Microsatellite marker loci and primer sets of Montipora digitata and their applications

Abstract

The application belongs to the technical field of molecular biology DNA marker, and specifically discloses a microsatellite marker site of Anemone coronaria, which comprises at least one of ZH3008, ZH7380, ZH13016, ZH17408, ZH18659, ZH18997, ZH19490, ZH19729 and ZH21570. The application provides a primer group for amplifying the microsatellite marker site of Anemone coronaria, and application of the microsatellite marker site of Anemone coronaria in population genetic structure analysis, paternity identification and / or molecular marker assisted breeding. The microsatellite marker site of Anemone coronaria and the primer group for amplifying the microsatellite marker site provided by the application can be applied to research in the fields of population genetic structure analysis, paternity identification and molecular marker assisted breeding of Anemone coronaria, and have good repeatability, are reliable and effective molecular markers, and are important tools for studying genetic diversity and connectivity of Anemone coronaria.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology DNA markers, and in particular relates to a Montipora digitata microsatellite marker site, a primer set and an application thereof. Background Art

[0002] Microsatellite markers, also known as short tandem repeats (STRs) or simple sequence repeats (SSRs), are composed of tandem repeating units of 1-6 nucleotides. Microsatellite markers are abundant and evenly distributed across the genome. The number of repeats within the same microsatellite marker can vary between samples, and length variation exists between samples. Microsatellite markers have the advantages of widespread distribution, high polymorphism information capacity, codominance, ease of PCR amplification, and excellent reproducibility, making them a key tool for studying sample connectivity and genetic diversity.

[0003] The coral reef ecosystem of the Xisha Islands is the oldest and most pristine of my country's existing coral reef communities. It is the birthplace of my country's coastal coral reef ecosystems and one of the most well-preserved and precious coral reef areas in my country's offshore waters. The Xisha Islands' coral reef ecosystem provides an excellent habitat for marine life, serving as a gene bank for marine species and a reservoir of marine natural medicines. However, coral reef ecosystems are extremely fragile and susceptible to environmental changes. Currently, reef-building corals in the Xisha Islands are experiencing bleaching and mortality, with the coral bleaching rate exceeding 30% in some areas.

[0004] Reef-building corals are a vital component of coral reef ecosystems. Their connectivity and genetic diversity are crucial for developing coral reef restoration and restoration strategies. Montipora digitata is a dominant and representative species of reef-building coral in the Xisha Islands. Research on the connectivity and genetic diversity of Montipora digitata provides crucial data support for the conservation of reef-building corals in the Xisha Islands. Summary of the Invention

[0005] The purpose of the present invention is to provide a Montipora digitata microsatellite marker site and a primer set and application thereof to solve the above technical problems.

[0006] One of the purposes of the present invention is to provide a microsatellite marker locus of Montipora digitata, including at least one locus among ZH3008, ZH7380, ZH13016, ZH17408, ZH18659, ZH18997, ZH19490, ZH19729 and ZH21570, wherein the nucleotide sequence of ZH3008 is SEQ ID NO.3; the nucleotide sequence of ZH7380 is SEQ ID NO.6; the nucleotide sequence of ZH13016 is SEQ ID NO.9; the nucleotide sequence of ZH17408 is SEQ ID NO.12; the nucleotide sequence of ZH18659 is SEQ ID NO.15; the nucleotide sequence of ZH18997 is SEQ ID NO.18; the nucleotide sequence of ZH19490 is SEQ ID NO.21; the nucleotide sequence of ZH19729 is SEQ ID NO.24; the nucleotide sequence of ZH21570 is SEQ ID NO. NO.27.

[0007] A second object of the present invention is to provide the above-mentioned primer set for detecting the microsatellite marker loci of Montipora digitata, comprising at least one of primer pair SEQ ID NO.1-2, primer pair SEQ ID NO.4-5, primer pair SEQ ID NO.7-8, primer pair SEQ ID NO.10-11, primer pair SEQ ID NO.13-14, primer pair SEQ ID NO.16-17, primer pair SEQ ID NO.19-20, primer pair SEQ ID NO.22-23 and primer pair SEQ ID NO.25-26;

[0008] Specifically, the primer pair used to amplify ZH3008 is SEQ ID NO.1-2; the primer pair used to amplify ZH7380 is SEQ ID NO.4-5; the primer pair used to amplify ZH13016 is SEQ ID NO.7-8; the primer pair used to amplify ZH17408 is SEQ ID NO.10-11; the primer pair used to amplify ZH18659 is SEQ ID NO.13-14; the primer pair used to amplify ZH18997 is SEQ ID NO.16-17; the primer pair used to amplify ZH19490 is SEQ ID NO.19-20; the primer pair used to amplify ZH19729 is SEQ ID NO.22-23; and the primer pair used to amplify ZH21570 is SEQ ID NO.25-26.

