A dye-free macroscopically identifiable nucleic acid culture detection counting method
By combining polyacrylamide hydrogel with loop-mediated isothermal amplification reaction, a dye-free, visually visible nucleic acid culture detection method has been achieved, solving the problem of dependence on complex instruments and fluorescent dyes in existing technologies and providing a rapid and accurate method for nucleic acid quantification.
Patent Information
- Application Number
- CN202211550972.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-05
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2042-12-05
AI Technical Summary
Existing nucleic acid culture detection methods require complex detection instruments and fluorescent dyes, leading to operational difficulties and false negative results, making it difficult to achieve quantitative analysis that is visible to the naked eye.
By employing polyacrylamide hydrogel combined with ring-mediated isothermal amplification reaction, magnesium pyrophosphate precipitation points can be identified under natural light through the formation of a hydrogel system, achieving dye-free, visually visualized quantitative detection.
It simplifies the testing process, reduces equipment requirements, and improves the accuracy and speed of testing, making it suitable for resource-scarce areas and rapid on-site testing.
Smart Images

Figure CN116064742B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of digital nucleic acid culture, and particularly relates to a dye-free naked-eye recognizable nucleic acid culture detection and counting method. BACKGROUND
[0002] Traditional plate culture method is regarded as the "gold standard" of microorganism culture and counting, and is widely used in quantitative detection, screening and isolation, and pure culture of microorganisms. Similarly, nucleic acid culture (amplification) method is widely used in clinical, environmental, agricultural and other fields, and plays an important role in the identification and genetic analysis of pathogen infection.
[0003] Real-time polymerase chain reaction (qPCR) and digital polymerase chain reaction (dPCR) have become the main methods for nucleic acid detection, but the former can only be used for relative quantification and needs a reference standard curve. The dPCR method divides the sample into countless micro-reaction systems by a certain technology, each system contains no more than one template molecule, and the fluorescence signal of the micro-reaction system with or without template molecules is counted after amplification, which revolutionarily realizes the absolute quantification of the sample.
[0004] However, the current dPCR method often needs precise microfluidic equipment, and the operations of droplet generation, amplification and result reading are relatively complex. More importantly, it is still challenging to visually analyze the culture results by naked eye. Specifically, the current technology usually uses fluorescent indicators to label the target to achieve counting, so additional dyes and precise optical equipment are needed. However, these fluorescent dyes also inhibit the amplification efficiency, resulting in false negative results.
[0005] In recent years, many label-free detection methods have emerged for the realization of simple and efficient digital amplification technology. For example, digital LAMP analysis based on elemental labeling ICP-MS technology has been used to realize the absolute quantification of nucleic acids, but the instrument requirement of this analysis is extremely high, and the experiment is difficult, which limits its application in remote areas. In addition, a by-product precipitate (magnesium pyrophosphate) generated in the nucleic acid amplification reaction is regarded as a marker for nucleic acid reaction and nucleic acid quantification. By real-time monitoring of the turbidity of the reaction system during the reaction process, the qualitative and rough quantitative of the template nucleic acid can be realized. By observing whether the digital microdroplet contains the by-product precipitate, it can also be judged whether it is a positive droplet. However, the precipitate produced by this method cannot be directly observed by the naked eye, and still needs microscopic magnification technology and complex experimental operation to realize accurate quantification. The milky turbidity of the reaction system mixture affects the clarity of the image; the ultra-short optical path of the microdroplet also hinders the accurate identification of the precipitate. Previous studies have shown that the speed of generating magnesium pyrophosphate precipitate in the aqueous solution reaction system is slow and tends to deposit and aggregate, making it difficult to directly observe the positive water phase droplet by the naked eye, which increases the difficulty of application of the dye-free nucleic acid quantification method that can be recognized by the naked eye. SUMMARY
[0006] The purpose of the present application is to provide a dye-free nucleic acid culture detection counting method that can be recognized by the naked eye, which can realize the on-site rapid detection of the naked eye recognition and quantification of the target nucleic acid without the aid of complex detection instruments.
