A method for constructing a bmp4 gene knock-in mouse model

Abstract

The application provides a method for constructing a Bmp4 gene knock-in mouse model, and the method comprises the following steps: obtaining sgRNA12 shown in SEQ ID NO. 3; mixing the sgRNA12, Cas9 mRNA and a targeting vector shown in SEQ ID NO. 1, and then microinjecting into a mouse zygote to obtain F0 generation mice; selecting F0 generation positive mice in genotype identification results of the F0 generation mice, and mating the F0 generation positive mice with wild type mice to obtain F1 generation mice with stable genotypes; and screening gene targeting mice with correct recombination, and mating the gene targeting mice with retinal specific knock-out tool mice Six3-Cre to obtain Bmp4 gene knock-in model mice. The method has high gene editing efficiency, and the transgenic mouse can highly express human Bmp4 protein.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering technology, and particularly relates to a method for constructing a Bmp4 gene knock-in mouse model. BACKGROUND

[0002] Bone morphogenetic protein (Bmp) is the largest subfamily of transforming growth factor beta protein superfamily. As early as 1965, Marshall Urist et al. found that Bmp had significant bone inductive activity in the decalcified bone matrix. Bmp ligands include Bmp2, Bmp3, Bmp4, Bmp5, Bmp6, Bmp7, GDF5 (Bmp14) and GDF6 (Bmp13). Bmp receptors (Bmpr) include Bmpr1a, Bmpr1b and Bmpr2. Generally, Bmp ligands play a role by binding to Bmp receptors and activating downstream Smad family transcription factors. Bmp signaling pathway has a wide range of effects and is essential for development, such as heart formation, cell apoptosis, neurogenesis, eye formation and musculoskeletal development. Under the influence of the regulated environment, the strength and duration of Bmp signaling pathway are strictly regulated at multiple levels by intracellular and extracellular mechanisms, and the dysfunction of Bmp pathway is the basis for the occurrence of many diseases.

[0003] Bmp4 gene is 7.1 kb in length on the reverse strand of chromosome 14. Bmp4 is widely expressed in the nervous system, urinary system and digestive system, and is a popular research object in multiple fields. Bmp4 is expressed in optic vesicle, optic cup and retina, and defects in Bmp4 gene will lead to congenital anophthalmia and microphthalmia. Bmp4 knockout mice can have abnormal eye development. Bmp4 needs to maintain a certain concentration gradient during the development of the eye, and the concentration of Bmp4 protein is higher on the dorsal side of the eye and lower on the ventral side. Exogenous Bmp4 can inhibit the proliferation of retinal cells, reduce the volume of the retina, and thus affect the occurrence of the eye. Bmp4 causes abnormal eye development, which may be related to the inhibition of eye transcription factor expression and the promotion of cell apoptosis by Bmp4. Studies have shown that inhibitors of Bmp can enhance the expression of eye transcription factors. Studies have also shown that Bmp4 can promote the expression of Tbx family, thereby inducing retinal cell apoptosis and affecting eye development.

[0004] Bmp4 is essential for retinal development. Studies have shown that Bmp4 can participate in the development of the retina through Smad and Id signaling pathways. In addition, Bmp4 has a neuroprotective effect, and studies have reported that the activation of Bmp4 / Smad1 pathway can promote the survival of retinal ganglion cells and axon regeneration.

[0005] Therefore, in order to better explore the influence of Bmp4 on eye development in embryonic period and realize large-scale production in the future, it is necessary to develop a method for constructing a Bmp4 gene knock-in mouse model. SUMMARY

[0006] The application aims to provide a method for constructing a Bmp4 gene knock-in mouse model, which has high gene editing efficiency and can highly express human Bmp4 protein.

[0007] In a first aspect of the application, a targeting vector of a Bmp4 gene knock-in mouse is provided, and the nucleotide sequence of the targeting vector is shown in SEQ ID NO. 1.

