Method for identifying a methomyl-resistant gene in spodoptera frugiperda, dsrna and application thereof

By identifying the emamectin benzoate resistance gene in fall armyworm through genome and transcriptome sequencing, and designing dsRNA to interfere with fall armyworm's emamectin benzoate resistance, the problem of fall armyworm's resistance to emamectin benzoate was solved, and an effective resistance regulation and control strategy was realized.

CN116179665BActive Publication Date: 2026-05-05YUNNAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310110986.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-14
Publication Date
2026-05-05
Estimated Expiration
2043-02-14

AI Technical Summary

Technical Problem

The fall armyworm has developed resistance to emamectin benzoate (emamectin benzoate), but existing research lacks reports on the resistance mechanism, which increases the difficulty of control.

Method used

Key resistance genes to abamectin in fall armyworm were identified by genome resequencing and transcriptome sequencing. dsRNA was designed to interfere with abamectin resistance in fall armyworm, and RNAi technology was used to regulate its resistance.

Benefits of technology

Effectively reducing the fall armyworm's resistance to abamectin and delaying the development of resistance provides a new target for fall armyworm control, which has important practical significance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179665B_ABST
    Figure CN116179665B_ABST
Patent Text Reader

Abstract

This invention provides a method for identifying abamectin resistance genes in the fall armyworm, dsRNA, and their applications, belonging to the field of molecular biology. This invention combines genome resequencing and transcriptome sequencing to identify key abamectin resistance genes in the fall armyworm. Based on the conserved mRNA sequences of the key resistance genes GSTD6 and CTP6A18, dsRNA was designed, and RNAi technology can effectively reduce the fall armyworm's resistance to abamectin. This has significant practical implications for developing effective fall armyworm resistance management strategies to delay the emergence of resistance and for identifying new targets for pest control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a method for identifying abamectin resistance genes in the fall armyworm, dsRNA, and their applications. Background Technology

[0002] fall armyworm ( Spodoptera frugiperda The fall armyworm (PMO) is a major transboundary migratory pest under global early warning by the Food and Agriculture Organization of the United Nations (FAO). Its larvae can damage more than 350 plant species, including corn, wheat, and rice. Currently, chemical control is still the primary method for controlling the fall armyworm both domestically and internationally, characterized by its rapid effectiveness and low cost. Emamectin benzoate (emamectin benzoate) is a semi-synthetic, highly effective, and low-toxicity biopesticide that has been used to control pests in vegetables, fruit trees, and cotton. Studies have shown that emamectin benzoate has a strong toxic effect on the fall armyworm, with a corrected mortality rate exceeding 90%. Field efficacy trials have found that emamectin benzoate has excellent rapid and sustained effects against the fall armyworm, superior to other pesticides, and can be considered one of the preferred pesticides for controlling the fall armyworm.

[0003] However, the fall armyworm has not only developed resistance to many traditional chemical pesticides, but investigations into the resistance of fall armyworm populations in Foshan, Maoming, and Shaoguan cities in Guangdong Province have also revealed varying degrees of resistance to the novel bio-based insecticide abamectin. Current research on the effects of abamectin on the fall armyworm mainly focuses on toxicity effects and resistance genetics, while research on resistance mechanisms is still scarce. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide an identification of abamectin resistance genes in fall armyworm, dsRNA, and their applications. This invention combines genome resequencing and transcriptome sequencing to identify key abamectin resistance genes in fall armyworm, and regulates fall armyworm resistance to abamectin by RNA interference of these key resistance genes. The dsRNA provided by this invention can effectively regulate fall armyworm resistance to abamectin, which has important practical significance for developing effective fall armyworm resistance management strategies to delay the emergence of resistance and for identifying new targets for pest control.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] A method for identifying abamectin resistance genes in the fall armyworm includes the following steps:

[0007] S1. Genome resequencing analysis of abamectin-resistant and susceptible populations; S2. Transcriptome sequencing analysis of resistant and susceptible populations;

[0008] S3. Identification of drug resistance-related candidate genes: Cross-link the drug resistance-related genomic regions obtained in S1 with the differentially expressed genes obtained in S2 to find candidate drug resistance-related genes that cross over between the two.

[0009] S4. Quantitative real-time PCR was used to verify the difference in expression levels of candidate resistance-related genes in abamectin-resistant and susceptible fall armyworm lines.