[0007] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows:
[0008] A dye-free nucleic acid culture detection counting method, comprising the following steps:
[0009] (1) adding the sample to be tested into the loop-mediated isothermal amplification reaction system solution, and then adding the hydrogel monomer into the reaction system to initiate crosslinking to form a hydrogel system; the hydrogel monomer includes acrylamide (MA) and methylene bisacrylamide (BMA), and the loop-mediated isothermal amplification reaction system includes primers for specifically amplifying target nucleic acid molecules;
[0010] (2) placing the hydrogel system under isothermal conditions for heating to perform loop-mediated isothermal amplification reaction;
[0011] (3) after the amplification is completed, identifying and counting the magnesium pyrophosphate precipitate points formed in the hydrogel system, and calculating the concentration of the target nucleic acid molecules in the sample to be tested.
[0012] Specifically, the sample to be tested is a sample containing pathogenic bacteria or nucleic acid molecules, which can be food, fruits and vegetables, environmental wastewater, etc. The pathogenic bacteria can be foodborne pathogenic bacteria or environmental pathogenic bacteria.
[0013] When the target to be detected is microorganism, the sample can be pretreated, nucleic acid substance is extracted to prepare the sample to be detected, and then culture and visual quantitative detection are carried out. The reaction system can also be directly added to carry out culture and detection.
[0014] The present application designs the LAMP primer according to the target nucleic acid molecule.
[0015] In step (1), the PAM-LAMP reaction system mixture of the sample to be detected is prepared.
[0016] As a three-dimensional network structure composed of a large amount of water and a cross-linked polymer network, the PAM hydrogel has important characteristics such as hydrophilicity, biocompatibility, biodegradability and non-toxicity. The nanoscale porous characteristics are similar to the physical separation of the microfluidic chip, which means that the relative separation of nucleic acid can be realized without complex chip preparation and fluid control. At the same time, the PAM hydrogel has polar amide groups, which can easily adsorb the surface of solid particles by hydrogen bonding and form large particle flocs by bridging. Therefore, the hydrogel has excellent flocculation effect on the magnesium pyrophosphate precipitate generated in the LAMP reaction process. The present application uses the nanoscale pore size of the PAM hydrogel to accumulate the products of the nucleic acid amplification reaction in situ, uses the good adsorption and flocculation capacity of the PAM hydrogel to realize the accumulation of the magnesium pyrophosphate precipitate generated in the nucleic acid amplification reaction in the nucleic acid amplification group area, and forms white spots corresponding to the position and size of the amplification group, thereby realizing the method for visual quantitative detection of pathogenic bacteria and target nucleic acid.
[0017] The sealed chamber is a simple chip made by bonding a glass slide and an incubation chamber, and the hydrogel gelation and isothermal amplification reaction are completed in the sealed chamber without complex microfluidic processing process. Not only is the actual operation of the technician facilitated, but also the experimental process is simplified, and the purpose of rapid detection is realized.
[0018] As a preferred, the reaction system containing the hydrogel monomer is injected into the sealed chamber to cross-link and form the hydrogel system, and the thickness of the sealed chamber is 250-300 μm.
[0019] Specifically, the mixed system solution is added dropwise into the transparent sealed chamber, and a sealing sheet is covered to gel. The sealing system composed of the sealed chamber and the sealing sheet can prevent the evaporation of water in the hydrogel, and ensure the accuracy of the detection result. Based on the diameter of the nucleic acid amplification group of about 300 μm, the thickness of the hydrogel system is 250-300 μm, so that the nucleic acid amplification group is distributed in a single layer in the hydrogel system, and counting is facilitated.
[0020] The present application uses polyacrylamide hydrogel as the reaction matrix. Studies have shown that, compared with polyethylene glycol-based hydrogel, polyacrylamide hydrogel is more conducive to the flocculation and deposition of the magnesium pyrophosphate precipitate generated in the nucleic acid amplification reaction to form white spots with clear boundaries.
[0021] The polyacrylamide gel is formed by using ammonium persulfate as an initiator and via tetramethylethylenediamine catalysis of cross-linking between MA and BMA.
[0022] Suitable nanopore size is obtained by adjusting the concentration of polymer or cross-linking agent in the PAM hydrogel, and the relative separation of nucleic acid molecules and their amplification products is realized by the confined function of the PAM nanoporous structure, and the large amount of production and accumulation of the amplification by-product magnesium pyrophosphate is realized by the good adsorption flocculation capacity of PAM. As preferred, the molar ratio of MA and BMA is 25-45:1, and both are added to the reaction system in a total mass volume ratio of 5%-7%. More preferably, the concentration of MA in the reaction system is 0.668M, and the concentration of BMA is 0.0243M.