[0009] A third object of the present invention is to provide the use of the above-mentioned Montipora digitata microsatellite marker loci in population genetic structure analysis, parentage testing and / or molecular marker-assisted breeding.

[0010] Beneficial effects of the present invention:

[0011] The present invention provides nine Montipora digitata microsatellite marker sites, which are respectively named ZH3008, ZH7380, ZH13016, ZH17408, ZH18659, ZH18997, ZH19490, ZH19729 and ZH21570, and the nucleotide sequences are SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.15, SEQ ID NO.18, SEQ ID NO.21, SEQ ID NO.24 and SEQ ID NO.27, respectively.

[0012] The present invention provides nine microsatellite marker loci for Montipora digitata and a primer set for amplifying the microsatellite marker loci. These loci can be applied to research in the fields of population genetic structure analysis, parentage identification, and molecular marker-assisted breeding of Montipora digitata. These loci have good reproducibility and are reliable and effective molecular markers, providing an important tool for studying the genetic diversity and connectivity of Montipora digitata. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the capillary electrophoresis signal diagram of ZH3008;

[0014] Figure 2 This is the capillary electrophoresis signal diagram of ZH7380;

[0015] Figure 3 This is the capillary electrophoresis signal diagram of ZH13016;

[0016] Figure 4 This is the capillary electrophoresis signal diagram of ZH17408;

[0017] Figure 5 is the capillary electrophoresis signal diagram of ZH18659;

[0018] Figure 6 is the capillary electrophoresis signal diagram of ZH18997;

[0019] Figure 7 This is the capillary electrophoresis signal diagram of ZH19490;

[0020] Figure 8 is the capillary electrophoresis signal diagram of ZH19729;

[0021] Figure 9 This is the capillary electrophoresis signal diagram of ZH21570. DETAILED DESCRIPTION

[0022] The following is further described in detail through specific implementation methods:

[0023] Example 1:

[0024] S1. The water temperature was raised to 33°C using a heating rod. After bleaching by high temperature induction at 33°C (to remove zooxanthellae from the coral), the live Montipora digitata was sent to Guangzhou Kidio Biotechnology Co., Ltd. for genomic DNA extraction, enzyme digestion, end repair, A-linker addition, fragment selection, PCR amplification, and sequencing.

[0025] The specific steps are as follows: (1) DNA extraction: Genomic DNA was extracted using the CTAB (cetyltrimethylammonium bromide) method. DNA quality was tested using Qubit (Thermo Fisher Scientific, Waltham, MA) and Nanodrop (Thermo Fisher Scientific, Waltham, MA).

[0026] (2) The genomic DNA that has passed the quality inspection is digested with restriction endonucleases and physically broken into 300-700 bp sequences, which are then repaired at the ends, A-tailed, and cloned using ΜLtra TM DNA Library Prep Kit (NEB, USA) was used to add Illumina sequencing adapters.

[0027] DNA fragments of 300-400 bp were amplified and enriched by PCR.

[0028] Finally, PCR products were purified using the AMPure XP system (Beckman Coulter, Brea, CA, USA), and sequencing libraries were detected using an Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA), and library quantification was performed using real-time PCR. Sequencing was performed on a Novasek 6000 sequencer using a PE 150 sequencing strategy.

[0029] (3) The raw data from the Illumina platform were filtered using FASTP (version 0.18.0). The filtering criteria were as follows:

[0030] ① Remove reads containing unknown nucleotides (N) ≥ 10%;

[0031] ② Remove reads with bases ≥50% with a phred quality score ≤ 20;

[0032] ③ Delete reads containing adapters. The filtered clean reads are used for assembly analysis.

[0033] (4) Using stack (version 1.46), all individual read1 data were first clustered separately to obtain individual stacks. The stacks between individuals were then clustered to obtain a set of stacks for the population. Read2 was classified according to the read1 clustering results, and then read2 was spliced. After the stacks sequence obtained by splicing read1 and the contigs obtained by splicing read2, the sequences were aligned to the zooxanthellae genome and the zooxanthellae data were filtered. After filtering, the stacks sequence and contig sequence were spliced ​​to construct RAD-tags. RAD-tags will serve as reference sequences for subsequent variant detection and advanced analysis.

[0034] Coral cells contain a large number of zooxanthellae, and the extracted DNA is a mixture of coral and zooxanthellae. Therefore, S1 must first increase the temperature to induce the removal of zooxanthellae in the coral body, and then filter the zooxanthellae again during the bioinformatics analysis to separate the zooxanthellae data and obtain the coral DNA.