[0010] A dsRNA that regulates emamectin benzoate resistance in fall armyworm, identified by the identification method described above, wherein the dsRNA is dsRNA-1 or dsRNA-2; wherein dsRNA-1 is transcribed from a nucleotide sequence as shown in SEQ ID NO: 1; and dsRNA-2 is transcribed from a nucleotide sequence as shown in SEQ ID NO: 2.

[0011] The present invention also provides a template DNA for synthesizing dsRNA-1 or dsRNA-2 as described in the above scheme, wherein the nucleotide sequence of the template mRNA of dsRNA-1 is shown in SEQ ID NO: 1, and the nucleotide sequence of the template mRNA of dsRNA-2 is shown in SEQ ID NO: 2.

[0012] The present invention also provides the application of the dsRNA or template mRNA described in the above scheme in regulating the emamectin benzoate resistance of fall armyworm.

[0013] The present invention also provides the application of the dsRNA or template mRNA described above in the preparation of a product for regulating the emamectin benzoate resistance of fall armyworm.

[0014] The present invention also provides the application of the dsRNA or template mRNA described in the above scheme in the control of fall armyworm.

[0015] The present invention also provides the application of the dsRNA or template mRNA described above in the preparation of products for controlling fall armyworm.

[0016] The present invention also provides a method for regulating the emamectin benzoate resistance of fall armyworm, wherein the method comprises: introducing the dsRNA described in the above scheme into the fall armyworm.

[0017] Beneficial Technical Effects: This invention provides a method for identifying abamectin resistance genes in the fall armyworm, dsRNA, and their applications. This invention, combining genome resequencing and transcriptome sequencing, identifies key abamectin resistance genes in the fall armyworm and, based on these key resistance genes… GSTD6 and CYP6A18Based on the conserved mRNA sequence, dsDNA was designed, and RNAi technology can effectively reduce the resistance of fall armyworm to abamectin. This has important practical significance for developing effective fall armyworm resistance management strategies to delay the emergence of resistance and for identifying new targets for pest control. Attached Figure Description

[0018] Figure 1 Manhattan plot of FST value distribution across the entire genome;

[0019] Figure 2 Results of genome-wide selective sweep analysis;

[0020] Figure 3 Volcano plot for differentially expressed genes;

[0021] Figure 4 The expression status of 6 genes is shown; among them, Figure 4 A is; Figure 4 B represents the changes in the expression levels of six genes in the fall armyworm after treatment with different lethal concentrations of abamectin;

[0022] Figure 5 for GSTD6 and CYP6A18 The expression of; among them, Figure 5 A and 5B respectively represent GSTD6 and CYP6A18 Differences in expression levels across different tissues; 5C and 5D represent ds GSTS6 and ds CYP6A18 RNAi interference efficiency; 5E represents the mortality rate of fall armyworm under emamectin benzoate stress after RNAi treatment; different letters indicate significant differences using the Tukey honestly significant difference multiple range test. P < 0.05); the asterisk indicates a significant difference obtained using Student's t-test (* P < 0.05,** P < 0.01). Detailed Implementation

[0023] This invention provides a method for identifying abamectin resistance genes in the fall armyworm, comprising the following steps:

[0024] Genome resequencing analysis of S1, abamectin-resistant and susceptible populations;

[0025] Transcriptome sequencing analysis of S2, drug-resistant populations and susceptible populations;

[0026] S3. Identification of drug resistance-related candidate genes: Cross-link the drug resistance-related genomic regions obtained in S1 with the differentially expressed genes obtained in S2 to find candidate drug resistance-related genes that cross over between the two.

[0027] S4. Quantitative real-time PCR was used to verify the difference in expression levels of candidate resistance-related genes in abamectin-resistant and susceptible fall armyworm lines.

[0028] This invention provides genome resequencing analysis of abamectin-resistant and susceptible populations.

[0029] In this invention, the emamectin benzoate resistant and susceptible populations are fall armyworms collected from maize in Yuanjiang County, Yunnan Province (101°58′E, 23°35′N, altitude 421 m). After being preserved in the laboratory, they underwent continuous emamectin benzoate resistance selection. The resistant population is the population with a resistance level of 27.1 times that of emamectin benzoate, and the susceptible population is the population that has not been subjected to any insecticide stress and shows sensitivity to emamectin benzoate.