[0008] Further, the targeting vector comprises a DNA fragment structure CAGPr-loxP-Stop-loxP-EGE-ZY-002CDS-WPRE-pA shown in SEQ ID NO. 2, wherein the CAG is a promoter, the Pr-loxP-Stop-loxP is a regulatory element, and the EGE-ZY-002CDS-WPRE-pA is an expression element and comprises the homologous arms at the 5' end and the 3' end of EGE-ZY-002CDS.

[0009] In a second aspect of the application, a method for constructing the targeting vector is provided, and the method comprises: connecting the DNA fragment structure shown in SEQ ID NO. 2 into a ROSA public vector to obtain the targeting vector.

[0010] In a third aspect of the application, a specific target site guide RNA for constructing a Bmp4 gene knock-in mouse animal model is provided, and the specific target site guide RNA comprises sgRNA12, and the nucleotide sequence of the sgRNA12 is shown in SEQ ID NO. 3.

[0011] In a fourth aspect of the application, a method for constructing a Bmp4 gene knock-in mouse model is provided, and the method comprises:

[0012] The sgRNA12 and the Cas9 plasmid are respectively transcribed into mRNA in vitro to obtain active sgRNA12 and Cas9 mRNA shown in SEQ ID NO. 3;

[0013] The sgRNA12, the Cas9 mRNA and the targeting vector are mixed and microinjected into a mouse fertilized egg to obtain F0 generation mice; F0 generation mice with positive genotyping results are selected and mated with wild type mice to obtain F1 generation mice with stable genotypes; and the gene targeting mice with correct recombination are screened and mated with the retina-specific knockout tool mouse Six3-Cre to obtain Bmp4 gene knock-in mode mice.

[0014] In a fifth aspect of the present application, a set of nucleic acid molecules for constructing a human-derived Bmp4 transgenic mouse model is provided, and the set of nucleic acid molecules comprises:

[0015] (a) a nucleic acid molecule encoding sgRNA12 with a nucleotide sequence as shown in SEQ ID NO. 3;

[0016] (b) a targeting vector as shown in SEQ ID NO. 1.

[0017] In a sixth aspect of the present application, a Bmp4 gene knock-in mouse model obtained by the method is provided.

[0018] In a seventh aspect of the present application, the Bmp4 gene knock-in mouse model is used for preparing a human-derived Bmp4 protein overexpressing mouse or screening drugs.

[0019] The one or more technical solutions in the embodiments of the present application have at least the following technical effects or advantages:

[0020] The CRISPR / Cas9 system is used to prepare the mouse model, the gene knock-in efficiency is increased by nearly 20 times, the method is fast and convenient, the success rate is improved, the cost is saved, the cycle is shortened, and the industrialization and large-scale commercial application are more beneficial. Finally, a mouse overexpressing Bmp4 in the retina is obtained, which is used to explore the role of Bmp4 protein in the embryonic development of mouse eyes. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0022] Figure 1 It is a schematic diagram of the targeting vector;

[0023] Figure 2 It is a pCS(puro) vector map;

[0024] Figure 3 The results of Cas9 / sgRNA activity detection; wherein con is a negative control group, pc is a positive plasmid control group, sg1-sg18 respectively represent 18 designed sgRNA, blank is a blank control group, no template control;

[0025] Figure 4 The RNA electrophoretogram of sgRNA;

[0026] Figure 5 The targeting vector map;

[0027] Figure 6 The enzyme digestion identification and sequencing map of the targeting vector construction;

[0028] Figure 7 The tail part of F0 generation mouse identification electrophoretogram; wherein Figure 7 A and Figure 7 The primer of B is "ROSA26-GT-new-L-F2 / ROSA26-GT-new-L-R2" in Table 4; Figure 7 The primer of C is "WPRE-F1 / mROSA26-GT-new-R-R1" in Table 4; Figure 7 The primer of D is "WPRE-F2 / mROSA26-GT-new-R-R1" in Table 4;