[0035] (5) All RAD-tags were searched using the software MISA (http: / / pgrc.ipk-gatersleben.de / misa / ), and SSRs in RAD-tags were found to obtain the microsatellite marker loci of Montipora digitata.

[0036] Configuration parameter information:

[0037] definition(unit_size,min_repeats):1-10 2-6 3-5 4-4 5-4 6-4;

[0038] interruptions(max_difference_between_2_SSRs):100.

[0039] S2. Collect two Montipora digitata corals from each of Xisha Silver Island, Lingyang Reef, and Jinqing Island, extract DNA, and then perform PCR amplification. Add an M13 forward primer to the 5' end of the forward primer at each site as the forward primer for PCR. The amplification reaction system is 25 μL.

[0040] The PCR system was as follows: PCR Master Mix (2×) 12.5 μL, forward primer 10 μmol / L 0.2 μL, reverse primer 10 μmol / L 0.6 μL, FAM-labeled M13 primer 10 μmol / L 0.4 μL, template DNA <100 ng, and finally made up to 25 μL with ddH2O.

[0041] The reaction program was as follows: 95°C for 2 min; 30 cycles of denaturation at 95°C for 20 s, annealing at 55°C for 20 s, and extension at 72°C for 20 s; 8 cycles of denaturation at 95°C for 20 s, annealing at 53°C for 20 s, and extension at 72°C for 30 s; and a total extension at 72°C for 5 min.

[0042] The microsatellite marker loci, forward primer sequences, reverse primer sequences and corresponding capillary electrophoresis signal diagrams of Montipora digitata are shown in the table below.

[0043]

[0044] Depend on Figures 1-9 As can be seen, the lengths of the Montipora digitata microsatellite markers obtained in this example were polymorphic across all tested Montipora digitata species, demonstrating the advantages of high amplification stability, strong specificity, and excellent reproducibility. This demonstrates that these nine microsatellite markers are reliable and effective molecular markers. The development of microsatellite markers for Montipora digitata provides an important tool for studying its genetic diversity and connectivity, and can be used in future work such as evaluating Montipora digitata germplasm resources and constructing genetic linkage maps.

[0045] Allele typing was performed using an ABI 3730XL genetic analyzer and SoftGenetics GeneMarker 3.0.0 software, and the PCR product fragment sizes were obtained.

[0046] (1) Montipora digitata microsatellite marker locus ZH3008 (SEQ ID NO. 3):

[0047] TTCGAAGAAGACGTCAGCCTTTCGGCAGAGGAAATAACATAAAGATAGCTTACGTGCGTTAGAAAATTTAAGACGAGATCTTATTTATTATGGGGGGTGGATCATCAAGAAAGTGTTGGTCATTGCTTTTGACAAACGTGTTGGCTCCTAAAGGAGCCGTTGTTGTTGTTGTTTTTTCAGTTCACGAGACTCGTTCACTTGCTGCT GGTGTACTTGGTCACGGCCTTCGTACCCTCGCTGACGGCGTGTTTTGCAAGTTCACCGGGAAGCAAAACTCTTATCGCTGTTTGGATCTCTCTTGAACTAATGGTGGCCTTCTTGTTGTAAAGTGAAAGACGTGAGGACTCCACGGCTATGCGTTCGAAAATATCGTTCACGAAAGAATTAGAGTCAAAGATCGGAAGAGCGTCG;

[0048] Forward primer (SEQ ID NO. 1): CGAAGAAGACGTCAGCCTTT; reverse primer (SEQ ID NO. 2): AAGGCCGTGACCAAGTACAC.

[0049] (2) Montipora digitata microsatellite marker locus ZH7380 (SEQ ID NO.6):

[0050] TAAATTTCAGTAGCTCTCACCGTATGCACGGTTGATACGCTATTTCAGACCTATTGAATAATTTGAAAAGGGCTTTGGTTGATGGTCTTATCTCTTAATGATGAAGAAGAAGAAGAAGAAGAAGAAGCTTCTAAGAAAAACACCCAATTCAAACTTGAGTGCACAAACCACATTCA GATCAAAACGGCTAAAAAAAACCCTACCCTTTAGGGGCCGCACATACCTATATTGCGCATATAGGGGCTTATATTTTTCAAAGGTCCTTTTGGAGGGGGCTTATTTTTGAAGGGGCTTATATTCAAAGGGGTTTATCTACGGAGGGAAATTTGCGTTTCCAAATAAATTAGGCTAGCC;

[0051] Forward primer (SEQ ID NO. 4): TAGCTCTCCACCGTATGCACG; reverse primer (SEQ ID NO. 5): AATAAGCCCCTCCAAAAGGA.