[0030] In this invention, the genome resequencing analysis includes: comparing the positions of sequencing reads obtained from resequencing on a reference genome, statistically analyzing sequencing depth, genome coverage, and other information for each sample, and detecting SNPs and InDel (insertion / deletion) variants; using the Euclidean Distance (ED) algorithm to obtain candidate genomic regions, then annotating, performing GO enrichment analysis, and KEGG enrichment analysis on genes within these candidate regions, and further analyzing the functions of these candidate genes. The reference genome in this invention is based on the chromosome-level genome of *S. fall armyworm* (GCA_011064685.1, ZJU_Sfru_1.0) completed by Zhejiang University.

[0031] This invention relates to transcriptome sequencing analysis of drug-resistant and drug-sensitive populations.

[0032] In this invention, the transcriptome sequencing analysis is used to identify differentially expressed genes in drug-resistant populations relative to susceptible populations. These differentially expressed genes are then annotated, subjected to GO enrichment analysis, and KEGG enrichment analysis.

[0033] The present invention identifies candidate genes related to drug resistance by cross-linking the obtained resistance-related genomic regions with the obtained differentially expressed genes to find candidate resistance-related genes that cross over between the two.

[0034] In this invention, the candidate resistance-related genes that cross between the two include LOC118279731, which belongs to the P450 gene family (cytochrome P450 6B7-like gene), LOC118270337, which belongs to the ABC gene family (ABC transporterG family member 20-like gene), and four genes belonging to the GST gene family (Glutathione S-transferase family): LOC118277779, LOC118269545, LOC118270053, and LOC118277773.

[0035] This invention utilizes quantitative real-time PCR to verify the differences in expression levels of candidate resistance-related genes in abamectin-resistant and susceptible fall armyworm strains.

[0036] In this invention, primers for six candidate genes were designed, and quantitative real-time qRT-PCR was used to verify the expression differences of the six genes in the emamectin benzoate-resistant (Em-R) and susceptible (Em-Sus) fall armyworm strains. The nucleotide sequences of the primers for the six candidate genes are shown in Table 1.

[0037] Table 1. qRT-PCR primer sequences for the six candidate genes.

[0038]

[0039]

[0040] The present invention also provides a dsRNA for regulating emamectin benzoate resistance in fall armyworm identified by the identification method described above, wherein the dsRNA is dsRNA-1 or dsRNA-2; wherein dsRNA-1 is transcribed from a nucleotide sequence as shown in SEQ ID NO: 1; and dsRNA-2 is transcribed from a nucleotide sequence as shown in SEQ ID NO: 2.

[0041] In this invention, the nucleotide sequence shown in SEQ ID NO: 1 is preferably that of the fall armyworm. GSTD6 The CDS sequence of the gene; the nucleotide sequence shown in SEQ ID NO: 2 is preferably that of the fall armyworm. CYP6A18 CDS sequence of the gene.

[0042] The present invention also provides a template DNA for synthesizing dsRNA-1 or dsRNA-2 as described in the above scheme, wherein the nucleotide sequence of the template mRNA of dsRNA-1 is shown in SEQ ID NO: 1, and the nucleotide sequence of the template mRNA of dsRNA-2 is shown in SEQ ID NO: 2.

[0043] In this invention, the template for dsRNA-1 is the fall armyworm. GSTD6 The CDS sequence of the gene; the template for the dsRNA-2 is the fall armyworm. CYP6A18 CDS sequence of the gene.

[0044] The present invention also provides the application of the dsRNA or template mRNA described in the above scheme in regulating the emamectin benzoate resistance of fall armyworm.

[0045] In this invention, there is no special limitation on the type of application; any application type acceptable to dsRNA or template mRNA can be used.

[0046] The present invention also provides the application of the dsRNA or template mRNA described above in the preparation of a product for regulating the emamectin benzoate resistance of fall armyworm.

[0047] In this invention, there is no particular limitation on the type of product, nor on the preparation method of the product; any preparation method suitable for the product can be used. Furthermore, there is no particular limitation on the content of dsRNA or template mRNA in the product; any content of conventional dsRNA or template mRNA in the product can be used.

[0048] The present invention also provides the application of the dsRNA or template mRNA described in the above scheme in the control of fall armyworm.

[0049] In this invention, there is no special limitation on the type of application; any application type acceptable to dsRNA or template mRNA can be used.

[0050] The present invention also provides the application of the dsRNA or template mRNA described above in the preparation of products for controlling fall armyworm.

[0051] In this invention, there is no particular limitation on the type of product, nor on the preparation method of the product; any preparation method suitable for the product can be used. Furthermore, there is no particular limitation on the content of dsRNA or template mRNA in the product; any content of conventional dsRNA or template mRNA in the product can be used.