[0023] As preferred, the initiator used for cross-linking the hydrogel into a gel is 0.05% ammonium persulfate by mass volume ratio, and the catalyst is 1% tetramethylethylenediamine by volume ratio.
[0024] Studies have shown that the concentration conditions of LAMP reaction reagents (mainly dNTPs, MgSO4) and PAM monomers (MA & BMA) will affect the clarity of the separation boundary between the white spots formed by each nucleic acid amplification group. As preferred, when the amplification target is DNA, the loop-mediated isothermal amplification reaction system composition includes: 1x isothermal amplification buffer, 6mM MgSO4, 0.8mM dNTPs, 800U / mL Bst 2.0 DNA polymerase, 1.2mg / mL BSA and primer mixture, and the primer mixture is a mixture of 1.6μM FIB and BIP, 0.2μM F3 and B3, and 0.8μM LF and LB.
[0025] When the detection target is microorganisms such as foodborne pathogenic bacteria and environmental pathogenic bacteria, 0.1mg / mL lysozyme is added to the above reaction system. The lysozyme can directly lyse the bacteria in the sample to be tested, saving the laborious and time-consuming step of DNA extraction, greatly shortening the sample preparation and detection time.
[0026] In step (2), the PAM-LAMP reaction system is placed under constant temperature conditions for loop-mediated isothermal amplification reaction.
[0027] The conditions for the loop-mediated isothermal amplification reaction are constant temperature heating at 60-70℃ for 30-40min. As preferred, the conditions for the isothermal amplification reaction are constant temperature heating at 65℃ for 30min. After the accumulation of enough nucleic acid amplification reaction by-product magnesium pyrophosphate, a clear visible precipitation point is formed.
[0028] In step (3), the concentration of the target nucleic acid molecules in the sample to be detected is calculated by counting the magnesium pyrophosphate precipitation points in the hydrogel system. The magnesium pyrophosphate precipitation points can be observed by naked eye under natural light without additional light source or even special microscope. The counting can be performed manually or with the aid of a counting tool.
[0029] As preferred, the hydrogel system is subjected to image acquisition, and the magnesium pyrophosphate precipitation points in the image are counted manually or identified and counted by a counting model.
[0030] The counting model is based on AutoML integrated in Google platform Vertex AI, which can create a data set based on pictures and train a model by marking target counting objects without self-writing code. Model deployment and application can be completed by one-click operation.
[0031] The construction method of the counting model comprises the following steps: first, using "Vertex AI" in the Google platform to create an empty data set for picture detection, importing amplification result images under different concentrations of nucleic acid templates in the data import window, and marking the precipitation points in the images as counting recognition objects; then selecting the established target data set for new model training, wherein the node budget is specified as 8 nodes, after training the AutoML picture classification model, clicking to create an endpoint, wherein the model settings select to accept 100% traffic split, and 1 is input in the number of calculation nodes, and after clicking to confirm, the model can be deployed to the endpoint.
[0032] The present application has the following beneficial effects:
[0033] (1) The present application provides a dye-free nucleic acid culture detection counting method recognizable by naked eye. The polyacrylamide hydrogel and digital LAMP are combined, the adsorption and flocculation ability of PAM is utilized to promote the generation and deposition of LAMP reaction by-product magnesium pyrophosphate precipitation, and the precipitation is controlled near the nucleic acid amplification group, thereby forming white spots with obvious color difference from the background at the amplification group position, without relying on precise and complex microfluidic technology to realize physical separation of amplification subunits, and without the aid of any microscopic magnification equipment or fluorescent microscopic imaging device to realize naked eye visualization quantitative detection under natural light. At the same time, the good precipitation promoting ability of PAM ensures that the method of the present application has more superior visualization quantitative detection performance than the microdroplet-based aqueous reaction system.
[0034] (2) The nucleic acid culture detection counting method provided by the application has good anti-interference and repeatability, can realize accurate quantitative detection of target bacteria or nucleic acids, and can realize visual quantitative analysis only by heating at 60-70 DEG C for 30-40 min in the whole detection process, and has the characteristics of rapidness, simplicity, easy operation and less equipment demand, and has great potential for application in resource-poor areas and on-site rapid detection.
[0035] (3) The nucleic acid culture detection counting method provided by the application does not need to rely on nucleic acid dye for fluorescence imaging analysis, not only saves the detection cost, but also avoids the inhibition of dye on the amplification reaction, so that the detection accuracy is further improved.