[0052] (3) Montipora digitata microsatellite marker locus ZH13016 (SEQ ID NO.9):

[0053] CACATTACTATGTTTTCAACATAGCAATTCTGGGAACCTTTTCAGACAGAAAAAAAAAAGTAAATTTTTTTTTAGCTTCTTTTTGTAATACGCTGTTTGTAAAACAATAGGAACTTCAAGAAAGCGTAATAGTTTATAATATAGTGACAGTACTCACACACACTCAGGCTGCACACTGTTATCTATTGTAGCTAAATAAGGGTGTCGAGTTCCTTTTTGTTATTTTAGTATGTTCCTTTTTCACTACTTTTCTGTAATATTTTAAAAAATACAACCACACTTTTGAATTTTCGGAACATGTTTCGATGTTTCAAACATCATCTTCAGCCATAGTGAGTGAAACATTAAAATTTTTACAAGATAATTCGTATATATATATAAGTTAACTATCAGTACAATGATTCTTTGTAGATTAAATGTTCGTTACAA;

[0054] 正向引物(SEQ ID NO.7):CACTCAGGCTGCACACTGTT;反向引物(SEQ ID NO.8):AACGAACATTTAATCTACAAAGAATCA。

[0055] (4)指状蔷薇珊瑚微卫星标记位点ZH17408(SEQ ID NO.12):

[0056] CTATTTTTTGTTAATAGCCAAACTACATCTGTGGGATTGCAGAAGATCACAAATACGTCCAACTATTGCTGGTTTTAAGACTAAGATAAAATTAAAATTTGAGACGAAAAAGTATATCTGTAAAAGATATATATATATGAAATACATATTTTGCACTGCGGGTATGAAATCAAATGAAACCATGTTGTCTCGCAGTGATGAGCGCAAATTTCTATTGCGTCGAGAAGTCTGAAAATTTTTCAGGACTTCAACGGGATTTAAACCCGCGACCTCGCGATACCGGTGCGATGGTCTAACCAACTGAGCTATGAAGCGACTGACGTTGGGAGCTGGTCACTTCTGAGTTCAC;

[0057] Forward primer (SEQ ID NO. 10): TGTGGGATTGCAGAAGATCA; reverse primer (SEQ ID NO. 11): CCCGTTGAAGTCCTGAAAAA.

[0058] (5) Montipora digitata microsatellite marker locus ZH18659 (SEQ ID NO.15):

[0059] GCAGTTGCAGTGGGCAAAACAAGACTACCAAAGGTGAAGTTTATCAGCTCCTGTAACAAGCAAATTTCAGTTGTTTTTGAGGAAATTTTTTGTTTTTGAAAATTAAATTAAATTAAATTGAATATTCCTATTTGAAACTCAAGTATTAGCCGACAGC AATTTTTTGGGCTGATTTTAAGGTCATAAAAGGTCAACTTATACCCATGTAAATTTGGTATTTTATTATATAAACACCATGAAATACCAAGTGAGCTTTAGCGCAAAGACATGTTATTTTCACACATGAAAAGATCACTGTTGCTATTGTTACAT;

[0060] Forward primer (SEQ ID NO. 13): GCAGTGGGCAAAACAAGACT; reverse primer (SEQ ID NO. 14): TTTGCGCTAAAGCTCACTTG.

[0061] (6) Montipora digitata microsatellite marker locus ZH18997 (SEQ ID NO.18):

[0062] CTGCAGACTGGGTACAAATGCAGACCAAGTCTAAATAAATAAATAAATACGTGATGGAATGTCATCTTATAACTTACCTGCTGTCACGCAATCGTCATTTTTCACGAATATTAGCATTTATTGGGTTT CCTTGCCCGTTTCTTAATGTATTATGTCTTAAACAGAGTGGCCAGGCTACAGTGGTTTCTTAAATAAAATTCTGAGCTACTTACTGATCTCCTAGCAGACTAGCTGATCTCCGGAAAGGTGATCTGCC;

[0063] Forward primer (SEQ ID NO. 16): TGGGTACAAATGCAGACCAA; reverse primer (SEQ ID NO. 17): GATCACCTTTCCGGAGATCA.