[0052] The present invention also provides a method for regulating the abamectin resistance of fall armyworm, wherein the method comprises: injecting the dsRNA described in the above scheme into the fall armyworm.

[0053] In this invention, the preferred amount of dsRNA introduced is 3 μg to 5 μg.

[0054] To better understand the present invention, the following embodiments further illustrate the content of the present invention, but the content of the present invention is not limited to the following embodiments.

[0055] Unless otherwise specified, the experimental methods used in the embodiments of this invention are all conventional methods.

[0056] Unless otherwise specified, all materials and reagents used in the embodiments of this invention are commercially available.

[0057] Example 1: Identification of abamectin resistance genes in fall armyworm

[0058] (1) Genome resequencing analysis of abamectin-resistant and susceptible populations

[0059] Fifty 3rd instar larvae from the abamectin-resistant population and 50 larvae from the susceptible population were randomly selected, and genomic DNA was extracted from each larva. The larvae were then pooled in equal amounts and their genomes were resequencing using Illumina HiSeq. The genome of the fall armyworm at the chromosome level, as completed by our research group, was used as a reference. The positions of the resequencing reads obtained by the resequencing were compared with those of the reference genome. The sequencing depth, genome coverage, and other information of each sample were statistically analyzed, and SNPs and InDel (insertion / deletion) variants were detected.

[0060] Candidate genomic regions were obtained using the Euclidean Distance (ED) algorithm. Genes within these regions were then annotated, subjected to GO enrichment analysis and KEGG enrichment analysis, and their functions were further analyzed.

[0061] Genome-wide selective sweep analysis was performed using a 10k window and 2k sliding strategy, and the results are as follows: Figure 1 As shown, by Figure 1 It can be seen that the average FST value of the whole genome in the CK and emamectin benzoate (EB) samples is 0.400. After Z-transformation of the FST values ​​of all genomic regions, analysis of the Z-value distribution revealed that, in addition to the large number of regions with the median Z-value, there were also peaks in the number of regions with the minimum and maximum Z-values. Figure 2Genomic regions with FST values ​​of 0 (undifferentiated) and 1 (fully differentiated) also accounted for a significant proportion. Among them, regions with fully differentiated FST values ​​(FST=1) and ≥20 SNP sites numbered 8599, accounting for 3.55% of the total genomic regions. These genomic regions contained 806 annotated genes (including 5k intergenic regions upstream and downstream of the genes), which can be considered as candidate genes with high differentiation in emamectin benzoate (EB) samples.

[0062] (2) Transcriptome sequencing analysis of drug-resistant and susceptible populations

[0063] Thirty third-instar larvae from an abamectin-resistant population and 30 from a susceptible population were randomly selected. Total RNA was extracted from each larva, and pooled in equal amounts of 10 larvae per pool. Three biological replicates were set up for each population, and transcriptome sequencing was performed to identify differentially expressed genes between the resistant and susceptible populations. The differentially expressed genes were then annotated, and GO and KEGG enrichment analyses were conducted.

[0064] Transcriptome sequencing of abamectin-resistant and susceptible populations identified 3144 differentially expressed genes, including 1618 upregulated genes and 1526 downregulated genes. The transcriptome sequencing analysis results are as follows: Figure 3 As shown.

[0065] (3) Identification of candidate genes related to drug resistance

[0066] Differentially expressed genes obtained from transcriptome analysis were correlated with resistance-related genomic regions obtained from genome resequencing analysis, identifying six candidate resistance-related genes with overlapping regions. These include LOC118279731 (a cytochrome P450 6B7-like gene), LOC118270337 (an ABC transporter G family member 20-like gene), and four genes belonging to the GST gene family (Glutathione S-transferase family): LOC118277779, LOC118269545, LOC118270053, and LOC118277773. The nucleotide sequence of LOC118279731 is shown in SEQ ID NO: 2; the nucleotide sequence of LOC118270337 is shown in SEQ ID NO: 33; and the nucleotide sequence of LOC118277779 is shown in SEQ ID NO: 33. The nucleotide sequence of LOC118269545 is shown in SEQ ID NO: 34; the nucleotide sequence of LOC118270053 is shown in SEQ ID NO: 35; and the nucleotide sequence of LOC118277773 is shown in SEQ ID NO: 36.