[0029] Figure 8 The tail of F1 generation mouse identification electrophoretogram; wherein, Figure 8 The primer of A, 8B and 8C is "ROSA26-GT-new-L-F2 / ROSA26-GT-new-L-R2"; Figure 8 The primer of D, 8E and 8F is "WPRE-F2 / mROSA26-GT-new-R-R1"; Figure 8 The primer of G is "ROSA26-GT-F / ROSA26-GT-R"; Figure 8 The primer of H is "3X-F2 / EGE-ZY-002-GT-R"

[0030] Figure 9 The genotype Southern identification result of F1 generation;

[0031] Figure 10After the transgenic mice were successfully constructed, the genotype was verified by gel electrophoresis (A); PCR technology showed that the relative expression of mRNA content of Bmp4, Bmp4 downstream molecules Smad1 / 5 / 9 and Bmp4 receptors Bmpr1a and Bmpr2 in the retina of the mice was significantly increased compared with the control group (B); Western blot technology verified the expression of Bmp4: the expression of Bmp4 and Smad1 / 5 / 9 was higher than that of the control group (C), which proved that the overexpression model was successfully established.

[0032] Figure 11 To observe the effect of retinal overexpression of Bmp4 on microphthalmia, from embryonic period E12.5 days, the eyes of Bmp4-Tg(+);Cre(+) mice were significantly smaller than those of the control group, and at E16.5 days, the eyes of Bmp4-Tg(+);Cre(+) mice were located below the eyelid and skin (A); HE staining showed that the size of the eyes of Bmp4-Tg(+);Cre(+) mice was smaller than that of the control group, and the observed lens, part of the retina was shrunk into a group, R, retina; L, lens (B); Bmp4-Tg(+);Cre(+) mice and Bmp4fl / -mice retinal frozen sections and immunofluorescence staining, Brn3a (green) and DAPI (blue) co-staining, the distribution of RGC cells in Bmp4-Tg(+);Cre(+) mice was abnormal, R, retina; L, lens; INBL, inner neuroblastic layer; ONBL, outer neuroblastic layer (C);

[0033] Figure 12 The map of ROSA public vector. DETAILED DESCRIPTION

[0034] The advantages and various effects of the present application will be more clearly presented hereinafter in conjunction with specific embodiments and examples. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present application, rather than limit the present application.

[0035] Throughout the specification, unless otherwise specifically indicated, the terms used herein are to be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which the present application belongs. If there is a conflict, the present specification takes precedence.

[0036] Unless otherwise specifically stated, the various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or obtained by existing methods.

[0037] Terminology

[0038] Wild type allele (WT): i.e. wild type mouse;

[0039] Targeted allele: refers to positive mice obtained through injection of fertilized eggs, or F1 generation positive heterozygous mice obtained by mating F0 generation positive mice with wild-type mice.

[0040] 1EK37-15: This refers to the mouse's serial number. The numbering principle is as follows: 1 indicates the F1 generation; EK37 is an abbreviation for this research project; -15 indicates the tail-clipping serial number.

[0041] To solve the above-mentioned technical problems, the overall concept of the technical solution of the present invention is as follows:

[0042] Design scheme for Rosa26-CAG-LSL-EGE-ZY-002 gene knock-in mouse model:

[0043] 1. The Gene ID (NCBI) of the Bmp4 (EGE-ZY-002) gene is 652. The nucleotide sequence of wild-type Bmp4 is shown in SEQ ID NO.4.

[0044] 2. Based on the characteristics of the Rosa26 gene, we selected to insert CAG Pr-loxP-Stop-loxP-EGE-ZY-002CDS-WPRE-pA (e.g., at the Rosa26 site of the Bmp4 gene) into the gene. Figure 1 (As shown). The sgRNA was designed to be positioned around the insertion site.

[0045] The target vector designed for knock-in at Rosa26 mainly includes the following functional elements: CAG promoter; Loxp-Stop-Loxp regulatory element; EGE-ZY-002CDS-WPRE-pA expression element; and homologous arms at the 5' and 3' ends, each approximately 2 kb.

