Aspergillus oryzae and its use in flavoring soy sauce

By screening and applying the Aspergillus oryzae strain WJM008, which produces high levels of non-starch polysaccharide enzymes, the problem of low raw material utilization in soy sauce brewing was solved, resulting in improved soy sauce flavor and reduced production costs.

CN116064251BActive Publication Date: 2026-05-08JIANGSU HENGSHUN VINEGAR IND +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310175227.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-28
Publication Date
2026-05-08
Estimated Expiration
2043-02-28

AI Technical Summary

Technical Problem

The utilization rate of raw materials in current soy sauce brewing is not high. In particular, non-starch polysaccharides are difficult to hydrolyze with enzymes, which makes it difficult to release nutrients and affects the flavor of soy sauce and the full utilization of raw materials.

Method used

The Aspergillus oryzae strain WJM008, which produces high levels of non-starch polysaccharide enzymes, was screened and applied to the soy sauce brewing process. Combined with specific koji-making and fermentation processes, including steaming, koji-making, and fermentation, it promotes the hydrolysis of non-starch polysaccharides and the release of nutrients.

Benefits of technology

It improves the utilization rate of soy sauce raw materials, enhances the aroma of soy sauce, reduces production costs, and improves the flavor quality of soy sauce.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064251B_ABST
    Figure CN116064251B_ABST
Patent Text Reader

Abstract

The application discloses an Aspergillus oryzae strain WJM008, which is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO:M 20221829, and the preservation date is November 28, 2022. The application also discloses an application of the Aspergillus oryzae strain WJM008 in flavor soy sauce brewing. The strain has a strong ability of producing non-starch polysaccharase, can well hydrolyze non-starch polysaccharide of raw materials, realizes efficient utilization of raw materials for soy sauce brewing, and provides sufficient carbon source for yeast alcohol fermentation due to that sugar in the raw materials is fully released, so that the original oil has rich and mellow alcohol aroma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of soy sauce brewing, and more particularly to a strain of Aspergillus oryzae and its application in soy sauce brewing. Background Technology

[0002] Soy sauce is a traditional condiment, a liquid seasoning brewed from soybeans, wheat, and other grains. It has a unique savory aroma and delicious flavor, and can enhance appetite. However, as a fermented condiment, it is often found that its raw material utilization rate is not high, resulting in resource waste.

[0003] Due to the properties of its raw materials, protein and starch are the main sources of nutrition in soy sauce. For a long time, protease and amylase have been important concerns.

[0004] Because the raw materials contain wheat-like grains, whose cell walls are mainly composed of arabinoxylan, β-glucan, and cellulose, amylase cannot hydrolyze these non-starch polysaccharides. Therefore, the nutrients in the cell walls are difficult to release. For example, cellulase can break down the fiber-rich cell walls, releasing and utilizing the proteins, starches, and other nutrients contained within them. At the same time, it can also degrade the fiber into usable reducing sugars. Therefore, through the combined action of various non-starch polysaccharide enzymes, proteases, and amylases, the nutrients in the raw materials can be released more effectively, allowing the fermentation raw materials to be fully utilized. In addition, the hydrolysis of more reducing sugars also benefits the alcoholic fermentation of yeast, making the resulting crude oil more mellow and fragrant.

[0005] As a fermentation agent, screening for strains of Aspergillus oryzae that produce high levels of non-starch polysaccharide enzymes is the most convenient way to solve the above problems. Summary of the Invention

[0006] To solve the above-mentioned technical problems, the first objective of this invention is to provide a strain of Aspergillus oryzae that produces spores quickly and produces a high amount of non-starch polysaccharide enzymes. The second objective of this invention is to provide a method for brewing soy sauce with high raw material utilization and rich aroma of crude oil.

[0007] Specifically, the first aspect of the present invention provides a *Aspergillus oryzae* strain named WJM008, which is deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, with accession number CCTCC NO: M20221829 and deposit date of November 28, 2022.