[0067] (4) Differences in the expression levels of resistance-related genes

[0068] Based on the primers for the six candidate genes in Table 1, quantitative real-time PCR was used to verify the difference in expression levels of the six genes in the emamectin benzoate-resistant (Em-R) and susceptible (Em-Sus) fall armyworm lines. The quantitative real-time PCR experimental method is as follows:

[0069] ① Extraction of total RNA:

[0070] RNA was extracted according to the instructions of the Omega Total RNA Extraction Kit: Fall armyworm samples were mixed and placed in a 1.50 mL EP tube and frozen in liquid nitrogen. The insects were then quickly ground into powder using a grinding rod. 1 mL of RNA-Solv™ Reagent was added to the EP tube, and the mixture was gently pipetted until homogeneous. The mixture was incubated at room temperature for 2-3 minutes. 200 μL of chloroform (trichloromethane) was added to the EP tube, and the mixture was vigorously shaken for 15 seconds to ensure thorough mixing. The mixture was then incubated on ice for 10 minutes. The mixture was centrifuged at 12,000 g for 15 minutes at 4°C. Approximately 80% of the supernatant was transferred to a new 1.5 mL EP tube (avoiding aspirating any liquid outside the supernatant). Half a volume of anhydrous ethanol was added, and the mixture was vigorously shaken for 15 seconds. The mixture was placed on an RNA filter column and centrifuged at 10,000 g for 1 minute at room temperature. The filtrate was discarded. 300 μL of RNA Wash Buffer was added to the RNA filter column. First, centrifuge at 10,000g for 1 min at room temperature, discard the filtrate; then add 400 μL of RNA Wash Buffer I, centrifuge at 10,000g for 1 min at room temperature, discard the filtrate; then add 500 μL of RNA Wash Buffer II, centrifuge at 10,000g for 1 min at room temperature, discard the filtrate. Centrifuge at 13,000g for 2 min at room temperature, discard the liquid in the RNA filter column; place the RNA filter column into a new 1.5 mL EP tube, then add 20 μL~30 μL of DEPC water preheated to 65℃, incubate at room temperature for 3 min, centrifuge at 13,000g for 2 min, and collect the RNA; the collected RNA is analyzed for concentration and purity by gel electrophoresis and Nanodrop2000 spectrophotometer.

[0071] ② Synthesis of the first strand of cDNA

[0072] Total RNA was reverse transcribed into cDNA according to the instructions of Takara's PrimeScript RT reagent Kit with gDNA Eraser. The reaction product was stored at -20°C.

[0073] ③ Real-time PCR

[0074] The SYBR Premix Ex Taq Kit was purchased from Roche. Six gene-specific primers and an internal control primer for EF1α were designed for quantitative PCR detection. The following quantitative PCR reaction program was run using a Roche LightCycler 480: pre-denaturation at 95℃ for 5 min; then the following PCR reaction was performed: 95℃, 10 s; 58℃, 20 s; 72℃, 20 s; for a total of 40 cycles. After the reaction, the CT values ​​for each well were exported to an Excel spreadsheet. −△△CT The relative expression level is calculated using this method.

[0075] The results are as follows Figure 4 As shown in A, by Figure 4 As can be seen from A, except for LOC118270337, the mRNA expression levels of the other five genes were significantly higher in Em-R than in Em-Sus. Among them, the difference was most significant in the LOC118277779 gene (further annotation results show that this gene is GSTD6).

[0076] Treatment with 0.1% Triton X-100 solution was used as a control, and LC-MS treatment with abamectin was performed. 10 LC 30 and LC 50 Em-Sus fall armyworm larvae were treated separately. Surviving larvae were collected 24 hours later, with five larvae per treatment, for a total of four replicates. Total RNA was extracted from the collected samples, and quantitative real-time PCR was performed to investigate the changes in the expression levels of six genes in fall armyworms after treatment with different lethal concentrations of abamectin. Results are as follows: Figure 4 As shown in B, by Figure 4 As can be seen from B, except for LOC118270337, emamectin benzoate LC 50 All treatments significantly induced the expression of the remaining five genes, with the LOC118279731 gene (further annotation results indicate this gene is CYP6A18) showing the highest expression under LC treatment. 10 LC 30 and LC 50 The expression levels of both the treated and control groups increased significantly after treatment.

[0077] Example 2: Extraction of total RNA and synthesis of the first strand of cDNA

[0078] (1) Fall armyworm sample

[0079] Fall armyworms were collected in 2019 from a cornfield in Yuanjiang County, Yunnan Province (101°58′E, 23°35′N, 421m altitude) and reared in a laboratory artificial climate chamber.