[0046] 3. Southern blot identification strategy: To verify the correctness of recombination in F1 mice, we used Southern blot, and simultaneously utilized 5' probe-2 and WPRE(3') probe for verification. The specific design is as follows: 5' probe-2 was used to detect the occurrence of gene recombination. If correct recombination occurred, two bands, wild-type and mutant, would appear; if incorrect recombination did not occur, only the wild-type band would appear. WPRE(3') probe was used to detect whether random insertion was present. If correct recombination occurred, only the target band would appear; if random insertion was present, multiple bands would appear.

[0047] The following will provide a detailed description of the method for constructing a humanized Bmp4 transgenic mouse model according to the present application, in conjunction with embodiments and experimental data.

[0048] Example 1: Construction of a Bmp4 gene knock-in mouse model

[0049] 1. Sequencing confirmation of the target sequence;

[0050] Different strains, target gene sequence may vary. In order to ensure the efficiency of the designed sgRNA, first of all, the C57BL / 6N mouse tail target site sequence needs to be PCR amplified and sequenced to confirm that the sgRNA recognition sequence is completely consistent with the C57BL / 6N mouse tail DNA sequence. The nucleotide sequence of the PCR primer is shown in Table 1:

[0051] Table 1

[0052]

[0053] PCR amplification and sequencing verification of C57BL / 6N mouse tail DNA proved that the C57BL / 6N mouse tail target sequence was completely consistent with the sequence given by Genebank and Ensembl.

[0054] 2. Design and construction of Cas9 / sgRNA plasmid;

[0055] 2.1 Design of Cas9 / sgRNA plasmid;

[0056] Based on the design principle of sgRNA, 18 sgRNAs were designed in the target site region, namely sgRNA1-sgRNA18. The oligo sequences corresponding to the 18 sgRNAs are shown in Table 2:

[0057] Table 2

[0058]

[0059]

[0060] 2.2 Construction of Cas9 / sgRNA plasmid;

[0061] According to the above designed 18 sgRNA sequences, the corresponding primers were synthesized, annealed and polymerized, and then connected into the pCS(puro) vector as shown in Figure 2 The ligation product was transformed and sent for sequencing verification, and the correct sequence was obtained, thereby constructing 18 Cas9 / sgRNA plasmids.

[0062] The method for constructing the Cas9 / sgRNA plasmid is as follows: design sgRNA recognition sequence to synthesize corresponding primers, the primer sequences are shown in Table 3, use ddH2O to configure sgRNA solution, use PCR instrument program: 95℃ for 5min; reduce to 25℃ at a rate of every 5℃ / min; 12℃ hold, after annealing polymerization, connect into the pCS(puro) vector as shown in Figure 2 The connecting product obtained by the experiment is transformed into competent cells, and dozens to hundreds of clones can be obtained, a few single clones are picked and amplified, and a plasmid extraction kit is used to extract the plasmid, and after enzyme digestion verification of sgRNA insertion success, it can be used.

[0063] Table 3

[0064]

[0065] Construction of positive plasmid control group: the sgRNA sequence of the positive plasmid is shown in Table 4, and the construction method is the same as that of Cas9 / sgRNA plasmid.

[0066] Table 4

[0067] sgRNA Sequence (5’-3”) Positive control ACCGACTCGGTGCTGTTCCGGCG

[0068] 3. Activity detection of Cas9 / sgRNA

[0069] A self-developed CRISPR / Cas9 activity detection method-UCATM method is used. It has the advantages of no species limitation, high throughput, wide adaptability, high sensitivity and simplicity. After activity detection of 18 constructed Cas9 / sgRNA plasmids, the detection results are shown in Figure 3

[0070] As can be seen from Figure 3 , the activity and specificity of the 12th Cas9 / sgRNA plasmid are obviously better than those of the other 17 Cas9 / sgRNA plasmids, so the sgRNA12 corresponding to the selected Cas9 / sgRNA plasmid is used for the next step;

[0071] 4. Preparation of sgRNA microinjection RNA

[0072] The sgRNA12 and Cas9 plasmid are in vitro transcribed by MEGAs hortscript T7 kit (Life Technologies) in vitro transcription kit to obtain Cas9 mRNA and active sgRNA12 for microinjection, and are purified and recovered by MEGAClear kit, and the RNA electrophoresis map is as shown in Figure 4 ​As shown, it indicates that sgRNA 12 is successfully transcribed at the desired concentration.