[0064] (7) Montipora digitata microsatellite marker locus ZH19490 (SEQ ID NO.21):

[0065] GAGCTGGAATACGTTGCATTCGATCGAGGAATACGTTCCCGGGTTTTTGTCCCTCTGGGTTTTTACCCCGGGTTTTCGTATCGGGCAACGTATCATCGATGTTTTTTCTGTAGATTTTTCCTAGTTTCCTGTTATGTGAATTTTTT TTTTTTTTTTTACACTTATGTAACTGCACTTAAATTTTTTGACTACGGTTATCTATAATAATACATTTCCTGTAGATAGATACATTTCTATATACATTTTCAGGCTATTGTCAACAATATTCGCACTTTCACATTGATGTTCATGTA;

[0066] Forward primer (SEQ ID NO. 19): GAATACGTTCCCGGGTTTTT; reverse primer (SEQ ID NO. 20): CATCAATGTGAAAGTGCGAA.

[0067] (8) Montipora digitata microsatellite marker locus ZH19729 (SEQ ID NO. 24):

[0068] GCGTATTCGGATAGAAAAATTGCGGTTTCAAAAATATCCGGATACGTGTGGACGGGGCCTTAGCAAACAGGAAATGTCTGGATGAAACTTGGTGGTAGAGCAATTGCAGCGTAATCGCAGGGCCATGGATTCGAATCACGTTCAA ACTTTCGATTTTTTTTTTTTTTCAGGTTTCTGCAACTATTTTAGTTGTTTGGTTTTATCAACGGAGTTGATAATGTAAATTGGCCACCGTACAGAGATTTTAAAAGCTGGTTTCGAGGGTTAGCCCTTCGTTCGCTTTATTT;

[0069] Forward primer (SEQ ID NO. 22): TTCGGATAGAAAAATTGCGG; reverse primer (SEQ ID NO. 23): GAAGGGCTAACCCTCGAAAC.

[0070] (9) Montipora digitata microsatellite marker locus ZH21570 (SEQ ID NO. 27):

[0071] TATTGTTTTTTTGTCCTCACTGCCTGGCTATCAAGCTGAATATTTGATATTTCGAAAATGTCATAGTGACTTTTACGCGAAACTCACATTTCCATACCAGAGATATTTGGCAGTGTTCATAATGGTGAGAAGA CCAGCTCTTGGACTCCAGCTGAGGAAAACAACAACAACAACAATCATCGTTCACGTTTAGACAAGGTATAGCAACAGCTCCAACACAAGGCCAAGTTGTTCGGCAATTCTATCGATTACTAGAAACTCAAAT;

[0072] Forward primer (SEQ ID NO. 25): GTCCTCACTGCCTGGCTATC; reverse primer (SEQ ID NO. 26): AGAATTGCCGAACAACTTGG.

[0073] The above describes in detail the preferred embodiments of the present invention. It should be understood that those skilled in the art can make numerous modifications and variations based on the concepts of the present invention without inventive effort. Therefore, any technical solutions that can be derived by those skilled in the art through logical analysis, reasoning, or limited experimentation based on the concepts of the present invention and the prior art should be within the scope of protection defined by the claims.

Claims

1. A primer set for amplifying a microsatellite marker locus of Montipora digitata, characterized in that: The digital Montipora microsatellite marker loci include ZH3008, ZH7380, ZH13016, ZH17408, ZH18659, ZH18997, ZH19490, ZH19729 and ZH21570, the nucleotide sequence of ZH3008 is SEQ ID NO.3; the nucleotide sequence of ZH7380 is SEQ ID NO.6; the nucleotide sequence of ZH13016 is SEQ ID NO.9; the nucleotide sequence of ZH17408 is SEQ ID NO.12; the nucleotide sequence of ZH18659 is SEQ ID NO.15; the nucleotide sequence of ZH18997 is SEQ ID NO.18; the nucleotide sequence of ZH19490 is SEQ ID NO.21; the nucleotide sequence of ZH19729 is SEQ ID NO.24; and the nucleotide sequence of ZH21570 is SEQ ID NO.27; The primer pair used to amplify ZH3008 is SEQ ID NO.1-2, the primer pair used to amplify ZH7380 is SEQ ID NO.4-5, the primer pair used to amplify ZH13016 is SEQ ID NO.7-8, the primer pair used to amplify ZH17408 is SEQ ID NO.10-11, the primer pair used to amplify ZH18659 is SEQ ID NO.13-14, the primer pair used to amplify ZH18997 is SEQ ID NO.16-17, the primer pair used to amplify ZH19490 is SEQ ID NO.19-20, the primer pair used to amplify ZH19729 is SEQ ID NO.22-23 and the primer pair used to amplify ZH21570 is SEQ ID NO.25-26.

2. Use of the primer set according to claim 1 in population genetic structure analysis, paternity testing and / or molecular marker-assisted breeding.

Images