[0036] (4) The nucleic acid culture detection counting method provided by the application can be applied to digital nucleic acid detection in many fields such as clinic, environment and agriculture, and can be used not only for quantitative detection of microorganisms such as foodborne pathogenic bacteria and environmental pathogenic bacteria, but also for quantitative detection of target nucleic acids contained in samples, and has high application potential and value in identification and analysis of pathogen infection. BRIEF DESCRIPTION OF DRAWINGS
[0037] Figure 1 For characterization of the generation of magnesium pyrophosphate precipitate in solution and hydrogel. (a) Fluorescence image (top) and bright field image (bottom) of LAMP reaction results in microdroplets. The boxed droplets contain a small amount of precipitate in aggregated form, and the unboxed droplets do not contain the precipitate, so as to distinguish positive and negative droplets; (b) Fluorescence image (top) and mobile phone photograph (bottom) of PAM-LAMP results. The boxed points are the fluorescence amplification points (top) and the precipitate points (bottom); (c) Absorbance change of water solution system and PAM system at 400 nm; (d) Comparison of average particle size of precipitate generated in water solution system and PAM system; (e) Comparison of zeta potential of water solution system and PAM system; (f) FT-IR spectrum of PAM hydrogel.
[0038] Figure 2 For the optimization results of PAM-LAMP hydrogel chip reagents (dNTPs, MgSO4, MA & BMA).
[0039] Figure 3 For the results of PAM-LAMP hydrogel chip under different amplification culture times (65 DEG C for 25 min, 30 min).
[0040] Figure 4For counting analysis of PAM-LAMP hydrogel chips after amplification reaction, the left photo in (a) is the PAM-LAMP hydrogel chip after amplification reaction taken by the original camera of the mobile phone, and the right photo is the picture uploaded to the pre-trained Google AutoML model for intelligent recognition and counting; (b) is the accuracy of the ML model in counting target objects. The counting results of various concentrations of templates based on deep learning are compared with the manual counting results.
[0041] Figure 5 For the photo of PAM-LAMP hydrogel chips under different template concentrations (a), and the comparison of the number of detections obtained by PAM-LAMP reaction quantification with the number of additions (measured by using commercial droplet digital chip) (b).
[0042] Figure 6 For the photo and fluorescence endpoint image of the dye-containing PAM-LAMP system in Comparative Example 1 after amplification reaction, wherein (a) is the photo of PAM-LAMP hydrogel chip under natural light; (b) is the comparison of the number of precipitate points and the number of fluorescence points of the dye-containing PAM-LAMP system after amplification reaction under various concentrations of template DNA; (c) is the photo and fluorescence endpoint image of the dye-containing PAM-LAMP system after amplification reaction; (d) is the photo and fluorescence endpoint image of the PAM-LAMP system without dye after amplification reaction; (e) is the photo and fluorescence endpoint image of the PAM hydrogel containing dye and 10 mU pyrophosphatase after amplification reaction, and the left photo in (c)-(e) is identified by naked eye, and the right photo is fluorescence imaging.
[0043] Figure 7 For the fluorescence imaging and precipitate point change under blue light exposure in Comparative Example 1, wherein (a) is before exposure, (b) is after exposure, the left photo is fluorescence imaging, and the right photo is naked eye identification of precipitate points; for the simulation of fluorescence imaging and precipitate point change under natural light, wherein (c) is before natural light irradiation, (d) is after natural light irradiation, the left photo is fluorescence imaging, and the right photo is naked eye identification of precipitate points.
[0044] Figure 8 For the comparison chart of fluorescence imaging (left) and precipitate points (right) in different hydrogels (PEG, PAM) systems in Comparative Example 2 after amplification at 65°C for 30 min.
[0045] Figure 9 For the photo of PAM-LAMP hydrogel chip after LAMP amplification in the system of Application Example 1, 2 μL of various vegetable and fruit juices or beverages (blank control, grape juice, apple juice, orange juice, watermelon juice, tomato, wine, sparkling water) is added.