[0080] (2) Extraction of total RNA from fall armyworm

[0081] Total RNA was extracted according to the total RNA extraction method described in Example 1.

[0082] (3) Synthesis of the first strand of cDNA

[0083] Total RNA was reverse transcribed into cDNA according to the instructions of Takara's PrimeScript RT reagent Kit with gDNA Eraser, and the reaction product was stored at -20°C.

[0084] Example 3 Synthesis of dsRNA-1 of the GSTD6 gene of fall armyworm

[0085] fall armyworm GSTD6 The dsRNA-1 gene was synthesized using the T7 RiboMAX™ Express RNAiSystem kit.

[0086] (1) Design of fall armyworm GSTD6 The primers for the gene, and their nucleotide sequences are shown in SEQ ID NO: 3~SEQ ID NO: 6, specifically:

[0087] SEQ ID NO: 3:

[0088] GGATCCTAATACGACTCACTATAGG TGATTCAACGCGAACACTTCAG;

[0089] SEQ ID NO: 4:

[0090] GGATCCTAATACGACTCACTATAGG CCAGGCAGATAATTTGGGATACAG;

[0091] SEQ ID NO: 5: GATTCAACGCGAACACTTCAG;

[0092] SEQ ID NO: 6: AGGCAGATAATTTGGGATACAG;

[0093] Among them, SEQ ID NO: 3 is the forward primer T7-GSTD6-F containing the T7 promoter, SEQ ID NO: 4 is the reverse primer T7-GSTD6-R containing the T7 promoter; SEQ ID NO: 5 is the forward primer GSTD6-F, and SEQ ID NO: 6 is the reverse primer GSTD6-R;

[0094] Primers for cloning the GSTD6 gene of the fall armyworm were synthesized by Qingke Biotechnology Co., Ltd.

[0095] (2) Fall armyworm was obtained by amplification using the above SEQ ID NO: 3~SEQ ID NO: 6. GSTD6 Gene sequence.

[0096] Amplification of the positive strand ssRNA: PCR reaction system: 25 μL TaKaRa Ex Taq; 1 μL cDNA; 1.5 μL T7-GSTD6-F; 1.5 μL GSTD6-R; 21 μL ddH2O.

[0097] Amplification of antisense ssRNA: PCR reaction system: 25 μL TaKaRa Ex Taq; 1 μL cDNA; 1.5 μL GSTD6-F; 1.5 μL T7-GSTD6-R; 21 μL ddH2O.

[0098] PCR reaction program: 98℃, 10 sec; 53℃, 30 sec; 72℃, 45 sec; repeat the above 3 steps for 30 cycles; 72℃, 5 min.

[0099] PCR reaction products were stored at -20°C for later use.

[0100] (3) Gel purification

[0101] Refer to the instructions for the TIANGEN Universal DNA Purification Kit (catalog number: DP214).

[0102] (4) Transcription and synthesis of GSTD6 ssRNA

[0103] Reaction component amounts: RiboMax™ Express T7 2x buffer 10 μL; DNA template 8 μL; Enzyme Mix, T7 Express 2 μL; mix well and incubate at 37°C for 4 hours.

[0104] (5) Annealing synthesis of GSTD6 dsRNA

[0105] Mix 20 μL of sense strand ssRNA with 20 μL of antisense strand ssRNA in equal volumes; incubate at 70°C for 10 min, then let stand at room temperature for 20 min; add 20 μL of RNase A solution (1:200) and 2 μL of RNase-Free DNase, and incubate at 37°C for 30 min.

[0106] (6) Purification of GSTD6 dsRNA

[0107] Add 4.4 μL of 3M sodium acetate (pH=5.2) and 110 μL of 95% ethanol, mix gently, and incubate on ice for 5 min; centrifuge at 14000 rpm and 4°C for 10 min, and discard the supernatant; add 500 μL of 70% ethanol, centrifuge at 14000 rpm and 4°C for 10 min, and discard the supernatant; allow to dry for 5 min, dilute the dsRNA with 50 μL of ddH2O, and store at -20°C.

[0108] Example 4: Synthesis of Fall Armyworm CYP6A18 dsRNA-2 of the gene

[0109] fall armyworm CYP6A18 The dsRNA-1 gene was synthesized using the T7 RiboMAX™ Express RNAiSystem kit.