[0008] A second aspect of the present invention provides a microbial agent comprising Aspergillus oryzae as described in the first aspect of the present invention.

[0009] The third aspect of this invention provides the application of Aspergillus oryzae described in the first aspect of this invention and the microbial inoculants described in the second aspect of this invention in the brewing of flavored soy sauce.

[0010] The fourth aspect of this invention provides a method for brewing flavored soy sauce, comprising the following steps: 1) raw material screening; 2) steaming; 3) koji making; 4) fermentation; 5) filtering the soy sauce mash to obtain the original juice.

[0011] In some embodiments, the raw materials are selected from soybeans, wheat, black beans, and soybean meal.

[0012] In some embodiments, the koji-making process uses Aspergillus oryzae as described in the first aspect of the present invention or the microbial agent as described in the second aspect of the present invention.

[0013] In some embodiments, the steaming material includes dry steaming soybeans, black beans, or soybean meal at about 110°C for 10-15 minutes, then adding 1 part water and steaming at 120°C for 20 minutes, and after steaming and cooking, slightly cooling and mixing with 0.8 parts roasted wheat.

[0014] In some embodiments, the preparation includes: waiting for the material temperature to drop to about 36°C, inoculating with 3‰-5‰ Aspergillus oryzae WJM008, controlling the room temperature at 28°C-30°C and the humidity above 90% until the material matures, and intermittently circulating air to supply oxygen and control the material temperature at 32°C-36°C to promote the rapid germination of Aspergillus oryzae. When the material temperature reaches about 36°C, the material clumps together and is covered with mycelium, the first turning can be performed using a turning machine. Circulating air is continued, and the material temperature is controlled at 32°C-36°C for further cultivation. When the material clumps together and the mycelium is abundant, the second turning is performed, and circulating air is continued for cultivation, controlling the material temperature at 32°C-36°C. When yellow-green spores are covered on the material and the material is loose and smooth, it is considered mature.

[0015] In some embodiments, the fermentation includes: brine volume of 1.8-2.2 times, with a final brine concentration of approximately 11°Bé; low-temperature fermentation: temperature ≤15℃, fermentation time 20 days; heat-insulated fermentation: temperature controlled at approximately 30℃, fermentation time 40 days; natural fermentation: continued post-ripening at room temperature, continuing fermentation for 90 days.

[0016] The fifth aspect of the present invention provides a soy sauce comprising Aspergillus oryzae as described in the first aspect of the present invention or prepared by the method described in the fourth aspect of the present invention.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] (1) The Aspergillus oryzae strain WJM008 screened in this invention has a strong ability to produce non-starch polysaccharide enzymes, which can effectively hydrolyze non-starch polysaccharides in raw materials, thus realizing the efficient utilization of raw materials for soy sauce brewing.

[0019] (2) The soy sauce brewing process of the present invention is simple, easy to implement, and has low production cost;

[0020] (3) Because the sugar in the raw materials is fully released, it provides a sufficient carbon source for yeast alcoholic fermentation, which can make the crude oil mellow and rich. Attached Figure Description

[0021] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0022] Figure 1 Colony morphology diagram of strain Aspergillus oryzae (WJM008). Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] Example 1: Isolation and Identification of Aspergillus oryzae WJM008

[0025] (1) Strain isolation

[0026] Take 2g of soy sauce koji from different sources and add it to 15mL of physiological saline. Vortex and mix well. Take 200μL of the diluted solution and spread it evenly on a PDA plate. Incubate at 25℃. After one week, pick the mold colonies and perform streak purification. Based on morphological characteristics, identify 5 strains for the test.

[0027] (2) Determination of enzyme production performance of strains

[0028] Five Aspergillus oryzae strains from the laboratory were used as test strains. After culturing in PDA medium at 25°C for one week, an appropriate amount of spores were picked and suspended in physiological saline, adjusting the spore concentration to 1×10⁻⁶. 8 Inoculate the basal enzyme-producing medium with a 2% inoculum of 100 rpm at 30°C for 5 days. Centrifuge at 8000 rpm for 6 minutes, discard the precipitate, and use the supernatant as the enzyme solution for later use.