[0046] Figure 10To visualize the PAM-LAMP counting in the presence of real samples (common fruit and vegetable juice and beverage on the market) under naked eye. Three methods, dilution plating method (unit: CFU), PAM-LAMP (unit: cell) and commercial Quantstudio 3D PCR method (unit: copy) were used for comparison. DETAILED DESCRIPTION
[0047] The application will be further described below in connection with specific embodiments. The following examples are only used to illustrate the application, and are not used to limit the application scope. Modifications or replacements of the method, steps or conditions of the application, without departing from the spirit and essence of the application, all belong to the scope of the application.
[0048] The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.
[0049] The microorganism in the following examples is Escherichia coli. The total DNA extraction of each bacterial strain uses PureLinkTM Genomic DNA Mini Kit kit, and the volume of the bacterial solution can be appropriately increased according to the need for extracting DNA concentration. The quality of the extracted DNA is detected by Nano-300 microspectrophotometer, and is stored at -20℃ after labeling for standby use. If the target bacteria are directly amplified, 0.1 mg / mL lysozyme is added to the system. The specific sequences of the primers used are as follows:
[0050] F3: GCCATCTCCTGATGACGC;
[0051] B3: ATTTACCGCAGCCAGACG;
[0052] FIP: CATTTTGCAGCTGTACGCTCGCAGCCCATCATGAATGTTGCT;
[0053] BIP: CTGGGGCGAGGTCGTGGTATTCCGACAAACACCACGAATT;
[0054] LF: CTTTGTAACAACCTGTCATCGACA;
[0055] LB: ATCAATCTCGATATCCATGAAGGTG.
[0056] The PAM hydrogel involved in the application has superior abilities of promoting precipitation formation and flocculation, which are also verified by a series of characterization experiments. For example, Figure 1(a)-(b) show that although the microdroplets based on fluorescent labeling have better positive and negative discrimination, the magnesium pyrophosphate precipitate generated in the positive droplets is very small and difficult to be observed; on the contrary, the amount of precipitate generated in PAM is more and clear, and the positions of the fluorophore and the precipitate point also correspond one by one. In order to explore the precipitate generation in the aqueous solution and in the PAM hydrogel, the absorbance changes of the two systems at 400 nm during the LAMP reaction process were compared. As shown in Figure 1 (c), the generation rate of magnesium pyrophosphate in PAM is faster than that in the solution, and the amount of precipitate generated is also more. As shown in Figure 1 (d), the particle size of the precipitate generated in PAM is larger than that in the aqueous solution, which supports the flocculation function of PAM hydrogel. At the same time, through Figure 1 (e) can also be seen that the absolute value of Zeta potential in PAM system is smaller than that in the aqueous solution, which also shows that the flocculated PAM polymer helps the formation and flocculation accumulation of the precipitate. Through Figure 1 (f) shows that the FT-IR spectrum can be seen that there are polar amide groups in PAM hydrogel, so it can adsorb precipitate and bridge through hydrogen bonding, resulting in a large amount of precipitate precipitation and flocculation.
[0057] Example 1:
[0058] I. The nucleic acid culture detection counting method of PAM-LAMP is as follows:
[0059] Step one, the glass slide is pre-coated with a simple chip and incubated in a chamber. The incubation chamber is purchased from Bio-Rad, with a size of 10x10mm and a depth of 270μm.
[0060] Step two, prepare the PAM-LAMP reaction system mixture, and the test substance is DNA of different concentrations. Inject the mixture into the incubation chamber on the glass slide, make it evenly distributed, and cover the sealing sheet;
[0061] The reaction system mixture (25 μΐ) consists of: 1 x isothermal buffer, 6 mM MgS04, 0.8 mM dNTPs, 800 U / mL Bst 2.0 WarmStart polymerase, 1.2 mg / mL of BSA, 1.6 μΜ FIB and BIP, 0.2 μΜ F3 and B3, 0.8 μΜ LF and LB, and 2 μΐ^ of template DNA. On this basis, 0.668 M acrylamide (CAS: 79-06-1), 0.0243 M bis-acrylamide (CAS: 110-26-9), 0.05% (w / v) ammonium persulfate, and 1% (v / v) tetramethyl ethylenediamine (TEMED) are added; ddH20 is added to a final volume of 25 μΐ.
[0062] Step three, the finished simple gel chip is placed in a small metal bath heated at 65°C for 30 min.
[0063] Step four, after amplification, the chip is identified by the naked eye under natural light, photographed by a mobile phone camera, and uploaded to a machine learning model for counting and analysis. The final quantitative results are compared with the amount of standard addition (measured using a commercial droplet digital chip).