[0073] 5. Construction of targeting vector;

[0074] Firstly, according to the designed targeting scheme, primers are designed, and the targeting vector is constructed. The map of the targeting vector is as shown in Figure 5 As shown, the construction method is as follows:

[0075] Confirm the target sequence, and design primers (the sequences are shown in Table 1).

[0076] Select the target DNA fragment, and connect the DNA fragment structure shown in SEQ ID NO. 2 into the ROSA public vector (purchased from Beijing Bao'osaitu Gene Biotechnology Co., Ltd., the map of the ROSA public vector is as shown in Figure 12 As shown, the nucleotide sequence of the ROSA public vector is shown in SEQ ID NO. 22), and the homologous recombination arm of Bmp4 is obtained by using the ROSA public vector containing the DNA fragment of SEQ ID NO. 2, and the loxp sequence is inserted into the downstream of exon 1 by homologous recombination, thereby obtaining the targeting vector.

[0077] The targeting vector comprises a DNA fragment structure CAG Pr-loxP-Stop-loxP-EGE-ZY-002CDS-WPRE-pA, wherein the nucleotide sequence is shown in SEQ ID NO. 2, wherein the CAG is a promoter, the Pr-loxP-Stop-loxP is a regulatory element; EGE-ZY-002CDS-WPRE-pA is an expression element, and comprises the homologous arms at the 5' end and the 3' end of EGE-ZY-002CDS, and the WPRE comprises a 12bp enzyme cutting site sequence, and there is a 17bp enzyme cutting site sequence between the WPRE and the pA, and the enzyme cutting site is used for subsequent Southern blot identification;

[0078] Then, the obtained targeting vector is subjected to enzyme cutting identification and sequencing by using restriction endonucleases (Mfel and EcoRI, Sacl and BamHI), so as to confirm that the construction of the targeting vector is completed. The results of enzyme cutting identification and sequencing of the targeting vector are as shown in Figure 6 As shown, it indicates that the construction of the targeting vector is successful.

[0079] 6. Preparation of F0 generation mice;

[0080] The Cas9 in vitro transcription active RNA: the Cas9 expression plasmid (Addgene No. 44758) is linearized by enzyme cutting of Age I, purified by phenol chloroform extraction, and dissolved in nuclease-free water as a template for in vitro transcription; the Cas 9 mRNA is synthesized in vitro by T7 RNA polymerase according to the T7 Ultra Kit (Ambion, AM1345) kit.

[0081] The Cas 9 mRNA, the sgRNA12 and the targeting vector are microinjected into mouse zygotes, and the mice born after injection are recorded as F0 generation.

[0082] 7, F0 generation mouse genotype detection:

[0083] The present application adopts the method of injecting zygotes by Cas9 / sgRNA to construct gene knock-in mice; since the early embryonic cleavage speed is very fast, the F0 generation mice obtained are chimeras; therefore, the F0 genotype obtained by identifying the mouse tail of the F0 generation mice is only for reference, and cannot represent that it is a heritable gene mutant type, and the heritable genotype needs to be determined after the mouse tail of the F1 generation is detected.