[0029] Take the above enzyme solution, dilute it 10 times, and add 2 mL to each test tube. Then add 2 mL each of preheated 5 mg / mL xylan solution, 5 mg / mL β-glucan solution, and 5 mg / mL sodium carboxymethyl cellulose solution. Mix well and place in a 37°C water bath for 30 min. Add 5 mL of DNS solution and boil in a water bath for 5 min to develop color. After cooling, add water to 25 mL. Measure the absorbance of the above reaction solution at 540 nm. Enzyme activity is defined as: 1 μmol of reducing sugar released per minute from a 5 mg / mL polysaccharide solution is defined as one unit of enzyme activity (U). Calculations showed that one strain of *Aspergillus oryzae* exhibited the strongest enzyme production capacity on the basic enzyme-producing medium, with xylanase, β-glucanase, and cellulase activities of 322 U / mL, 200 U / mL, and 209 U / mL, respectively.

[0030] (3) Strain identification

[0031] The strain with high enzyme activity was compared and analyzed in the NCBI database using its 16S rDNA sequence. Based on the physiological and biochemical characteristics, the strain of the present invention was named Aspergillus oryzae WMJ008, and its 16S rDNA sequence is shown in SEQ ID NO: 1.

[0032] SEQ ID NO: 1:

[0033] CTTCCGTAGGGGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCG CCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCG TGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGG CACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGA

[0034] The Aspergillus oryzae of this invention grows well on PDA medium, exhibiting rapid sporulation. The sporulation is initially white, later turning yellowish-green. After inoculation into a basic enzyme-producing medium, the activities of xylanase, β-glucanase, and cellulase were measured to be 322 U / mL, 200 U / mL, and 209 U / mL, respectively.

[0035] (4) Strain preservation

[0036] Aspergillus oryzae WJM008 was deposited on November 28, 2022, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20221829.

[0037] Example 2: Soy sauce brewing using soybeans and wheat as raw materials

[0038] Experimental group:

[0039] Raw material selection: High-quality soybeans and wheat are used as raw materials;

[0040] Steaming ingredients: Dry steam soybeans at 110℃ for 10 minutes, then add 1 part water (80℃ hot water) and steam at 120℃ for 20 minutes. After steaming, let it cool slightly and mix it with 0.8 parts roasted wheat.

[0041] Koji making: When the material temperature drops to about 36℃, inoculate with 3‰ of the Aspergillus oryzae mentioned above, control the room temperature at 28℃ and the humidity above 90% until the koji matures. Intermittently circulate air to supply oxygen and control the material temperature at 32℃ to promote the rapid germination of Aspergillus oryzae. After 18 hours of cultivation, when the material temperature reaches about 36℃, the koji clumps together and is covered with mycelium, the first turning can be performed using a turning machine. Continue to circulate air and control the material temperature at 32℃. Cultivate for another 8 hours until the koji clumps together and the mycelium is abundant, then perform the second turning. Continue to circulate air and control the material temperature at 32℃. When the koji clumps are covered with yellow-green spores and the koji clumps are loose and smooth, it is considered mature.

[0042] Fermentation: The brine volume is 1.8 times, and the final brine concentration is around 11°Bé. Low-temperature fermentation: Temperature ≤15℃, fermentation time 20 days; Insulated fermentation: Temperature controlled at around 30℃, fermentation time 40 days; Natural fermentation: Continued ripening at room temperature, fermentation continues for 90 days;

[0043] Soy sauce base: The soy sauce mash is filtered to obtain the base.

[0044] Control group:

[0045] The procedure was followed as in the experimental group, and the strain was Hu Niang 3.042.