[0064] The porous structure possessed by PAM hydrogel allows small molecules to diffuse to some extent, but limits the movement of cells and high molecular weight nucleic acids and other substances, and has a good confinement effect on amplification products / by-products. At the same time, the adsorption and flocculation ability of PAM hydrogel causes the reaction by-products to accumulate in large quantities at the nucleic acid amplification group, thereby generating white spots visible to the naked eye in situ.
[0065] In step two, the concentration of LAMP reagents (dNTPs, MgS04) and the conditions of hydrogel (MA, BMA) are optimized by single factor adjustment, as shown in Figure 2 , and the optimal reaction conditions are determined (the final concentration of dNTPs in the system is 0.8 mM, the final concentration of MgS04 in the system is 4 mM, and MA and BMA are added to the reaction system in a total mass / volume ratio of 5% to 7%), so that the size of the white spots used for visual counting is appropriate and the intervals are clear.
[0066] In step three, the LAMP reaction time is optimized, and the metal bath is heated at 65°C for 25 min and 30 min, respectively, and the results are shown in Figure 3 . When the amplification time is 25 min, the white spots are not complete, which is reflected in the fact that the color of the white spots is very light, and many white spots only show a small part. When the amplification time is extended to 30 min, the white spots on the whole gel are complete and the color is uniform.
[0067] In step four, after amplification, the chip is photographed under natural light using a mobile phone original camera for subsequent intelligent identification and counting.
[0068] The machine learning model used for intelligent counting is trained in advance. The specific process is as follows: using "Vertex AI" on the Google platform to create an empty data set for image detection, importing the amplification result images (different concentration template amounts) as the reference model in the data import window, and marking the target points (such as white points) in the images as the standard for counting. Upload the 10 result photos obtained under different concentrations of nucleic acid templates to Google Cloud Storage, and manually mark all the precipitate points in the images as the recognition object. Select the target data set to train a new model, with a node budget of 8 nodes. After completing the AutoML image classification model training, click to create an endpoint using the Google Cloud console. Select 100% traffic split for model settings, and input 1 in the number of computing nodes. Click Confirm to deploy the model to the endpoint. By one-click uploading of images, the result images obtained by the mobile phone original camera can be counted and analyzed. The counting model is based on the AutoML integrated in the Vertex AI of the Google platform, which does not require self-programming code to create a data set based on images and train a model by marking the target counting object. Model deployment and application can be completed through simple one-click operation.
[0069] As shown in Figure 4 (a), the photos taken by the mobile phone original camera can be directly uploaded to the pre-trained machine learning model for counting analysis, and the counting results are highly consistent with the manual counting results Figure 4 (b), indicating that the method of the present application has high convenience and practicality.
[0070] As shown in Figure 5 (a), within a certain range, the nucleic acid culture detection counting method based on PAM-LAMP has high recognizability and quantitative accuracy. In the case of higher concentration of templates, there is still a relatively obvious separation between the precipitate points, and the color difference between the precipitate points and the background is large, making it easy to identify and analyze. As shown in Figure 5 (b), the nucleic acid culture detection counting method in the present application has high accuracy and reliability, and the linear relationship is good (R 2 = 0.9905), which shows that visual counting by the naked eye can effectively replace the traditional fluorescence imaging quantitative counting.
[0071] Comparative Example 1
[0072] I. LAMP quantitative detection based on fluorescence imaging technology, LAMP reaction system added fluorescent dye EvaGreen, reaction conditions same as Example 1.
[0073] The reaction mixture (25 μΐ) consisted of 1 x isothermal buffer, 6 mM MgS04, 0.8 mM dNTP, 800 U / mL Bst 2.0 WarmStart polymerase, 1.2 mg / mL of BSA, 1.6 μΜ FIB and BIP, 0.2 μΜ F3 and B3, 0.8 μΜ LF and LB, 1 x EvaGreen, and 2 μΐ^ of template DNA. On this basis, 0.668 M of MA, 0.0243 M of BMA, 0.05% (w / v) of ammonium persulfate and 1% (v / v) of TEMED were added; ddH20 was added to a final volume of 25 μΐ.
