal with 10 μL of neutral gum, observe under a laser confocal microscope, and collect images (AO makes normal cells show green fluorescence, and EB makes cells with damaged cell membranes show orange-red fluorescence).

[0101] exist Figure 3 The control group not treated with the quenching enzyme FadDD1 recombinant protein ( Figure 3 A), a large area of ​​green fluorescence can be seen under the microscope, indicating that there is basically no inhibitory effect in the biofilm. After intervention with the quenching enzyme FadDD1 recombinant protein at a concentration of 5 μg / mL for 24 hours, it can be clearly seen under the microscope that the green fluorescence is significantly reduced ( Figure 3 In summary, the recombinant protein FadDD1 has a significant inhibitory effect on the biofilm formation of Shigella-like bacteria.

[0102] Example 4: Effects of FadDD1 recombinant protein on the quorum sensing system and virulence of Pleistomonas shigellae

[0103] 1. Total RNA Extraction from Pleistomonas shigellae CB5

[0104] First, activate the Shigella-like Pleistomonas CB5 overnight, then inoculate it into 150mL LB medium at a ratio of 1%, mix it and dispense it into 30 bottles (5mL per bottle). Then add 500μL of FadDD1 recombinant protein (FadDD1 final concentration is 1μg / mL, 2μg / mL, 5μg / mL, 10μg / mL) and 500μL of PBS (control group CK) to each bottle. Put it in a 37℃ shaker for culture. After 12h, take 3mL of the cultured sample from each group and centrifuge it at 12000rpm for 10min to collect the bacteria. Then use the TRIzol method to extract the RNA of the bacteria, and each treatment is repeated 6 times. Place the sample in an RNase-free centrifuge tube, add 1mL Trizol, homogenize the sample using a tissue homogenizer, and place it at room temperature for 3min to fully lyse the cells. Add 200μL of chloroform, shake for 15s, stand at room temperature for 3min, and then centrifuge at 12000rpm for 15min. Carefully pipette 300 μL of supernatant into a new centrifuge tube, add 200 μL of anhydrous ethanol, mix gently, transfer to RNase-free adsorption column CR3, centrifuge at 12000 rpm for 1 min. Wash twice with 600 μL of rinse solution RW, and empty the column at 12000 rpm for 2 min. Add 50 μL of DEPC H 2 O to dissolve total RNA.

[0105] 2. Detection of Quorum Sensing System and Virulence Gene Expression of Shigella-like Pleistomonas by Fluorescence Quantitative PCR

[0106] After determining the RNA concentration, genomic DNA was removed and reverse transcribed at 1 μg. After obtaining cDNA, it was diluted 5 times for fluorescence quantitative PCR to detect the expression of the quorum sensing system and virulence genes of Shigella-like bacteria. The primers are shown in Table 2.

[0107] Table 2. Primer sequences used for fluorescence quantitative PCR analysis

[0108]

[0109] The results of the quorum sensing system of Pleistomonas shigellae are shown in Figure 4 Compared with the control group, the addition of different concentrations of FadDD1 significantly downregulated the expression of the quorum sensing system of Shigella-like Pleistomonas, including the DSF synthase rpfF and the receptor proteins rpfC and rpfG. This indicates that the addition of the quenching enzyme FadDD1 to Shigella-like Pleistomonas can inhibit the gene expression of its quorum sensing system.

[0110] The results of virulence factors of Shigella-like bacteria are shown in Figure 5Compared with the control group, the addition of different concentrations of FadDD1 significantly downregulated the expression of virulence factors of Shigella-like Pleistomonas, including cytolytic enterotoxins astA, astD and astE, cytotoxic enterotoxin P actP, heat-sensitive serine protease aphA, hemolysin Hemolysin, DNA enzyme activity tatD, biofilm pgaC, histamine histidine and exopolysaccharide cpsD, etc. This indicates that the addition of the quenching enzyme FadDD1 to Shigella-like Pleistomonas can inhibit the gene expression of its virulence factors.

[0111] Example 5: Effect of FadDD1 protein on zebrafish infection with Pleistomonas shigella

[0112] The experiment was repeated three times. In each repetition, newly hatched healthy zebrafish fry (5 days after hatching) were cultured in a culture bottle filled with water. Each culture bottle contained 5 mL of culture water (1000 mL of water, 1.5 mL of 40 g / L sea salt mother solution, sterilized at 121 ° C for 20 min) and 10 zebrafish. The 6 culture bottles were randomly divided into 2 treatment groups for the following parallel experiments, with 3 culture bottles in each treatment group: 1) control group; 2) treatment group with 5 μg / mL of quenching enzyme FadDD1.

[0113] The quenching enzyme FadDD1 treatment group (FadDD1-5μg / mL) was added with 5μg / mL of quenching enzyme FadDD1 solution obtained in Example 2 (wherein the solute is PBS buffer, the concentration of PBS buffer is 0.01M, pH=7.4) to each bottle on the 5th day of culture, so that the quenching enzyme FadDD1 content in the culture system is 5μg / mL. After another 72h of culture, the culture system was replaced with aquaculture water and challenged with Shigella-like Pleistomonas CB5, and the survival rate 48h after challenge was calculated. The addition amount of Shigella-like Pleistomonas CB5 was 1x10 7 CFU / mL.

[0114] Control group (Control): On the 5th day of culture, a PBS buffer solution equal to the volume of the quenching enzyme in the treatment group was added to each bottle, and the rest of the treatment was the same as that of the treatment group.

[0115] The attack results are as follows Figure 6 As shown, after immersion for 72 hours, 5 μg / mL of the quenching enzyme FadDD1 significantly increased the survival rate of zebrafish to 73.3%, an increase of 33.3% compared with the control group.

[0116] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A biocontrol agent for improving the resistance of aquatic animals to diseases caused by infection with Shigella-like bacteria, characterized in that: The biocontrol agent contains a protein with an amino acid sequence as shown in SEQ ID No. 2 or SEQ ID No.

4.

2. Use of the recombinant protein having an amino acid sequence as shown in SEQ ID No. 2 or SEQ ID No. 4 and the biological material thereof in any of the following: 1) Application in the preparation of drugs for improving the disease resistance of aquatic animals; 2) Application in the preparation of products for resisting diseases in aquatic animals; The disease is caused by Pleistomonas shigelloides; The biological material is any one of the following: B1) a nucleic acid molecule encoding the protein; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1); B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) A recombinant microorganism containing the recombinant vector described in B4).

Images