[0110] (1) Design of fall armyworm CYP6A18 The primers for the gene, and their nucleotide sequences are shown in SEQ ID NO: 7~SEQ ID NO: 10, specifically:

[0111] SEQ ID NO: 7:

[0112] GGATCCTAATACGACTCACTATAGG GTGGAACGAGCGGAGAAGC;

[0113] SEQ ID NO: 8:

[0114] GGATCCTAATACGACTCACTATAGG CGAACCCAGCAGCGAAGA;

[0115] SEQ ID NO: 9: GTGGAACGAGCGGAGAAGC;

[0116] SEQ ID NO: 10: CGAACCCAGCAGCGAAGA;

[0117] Wherein, SEQ ID NO: 7 is the forward primer T7-CYP6A18-F containing the T7 promoter, SEQ ID NO: 8 is the reverse primer T7-CYP6A18-R containing the T7 promoter; SEQ ID NO: 9 is the forward primer CYP6A18-F, and SEQ ID NO: 10 is the reverse primer CYP6A18-R;

[0118] Primers for cloning the CYP6A18 gene of the fall armyworm were synthesized by Qingke Biotechnology Co., Ltd.

[0119] (2) Fall armyworm was obtained by amplification using the above SEQ ID NO: 7~SEQ ID NO: 10. CYP6A18 Gene sequence.

[0120] Amplification of the positive strand ssRNA: PCR reaction system: 25 μL TaKaRa Ex Taq; 1 μL cDNA; 1.5 μL T7-CYP6A18-F; 1.5 μL CYP6A18-R; 21 μL ddH2O.

[0121] Amplification of antisense ssRNA: PCR reaction system: 25 μL TaKaRa Ex Taq; 1 μL cDNA; 1.5 μL LCYP6A18-F; 1.5 μL T7-CYP6A18-R; 21 μL ddH2O.

[0122] PCR reaction program: 98℃, 10 sec; 53℃, 30 sec; 72℃, 45 sec; repeat the above 3 steps for 30 cycles; 72℃, 5 min.

[0123] PCR reaction products were stored at -20°C for later use.

[0124] (3) Gel purification

[0125] Refer to the instructions for the TIANGEN Universal DNA Purification Kit (catalog number: DP214).

[0126] (4) Transcription and synthesis of CYP6A18 ssRNA

[0127] Reaction component amounts: RiboMax™ Express T7 2x buffer 10 μL; DNA template 8 μL; Enzyme Mix, T7 Express 2 μL; mix well and incubate at 37°C for 4 hours.

[0128] (5) Annealing synthesis of CYP6A18 dsRNA

[0129] Mix 20 μL of sense strand ssRNA with 20 μL of antisense strand ssRNA in equal volumes; incubate at 70°C for 10 min, then let stand at room temperature for 20 min; add 20 μL of RNase A solution (1:200) and 2 μL of RNase-Free DNase, and incubate at 37°C for 30 min.

[0130] (6) Purification of CYP6A18 dsRNA

[0131] Add 4.4 μL of 3M sodium acetate (pH=5.2) and 110 μL of 95% ethanol, mix gently, and incubate on ice for 5 min; centrifuge at 14000 rpm and 4°C for 10 min, and discard the supernatant; add 500 μL of 70% ethanol, centrifuge at 14000 rpm and 4°C for 10 min, and discard the supernatant; allow to dry for 5 min, dilute the dsRNA with 50 μL of ddH2O, and store at -20°C.

[0132] Example 5: Determination of dsRNA injection and subsequent resistance of fall armyworm to abamectin.

[0133] (1) Preparation of dsGFP of green fluorescent protein:

[0134] The GFP fragment amplification template was obtained from a laboratory-preserved plasmid. The specific nucleotide sequences of the amplification primers are shown in SEQ ID NO: 29~SEQ ID NO: 32, where SEQ ID NO: 29 is the forward primer T7GFP-F containing the T7 promoter; SEQ ID NO: 30 is the reverse primer T7GFP-R containing the T7 promoter; SEQ ID NO: 31 is the forward primer GFP-F; and SEQ ID NO: 32 is the reverse primer GFP-R. The specific synthesis method is as follows... GSTD6 and CYP6A18 Same.

[0135] SEQ ID NO 29:

[0136] GGATCCTAATACGACTCACTATAGGAAGGGCGAGGAGCTGTTCACCG;

[0137] SEQ ID NO 30:

[0138] GGATCCTAATACGACTCACTATAGGCAGCAGGACCATGTGATCGCGC;

[0139] SEQ ID NO 31: AAGGGCGAGGAGCTGTTCACCG;

[0140] SEQ ID NO 32: CAGCAGGACC ATGTGATCGCGC.