[0074] After amplification, as shown in Figure 6 (a), the clear visible precipitate pattern could also be seen under natural light. The fluorescent spots generated by LAMP in situ amplification in the hydrogel system were imaged using fluorescence imaging technology. The fluorescence emitted by the amplification products under excitation light irradiation was identified under a fluorescence microscope, as shown in Figure 6 (b) - 6(c), in the presence of dye, the fluorescent group corresponded to the position of the precipitate point, and the size was also similar. At the same time, the number of precipitate points and fluorescent points was highly consistent. As shown in Figure 6 (d), in the absence of dye labeling, the magnesium pyrophosphate precipitation still existed.
[0075] Therefore, the precipitate point can replace the fluorescent point as a marker for counting, which makes it possible to realize label-free amplification counting in the field of digital nucleic acid amplification.
[0076] In order to confirm whether the composition of the precipitate is as described in the literature, the situation after adding 10 mU of pyrophosphatase was compared, as shown in Figure 6 (e), the presence of pyrophosphatase makes the precipitate disappear, while the amplification group labeled with dye still exists. Thus, the identity of the white precipitate is magnesium pyrophosphate.
[0077] II. Influence of exposure time on result interpretation
[0078] As shown in Figure 7 (a) - (b), under blue light exposure conditions, the fluorescence will gradually weaken with the extension of time, while the precipitate point remains almost unchanged. As shown in Figure 7 (c) - (d), under natural light, the fluorescence is bleached with the extension of time, while the precipitate still exists.
[0079] Comparative Example 2
[0080] Comparison of the influence of different hydrogel systems on the formation of precipitate points
[0081] 1. PEG hydrogel system
[0082] The reaction system mixture (25 μL) was composed of the following components: 1 × isothermal buffer, 6 mM MgSO4, 0.8 mM dNTPs, 800 U / mL Bst 2.0 WarmStart polymerase, 1.2 mg / mL of BSA, 1.6 μM FIB and BIP, 0.2 μM F3 and B3, 0.8 μM LF and LB, 1 × EvaGreen, and 2 μL of template DNA, 1.6 mg of Four-arm PEG Acrylate and 1.1 mg of SH-PEG-SH, ddH2O was added to a final volume of 25 μL.
[0083] The mixture was injected into the incubation chamber on the glass slide, and after uniform distribution, a sealing sheet was covered; the prepared simple gel chip was placed in a small metal bath at 65°C for heating for 30 min.
[0084] 2. PAM hydrogel system
[0085] The reaction system was the same as in Example 1. The mixture was injected into the incubation chamber on the glass slide, and after uniform distribution, a sealing sheet was covered; the prepared simple gel chip was placed in a small metal bath at 65°C for heating for 30 min.
[0086] 3. As shown in Figure 8 , under the same amplification conditions, the white spot result image in the PAM hydrogel system is clearer. Specifically, when amplified to the same time, the white spot in the PEG hydrogel system is smaller and lighter and only a small part is present. The white spot in the PAM hydrogel system is completely present at this time, and is thicker and clearer, facilitating counting.
[0087] Application Example 1:
[0088] I. The nucleic acid culture detection counting method of PAM-LAMP is as follows:
[0089] Step one, the glass slide is pre-assembled with the incubation chamber to make a simple chip; the incubation chamber is purchased from Bio-Rad, with a size of 10 × 10 mm and a depth of 270 μm.
[0090] Step two, prepare the PAM-LAMP reaction system mixture, and the test object is various vegetable and fruit juice or beverage. The mixture is injected into the incubation chamber on the glass slide, and after uniform distribution, a sealing sheet is covered;
[0091] The reaction mixture (25 μΐ) was composed of 1 x isothermal buffer, 6 mM MgS04, 0.8 mM dNTPs, 800 U / mL Bst 2.0 WarmStart polymerase, 1.2 mg / mL of BSA, 1.6 μΜ FIB and BIP, 0.2 μΜ F3 and B3, 0.8 μΜ LF and LB, and 2 μΐ^ of template DNA. On this basis, 0.668 M Acrylamide, 0.0243 M Bis-Acrylamide, 0.05% (w / v) of ammonium persulfate and 1% (v / v) of tetramethyl ethylenediamine (TEMED) were added; ddH20 was added to a final volume of 25 μΐ.
[0092] LAMP reaction mixture containing the same DNA dilution was prepared, and 2 μΐ^ of each vegetable and fruit juice or beverage (blank control, grape juice, apple juice, orange juice, watermelon juice, tomato, wine, sparkling water) was added.
[0093] Step three, the finished simple gel chip was placed in a small metal bath and heated at 65°C for 30 min.