[0084] 7.1, design F0 generation mouse genotype identification primers. The nucleotide sequences of the PCR primers are shown in Table 5:

[0085] Table 5

[0086]

[0087] The PCR conditions are as follows:

[0088] Table 6

[0089]

[0090] 7.2, the above primers are used to identify the F0 generation mouse tail genotype by using the conventional method in the art, and part of the identification results are shown in Table 6. Figure 7

[0091] Conclusion: the PCR products and sequencing show that EY2-60 (death), EY2-61, EY2-79, EY2-85, EY2-87, EY2-90, EY2-95, EY2-96 and EY2-172 are positive mice, and the positive mice in the F0 generation mouse tail genotype identification results are mated with wild type to obtain F1 generation with stable genotype.

[0092] 8, F1 generation mouse genotype and Southern blot identification;

[0093] 8.1, F1 generation mouse genotype identification; the nucleotide sequences of the PCR primers are shown in Table 7:​

[0094] Table 7

[0095]

[0096]

[0097]

[0098] The PCR conditions are as follows:

[0099] Table 8

[0100]

[0101] Some of the identification results are as follows: Figure 8 As shown. Conclusion: PCR identification and point mutation site sequencing results indicate that 1EY2-42, 1EY2-43, 1EY2-46, 1EY2-47, 1EY2-48, 1EY2-60, 1EY2-61, and 1EY2-70 are positive gene knock-in mice, which are F1 generation PCR positive mice.

[0102] 8.2 Southern blot detection in F1 generation positive homologous recombinant mice;

[0103] DNA was extracted from the tails of F1 generation mice that tested positive by PCR and then subjected to Southern blot analysis and sequencing. The results are as follows: Figure 9 As shown. The test results show that 1EY2-42, 1EY2-43, 1EY2-46, 1EY2-47, 1EY2-48, 1EY2-60, 1EY2-61 and 1EY2-70 are correctly recombined and there are no random insertions.

[0104] 9. In this experiment, Bmp4fl / fl homozygous mice were crossed with Six3-Cre tool mice (https: / / www.jax.org / strain / 019755) to obtain Bmp4fl / -;Six3-Cre mice. The Cre sequence carrying the Six3 promoter expressed Cre enzyme in the mouse retina. After knocking out the LoxP-Stop-LoxP sequence, Bmp4 was conditionally overexpressed in the mouse retina, thus obtaining transgenic mice that overexpress Bmp4 in the retina.

[0105] Example 2, Result Verification

[0106] I. Verification of successful transgenic construction

[0107] 1. Identification of mouse genotypes using PCR amplification and gel electrophoresis techniques. Figure 10A), the mutant allele of the transgenic mice overexpressing Bmp4 in the retina (Bmp4 is 494 bp, Six3-cre is 480 bp, and wild-type GT is 469 bp) was identified by the GT primer pair. Since the Bmp4 overexpression sequence was inserted between the sites corresponding to the GT primer, the GT primer could not amplify a band, and therefore the primer GT was used to identify the presence of the wild-type allele.

[0108] 2. Retinal tissue of littermates of different genotypes was extracted at 14.5 days of embryonic age, and the genomic RNA was reverse transcribed into cDNA for qRT-PCR detection of the Bmp4 mRNA content in the retinas of the two groups of mice: compared with the control group, the Bmp4 mRNA content in the Bmp4-Tg(+); Cre(+) mice was significantly up-regulated, i.e., Bmp4 was successfully overexpressed in the retina Figure 10 B). The Bmp4 protein expression in the retinas of the two groups of mice was then detected by western blot, and the results showed that the Bmp4 protein content in the retinas of the Bmp4-Tg(+); Cre(+) mice was significantly higher than that in the control group Figure 10 C)

[0109] (II) Phenotypic changes of the retina overexpressing Bmp4

[0110] 1. Overexpression of Bmp4 in the retina causes microphthalmia

[0111] From E12.5, the eyes of all Bmp4-Tg(+); Cre(+) mice were significantly smaller than those of the control group, and at E16.5, the microphthalmic eyes were deeply buried under the eyelids and skin and could not be observed. There were no significant differences in the color of the skin, body size, limbs, head, etc. between the two groups of mice Figure 11 A)

[0112] 2. Overexpression of Bmp4 in the retina causes changes in eye structure

[0113] It was found by paraffin sectioning and HE staining that the eyes of the mice overexpressing Bmp4 were significantly smaller than those of the control group, the front end of the optic vesicle failed to correctly fold inward, part of the retina was shrunk into a mass, the vitreous cavity and anterior chamber were severely compressed, but the lens structure could be observed Figure 11 B).