[0141] (2) Two hundred and fifty fall armyworms of uniform size (weight range 80-100 mg) in their early fourth instar were randomly divided into three groups. Green fluorescent protein (GFP) and target genes (GSTD6, ​​CYP6A18) dsRNA were injected into the body cavity of the fall armyworms via microinjection. Each fall armyworm was injected with 4 μg of dsRNA (2 μg / μL), with GFP injection serving as the control group. The injected fall armyworms were placed under normal rearing conditions. After 24 hours, they were examined. Fall armyworms that died due to improper handling (mortality rate <10%) were discarded. Surviving fall armyworms (three technical replicates per treatment, three moths per replicate) were dissected, and their heads, epidermis, fat bodies, intestines, and hemolymph were collected. RNA was extracted from each part of the fall armyworm to observe the expression of GSTD6 or CYP6A18 in different parts of the body. The differences in expression levels of GSTD6 and CYP6A18 in different tissues are shown below. Figure 5 A and Figure 5 As shown in B. Figure 5 A and Figure 5 As shown in Figure B, GSTD6 was most highly expressed in the epidermis after injection, significantly higher than its expression levels in the head, fat body, intestine, and hemolymph; CYP6A18 was also most highly expressed in the epidermis, significantly higher than its expression levels in the head, fat body, intestine, and hemolymph.

[0142] The dsRNA interference efficiency was detected by real-time quantitative PCR. The conditions for real-time quantitative PCR were as follows:

[0143] The SYBR Premix Ex Taq Kit was purchased from Roche. Specific primers for the GSTD6 and CYP6A18 genes, as well as the internal reference gene EF1α-F primers, were designed for quantitative real-time PCR detection. The nucleotide sequences of the primers are shown in Table 2.

[0144] Table 2. Primer list for qRT-PCR

[0145]

[0146] The following quantitative PCR reaction program was run using a Roche LightCycler 480: Pre-denaturation at 95°C for 5 min; then the following PCR reaction was performed: 95°C, 10 s; 58°C, 20 s; 72°C, 20 s; for a total of 40 cycles. After the reaction, the CT values ​​for each well were exported to an Excel spreadsheet. The relative expression level is calculated using this method.

[0147] The interference effect of dsRNA is as follows Figure 5 As shown in C and 5D. (By...) Figure 5As shown in C and 5D, compared with the control larvae injected with dsGFP, the expression levels of GSTD6 or CYP6A18 in the fall armyworm injected with dsGSTD6 or dsCYP6A18 were significantly reduced.

[0148] (2) Determination of the resistance of fall armyworm to abamectin after injection

[0149] Fall armyworms were collected 24 hours after injection for abamectin toxicity testing, and mortality rates were recorded 24 hours later. Each treatment consisted of 15 insects, with three technical replicates. RNAi interference effects were as follows: Figure 5 As shown in E. Figure 5 As shown in Figure E, larval mortality increased by 28.3% and 37.5% respectively after injection of dsGSTD6 and dsCYP6A18. These results indicate that both GSTD6 and CYP6A18 played a role in the acquisition of abamectin resistance in the fall armyworm.

[0150] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A dsRNA that reduces emamectin benzoate resistance in fall armyworm, characterized in that, The dsRNA is either dsRNA-1 or dsRNA-2; The nucleotide sequence of the template for the synthesis of dsRNA-1 is shown in SEQ ID NO: 1; the sense strand of dsRNA-1 is obtained by amplification using primers with nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 6; the antisense strand of dsRNA-1 is obtained by amplification using primers with nucleotide sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5; the sense and antisense strands of dsRNA-1 are annealed to obtain dsRNA-1. The nucleotide sequence of the template for the synthesis of dsRNA-2 is shown in SEQ ID NO:

2. The sense strand of dsRNA-2 is obtained by amplification using primers with nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO:

10. The antisense strand of dsRNA-2 is obtained by amplification using primers with nucleotide sequences shown in SEQ ID NO: 8 and SEQ ID NO:

9. The sense and antisense strands of dsRNA-2 are annealed to obtain dsRNA-2.

2. The use of the dsRNA according to claim 1 in the preparation of a product that reduces the emamectin benzoate resistance of fall armyworm.

3. The application of the dsRNA according to claim 1 in the control of fall armyworm.

4. A method for reducing the emamectin benzoate resistance of fall armyworm, characterized in that, The method involves introducing the dsRNA described in claim 1 into the body of the fall armyworm.