[0094] Step four, after amplification, the chip was identified by naked eye under natural light, photographed by a mobile phone camera and uploaded to a machine learning model for counting and analysis. The final quantitative results were compared with the blank control group (without additional vegetable and fruit juice or beverage).
[0095] The results are shown in Figure 9 The size of the precipitate points was uniform and clearly distinguished from the background in the results graph of the additional real samples. Despite the presence of a large number of fibers and color in the samples, the precipitate points could still be clearly distinguished for quantitative analysis in the detection results.
[0096] As shown in Figure 10 The recovery rate of the method used in this study was relatively stable (ranging from 80% to 122%), and the addition of fruit and vegetable juice and beverage had little effect on amplification. In contrast, the results of traditional plate culture method and commercial Quantstudio digital PCR method were more unstable. Specifically, the total number of colonies measured by the dilution and spread plate method was not specific, and therefore often overestimated (such as samples containing watermelon juice and tomato juice). The commercial Quantstudio digital PCR method had higher requirements for sample processing, and the reaction system containing impurities often showed poor amplification performance.
[0097] The above embodiments are only explanations of the present application, and the embodiments of the present application are not limited by the above embodiments. For those skilled in the art, other various corresponding changes and modifications can be made according to the technical solutions and concepts described above, and all the changes and modifications should belong to the protection scope of the claims of the present application.
Claims
1. A dye-free macroscopically identifiable nucleic acid culture detection counting method, characterized by, The method comprises the following steps: (1) adding the sample to be tested into a loop-mediated isothermal amplification reaction system solution, then adding a hydrogel monomer into the reaction system, and injecting the hydrogel monomer into a sealing chamber with a thickness of 250-300 μm to initiate crosslinking to form a hydrogel system; the hydrogel monomer comprises acrylamide and methylene bisacrylamide, the molar ratio of the acrylamide and the methylene bisacrylamide is 25-45:1, and both are added into the reaction system in a total mass volume ratio of 5%-7%; the loop-mediated isothermal amplification reaction system comprises primers for specifically amplifying target nucleic acid molecules; (2) placing the hydrogel system in an isothermal condition to heat and perform loop-mediated isothermal amplification reaction, and the isothermal amplification reaction is performed at a constant temperature of 60-70 ℃ for 30-40 min; (3) after the amplification is completed, the magnesium pyrophosphate precipitation points formed in the hydrogel system are identified and counted to calculate the concentration of the target nucleic acid molecules in the sample to be tested.
2. The nucleic acid culture test counting method of claim 1, wherein, The concentration of the acrylamide in the reaction system is 0.668 M, and the concentration of the methylene bisacrylamide is 0.0243 M.
3. The nucleic acid culture detection and counting method as described in claim 1 or 2, characterized in that, The initiator used for crosslinking the hydrogel into a gel is ammonium persulfate with a mass volume ratio of 0.05%, and the catalyst is tetramethyl ethylenediamine with a volume ratio of 1%.
4. The nucleic acid culture detection and counting method as described in claim 1, characterized in that, When the amplification target is DNA, the loop-mediated isothermal amplification reaction system comprises 1×isothermal amplification buffer, 6 mM MgSO4, 0.8 mM dNTPs, 800 U / mL Bst 2.0 DNA polymerase, 1.2 mg / mL BSA and a primer mixture, and the primer mixture is a mixture of 1.6 μM FIB and BIP, 0.2 μM F3 and B3, and 0.8 μM LF and LB; when the detection target is microorganisms, the reaction system further comprises 0.1 mg / mL lysozyme.
5. The nucleic acid culture detection and counting method as described in claim 1, characterized in that, In step (2), the isothermal amplification reaction is performed at a constant temperature of 65 ℃ for 30 min.
6. The method of claim 1, wherein the nucleic acid culture test count is determined by the formula: ###0001### wherein: N = the number of colonies; A = the area of the plate; and D = the dilution factor. In step (3), the hydrogel system is subjected to image acquisition, and the magnesium pyrophosphate precipitation points in the image are manually counted or identified and counted by using a counting model.
7. The nucleic acid culture detection and counting method as described in claim 1, characterized in that, The sample to be tested is a sample containing pathogenic bacteria or nucleic acid molecules.
Citation Information
Patent Citations
Loop-mediated isothermal amplification (LAMP) based assay for detecting microbes
CN111801426A