[0114] 3. Overexpression of Bmp4 in the retina causes abnormal distribution of retinal ganglion cells

[0115] The heads of E16.5-day mouse embryos of the control group and the Bmp4-Tg(+); Cre(+) mice were taken for frozen sectioning and immunofluorescence staining to observe the distribution of retinal cells. The results of immunofluorescence staining are shown in Figure 10As shown in FIG. 8B, the anti-Brn3a antibody can label the retinal ganglion cells (green fluorescence). The ganglion cells of the control mice are distributed in the inner layer of the retina, while the ganglion cells of the Bmp4-Tg(+) ; Cre(+) mice are distributed in the outer layer of the retina.

[0116] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, which are not deviated from the spirit and principles of the present application, should be equivalent replacement manners, and are included in the protection scope of the present application.

[0117] Finally, it should be noted that the terms "comprising", "including", or any other variation thereof are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but can also include other elements not expressly listed or inherent to such process, method, article, or apparatus. Although preferred embodiments of the present application have been described, those skilled in the art, once aware of the basic inventive concept, can make additional changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application. Obviously, those skilled in the art can make various modifications and changes to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and changes of the present application fall within the scope of the claims of the present application and their equivalent technologies, the present application also intends to include these modifications and changes.

Claims

1. A targeting vector for Bmp4 knock-in mice, characterized in that, The nucleotide sequence of the targeting vector is shown as SEQ ID NO.

1.

2. The targeting vector of the Bmp4 knock-in mouse according to claim 1, wherein, The targeting vector comprises a DNA fragment structure CAG Pr-loxP-Stop-loxP-EGE-ZY-002 CDS-WPRE-pA, wherein the CAG is a promoter, the Pr-loxP-Stop-loxP is a regulatory element, the EGE-ZY-002 CDS-WPRE-pA is an expression element, and comprises homologous arms at the 5' end and the 3' end of EGE-ZY-002 CDS, and the nucleotide sequence of the DNA fragment structure is shown as SEQ ID NO.

2.

3. A method for constructing a targeting vector according to claim 1 or 2, characterized by, The method comprises: connecting the DNA fragment structure shown as SEQ ID NO. 2 into a ROSA public vector to obtain the targeting vector.

4. A method for constructing a Bmp4 knock-in mouse model, comprising the steps of, The method comprises: The sgRNA12 and the Cas9 plasmid are respectively transcribed into mRNA in vitro to obtain active sgRNA12 and Cas9 mRNA, the nucleotide sequence of the nucleic acid molecule encoding the sgRNA12 is shown as SEQ ID NO. 3; The sgRNA12, the Cas9 mRNA and the targeting vector of claim 1 are mixed and then microinjected into a mouse zygote to obtain F0 generation mice; The F0 generation positive mice in the genotype identification results of the F0 generation mice are selected, and are mated with wild type mice to obtain F1 generation mice with stable genotypes; and the mice with correct recombination are screened out, and are mated with the retina-specific knockout tool mouse Six3-Cre to obtain Bmp4 gene knock-in mode mice.

5. A set of nucleic acid molecules for constructing a Bmp4 knock-in mouse model, comprising, The nucleic acid molecule set comprises: (a) a nucleic acid molecule encoding sgRNA12, the nucleotide sequence of which is shown as SEQ ID NO. 3; (b) the targeting vector shown as SEQ ID NO.

1.

6. The use of the Bmp4 gene knock-in mouse model obtained by the method of claim 4 in the preparation of a human-derived BMP4 protein overexpression or drug screening.

Images