[0046] The activities of xylanase, β-glucanase, and cellulase in the fermented product, as well as the ethanol content in the crude oil, were tested in the above groups respectively. The results are listed in the table below:

[0047] Table 1 Results of fermentation enzyme activity and crude oil ethanol content

[0048]

[0049] As can be seen from the table above, compared with the control group, the activity of xylanase, β-glucanase and cellulase in the koji of the experimental group was significantly improved, thereby promoting the further generation of reducing sugars and thus significantly increasing the ethanol content.

[0050] Example 3: Soy sauce brewing using black beans and wheat as raw materials

[0051] Experimental group:

[0052] Raw material selection: High-quality black beans and wheat are used as raw materials;

[0053] Steaming ingredients: Dry steam black beans at 110℃ for 15 minutes, then add 1 part water (70℃ hot water) and steam at 120℃ for 20 minutes. After steaming, let it cool slightly and mix it with 0.8 parts roasted wheat.

[0054] Koji making: When the material temperature drops to about 36℃, inoculate with 5‰ of the Aspergillus oryzae mentioned above. Control the room temperature to 30℃ and the humidity to above 90% until the koji matures. Intermittently circulate air to supply oxygen and control the material temperature at 36℃ to promote the rapid germination of Aspergillus oryzae. After 16 hours of cultivation, when the material temperature reaches about 36℃, the koji clumps together and is covered with mycelium, the first turning can be performed using a turning machine. Continue to circulate air and control the material temperature at 35℃. Cultivate for another 6 hours until the koji clumps together and the mycelium is abundant, then perform the second turning. Continue to circulate air and control the material temperature at 32℃. When the koji clumps are covered with yellow-green spores and the koji clumps are loose and smooth, it is considered mature.

[0055] Fermentation: The brine volume is 2.2 times, and the final brine concentration is around 11°Bé. Low-temperature fermentation: Temperature ≤15℃, fermentation time 20 days; Insulated fermentation: Temperature controlled at around 30℃, fermentation time 40 days; Natural fermentation: Continued ripening at room temperature, fermentation for another 90 days;

[0056] Soy sauce base: The soy sauce mash is filtered to obtain the base.

[0057] Control group: The procedure was followed according to the experimental group, and the strain was Hu Niang 3.042.

[0058] The activities of xylanase, β-glucanase, and cellulase in the fermented product, as well as the ethanol content in the crude oil, were tested in the above groups respectively. The results are listed in the table below:

[0059] Table 2 Results of fermentation enzyme activity and crude oil ethanol content

[0060]

[0061] As can be seen from the table above, compared with the control group, the activity of xylanase, β-glucanase and cellulase in the koji of the experimental group was significantly improved, thereby promoting the further generation of reducing sugars and thus significantly increasing the ethanol content.

[0062] Example 4: Soy sauce brewing using soybean meal and wheat as raw materials

[0063] Experimental group:

[0064] Raw material selection: Soybean meal and wheat are used as raw materials;

[0065] Steaming: Dry steam soybean meal at 110℃ for 12 minutes, then add 1 part water (75℃ hot water) and steam at 120℃ for 20 minutes. After steaming, cool slightly and mix with 0.8 parts roasted wheat.

[0066] Koji making: When the material temperature drops to about 36℃, inoculate with 4‰ of the Aspergillus oryzae mentioned above. Control the room temperature to 30℃ and the humidity to above 90% until the koji matures. Intermittently circulate air to supply oxygen and control the material temperature at 35℃ to promote the rapid germination of Aspergillus oryzae. After 16 hours of cultivation, when the material temperature reaches about 36℃, the koji clumps together and is covered with mycelium, and the first turning can be performed using a turning machine. Continue to circulate air and control the material temperature at 34℃. Cultivate for another 7 hours until the koji clumps together and the mycelium is abundant, then perform the second turning. Continue to circulate air and control the material temperature at 30℃. When the koji clumps are covered with yellow-green spores and the koji clumps are loose and smooth, it is considered mature.

[0067] Fermentation: The brine volume is doubled, and the final brine concentration is around 11°Bé. Low-temperature fermentation: Temperature ≤15℃, fermentation time 20 days; Insulated fermentation: Temperature controlled at around 30℃, fermentation time 40 days; Natural fermentation: Continue post-ripening at room temperature, continue fermentation for 90 days;

[0068] Soy sauce base: The soy sauce mash is filtered to obtain the base.

[0069] Control group: The procedure was followed according to the experimental group, and the strain was Hu Niang 3.042.

[0070] The activities of xylanase, β-glucanase, and cellulase in the fermented product, as well as the ethanol content in the crude oil, were tested in the above groups respectively. The results are listed in the table below:

[0071] Table 3 Results of fermentation enzyme activity and crude oil ethanol content.

[0072]

[0073] As can be seen from the table above, compared with the control group, the activity of xylanase, β-glucanase and cellulase in the koji of the experimental group was significantly improved, thereby promoting the further generation of reducing sugars and thus significantly increasing the ethanol content.

[0074] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered illustrative and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the scope of the invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

[0075] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A type of Aspergillus oryzae ( Aspergillus oryzae ), characterized in that, The Aspergillus oryzae was named WJM008 and deposited at the China Center for Type Culture Collection (CCTCC), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC NO: M 20221829 and deposit date of November 28, 2022.

2. A microbial inoculant, characterized in that, The microbial agent comprises Aspergillus oryzae as described in claim 1.

3. The application of Aspergillus oryzae as described in claim 1 and the microbial agent as described in claim 2 in the brewing of flavored soy sauce.

4. A method for brewing a flavored soy sauce, characterized in that, Includes the following steps: 1) Raw material screening; 2) Steaming; 3) Koji making; 4) Fermentation; 5) Filtration of the mash to obtain the original juice; wherein, the koji making uses Aspergillus oryzae as described in claim 1 or the microbial agent as described in claim 2.

5. The brewing method according to claim 4, characterized in that, The raw materials are selected from soybeans, wheat, black beans, and soybean meal.

6. The method according to claim 4, characterized in that, The steaming material includes dry steaming soybeans, black beans, or soybean meal at 110℃ for 10-15 minutes, then adding 1 part water and steaming at 120℃ for 20 minutes. After steaming and cooking, the mixture is slightly cooled and then mixed with 0.8 parts roasted wheat.

7. The method according to claim 4, characterized in that, The koji-making process includes: waiting for the material temperature to drop to 36 ℃, inoculating with 3‰-5‰ Aspergillus oryzae WJM008, controlling the room temperature at 28 ℃-30 ℃ and humidity above 90% until the koji material matures, and intermittently circulating air to supply oxygen and control the material temperature at 32 ℃-36 ℃ to promote rapid germination of Aspergillus oryzae. When the material temperature reaches 36 ℃, the koji material clumps together and is covered with mycelium, and the first turning can be performed using a turning machine. Circulating air continues to be circulated, and the material temperature is controlled at 32 ℃-36 ℃ for further cultivation. When the koji material clumps together and the mycelium is abundant, the second turning is performed, and circulating air continues to be circulated, and the material temperature is controlled at 32 ℃-36 ℃. When the koji material is covered with yellow-green spores and is loose and smooth, it is considered mature.

8. The method according to claim 4, characterized in that, The fermentation process includes: 1.8-2.2 times the amount of brine, with a final brine concentration of 11°Bé; low-temperature fermentation: temperature ≤15℃, fermentation time 20 days; heat-insulated fermentation: temperature controlled at 30℃, fermentation time 40 days; natural fermentation: continued post-ripening at room temperature, fermentation for another 90 days.

9. A soy sauce, characterized in that, The soy sauce comprises Aspergillus oryzae as described in claim 1 or is prepared by the method described in any one of claims 4-8.

Citation Information

Patent Citations

  • Preparation of amylase-rich compound enzyme as well as strain and application of compound enzyme

    CN111549006A

  • Brewing technology of flavored soy sauce

    CN113892628A

  • Application of bacterial strain and enzyme in preparation of health-care soy sauce and preparation method of health-care soy sauce

    CN114606138A